| Title of Invention | NOVEL SPIROHETEROCYCLIC COMPOUNDS USEFUL AS REVERSIBLE INHIBITORS OF CYSTEINE PROTEASES |
|---|---|
| Abstract | "NOVEL SPIROHETEROCYCLIC COMPOUNDS USEFUL AS REVERSIBLE INHIBITORS OF CYSTEINE PROTEASES." Disclosed are novel cathepsin S, K, F, L and B reversible inhibitory compounds of formulas (I), (II), (la) and (lb) further defined herein. The compounds are "useful for treating autoimmune diseases. Also, disclosed are processes for making such novel compounds. |
| Full Text | FORM 2 THE PATENTS ACT 1970 [39 OF 1970] & THE PATENTS RULES, 2003 COMPLETE SPECIFICATION [See Section 10; rule 13] "NOVEL SPIROHETEROCYCLIC COMPOUNDS USEFUL AS REVERSIBLE INHIBITORS OF CYSTEINE PROTEASES." BOEHRINGER INGELHEIM PHARMACEUTICALS, INC., 900 Ridgebury Road, Ridgefield, Connecticut 06877, USA, The following specification particularly describes the invention and the manner in which it is to be performed: GRANTED 06-06-2007 This application claims benefit to US Provisional Application serial nos. 60/153,738 filed 9/13/99 and 60/222,900 filed August 3,2000. TECHNICAL FIELD OF THE INVENTION This invention relates to peptidyl spiroheterocyclic, amidino and guanidino compounds. The compounds are reversible inhibitors of the cysteine protease cathepsin S, K, F, L and B and are therefore useful in the treatment of autoimmune and other related diseases. The invention also relates to processes for preparing such compounds and pharmaceutical compositions comprising them. BACKGROUND OF THE INVENTION Cathepsin S and cathepsin K are members of the papain family, within the papain superfamily of cysteine proteases. The papain family is the largest group of cysteine proteases and includes proteases such as cathepsins B, H, K, L, O and S. (A.J. Barrett et, al., 1996, Perspectives in Drug Discovery and Design, 6,1). The cysteine proteases have important roles in human biology and diseases including atherosclerosis, emphysema, osteoporosis, chronic inflammation and immune disorders (H.A. Chapman et al., 1997, Ann. Rev. Physiol., 59, 63). Cathepsin S plays a key role in regulating antigen presentation and immunity (H.A. Chapman, 1998, Current Opinion in Immunology, 10, 93; R. J. Riese et al., 1998, J. Clin. Invest, 101,2351; RJ. Riese et al., 1996, Immunity, 4,357). Cathepsin S deficient mice have impaired invariant chain degradation resulting in decreased antigen presentation and germinal center formation, and diminished susceptibility to collagen-induced arthritis indicating the therapeutic potential for a cathepsin S inhibitor (G. Shi et al., 1999, Immunity, 10, 197; T.Y. Nakagawa et al, 1999, Immunity, 10,207) The specificity of the immune response relies on processing of foreign protein and 5 presentation of antigenic peptide at the cell surface. Antigenic peptide is presented bound to MHC Class II, a heterodimeric glycoprotein expressed in certain antigen presenting cells of hematopoietic lineage, such as B cells, macrophages and dendritic cells. Presentation of antigen to effector cells, such as T-cells, is a fundamental step in recognition of non-self and thus initiation of the immune response. 10 Recently MHC Class II heterodimers were shown to associate intracellularly with a third molecule designated invariant chain. Invariant chain facilitates Class II transport to the endosomal compartment and stabilizes the Class II protein prior to loading with antigen. Invariant chain interacts directly with Class II dimers in the antigen-binding groove and 15 therefore must be proteolyzed and removed or antigen cannot be loaded or presented. Current research suggests that invariant chain is selectively proteolyzed by cathepsin S, which is compartmentalized with MHC Class II complexes within the cell. Cathepsin S degrades invariant chain to a small peptide, termed CLIP, which occupies the antigen -binding groove. CLIP is released from MHC Class II by the interaction of MHC Class II 20 with HLA-DM, a MHC-like molecule thus freeing MHC Class II to associate with antigenic peptides. MHC Class H-antigen complexes are then transported to the cell surface for presentation to T-cells, and initiation of the immune response. Cathepsin S, through proteolytic degradation of invariant chain to CLIP, provides a 25 fundamental step in generation of an immune response. It follows that inhibition of antigen presentation via prevention of invariant chain degradation by cathepsin S could provide a mechanism for immuno-regulation. Control of antigen-specific immune responses has long been desirable as a useful and safe therapy for autoimmune diseases. Such diseases include Crohn's disease and arthritis, as well as other T-cell-mediated 30 immune responses (C. Janeway and P. Travers, 1996, Immunobiology, The Immune System in Health and Disease, Chapter 12). Furthermore, cathepsin S, which has broad pH specificity, has been implicated in a variety of other diseases involving extracellular proteolysis, such as Alzheimer's disease (U. Muller-Ladner et al., 1996, Perspectives in Drag Discovery and Design, 6,87) and atherosclerosis (G.K. Sukhova et al., 1998, J. Clin. Invest., 102,576). 5 A cathepsin S inhibitor has been found to block the rise in IgE titers and eosinophil infiltration in the lung in a mouse model of pulmonary hypersensitivity, suggesting that cathepsin S may be involved in asthma (R.J. Riese et al., J. Clin. Investigation, 1998,101, 2351). 10 Another cysteine protease, cathepsin F has been found in macrophages and is also involved in antigen processing. It has been postulated that cathepsin F in stimulated lung macrophages and possibly other antigen presenting cells could play a role in airway inflammation (G.-P. Shi et al., J. Exp. Med., 2000,191,1177). 15 Cathepsin K, another cysteine protease has been found to be highly expressed in osteoclasts and to degrade bone collagen and other bone matrix proteins. Inhibitors of cathepsin K have been shown to inhibit bone resorption in mice. Therefore, cathepsin K may play a role in osteoclastic bone resorption and cathepsin K inhibitors may be useful 20 in the treatment of diseases involving bone resorption such as osteoporosis (F. Lazner et al., Human Molecular Genetics, 1999,8,1839). Cysteine proteases are characterized by having a cysteine residue at the active site which serves as a nucleophile. The active site also contains a histidine residue. The imidazole 25 ring on the histidine serves as a base to generate a thiolate anion on the active site cysteine, increasing its nucleophilicity. When a substrate is recognized by the protease, the amide bond to be cleaved is directed to the active site, where the thiolate attacks the carbonyl carbon forming an acyl-enzyme intermediate and cleaving the amide bond, liberating an amine. Subsequently, water cleaves the acyl-enzyme species regenerating 30 the enzyme and liberating the other cleavage product of the substrate, a carboxylic acid. inhibitors of cysteine proteases contain a functionality that can react reversibly or irreversibly with the active site cysteine. Examples of reactive functionalities that have been described (D. Rasnick, 1996, Perspectives in Drug Discovery and Design, 6,47) on cysteine protease inhibitors include peptidyl diazomethanes, epoxides, 5 monofiuoroalkanes and acyloxymethanes, which irreversibly alkylate the cysteine thiol. Other irreversible inhibitors include Michael acceptors such as peptidyl vinyl esters and other carboxylic acid derivatives (S. Liu et al., J. Med Chem., 1992, 35,1067) and vinyl sulfones (J.T. Palmer et al., 1995, J. Med Chem., 38,3193). 10 Reactive functionalities that form reversible complexes with the active site cysteine include peptidyl aldehydes (R.P. Hanzlik et al, 1991, Biochim. Biophys. Acta., 1073, 33), which are non-selective, inhibiting both cysteine and serine proteases as well as other nucleophiles. Peptidyl nitriles (R.P. Hanzlik et al., 1990, Biochim. Biophys. Acta., 1035, 62) are less reactive than aldehydes and therefore more selective for the more 15 nucleophilic cysteine proteases. Various reactive ketones have also been reported to be reversible inhibitors of cysteine proteases (D. Rasnick, 1996, ibid). In addition to reacting with the nucleophilic cysteine of the active site, reactive ketones may react with water, forming a hemiketal which may act as a transition state inhibitor. 20 Examples of cathepsin S inhibitors have been reported. J.L. Klaus et al (WO 9640737) described reversible inhibitors of cysteine proteases including cathepsin S, containing an ethylene diamine. In US Patent No 5,776,718 to Palmer et al. there is disclosed in it's broadest generic aspect a protease inhibitor comprising a targeting group linked through a two carbon atom chain to an electron withdrawing group (EWG). The compounds of the 25 present application are structurally distinct and thus excluded from the 5,776,71 patent with particular embodiments possessing unexpectedly greater activity man the closest compounds of the prior art Other examples of cathepsin S inhibitors have been reported by E.T. Altmann et al, (WO 9924460,1999) which describes dipeptide nitriles asserted to have activity as inhibitors ofCatepsins B, K, L and S. The WO publication does not 30 disclose any compounds possessing an imino or guanidino moiety and fails to provide any description, methods or examples for particular spiroheterocylic moieities at the P2 position. Additional peptidyl nitriles have been reported as protease inhibitors. For example, both 5 nitriles and ketoheterocycles are described by B.A. Rowe et al. (US 5,714,471) as protease inhibitors useful in the treatment of neurodegenerative diseases. Peptidyl nitriles are reported by B. Malcolm et al. (WO 9222570) as inhibitors of picornavirus protease. B.J. Gour-Salin (Can. J. Chem., 1991, 69, 1288) and T.C. Liang (Arch. Biochim. Biophys., 1987,252,626) described peptidyl nitriles as inhibitors of papain 10 A reversible inhibitor presents a more attractive therapy than irreversible inhibitors. Even compounds with high specificity for a particular protease can bind non-target enzymes. An irreversible compound could therefore permanently inactivate a non-target enzyme, increasing the likelihood of toxicity. Furthermore, any toxic effects resulting from 15 inactivation of the target enzyme would be mitigated by reversible inhibitors, and could be easily remedied by modified or lower dosing. Finally, covalent modification of an enzyme by an irreversible inhibitor could potentially generate an antibody response by acting as a hapten. 20 In light of the above, there is a clear need for compounds which reversibly and selectively inhibit cysteine proteases cathepsin S ,K, F, L and B for indications in which these proteases exacerbate disease. 25 BRIEF DESCRIPTION OF THE INVENTION It is therefore an object of this invention to provide novel compounds according to the formulas (I), (H), (la) and (lb) as described herein which reversibly inhibit the cysteine 30 proteases cathepsin S ,K, F, L and B. It is a further object of the invention to provide methods for treating diseases and pathological conditions exacerbated by these cysteine proteases such as, but not limited, to rheumatoid arthritis, multiple sclerosis, asthma and osteoporosis. It is yet a further object of the invention to provide novel processes for preparation of the above-mentioned novel compounds. 5 DETAILED DESCRIPTION OF THE INVENTION A proposed mechanism of action of the cysteine protease inhibitors of this invention is that the inhibitors contain a functionality that can react (reversibly or irreversibly) with the active site cysteine. The reactive functionality is attached to a peptide or peptide 10 mimic that can be recognized and accommodated by the region of the protease surrounding the active site. The nature of both the reactive functionality and the remaining portion of the inhibitor determine the degree of selectivity and potency toward a particular protease. 15 Given the similarity of the active sites in cysteine proteases, it may be anticipated that a given class of inhibitors might have activity against more that one cysteine protease. It may also be expected that due to structural differences between individual cysteine proteases, different compounds of the invention may have different inhibitory potencies against different cysteine proteases. Thus some of the compounds of the invention may 20 also be expected to be most effective in treating diseases mediated by cysteine proteases that they inhibit most potently. The activity of particular compounds disclosed herein against cysteine proteases cathepsin S, K, F, L and B may be determined by the screens described in the section entitled "Assessment of Biological Properties." 25 In one broad generic aspect, the invention provides novel compounds of the formula (I): 30 wherein: Het is piperidinyl, pyrrolidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, hexahydropyrimidinyl, hexahydropyridazinyl, piperazinyl, 1,4,5,6-5 tetrahydropyrimidin-2-ylamine, dihydro-oxazolyl, 1,2-thiazinany 1-1,1 -dioxide, 1,2,6-thiadiazinanyl-1,1 -dioxide, isothiazolidinyl-1,1-dioxide or imidazolidinyI-2,4-dione, each being optionally substituted with one or more R5; 10 Y is 0 or S; R1 is CI-5 alkyl, CI-5 alkoxy, aryloxy, C3-7 cycloalkyl, phenyl, benzyl, naphthyl, tetrahydronaphthy 1, C1 -SalkylsulfonylC 1 -5alkyI, C3-7cycloalkylsulfony 1C1 -5alkyl, 15 arylsulfonylCl-5alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl, quinoxalinyl, or amino; wherein Ri is optionally substituted by one or 20 more Ra; Ra is CI-5 alkyl, C3-7 cycloalkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, 25 pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-5 alkoxy, Cl-5alkanoyl, Cl-5alkanoyloxy, aryloxy, benzyloxy, CI-5 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-8 alkyl, aryl, 30 pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benztbiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is CI-5 alkanoylamino, aroylamino, CI-5 alkylthio, arylthio wherein the 5 sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, 10 benztbiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, CI-5 alkoxycarbonylamino, aryloxycarbonylamino, CI-5 alkylcarbamoyloxy, arylcarbamoyloxy, CI-5 alkylsulfonylamino, arylsulfonylamino, CI-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by alkyl, aryl, pyrrolidinyl, piperidinyl, 15 morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Ra may be further optionally 20 substituted by one or more Ra; Rb is Cl-5 alkyl, C3-6 cycloalkyl, aryl, Cl-5 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino; 25 R2 is hydrogen or C1 -3 alkyl; R3 is hydrogen, Cl-5 alkyl, C2-5alkylene, C3-7 cycloalkyl, arylCl-3alkyl or aryl wherein R3 is optionally substituted by one or more Rc 30 Rc is Cl-5 alkyl, C3-7 cycloalkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-5 alkoxy, aiyloxy, Cl-5 alkanoyl, aroyl, Cl-5 alkoxycarbonyi, aryloxycarbonyl, Cl-5 alkanoyloxy, 5 aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, 10 isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Cl-5 alkanoylamino, aroylamino, Cl-5 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, 15 morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, Cl-5 alkoxycarbonylamino, aryloxycarbonylamino, Cl-5 alkylcarbamoyloxy, 20 arylcarbamoyloxy, Cl-5 alkylsulfonylamino, arylsulfonylamino, Cl-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, 25 pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more Rd; Ra is Cl-5 alkyl, C3-6 cycloalkyl, aryl, arylalkyl, CI-5 alkoxy, aryloxy, arylCl-5alkoxy, aroyl, amino, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino; 5 R4 is hydrogen or CI-3 alkyl; R5 is Cl-5 alkyl chain optionally interrupted by one or two O or S, phenyl, naphthyl, 10 arylCl-3alkyl, furanyl, thienyl, pyrrolyl, imidazolyl, pyridinyl, pyrimidinyl, Cl-5 alkanoyl, aroyl, Cl-5 alkoxycarbonyl, aryloxycarbonyl, benzyloxycarbonyl, carbamoyl wherein the nitrogen atom may be independantly mono or disubstituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl, pyrrolyl, thiazolyl, imidazolyl, pyridinyl, benzimidazolyl or quinolinyl, 15 or R5 is Cl-5 alkanoylamino, aroylamino, Cl-5 alkylthio wherein the sulfur atom may be oxidised to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidised to a sulfoxide or sulfone, Cl-5 alkylsulfonylamino, arylsulfonylamino, Cl-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or disubstituted by alkyl, aryl, pyrrolidinyl, piperidinyl, 20 morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyridinylcarbonyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl or arylsulfonyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, R5 may be further optionally substituted by 25 one or more Re; Re is Cl-5 alkyl, C3-6 cycloalkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, 30 indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl, quinoxalinyl, Cl-5 alkoxy, aryloxy, aroyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, furanyl, thienyl, pyrrolyl or pyridinyl, halogen, hydroxy, oxo, carboxy, cyano, nitro, benzyloxy, arylCl-3alkoxycarbonyl, amidino or guanidino; 5 X is O or S and pharmaceutically acceptable derivatives thereof. 10 In another embodiment of the invention, there are provided novel compounds of the formula (I) as described immediately above, and wherein: 15 Het is piperidinyl, pyrrolidinyl, tetrahydropyranyl or tetrahydrothiopyranyl each ring being substituted with one or more R5; Y is O; 20 Ri is Cl-3 alkyl, Cl-3alkoxy, C3-7 cycloalkyl, phenyl, benzyl, naphthyl, tetrahydronaphthyl, piperidinyl, morpholinyl, piperazinyl, fiiranyl, thienyl, pyridinyl, isoxazolyl, pyrazinyl, indolyl, quinolinyl, benzofuranyl, benzimidazolyl, benzoisoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; 25 Ra is Cl-3 alkyl, phenyl, naphthyl, piperidinyl, indolinyl, morpholinyl, piperazinyl, furanyl, thienyl, benzimidazolyl, Cl-3 alkoxy, Cl-3 alkanoyl, phenoxy, naphthyloxy, benzyloxy, Cl-3 alkoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-5 alkyl, phenyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl or pyridinyl, 30 or Ra is CI-5 alkanoylamino, benzoylamino, Cl-3 alkylsulfonyl, phenylsulfonyl, ureido wherein either nitrogen atom may be independently substituted by alkyl, phenyl, piperidinyl, morpholinyl, furanyl, thienyl orpyridinyl, CI-3 alkoxycarbonylamino, Cl-5 alkylcarbamoyloxy, Cl-5 alkylsulfonylamino, phenylsulfonylamino, Cl-5 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-5 5 alkyl, phenyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl or pyridinyl, halogen, hydroxy, oxo, carboxy, nitro or cyano, R* may be further optionally substituted by one or more Rb; Rb is halogen, hydroxy, benzyloxy, oxo or cyano; 10 R2 is hydrogen; R3 is Cl-5 alkyl or C2-5 alkylene, C4-6 cycloalkyl or benzyl wherein R3 is optionally substituted by one or more Rd 15 Rc is CI-4 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, CI-4 alkoxy, phenoxy, benzoyl, benzyloxy, indolinyl, imidazolyl, Cl-3alkylthio, Cl-3alkylsulfonyl, halogen, hydroxy, oxo, carboxy, nitro or cyano, Rc may be further optionally substituted by one or more Rd; 20 Rd is methyl, phenyl, benzyl, benzyloxy, Cl-3alkoxy, halogen, hydroxy, nitro or cyano; R4 is hydrogen; 25 R5 is Cl-4alkyl chain optionally interrupted by one 0 or S atom, phenyl, phenylCl-2alkyl, furanyl, pyrimidinyl, thienyl, Cl-3 alkanoyl, benzoyl, Cl-4 alkoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or disubstituted by Cl-5 alkyl, phenyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl or pyridinyl, 30 Cl-3 alkylthio, phenylthio, Cl-5 alkylaminosulfonyl, phenylaminosulfonyl, Cl- 5alkylamino wherein the nitrogen atom may be independently mono- or disubstituted by naphthylsulfonyl or pyridinylcarbonyl, halogen, hydroxy, carboxy, oxo or cyano, R5 may be further optionally substituted by one or more R«; Re is Cl-3 alkyl, C5-6 cycloalkyl, phenyl, naphthylmethyl, piperidinyl, 5 morpholinyl, piperazinyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, benzimidazolyl, quinolinyl, isoquinolinyl, CI-4 alkoxy, benzoyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-5 alkyl, phenyl, piperidinyl, morpholinyl, furanyl, thienyl or pyridinyl, halogen, hydroxy, oxo or cyano; and 10 X is O. In yet another embodiment of the invention, there are provided novel compounds of the 15 formula (I) as described immediately above, and wherein: R1 is methyl, ethyl, phenyl, piperidinyl, morpholinyl, piperazinyl, pyridinyl, pyrazinyl, furanyl, thienyl, benzyl, benzofuranyl, cyclohexyl, quinolinyl or amino; wherein Ri is optionally substituted by one or more Re; 20 Ra is Cl-3 alkyl, phenyl, piperidinyl, thienyl, Cl-3 alkoxy, phenoxy, Cl-3 alkanoyl, Cl-3 alkoxycarbonyl, benzyloxy, Cl-3 alkanoylamino, thiophenyl, benzimidazolyl, Cl-3 alkyltbio or chloro, Ra may be further optionally substituted by one or more R1,; 25 Rb is bromo, chloro, fluoro, iodo, hydroxy, oxo or cyano; R3 is methyl, ethyl, n-propyl, n-butyl, isobutyl, propene, butene, isobutene, C3-7 30 cycJoalkyJ or benzyl wherein R3 is optionally substituted by one or more Rc; Rc is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, methylthio, ethylthio, cyclohexyl, phenyl, naphthyl, imidazolyl, indolinyl, cyclohexyl, bromo, chloro, fluoro, iodo, hydroxy, oxo, carboxy, nitro, benzoyl, benzyloxy, N-benzylimidazolyl or cyano, Re may be further optionally substituted 5 by one or more Ra; Rd is methyl, methoxy, ethoxy, chloro, fluoro, nitro or hydroxy; Rs is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, phenyl, 10 methoxycarbonyl, ethoxycarbonyl, n-propoxycarbonyl, isopropoxycarbonyl, n- butoxycarbonyl, isobutyloxycarbonyl, tert-butoxycarbonyl and pyrimidinyl, R5 may be further optionally substituted by one or more Re; Re is methyl, ethyl, n-propyl, isopropyl, phenyl, methoxy, ethoxy, n-propoxy, isopropoxy, 15 n-butoxy, isobutoxy, tert-butoxycarbonyl, bromo, chloro, fluoro, iodo, hydroxy, oxo or cyano. In yet still another embodiment of the invention, there are provided novel compounds of 20 the formula (I) as described immediately above, and wherein: Het is piperidinyl or pyrrolidinyl; Ri is N-acetylaminophenyl, chlorophenyl, methoxyphenyl, m-phenoxyphenyl, 25 morpholinyl, pyrazinyl, pyridinyl, furanyl, chlorothienyl, thienyl or thienylmethyl; R3 is n-butyl, isobutyl, 2,2-dimethylpropyl, cyclohexylmethyl, p-methoxybenzyl or 2-naphthylmethyl; and 30 wherein the configuration at the stereocenter defined by R2 and R3 when they are different and the carbon they are attached to is defined as L; and Rs is methyl, propyl, isopropyl, ethoxycarbonyl, benzyloxycarbonyl, benzyl, phenethyl, N,N-dimethylaminoacetyl orpyrirnidinyl. 5 In yet a further embodiment of the invention, there are provided novel compounds of the formula (I) as described immediately above, and wherein: Het is piperidin-4-yl or pyrrolidinyl; 10 Rj is morpholinyl or N-acetylaminophenyl; R3 is 2,2-dimethylpropyl or cyclohexylmethyl; and 15 R5 is methyl, propyl, isopropyl, ethoxycarbonyl, benzyloxycarbonyl, benzyl, phenethyl, N,N-dimethylaminoacetyl or pyrimidinyl. 20 In a second broad generic aspect of the invention, mere are provided novel compounds of the formula (II): 25 wherein: He is azepanyl, piperidinyl, pyrrolidinyl, azetidinyl, oxepanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, oxetanyl, azocanyl, oxocanyl, 1,3-diazocanyl, 1,4-diazocanyl, 1,5-diazocanyl, 1,3-dioxocanyl, 1,4-dioxocanyl, 1,5-dioxocanyl, 1,3-oxazocanyl, 1,4-oxazocanyl, 1,5-oxazocanyl, 1,3-diazepanyl, 1,4-diazepanyl, 1,3-5 dioxepanyl, 1,4-dioxepanyl, 1,3-oxazepanyl, 1,4-oxazepanyl, l,2-thiazocanyl-l,l-dioxide, 1,2,8-thiadiazocanyl-1,1-dioxide, 1,2-thiazepany 1-1,1 -dioxide, 1,2,7-thiadiazepanyl-1,1-dioxide, tetrahydrothiophenyl, hexahydropyrimidinyl, hexahydropyridazinyl, piperazinyl, 1,4,5,6-tetrahydropyrimidinyl, pyrazolidinyl, dihydro-oxazolyl, dihydrothiazolyl, dihydroimidazolyl, isoxazolinyl, oxazolidinyl, 1,2- 10 thiazinanyl-l,l-dioxide, 1,2,6-thiadiazinanyl-l ,1-dioxide, isothiazolidinyl-1,1-dioxide, imidazolidinyl-2,4-dione, imidazolidinyl, morpholinyl, dioxanyl, tetrahydropyridinyl, thiomorpholinyl, thiazolidinyl, dihydropyranyl, dithianyl, decahydro-quinolinyl, decahydro-isoquinolinyl, 1,2,3,4-tetrahydro-quinolinyl, indolinyl, octahydro-quinolizinyl, dihydro-indolizinyl, octahydro-indolizinyl, octahydro-indolyl, decahydroquinazolinyl, 15 decahydroquinoxalinyl, 1,2,3,4-tetrahydroquinazolinyI or 1,2,3,4-tetrahydroquinoxalinyl; A C6-C10 bridged bicyclo wherein one or more carbon atoms are optionally replaced by a heteroatom chosen from N, O and S; 20 each being optionally substituted with one or more R5; Y is C(0), C(S)or S(0)2; 25 R1 is a bond, hydrogen, Cl-10 alkyl, Cl-10 alkoxy, aryloxy, C3-8 cycloalkyl, C3-8 cycloalkyloxy, aryl, benzyl, tetrahydronaphthyl, indenyl, indanyl, Cl-lOalkylsulfonylCl-lOalkyl, C3-8cycloalkylsulfonylCl-10alkyl, arylsulfonylCl-lOalkyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, 30 indolinyl, pyranyl, tetrahydropyranyl, tetrahydrothiopyranyl, thiopyranyl, furanyl, tetrahydrofuranyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pymnidinyl, pyrazinyl, pyridazinyl, tetrazolyl, pyrazolyl, indolyl, benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzisoxazolyl, quinolinyl, tetrahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, quinazolinyl, tetrahydroquinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the 5 heterocyclyl moiety is selected from those herein described in this paragraph, hydroxy or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond, Cl-10 alkyl, C3-8 cycloalkyl, aryl, tetrahydronaphthyl, indenyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, 10 indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-10 alkoxy, Cl-lOalkanoyl, Cl- 1 Oalkanoyloxy, aryloxy, benzyloxy, Cl-10 alkoxycarbonyl, aryloxycarbonyl, 15 aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, 20 isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is Cl-10 alkanoylamino, aroylamino, Cl-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, 25 morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is Cl-10 alkoxycarbonylamino, aryloxycarbonylamino, Cl-10 30 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-10 alkylsulfonylamino, arylsulfonylamino, Cl-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, 5 benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Rg is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, R« may be further optionally substituted by one or more Rb; with the proviso that K\ and Ra simultaneously cannot be a bond; 10 Rb is a CI-6 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more carbon atoms are optionally replaced by O, N, S(0), S(0)2 or S and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, 15 or one or more C1 -4 alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl; 20 or Rb is C3-6 cycloalkyl, aryl, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, mono-Cl-5alkylamino, di-Cl-5alkylamino, carboxamide, amidino or guanidino; 25 R2 is hydrogen or C1 -3 alkyl; R3 is a bond, hydrogen, Cl-10 alkyl, C2-10alkylene, C3-8 cycloalkyl, arylCl-5aIkyl or aryl wherein R3 is optionally substituted by one or more Rcj 30 Re is Cl-10 alkyl, C3-8 cycloalkyl, aryl, indanyl, indenyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, decahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, tetrahydrothiopyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, 5 pyridinyl, pyrimidinyl, pyrazinyl, indolyl, dihydrobenzofuranyl, octohydrobenzofuranyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, tetrahydroquinolinyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-10 alkoxy, aryloxy, Cl-10 alkanoyl, aroyl, Cl-10 alkoxycarbonyl, aryloxycarbonyl, Cl-10 alkanoyloxy, aroyloxy, 10 carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, 15 isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Cl-10 alkanoylamino, aroylamino, Cl-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, 20 morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Cl-10 alkoxycarbonylamino, aryloxycarbonylamino, Cl-10 25 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-10 alkylsulfonylamino, arylsulfonylamino, Cl-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, 30 tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Rc is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more Rj; 5 Rd is Cl-5 alkyl, C3-6 cycloalkyl, aryl, arylCl-5alkyl, Cl-5 alkoxy, aryloxy, arylCl-Salkoxy, aroyl, amino, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino; 10 R2 and R3 together with the carbon they are attached optionally form a nonaromatic 5-7 membered cycloalkyl or heterocyclic ring; R4 is hydrogen, hydroxy or CI-3 alkyl; 15 R5 is a bond, hydrogen, carbonyl, Cl-10 alkyl, Cl-lOalkoxyCl-lOalkyl, Cl- lOalkylaminoCl-lOalkyl, Cl-lOalkylthioCl-lOalkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-10 alkoxy, aryloxy, C3-8 cycloalkyl, aryl, benzyl, tetrahydronaphthyl, indenyl, indanyl, C3-7cycloalkylsulfonylCl-5alkyl, arylsulfonylCl-5alkyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, 20 thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, thiopyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridizinyl, tetrazolyl, triazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, tetrahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, quinazolinyl, 25 tetrahydroquinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl-lOalkanoyl, aroyl, Cl-lOalkanoyloxy, benzyloxy, Cl-lOalkoxycarbonyl, arylCl-Salkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, 30 morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is Cl-10 alkanoylarnino, aroylamino, Cl-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to 5 a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, 10 or R5 is Cl-10 alkoxycarbonylamino, aryloxycarbonylamino, Cl-10 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-10 alkylsulfonylamino, arylsulfonylamino, Cl-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, 15 thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ks is halogen, hydroxy, oxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, R5 may be further optionally substituted by one or more R«; 20 Re is Cl-10 alkyl, Cl-lOalkoxyCl-lOalkyl, Cl-lOalkylaminoCl-lOalkyI, Cl- lOalkylthioCl-lOalkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-10 alkoxy, C3-8 cycloalkyl, aryl, tetrahydronaphthyl, indenyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, 25 indolinyl, thiopyranyl, tetrahydrothiopyranyl, pyranyl, tetrahydropyranyl, tetrahydrofuranyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-lOalkanoyl, aroyl, Cl- 30 lOalkanoyloxy, aryloxy, benzyloxy, Cl-10 alkoxycarbonyl, arylCl- 3alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, 5 benzirnidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R« is Cl-10 alkanoylamino, aroylamino, Cl-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom 10 may be independently substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, 15 or Re is Cl-10 alkoxycarbonylamino, aryloxycarbonylamino, Cl-10 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-10 alkylsulfonylamino, arylsulfonylamino, Cl-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, 20 indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R« is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or 25 guanidino, Re may be further optionally substituted by one or more Rf; Rf is CI-5 alkyl, C3-6 cycloalkyl, tolylsulfonyl, CI-5 alkoxy, aryl, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; 30 X is 0 or S and pharmaceutically acceptable derivatives thereof. 5 In another embodiment of the invention, there are provided novel compounds of the formula (IT) as described immediately above, and wherein: Het is piperidinyl, pyrrolidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, azetidinyl, azepanyl, oxepanyl, tetrahydrofuranyl, oxetanyl, hexahydropyrimidinyl, 10 hexahydropryidazinyl, piperazinyl, 1,4,5,6-tetrahydropyrimidinyl, octahydro-indolizinyl, octahydro-quinolizinyl, decahydro-quinolinyl, 1,2,3,4-tetrahydro-quinolinyl, dihydro-oxazolyl, 1,2-thiazinanyl-1,1-dioxide, 1,2,6-thiadiazinanyl-1,1-dioxide, isothiazolidinyl-1,1-dioxide, imidazolidinyl, pyrazolidinyl or a bridged bicyclo chosen from aza-bicyclo[3.2.1]octane, aza-bicyclo[2.2.1]heptane, aza-bicyclo[2.2.2]octane, aza- 15 bicyclo[3.2.2]nonane, aza-bicyclo[2.1.1 jhexane, aza-bicyclo[3.1.1 ]heptane, aza-bicyclo(3.3.2]decane and 2-oxa or 2-thia-5-aza-bicyclo[2.2.1]heptane; each ring being substituted with one or more R5; Y is C(0)or S(0)2; 20 Ri is a bond, hydrogen, Cl-7 alkyl, Cl-7 alkoxy, C3-7 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, tetrahydronaphthyl, Cl-7alkylsulfonylCl-7alkyl, C3-7cycloalkylsulfonylCl-7alkyl, arylsulfonylCl-7alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, 25 thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, isoxazolyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzomranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoisoxazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; 30 Ra is a bond Cl-7 alkyl, C3-6 cycloalkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, CI-7 alkoxy, Cl-7alkanoyl, Cl-7alkanoyloxy, aryloxy, benzyloxy, CI-7 alkoxycarbonyl, aryloxycarbonyl, 5 aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl,, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, 10 quinazolinyl or quinoxalinyl, or Ra is C1 -7 alkanoylamino, aroylamino, C1 -7 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, 15 morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is Cl-7 alkoxycarbonylamino, aryloxycarbonylamino, Cl-7 20 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-7 alkylsulfonylamino, arylsulfonylamino, Cl-7 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, 25 pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Re may be further optionally substituted by one or more Rt; Rt is CI-5 alkyl, C3-6 cycloalkyl, aryl, CI-5 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; 5 R2 is hydrogen or methyl or ethyl; R3 is a bond, hydrogen, CI-5 alkyl, C2-5alkylene, C3-7 cycloalkyl, arylCl-3alkyl or aryl wherein R3 is optionally substituted by one or more Rcj 10 Re is Cl-5 alkyl, C3-7 cycloalkyl, aryl, indanyl, indenyl, bicydo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, l2,3,4-tetrahydronaphthyUpyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, thienyl, pyrrolyl, oxazolyl, 15 thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-5 alkoxy, aryloxy, Cl-5 alkanoyl, aroyl, Cl-5 alkoxycarbonyl, aryloxycarbonyl, Cl-5 alkanoyloxy, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or 20 di-substituted by C1 -5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, 25 or Re is Cl-5 alkanoylamino, aroylamino, Cl-5 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, 30 oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is CI-5 alkoxycarbonylamino, aryloxycarbonylamino, CI-5 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-5 alkylsulfonylamino, 5 arylsulfonylamino, Cl-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, 10 benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, R« may be further optionally substituted by one or more Raj 15 Rj is C1 -5 alkyl, C3-6 cycloalkyl, aryl, arylC 1 -4 alkyl, Cl-5 alkoxy, aryloxy, arylCl-Salkoxy, aroyl, halogen, hydroxy, oxo or cyano; R4 is hydrogen or methyl; 20 R5 is a bond, hydrogen, carbonyl, Cl-8 alkyl, Cl-8alkoxyCl-8alkyl, Cl-8alkylaminoCl-8alkyl, Cl-8alkylthioCl-8alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-8 alkoxy,, aryloxy, C3-7 cycloalkyl, aryl, benzyl, tetrahydronaphthyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, 25 thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, thiopyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, tetrazolyl, triazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is 30 selected from those herein described in this paragraph, CI -7sdkanoy], aroyl, CI -7alkanoyloxy, benzyloxy, Cl-7 alkoxycarbonyl, arylCl-4alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, 5 benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is CI-7 alkanoylamino, aroylamino, Cl-7 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, 10 piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is Cl-7 alkoxycarbonylamino, aryloxycarbonylamino, Cl-7 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-7 alkylsulfonylamino, arylsulfonylamino, Cl-7 15 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, 20 or R5 is halogen, hydroxy, oxy, oxo, carboxy, cyano, nitro or carboxamide, R5 may be further optionally substituted by one or more R,.; Re is Cl-7 alkyl, Cl-7alkoxyCl-7alkyl, Cl-7alkyIaminoCl-7alkyl, Cl-7alkylthioCl-7alkyl wherein the sulfur atom may be oxidized to a sulfoxide or 25 sulfone, C1 -7 alkoxy, C3-7 cycloalkyl, aryl, tetrahydronaphthyl, indany 1, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thiopyranyl, tetrahydrothiopyranyl, tetrahydropyranyl, tetrahydrofuranyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, 30 quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-5 alkanoyl, aroyl, Cl- 5alkanoyloxy, aryloxy, benzyloxy, Cl-5 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-5 alkyl, aiyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, 5 benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Cl-5 alkanoylamino, aroylamino, Cl-5 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be 10 independently substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, 15 or R« is Cl-5 alkoxycarbonylamino, aryloxycarbonylamino, Cl-5 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-5 alkylsulfonylamino, arylsulfonylamino, Cl-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, 20 thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, R« may be further optionally substituted by one or more Rf, 25 Rf is methyl, ethyl, t-butyl, tolylsulfonyl, Cl-3 alkoxy, cyclopropyl, cyclohexyl, phenyl, naphthyl, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; and 30 X is O. In yet another embodiment of the invention, there are provided novel compounds of the formula (II) as described immediately above, and wherein: 5 wherein: Het is pipendinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, oxetanyl, octahydro-indolizinyl, octahydro-quinolizinyl or aza-bicyclo[3.2.1]octanyl, each ring being optionally substituted with one 10 or more R$; Ri is a bond, CI-5 alkyl, Cl-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, Cl-3alkylsulfonylCl-3alkyl, C3-6cycloalkylsulfonylCl-3alkyl, arylsulfonylCl-3alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, 15 piperazinyl, faranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, isoxazolyl, pyrimidinyl, pyrazdnyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein R1 is optionally substituted by one or more Ra; 20 Ra is a bond, CI-3 alkyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, Cl-3 alkoxy, Cl-3alkanoyl, Cl-3alkanoyloxy, aryloxy, benzyloxy, Cl-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl 25 wherein the nitrogen atom may be independently mono or di-substituted by C1 -3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Ra is Cl-3 alkanoylamino, aroylamino, Cl-3 alkylthio wherein the sulfur atom 30 may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-3 alkyl, aryl, pyrrolidinyl, piperidinyl, moipholinyl, thiomorpholinyl or piperazinyl, or Ra is C1 -3 alkoxycarbony lamino, aryloxycarbonylamino, C1 -3 alkylcarbamoyloxy, arylcarbamoyloxy, CI-3 alkylsulfonylamino, 5 arylsulfonylamino, CI-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1 -3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rt,; 10 Rb is Cl-3 alkyl, C3-6 cycloalkyl, aryl, Cl-3 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; 15 R2 is hydrogen or methyl; R3 is a bond, hydrogen, Cl-5 alkyl, C2-5alkylene, C4-6 cycloalkyl or arylCl-2alkyl wherein R3 is optionally substituted by one or more Re", 20 Re is CI-4 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, bicyclo[2.2.1 ]heptanyl, bicyclo[2.2.2Joctanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclof 1.1.1 ]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, thienyl, pyrrolyl, 25 oxazolyl, thiazolyl, imidazolyl, pyrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, CI-4 alkoxy, phenoxy, naphthyloxy, Cl-3 alkanoyl, benzoyl, Cl-3 alkoxycarbonyl, phenoxycarbonyl, Cl-3 alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be 30 independently mono or di-substituted by Cl-5 alkyl or aryl, or Re is CI-3 atkanoylamino, benzoylamino, CI-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-5 alkyl or aryl, 5 or Re is C1 -3 alkoxycarbonylamino, aryloxycarbonylamino, C1 -3 alkylcarbamoyloxy, arylcarbamoyloxy, CI-3 alkylsulfonylamino, arylsulfonylamino, CI-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-5 alkyl or aryl, 10 or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more R Rd is Cl-3 alkyl, C3-6 cycloalkyl, phenyl, benzyl, CI-3 alkoxy, phenoxy, phenylCl-3alkoxy, benzoyl, halogen, hydroxy, oxo or cyano; 15 R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, CI-6 alkyl, Cl-6alkoxyCl-6alkyl, Cl-6alkylaminoCl-6alkyl, Cl-6alkylthioCl-6alkyl wherein the sulfur atom may be oxidized to a sulfoxide or 20 sulfone, CI-6 alkoxy,, phenoxy, naphthyloxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazolyl, benzomranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, 25 isoquinolinyl and benzoxazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl-3alkanoyl, benzoyl, naphthoyl, Cl-4alkanoyloxy, benzyloxy, Cl-4 alkoxycarbonyl, arylCl-2alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, 30 morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, orlli is CI-4 alkanoylamino, aroylamino, CI-4 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, 5 piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, or R5 is CI-4 alkoxycarbonylamino, phenoxycarbonylamino, CI-4 alkylcarbamoyloxy, phenylcarbamoyloxy, CI-4 alkylsulfonylamino, phenylsulfonylamino, CI-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be 10 independently mono or di-substituted by C1 -4 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, R5 may be further optionally substituted by one or more Rd; 15 Re is CI-4 alkyl, CI-4 alkoxy, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydrothiopyranyl, tetrahydropyranyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzimidazolyl, 20 benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, CI-4 alkanoyl, aroyl, Cl-4alkanoyloxy, phenoxy, naphthyloxy, benzyloxy, CI-4 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, 25 furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, or benzthiazolyl, or Re is Cl-4 alkanoylamino, benzoylamino, Cl-4 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen 30 atom may be independently substituted by C1 -3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is CI-4 alkoxycarbonylamino, phenoxycarbonylamino, CI-4 alkylcarbamoyloxy, phenylcarbamoyloxy, CI-4 alkylsulfonylamino, 5 phenylsulfonylamino, CI-4 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, 10 or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Re may be further optionally substituted by one or more Rfj Rr is methyl, ethyl, t-butyl, tolylsulfonyl, methoxy, cyclopropyl, phenyl, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or 15 carboxamide. In yet still another embodiment of the invention, there are provided novel compounds of the formula (II) as described immediately above, and wherein: 20 Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more R5; 25 Ri is a bond, Cl-5 alkyl, Cl-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more R«; 30 Ra is a bond, CI-3 alkyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, CI-3 alkoxy, Cl-3alkanoyl, Cl-3alkanoyloxy, aiyloxy, benzyloxy, Cl-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom 5 may be independently mono or di-substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is Cl-3 alkanoylamino, aroylamino, Cl-3 alkylthio wherein the suliur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be 10 independently substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Rg is Cl-3 alkoxycarbonylarnino, aryloxycarbonylamino, Cl-3 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-3 alkylsulfonylamino, arylsulfonylamino, Cl-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein 15 the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Rg is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Ri,; 20 Rb is methyl, ethyl, n-propyl, i-propyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, methoxy, ethoxy, n-propoxy, i-propoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; 25 R2 is hydrogen; R3 is a bond, Cl-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rcj 30 Re is Cl-3 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronaphthyl, fiiranyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrimidinyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, CI-3 alkoxy, phenoxy, naphthyloxy, CI-2 alkanoyl, benzoyl, CI-2 alkoxycarbonyl, 5 phenoxycarbonyl, C1 -2alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-3 alkyl or aryl, or Re is CI-2 alkanoylamino, benzoylamino, CI-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen 10 atom may be independently substituted by C1 -3 alkyl or aryl, or Re is CI-2 alkoxycarbonylamino, phenoxycarbonylamino, CI-2 alkylcarbamoyloxy, arylcarbamoyloxy, CI-2 alkylsulfonylarnino, phenylsulfonylamino, Cl-2aIkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-3 15 alkyl or phenyl, or Re is halogen, hydroxy, oxo, carboxy or cyano, R« may be further optionally substituted by one or more Rj; Rd is methyl, cyclopropyl, cyclohexyl, phenyl, benzyl, methoxy, phenoxy, 20 benzyloxy, benzoyl, fluoro, chloro, oxo or cyano; Rs is a bond, hydrogen, carbonyl, Cl-5 alkyl, Cl-5alkoxyCl-5alkyl, Cl-5alkylaminoCl-5alkyl, Cl-5alkylthioCl-5alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-5 alkoxy, phenoxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, 25 heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl-3alkanoyl, benzoyl, naphthoyl, Cl-3alkanoyloxy, benzyloxy, Cl-3 alkoxycarbonyl, benzyloxycarbonyl, 30 phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be lroependently mono or di-substituted by CI-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is CI-3 alkanoylamino, aroylamino, CI-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to 5 a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, or R5 is CI-3 alkoxycarbonylamino, phenoxycarbonylamino, CI-3 alkylcarbamoyloxy, 10 phenylcarbamoyloxy, Cl-3 alkylsulfonylamino, phenylsulfonylamino, Cl-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, 15 or R5 is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, R5 may be further optionally substituted by one or more Re; Re is Cl-3 alkyl, Cl-3 alkoxy, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, 20 thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, Cl-3 alkanoyl, aroyl, Cl-3alkanoyloxy, phenoxy, benzyloxy, Cl-3 alkoxycarbonyl, phenoxycarbdnyl, benzoyloxy, carbamoyl wherein (he nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, 25 thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R« is Cl-3 alkanoylamino, benzoylamino, Cl-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, 30 piperidinyl morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Rd is CI-3 alkoxycarbonylamino, phenoxycarbonylamino, CI-3 alkylcarbamoyloxy, phenylcarbamoyloxy, CI-3 alkylsulfonylamino, phenylsulfonylamino, CI-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-3 5 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R« is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, Re may be further optionally substituted by one or more Rfj 10 and Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide. 15 In yet still another embodiment of the invention, there are provided novel compounds of the formula (II) as described immediately above, and wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl or tetrahydropyranyl each ring being 20 substituted with one or more R5; YisC(O); Ri is a bond, methyl, ethyl, i-propyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, 25 cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more Rj Ra is a bond, methyl, ethyl, cyclopropyl, phenyl, pyrrolidinyl, piperidinyl, 30 morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Ra is acetylamino, benzoylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen 5 atom may be independently substituted by methyl, ethyl or phenyl, or R* is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, 10 or Ra is fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Ra may be further optionally substituted by one or more Rj,; Rb is methyl, cyclopropyl, phenyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide; 15 R3 is a bond, CI-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, ben2yl or naphthylmethyl wherein R3 is optionally substituted by one or more R«; Re is methyl, ethyl, n-propyl, i-propyl, C5-6 cycloalkyl, indanyl, 20 bicyclo[2.2,l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronaphthyl, thienyl, oxazolyl, thiazolyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the 25 nitrogen atom may be independently mono or di-substituted by methyl, ethyl or aryl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be 30 independently substituted by methyl, ethyl or aryl, or Re is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, 5 or Re is fluoro, chloro or oxo, Re may be further optionally substituted by one or more R4; Rd is methyl, cyclopropyl, phenyl, methoxy, fluoro, chloro or oxo; 10 R.5 is a bond, hydrogen, carbonyl, Cl-4 alkyl, Cl-4alkoxyCl-4alkyl, Cl-4alkylaminoCl-4alkyl, Cl-4alkylthioCl-4alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-4 alkoxy.phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, benzyl, indanyl, heterocyctyl selected from pyrrolidinyl, piperidinyl, morpholmyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, 15 benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl-2alkanoyl, benzoyl, naphthoyl, Cl-2alkanoyloxy, benzyloxy, CI-2 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, 20 morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is Cl-2 alkanoylamino, benzoylamino, Cl-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, 25 oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is Cl-2 alkoxycarbonylamino, phenoxycarbonylamino, Cl-2 alkylcarbamoyloxy, phenylcarbamoyloxy, Cl-2 alkylsulfonylamino, phenylsulfonylamino, Cl-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, 30 morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; Re is Cl-3 alkyl, Cl-2 alkoxy, C3-6 cycloalkyl, phenyl, naphthyl, indanyl, 5 pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, Cl-2 alkanoyl, aroyl, Cl-2alkanoyloxy, phenoxy, benzyloxy, Cl-2 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-2 10 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is Cl-2 alkanoylamino, benzoylamino, Cl-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen 15 atom may be independently substituted by Cl-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R« is Cl-2 alkoxycarbonylamino, phenoxycarbonylamino, Cl-2 alkylcarbamoyloxy, phenylcarbamoyloxy, Cl-2 alkylsulfonylamino, 20 phenylsulfonylamino, Cl-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-2 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R« is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, R- may be 25 further optionally substituted by one or more Rf, and Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide. 30 In yet a further embodiment of the invention, there are provided novel compounds of the formula (H) as described immediately above, and wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl, azepan-3-yl, azepan-4-yl or tetrahydropyran-4-yl, each ring being optionally substituted with one or more R5; 5 Ri is a bond, methyl, ethyl, i-propyl, methoxy, cyclopropyl, cyclohexyl, phenoxy, phenyl, , benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein R\ is optionally substituted by one or more Ra; 10 Ra is methyl, phenyl, thienyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is acetylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be 15 independently substituted by methyl or phenyl, or Ra is methoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, hydroxy, oxo, carboxy, cyano or carboxamide; 20 R3 is a bond, methyl, ethyl, n-propyl, propenyl, butenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rcj Re is methyl, ethyl, n-propyl, i-propyl, cyclohexyl, cyclopentyl, indanyl, 25 bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl,bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronaphthyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be 30 oxidized to a sulfoxide or sulfone, fluoro, chloro or oxo; R5 is a bond, hydrogen, carbonyl, C1 -4 alkyl, C1 -2alkoxyC 1 -2alkyl, C1 -2alkylaminoC 1 -2alkyl, Cl-2alkylthioCl-2alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-2 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, 5 pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, acetyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, benzyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, 10 or R5 is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, 15 methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; 20 Re is methyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di- 25 substituted by methyl, ethyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, 30 or Rd is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R« may be further 5 optionally substituted by one or more Rf; and Rf is methyl, phenyl, tolylsulfonyl, phenoxy, benzyloxy, fluoro, chloro or oxo. 10 In yet still a further embodiment of the invention, there are provided novel compounds of the formula (II) as described immediately above, and wherein: 15 Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl or tetrahydropyran-4-yl, each ring being substituted with one or more R5; Ri is i-propyl, benzyloxy, cyclohexyl, phenyl, 4-(acetylamino)-phenyl, 4-(methanesulfonylamino)-phenyl, 4rmethoxyphenyl, 3-phenoxyphenyl, 4-chlorophenyl, 4-20 fluorophenyl, 2-fluorophenyl, 2-fluoro-4-chlorophenyl, naphthyl, tbienylmethyl, piperidinyl, morphoHnyl, pyrrolidinyl, piperazinyl, furanyl, thienyl, 5-chlorothienyl, pyridin-4-yl, pyrazinyl, methylamino, ethylamino, dimethylamino or diethylamino; R3 is ethyl, n-propyl,propenyl, butenyl, i-butenyl, benzyl or naphthylmethyl wherein R3 is 25 optionally substituted by one or more Re; Re is methyl, cyclohexyl, cyclopentyl, indanyl, 1,2,3,4-tetrahydronaphthyl, methoxy, methyltbio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro or chloro; 30 Rs is a bond, carbonyl, methyl, ethyl, n-propyl, n-butyl, t-butyl, i-propyl, i-butyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, piperidinyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy, R5 may be 5 further optionally substituted by one or more R^; R- is methyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, thienyl, 5-methylthienyl, methoxy, phenoxy, benzyloxy, piperidinyl, pyridinyl, indolyl, l-(tolyl-sulfonyl)-indolyl, carbamoyl wherein the nitrogen atom may be 10 independently mono or di-substituted by methyl, phenyl or benzyl, or R« is hydroxy, fluoro, chloro, oxo, dimethylamino or trifluoromethyl; 15 In yet another embodiment of the invention, there are provided novel compounds of the formula (H) as described immediately above, and wherein: Het is piperidin-4-yI, piperidin-3-yl, pyrrolidin-3-yl or azetidin-3-yl, each ring being substituted with one or more Rs; 20 Ri is phenyl, 4-(acetylamino)-phenyl, 4-(methanesulfonylamino)-phenyl, 3-phenoxyphenyl, 4-chlorophenyl, 4-fluorophenyl, thienylmethyl, morpholinyl, pyrrolidinyl, piperidinyl, piperazinyl, 5-chIorothienyI, pyridin-4-yl or pyrazinyl; 25 R3 is n-butyl, i-butyl, 2,2-dimethylpropyl, cyclohexylmethyl, propenyl, i-butenyl, 4- methoxybenzyl, 4-chlorobenzyl, 3,4-dichlorobenzyl, 3-chlorobenzyl, 2,4-dichlorobenzyl, 4-methylbenzyl, 3-methylbenzyl or naphth-2-ylmethyl; wherein the configuration at the stereocenter defined by R2 and R3 when they are different and the carbon they are attached to is defined as L; 30 and R.5 is a bond, methyl, ethyl, n-propyl, n-butyl, n-pentyl, 2-pentyl, 3-pentyl, phenethyl, phenpropyl, 2,2-dimethylpropyl, t-butyl, i-propyl, i-butyl, cyclopropyl, cyclopentyl, cyclohexyl, cyclopropylmethyl, cyclopentylmethyl, cyclohexylmethyl, phenyl, benzyl, naphthylmethyl, indanylmethyl, pyridinylmethyl, indolylmethyl, thienylmethyl, 5-5 methylthienylmethyl, piperidinyl, piperidinylcarbonyl, pyridinylcarbonyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, t-butoxycarbonyl, methylcarbamoyl, phenylcarbamoyl, benzylcarbamoyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, methylcyclohexyl, methylbenzyl, methoxybenzyl, phenoxybenzyl, benzyloxybenzyl, N-10 [(4-methylphenyl)-sulfonyl]-indolylmethyl, fluorobenzyl, difluorobenzyl, chlorobenzyl, N,N-dimethylaminoacetyl, trifluoromethylbenzyl, fluoro, oxo or carboxy. Another embodiment of the invention provides for the following compounds of the 15 formulas (I) and (II) above which have demonstrated potent inhibition of CathepsinS in a cell based assay at concentrations of 15 uM or less. Morpholine-4-carboxylic acid [l-(4-cyano-tetrahydro-pyran-4-ylcarbamoyl)-2-20 cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 25 4-Acetylamino-iV-[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; 4-Acetylamino-iV-[l -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-benzamide; 30 Morpholine-4-carboxylicacid[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 4-Cyano-4- {3-cyclohexyl-2-[(morpholine-4-carbonyl)-amino]-propionylamino} -35 piperidine-1-carboxylic acid /-butyl ester; 4-Cyano-4- {3-cycIohexyl-2-[(morpholme^carbonyl)-amino]-propionylamino}-piperidine-1-carboxylic acid ethyl ester, M5rpholine-4-carboxylic acid [ 1 -(1 -benzyl-4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1 -(4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-5 amide hydrochloride; Morpholine-4-carboxylic acid {1 -[4-cyano-l-(1 -methyl-ethyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 10 Morpholine-4-carboxylic acid [1 -(4-cyano-l -phenethyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylj-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-benzyl-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 15 Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -propy l-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 4-Cyanc^-{3-cyclohexyl-2-[(morpholine-4-carbonyl)-amino]-propionyIamino}-20 piperidiiie-1-carboxylic acid benzyl ester; Morpholine-4-carboxyIic acid [1 -(4-cyano-1 -isopropyI-piperidin-4-yIcarbamoyI)-3,3-dimethyl-butyl]-amide; 25 Morpholine-4-carboxylic acid [l-(l-phenethyl-4-cyanc^piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylicacid[l-(l-n-propyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 30 Morpholine-4-carboxylic acid [l-(l-benzyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butylj-amide; Morpholine-4-carboxylic acid [l-(4-cyano-tetrahydro-thiopyran-4-ylcarbamoyl)-2-35 cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {1-[4-cyano-l-(2-dimethylamino-aceryl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-aniide; 40 4-Cyano-4-{3-cyclohexyl-2-[({4-acetylainino}-phenyl-l-carbonyl)-aniinoJ-propionylamino}-piperidine-l-carboxylic acid ethyl ester; Morpholine-4-carboxylic acid [1 -(3-cyano-1 -pyrimidin-2-yl-piperidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 45 4-Cyano-4-{4,4-dimethyl-2-[(morpholine-4-carbonyl)-amino]-propionylamino}-piperidine-1-carboxylic acid benzyl ester, 4-Acetylamino-A'-[l-(l-benzyl-4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyI]-5 benzamide; 4-Acetylamino-N-[ 1 -(4-cy ano-1 -isopropyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; 10 Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-piperidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 4-Cyano-4- {3-cyclohexyl-2-[( {4-acetylamino} -phenyl-1 -carbonyl)-amino]-propionylamino}-piperidine-l-carboxylic acid benzyl ester, 15 N-[l -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; Morpholine-4-carboxylic acid [l-(l-carbamimidoyl^4^yano-piperi&n-4-ylcarbainoyl)-2-cyclohexyl-ethyl]-amidep-toluenesulfonate; 20 4-Acetylamino-iV-[l-(4-cyano-l-phenethyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; 4-(Acetylamino-methyl)-iV'-[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-25 cyclohexyl-ethyl]-benzamide; 4-Cyano-4-{4,4-dimethyl-2-[(morpholine-4-carbonyl)-amino]-pentanoylamino}-piperidine-1-carboxylic acid ethyl ester, 30 Morpholine-4-carboxylic acid [ 1 -(1 -acetyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [ 1 -(1 -benzoyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 35 3-Cyano-3-{3-cycIohexyI-2-[(morphoIine-4-carbonyI)-aminoj-propionylamino}-pyrrolidine-1-carboxylic acid benzyl ester, ff.[ i -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-isonicotinamide; 40 Pyrazine-2-carboxylic acid [1-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Moipholine-4-carboxylic acid [l-(l-acetyl-4-cyano-piperidin-4-ylcarbamoyl)-2-45 cyclohexyl-ethyl]-amide; Merp,holine-4-carboxylicacid[l-(l-benzoyl-4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {i-[3-cyano-l-(2-chloro-ben2yl)-pyrrolidin-3-5 ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 5-Chloro-thiophene-2-carboxylic acid [ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylj-amide; 10 ^Chloro-iV-fl^cyano-l-methyl-piperidin-^ylcarbamoyO^-cyclohexyl-ethyl]-benzamide; Morpholine-4-carboxylicacid[l-(4-cyano-l-phenylcarbamoyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 15 Morpholine-4-carboxylic acid [l-(l-benzylcarbamoyl 4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-4-20 methanesulfonylamino-benzamide; N~[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-3-phenoxy-benzamide; 25 //-[l-(l-Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl-ethyl]-isonicotinamide; Pyrazine-2-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 30 iV-(l-Benzyl-3-cyano-pyrTolidin-3-yl)-3-cyclohexyl-2-(2-thiophen-2-yl-acetylamino)-propionamide; 5-CUorc-thiophene-2-carboxylicacid[l-(l-benzyl-3-cyanc^pyrrolidin-3-ylcarbamoyl)-2-35 cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(cyclohexyl-methyl)-pyrrolidin-3-ylcaibamoyl]-2-cyclohexyl-ethyl}-amide; 40 N-[ 1 -(1 -Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-3-phenoxy-benzamide; Morpholine-4-carboxylic acid [l-(3-cyano-l-benzyi-pyrrolidin-3-ylcaibamoyl)-3,3-dimethyl-butyl]-amide; 45 N-[ 1 -(1 -BenzyI-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-4-chloro-benzamide; iV-[l-(l-Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-benzamide; 5 Pyrazine-2-carboxylicacid[l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Moipholine-4-carboxylic acid {1 -[3-cyano-1 -(1 -methyl-ethyl)-pyrrolidin-3-} 0 yIcarbampylJ-2-cyclohexyl-ethyl} -amide; N-[ 1 -(1 -benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-4-methanesulfonylamino-benzamide; 15 Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(3-benzyloxy-benzyl)-pyrrolidm-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; N-[ 1 -(1 -Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; 20 N-[ 1 -(1 -Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-4-methanesulfonylamino-benzamide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(2-benzyloxy-benzyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 25 A'-[l-(4-cyano-l-methyl-piperidm-4-ylcarbamoyl)-33-dimethyl-butyl]-benzamide; Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(3,5-difluoro-benzyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 30 MoiphoIine-4-carboxylic acid {1 -[3-cyano- l-(2,6-difluoro-benzyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl} -amide; Morpholine-4-carboxylic acid {1-[3-cyano-l-(3-trifluoromethyl-benzyl)-pyrrolidin-3-35 ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; A^-[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-2-fluoro-benzamide; 40 4-CUoro-^-[l-(4-(^ano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-2-fluoro-benzamide; M[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl>2-cyclohexyl-ethyl]-4-methoxy-benzamide; 45 N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-4-fluoro-benzamide; N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-4-5 methanesulfonylamino-benzamide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(3-phenoxy-benzyl)-pyrrolidin-3-ylcarbamoyI]-2-cyclohexyl-ethyI}-amide; 10 Morpholine-4-carboxylic acid [l-(3~cyano-l-cyclohexyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(l-methyl-piperidine-4-yl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 15 Morpholine-4-carboxylicacid[l-(3-cyano-l-ethyl-pyrrolidin-3-ylcarbamoyl>2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -methyl-pyrrolidin-3-ylcarbamoy])-2-20 cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(3-methyl-benzyl)-pyirolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 25 MorphoIine-4-carboxylic acid {1 -[3>cyano-1 -(2-phenoxy-benzyI)-pyrroIidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(2-methyl-pent-2-enyl)-pyrrolidin-3-ylcarbamoyI]-2-cyclohexyl-ethyl}-amide; 30 Morpholine-4-carboxylic acid {l-[3*cyano-l-(4-fluoro-ben2yl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MorphoIine-4-carboxylic acid {l-[3-cyano-l-(2,4,6-trimethyl-benzyl)-pyrrolidin-3-35 ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid {l-[3«cyano-l-(l#-indol-3-ylmethyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 40 Morpholine-4-carboxylic acid [ l-(3-cyano-1 -cyclopropyl-pynx>lidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(l-pyridin-3-yknethyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 45 Pyrrolidine-l-carboxylicacid[l-(l-ben2yl-3-cyano-pyiTolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1 -(1 -benzyl-3-cyano-1 -oxy-pyrrolidin-3 -ylcarbamoy l)-2-5 cyclohexyl-ethyl]-amide; Isoxazole-5-carboxylicacid[l-(l-benzyl-3-cyano-pyiTolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 10 Morpholine-4-carboxylic acid [1-(3-cyano-l-cyclohexylmethyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -isobutyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 15 l#-Imidazole-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butylj-amide; Moipholine-4-carboxylic acid {l-[3-cyano-l-(5,5-dimethyl-3-oxo-cyclohex-l-enyl)-20 pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -isopropyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimechyl-butylj-amide; 25 Morpholine-4-carboxylic acid [ l-(3-cyano-1 -isobutyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid {1-[3-cyano 1-(1-ethyl-propyl)-pyrrolidin-3-ylcarbamoyI]-2-cyclohexyl-euiyl}-amide; 30 Morpholine-4-carboxylic acid {l-[3-cyano-l-(l-ethyl-propyl)-pyrrolidin-3-ylcarbamoyl]-3,3-dimethyl-butyl}-amide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -phenethyl-pyirolidin-3-ylcarbamoyl)-2-35 cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [1-(3-cyano-l-cyclopropylmethyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 40 Moipholine-4-carboxylic acid [ 1 -(3-cyano-1 -raethyl-piperidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morphoiine-4-carboxylic acid [l-(l-benzyl-3-cyano-azetidin-3-ylcarbamoyl)-2-cyclohexyl-ethylj-amide; 45 4-Cyano-4-{3-cyclohexyl-2-[(4-methyl-piperazine-l-carbonyl)-amino]-propionylamino}-piperidine-l-carboxylic acid ethyl ester; Morpholine-4-carboxyIicacid[l-(3-cyano-l-propyl-pyrroIidin-3-yIcarbamoyl)-3,3-5 dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -propyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 10 Morpholine-4-carboxylic acid {1 -[3-cyano-l-(/ra/w-4-methyl-cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(cis-4-methyl-cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 15 iV-[4-Cyano-tetrahydro-pyran-4-ylcarbanioyl)-2-cyclohexyl-ethyl]-isonicotinamide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -cyclopentyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 20 Morpholine-4-carboxylicacid[l-(3-cyano-l-isobutyl-piperidin-3-yIcarbamoyl)-2-cyclohexyl-ethylj-amide; Morpholine-4-carboxylic acid [1 -(3-cyano-1 -cyclopenty]-pyrrolidin-3-ylcarbamoyl)-2-25 cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(cw-4-methyl-cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-3,3-dimethyl-butyl}-amide; 30 Morpholine-4-carboxylic acid [l-(3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethylj-amide; Morpholine-4-carboxylic acid {1 -[3~cyano-l -(/r/z/w-4-methyl-cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-3,3-dimethyl-butyl}-amide; 35 Morpholine-4-carboxylicacid(l-{3-cyano-l-[l-(toluene-4-sulfonyl)-l//-indol-3-ylmethyl]-pyrroUdin-3-ylcarbamoyl} -2-cyclohexyl-ethyl)-amide; Motpholine-4-carboxylicacid[l-(3-cyano-l-cyclohexyl-pyrrolidin-3-ylcarbamoyl)-2-(4-40 iodo-phenyl)-ethyl]-amide; Morpholine-4-carboxylicacid[l-(3-cyano-l-cyclohexyl-pyiTolidin-3-ylcarbamoyl)-2-p-tolyl-ethyl]-amide; 45 Morpholine-4-carboxylic acid [(3-cyano-1 -cyclohexyl-pyrrolidin-3-ylcarbamoyl)-cyclohexyl-methyl]-amide; Morpholine-4-carboxylic acid [ 1 -(1 -benzyl-3-cyano-pyirolidin-3-ylcarbamoyl)-2-naphthalen-2-yI-ethyI]-amide; 5 Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-y]carbamoyl)-2-(4-chloro-phenyl)-ethyl]-amide; Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(2-methyI-2-phenyl-propyI)-pyrroIidin-3-y]carbamoyl]-2-cyclohexyl-ethyl}-amide; 10 Morpholine-4-carboxylic acid {l-[3-cyano-Hmdan-2-ylmemyl)-pyrrolidin-3-yIcarbamoyl]-2-cyclohexyI-ethyl}-amide; Morpholine-4-carboxylic acid {l-[3-cyano-1 -(5-methyI-thiophen-2-ylmethyl)-pyrrolidin-15 3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; l-Benzyl-3-cyano-3-{3-cyclohexyl-2-[(morpholine-4-carbonyl)-amino]-propionylamino}-pyrrolidine-2-carboxylic acid methyl ester; 20 N-[ 1 -(1 -Benzyl-3^yano-pyrroIidm-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-isobu1yramide; [l-(l-Benzyl-3K;yano-pyiTolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-carbarnicacid benzyl ester; 25 Morpholine-4-carboxylic acid [ 1 -(1 -ben2yl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3-rnethyl-but-3-enyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-1 -(3-methoxy-benzyI)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 30 Morpholine-4-carboxylic acid {1 -[3-cyano- l-(naphthalen-2-ylmethyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Cyclohexanecarboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-35 cyclohexyl-ethyl]-amide; Morpholine-4-carboxyIic acid [1-(3-cyano-l-cyclopentylmethyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 40 Morpholine-4-carboxylic acid {l-[4-cyano-l-(l-methyl-piperidine-4-carbonyl)-piperidin-4-y IcarbamoyI]-2-cyclohexy I-ethy 1} -amide; Morpholine-4-carboxylic acid {l-[4-cyano-l-(pyridine-4-carbonyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 45 ^lorphoIine-4-carboxylicacid[l-(I-benzyI-3-cyano-2-hydroxymethyl-pyrroIidin-3-ylcarbamoyl)-3,3-dimethyI-butyl]-amide; Morpholine-4-carboxylicacid[l-(3-cyano-l-cyclohexylmethyl-pyrrolidin-3-5 ylcarbamoyl)-3-methyl-butyl]-amide; 4-Chloro-A^[l-(4-cyano-l-propyl-piperidin-4-ylcarbamoyl)-3,3~dimethyl-butyl]-benzamide; 10 Pyrazine-2-carboxylic acid [l-(4-cyano-l-propyl-piperidin-4-y]carbamoyl)-3,3-dimethy]-butylj-amide; 4,4-dimethyl-2-(2-tbiophen-2-yl-acetylamino)-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)-amide; 15 Morpholine-4-carboxylic acid [ 1 -(1 -benzyl-3-cyano-pyiroIidin-3-ylcarbaraoyl)-3-methyl-butyl]-amide; iV'-(4-(^ano-l-methyI-piperidin-4-yI)-3-cycIohexyI-2-[(morpholine-4-carbothioyI)-20 aminoj-propionamide; Morpholine-4-carboxylicacid[l-(4-cyano-l-cyclohexyl-piperidin-4-ylcarbamoyl)-3J3-dimethyl-butyl]-amide; 25 MorphoIine-4-carboxylic acid {l-[4-cyano-l-(tetrahydro-pyran-4-yl)-piperidin-4-ylcarbamoyl]-3,3-dinieihyl-butyl}-amide;. Morpholine-4-carboxylic acid [2-(4-chloro-phenyl)-1 -(4-cyano-1 -propyl-piperidin-4-ylcarbamoyl)-ethyl]-amide; 30 Morpholine-4-carboxylicacid[l-(4-cyano-l-propyl-piperidin-4-ylcarbamoyl)-2-(3,4-dichloro-phenyl)-ethyl]-amide; Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -propy l-piperidin-4-ylcarbamoyl)-2-35 naphthalen-2-yl-ethyl]-amide; Moipholine-4-carboxylic acid [ 1 -(4-cyanc-1 -propyl-piperidin-4-ylcarbamoyl)-3-methyl-butyl]-amide; 40 Morpholine-4-carboxylic acid [l-(4-cyano-l,2-dimethyl-piperidin-4-ylcarbanioyl)-3J3-dimethyl-butyl]-amide; Naphthalene-2-carboxylic acid [ 1 -(1 -ben2yl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3-methyl-butylj-amide; 45 and the pharmaceutically acceptable derivatives thereof. The following are preferred compounds of the formulas (I) and (II) of the invention: 5 Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoy l)-2-cyclohexyl-ethyl]-amide; 4-Acerylamino-iV-[ 1 -(4-cyano-1 -methyI-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]' 10 benzamide; 4-Acerylamino-AL[l-(4-cyano-l-methyl-piperidin-4-ylcarbarnoyl)-3,3-dimethyl-butyl]-benzamide; 15 Morpholine-4-carboxylic acid [l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [ 1 -(1 -benzyl-4-cyano-piperidin-4-ylcarbamoy 1)~2-cyclohexyl-ethyl]-amide; 20 Morpholine-4-carboxylic acid [ 1 -(4-cyano-piperidin-4-ylcarbamoy l)-2-cyclohexy 1-ethyl]-amide hydrochloride; Morpholine-4-carboxylic acid {1 -[4-cyano-l -(1 -methyl-ethyl)-piperidin-4-ylcarbamoyl]-25 2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -phenethyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 30 Morpholine-4-carboxylic acid {1 -[3-cyano-1 -benzyl-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyi-ethyl}-amide; Morpholine-4-carboxylic acid [1-(4-cyano-l-propyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 35 Moipholine-4-carboxylicacid[l-(4-cyano-l-isopropyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-buryl]-amide; Morpholine-4-carboxylicacid[l-(l-phenethyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3-40 dimethyl-butyl]-amide; Morpholine-4-carboxylicacid[l-(l-n-propyI-4-cyano-piperidin-4-ylcarbamoyI)-3,3-dimethyl-butyl]-amide; 45 Morpholine-4-carboxylic acid [ 1 -(1 -benzy l-4-cyano-piperidin-4-ylcarbamoyl)-3,3 -dimethyl-buryl]-amide; 4-Acety lamino-A^ 1 -(1 -benzyl-4-cyano-piperidin-4-ylcarbainoyl)-2-cyclohexyl-ethy]]-benzamide; 5 ^Acetylamino-iV-t 1 -(4-cyano-1 -isopropyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; Morpholine-4-carboxylicacid[l-(l-benzyI-3-cyano-piperidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 10 N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-ben2amide; 4-( Acetylamino-methyl)-N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylj-benzamide; 15 ^-[l-(4-cyanc-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-isonicotinamide; Pyrazine-2-carboxylic acid [1-(4-cyano-1-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 20 5-Chloro-tbiophene-2-carboxylic acid [ l-(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 4-Cbloro-iV-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexy 1-ethyl]-25 benzamide; N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-3-phenoxy-benzamide; 30 iV-[l-(l-Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl-ethyl]-isonicotinamide; Pyrazine-2-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbanioyl)-2-cyclohexyl-ethyl]-amide; 35 Moipholine-4-carboxylic acid {l-[3-cyano-l-(cyclohexyl-methyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylicacid[l-(3-cyano-l-benzyl-pyrrolidin-3-ylcarbamoyl)-3J3-40 dimethyl-butyl]-amide; ^-[^(l-Benzyl-S-cyano-pyirolidin-S-ylcarbamoyO-S^-diniethyl-butylJ-benzamide; Pyrazine-2-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3,3-45 dimethyl-butyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(l-methyl-ethyl)-pyrrolidrn-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; N-[l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-4-5 methanesulfonylamino-benzamide; N-[l-fl-Benzyl-S-cyano-pyrrolidin-S-ylcarbamoyO^-cyclohexyl-ethyl]-^ methanesulfonylamino-benzamide; 10 N-[l^^cyano-l-methyl-piperidin^-ylcarbamoyO-S^-dimethyl-butyy-benzamide; N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-4-fluoro-benzamide; 15 N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoy l)-3,3 -dimethyl-buty l]-4-methanesulfonylamino-benzamide; Moipholine-4-carboxylicacid[l-(3-cyano-l-cyclohexyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 20 Morpholine-4-carboxylic acid [ l-(3-cyano-1 -ethyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [1 -(3-cyano-l-merayl-pyrrolidin-3-ylcarbamoyl)-2-25 cyclohexyl-ethyI]-amide; Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(3~methyl-benzyl)-pyiTolidin-3-ylcarbamoyl]-2-cyclohexy l-ethyl} -amide; 30 Moipholine-4-carboxylic acid {1 -[3-cyano-1 -(2-methyl-pent-2-enyl)-pyrrolidin-3-y lcarbamoyl]-2-cyclohexyl-ethyl} -amide; Moipholine-4-carboxylic acid {l-[3-cyano-l-(l//-mdol-3-ylmethyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; 35 Pyrrolidine-1-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclohexylmethyI-pyrrolidin-3-40 ylcarbamoyl)-3,3-dimethyl-butyI]-amide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -isobutyl-pyrrolidin-3 -ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 45 Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -isopropyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylicacid[l-(3-cyano-l-isobutyl-pyrrolidin-3-ylcarbamoyl)"3,3-dimethyl-butyl]-amide; 5 Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(1 -ethyl-propyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl} -amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(l-ethyl-propyl)-pyrrolidin-3-ylcarbaraoyl]-3,3-dimethyl-butyl} -amide; 10 Moipholine-4-caiboxylic acid [ 1 -(3-cyano-1 -phenethyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1-(3-cyano-1 -cyclopropylmethyl-pyrrolidin-3-15 ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [1 -(3-cyano-1 -methyl-piperidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 20 Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-azetidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -propyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 25 Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -propyl-pyrrolidin-3 -y lcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {1-[3-cyano-l-(/rfl/w-4-methyl-cyclohexyl)-pyrrolidin-3-30 ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -cyclopentyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyTJ-amide; 35 Morpholine-4-carboxylic acid [l-(3-cyano-l-isobutyl-piperidin-3-ylcarbamoyi)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclopentyl-pyrrolidin-3-ylcarbamoyl}-2-cyclohexyl-ethyl]-amide; 40 Morpholine-4-carboxylic acid [ 1 -(3-cyano-pyirolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(trans-4-methyl-cyclohexyl)-pyrrolidin-3-45 ylcarbamoyl]-3,3-dimethyl-butyl}-amide; Morpholine-4-carboxylic acid [ 1 -(1 -benzyl-3-cyano-pyrrolidin-3-y lcarbamoyl)-2-naphthalen-2-yl-ethyl]-amide; Morpholine-4-carboxylic acid [ l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-(4-5 chloro-phenyl)-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(5-methyl-thiophen-2-ylmethyl)-pyrroIidin-3-ylcarbamoyl]-2-cyc]ohexyl-ethyl}-amide; 10 Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyirolidin-3-ylcarbamoyl)-3-methyl-but-3-enyl]-amide; Morpholine-4-carboxylicacid[l-(3-cyano-l-cyclopentylmethyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 15 Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclohexylmethyl-pyrrolidin-3-ylcarbamoyl)-3-methyl-butyl]-amide; 4-Chloro-Ar-[l -(4-cyano-1 -propyl-piperidin-4-ylcarbamoyl)-3,3-dimethyi-butyl]-20 benzamide; Pyrazine-2-carboxylic acid [ 1 -(4-cyano-1 -propyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 25 4,4-dimethyl-2-(2-thiophen-2-yI-acetylamino)-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)-amide; Moipholine-4-carboxylicacid[l-(l-benzyl-3-cyano-pyrrolidin-3-ylcait>amoyl)-3-methyl-butylj-amide; 30 Moipholine-4-carboxylicacid[l-(4-cyano-l-cyclohexyl-piperidm-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylicacid[2-(4-chloro-phenyl)-l-(4-cyano-l-propyl-piperidin-4-35 ylcarbamoyl)-ethyl]-amide; Morpholine-4-carboxylic acid [l-(4-cyano-l-propyl-piperidin-4-ylcarbamoyl)-2-(3,4-dichloro-phenyl)-ethyl]-amide; 40 Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -propy l-piperidin-4-ylcarbamoyl)-2-naphthalen-2-yl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -propyl-piperidin-4-ylcarbamoyl)-3-methyl-butyl]-amide; 45 torpholine-4-carboxylic acid [ 1 -(4-cyano-1,2-dimethyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 5 and the pharmaceutically acceptable derivatives thereof. The activity of particular compounds disclosed herein against cathepsin K may be 10 determined without undue experimentation by one of ordinary skill in the art in view of the art, the guidance provided throughout this specification and by the screens described in the section entitled "Assessment of Biological Properties." The following subgeneric aspect of the compounds of the formula (II) have Cathepsin K 15 activity: The compound according to the third embodiment above of formula (II) and wherein: 20 Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more R5; Ri is a bond, CI-4 alkyl, CI-4 alkoxy, cyclopropyl, cyclohexyl, phenoxy, naphthyloxy, 25 phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, raranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; 30 Ra is methyl, ethyl, propyl, i-propyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, ethoxy, acetyl, acetoxy, phenoxy, naphthyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, phenoxycarbonyl, naphthyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl orpiperazinyl, or Ra is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be 5 oxidized to a sulfoxide or sulfone, ethylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, 10 or Ra is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, CI-2 alkylcarbamoyloxy, phenylcarbamoyloxy, naphthylcarbamoyloxy, CI-2 alkylsulfonylamino, phenylsulfonylamino, naphthylsulfonylamino, CI-2 alkylaminosulfonyl, phenylaminosulfonyl, naphthylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl, 15 phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rb; 20 Rb is methyl, ethyl, cyclopropyl, cyclohexyl, phenyl, methoxy, ethoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R2 is hydrogen or methyl; 25 R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rc 30 Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, naphthyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, furanyl, R5 is methyl, ethyl, n-propyl, n-butyl, n-pentyl, 2-pentyl, 3-pentyl, phenethyl, phenpropyl, 2,2-dimethylpropyl, t-butyl, i-propyl, i-butyl, cyclopropyl, cyclopentyl, cyclohexyl, cyclopropylmethyl, cyclopentylmethyl, cyclohexylmethyl, phenyl, benzyl, 2-methylbenzyl, 3-methylbenzyl, 4-methylbenzyl, 2,6-dimethylbenzyl, 2,5-dimethylbenzyl, 5 2,4-dimethylbenzyl, 2,3-dimethylbenzyl, 3,4-dimethylbenzyl, 3,5-dimethylbenzyl, 2,4,6-rrimethylbenzyl, 2-methoxybenzyl, 3-methoxybenzyl, 4-methoxybenzyl, 2-phenoxybenzyl, 3-phenoxybenzyl, 4-phenoxyben2yl, 2-benzyloxybenzyl,3-benzyloxybenzyl, 4-benzyloxybenzyl, 2-fluorobenzyl, 3-fluorobenzyl, 4-fluorobenzyl, 2,6-difluorobenzyl, 2,5-difiuorobenzyl, 2,4-difluorobenzyl, 2,3-difluorobenzyl, 3,4- 10 difluorobenzyl, 3,5-difluorobenzyl, 2,4,6-triflurobenzyl, 2-trifluoromethylbenzyl, 3-trifluoromethylbenzyl, 4-trifluoromethylbenzyl, naphthylmethyl, indanylmethyl, pyridinylmethyl, indolylmethyl, thienylmethyl, 5-methylthienylmethyl, piperidinyl, piperidinylcarbonyl, pyridinylcarbonyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, t-butoxycarbonyl, methylcarbamoyl, 15 phenylcarbamoyl, benzylcarbamoyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy. Yet another embodiment of the compounds of the formula (II) having Cathepsin K activity are those described immediately above and wherein: 20 Ri is methoxy, benzyloxy, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; 25 wherein Ri is optionally substituted by one or more R»; Ra is methyl, phenyl, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide; R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-30 butenyl or benzyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, acetylamino, methylthio, methylsulfonylamino or fluoro; 5 R2 and R.3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl or tetrahydroruranyl; Rj is methyl, ethyl, n-propyl, n-butyl, phenethyl, phenpropyl, t-butyl, i-propyl, i-butyl, 10 cyclopropyl, cyclohexyl, cyclopropylmethyl, cyclohexylmethyl, phenyl, benzyl, 2- methoxybenzyl, 3-methoxybenzyl, 4-methoxybenzyl 4-fluorobenzyl, 3,5-difluorobenzyl, 4-trifluoromethylbenzyl, naphthylmethyl, pyridinylmethyl, indolylmethyl, thienylmethyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, t-butoxycarbonyl, phenylcarbamoyl, phenylsulfonylamino or fluoro. 15 Yet still another embodiment of the compounds of the formula (H) having Cathepsin K activity are those described immediately above and wherein: Het is pyrrolidinyl, piperidinyl or tetrahydropyranyl; 20 Ri is benzyloxy, phenoxy, naphthyloxy, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyridinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or phenylamino; 25 R3 is n-propyl, i-butyl, propenyl, i-butenyl or 2,2-dimethylpropyl; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, or cycloheptyl; R.5 is methyl, ethyl, n-propyl, phenethyl, t-butyl, i-propyl, i-butyl, cyclohexyl, cyclohexylmethyl, benzyl, 4-fluorobenzyl, naphthylmethyl, acetyl, benzoyl or benzyloxycarbonyl. 5 Representative compounds possessing CAT K activity are the following: [ 1 -(1 -Ben2yl-4-cyano-piperidin-4-ylcarbamoyl)-3-methyl-butyl]-carbamic acid benzyl ester, 10 [l-(l-Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-cyclohexyl]-carbamic acid f-butyl ester; [l-(4-Cyano-l-methyl-piperidin-4-ylcarbamoyl)-3-methyl-butyl]-carbamic acid benzyl ester, 15 [l-(l-Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-cyclohexyl]-carbamic acid benzyl ester; Naphthalene-2-carboxylicacid[l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyI)-3-methyl-butyl]-amide; 20 MorphoIine-4-carboxylic acid [1 -(4-cyano-l -propyl-piperidin-4-ylcarbamoyl)-3-methyl-butyl]-amide; Naphthalene-2-carboxylic acid [l-(3-cyano-l-cyclohexylmethyl-pyrrolidin-3-25 ylcarbamoyl)-3-methyl-butyl]-amide; [l-(l-Benzyl-3-cyano^>yrrolidin-3-ylcarbamoyl)-3-methyl-butylJ-carbamic acid benzyl ester, 30 Morpholine-4-carboxyIic acid [1 -(1 -benzyI-3-cyano-pyrrolidin-3-yIcarbamoyl)-3-methyl-butyl]-amide; [l-(3-Cyano-l-cyclohexylmemyl-pyrrolidm-3-ylcarbamoyl)-3-methyl-butyl]-carbamic acid benzyl ester, 35 Moipholine-4-carboxylic acid [l-(3-cyano-l-cyclohexylmethyl-pyrrolidin-3-ylcarbamoyl)-3-methyl-butyl]-amide; Morpholine-4-carboxylic acid [ 1 -(1 -benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3-me(hyl-40 but-3-enyl]-amide. In a third broad generic aspect of the invention, there are provided novel compounds of the formulas (la) and (lb): wherein: 10 Het is azepanyt, piperidinyl, pyrrolidmyl, azetidinyl, oxepanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, oxetanyl, azocanyl, oxocanyl, 1,3-diazocanyl, 1,4-diazocanyl, 1,5-diazocanyl, 1,3-dioxocanyl, 1,4-dioxocanyl, 1,5-dioxocanyl, 1,3-oxazocanyl, 1,4-oxazocanyl, 1,5-oxazocanyI, 1,3-diazepanyl, 1,4-diazepanyl, 1,3- 15 dioxepanyl, 1,4-dioxepanyl, 1,3-oxazepanyl, 1,4-oxazepanyl, l,2-thiazocanyl-l,l-dioxide, 1,2,8-thiadiazocanyl-1,1-dioxide, 1,2-thiazepanyl-1,1 -dioxide, 1,2,7-thiadiazepanyl-1,1-dioxide, tetrahydrothiopnenyl, hexahydropyrimidinyl, hexahydropyridazinyl, piperazinyl, 1,4,5,6-tetrahydropyrimidinyl, pyrazolidinyl, dihydro-oxazolyl, dihydrothiazolyl, dihydroimidazolyl, isoxazolinyl, oxazolidinyl, 1,2- 20 thiazinanyl-l,l-dioxide, 1,2,6-thiadiazinanyl-1,1 -dioxide, isothiazolidinyl-1,1-dioxide, imidazolidinyl-2,4-dione, imidazolidinyl, morpholinyl, dioxanyl, tetrahydropyridinyl, thiomorpholinyl, fhiazolidinyl, dihydropyranyl, dithianyl, decahydro-quinolinyl, decahydro-isoquinolinyl, 1,2,3,4-tetrahydro-quinolinyl, indolinyl, octahydro-quinolizinyl, dihydro-indolizinyl, octahydro-indolizinyl, octahydro-indolyl, decahydroquinazolinyl, 25 decahydroquinoxalinyl, 1,2,3,4-tetrahydroquinazolmyl or 1,2,3,4-tetrahydroquinoxalinyl; A C6-C10 bridged bicyclo wherein one or more carbon atoms are optionally replaced by a heteroatom chosen from N, O and S; each being optionally substituted with one or more R5; 5 Ri is a bond, hydrogen, Cl-10 alkyl, Cl-10 alkoxy, aryloxy, C3-8 cycloalkyl, C3-8 cycloalkyloxy, aryl, benzyl, tetrahydronaphthyl, indenyl, indanyl, Cl-lOalkylsulfonylCl-lOalkyl, C3-8cycloalkylsulfonylCl-10alkyl, arylsulfonylCl-lOalkyl, heterocyclyl selected from azepanyl, azocanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, 10 tetrahydrothiopyranyl, thiopyranyl, furanyl, tetrahydrofuranyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, tetrazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzisoxazolyl, quinolinyl, tetrahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, quinazolinyl, tetrahydroquinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy 15 wherein the heterocyclyl moiety is selected from those herein described in this paragraph, hydroxy or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond, Cl-10 alkyl, C3-8 cycloalkyl, aryl, tetrahydronaphthyl, indenyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, 20 indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-10 alkoxy, Cl-lOalkanoyl, Cl-lOalkanoyloxy, aryloxy, benzyloxy, Cl-10 alkoxycarbonyl, aryloxycarbonyl, 25 aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, ruranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, 30 isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is CI-10 alkanoylamino, aroylamino, Cl-10 alkylthio wherein the sulfur atom maybe oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1 -10 alkyl, aryl, pyrrolidiny 1, piperidinyl, 5 morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, orRa is Cl-10 alkoxycarbonylamino, aryloxycarbonylamino, Cl-10 l o alkylcarbamoyloxy, arylcarbamoyloxy, Cl-10 alkylsulfonylamino, arylsulfonylamino, Cl-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di»substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, 15 tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rt,; 20 with the proviso that Ri and Ra simultaneously cannot be a bond; Rb is a CI-6 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more carbon atoms are optionally replaced by O, N, S(0), S(0)2 or S and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, 25 or one or more CI-4 alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl; 30 or Rb is C3-6 cycloalkyl, aryl, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, mono-Cl~5aIkylamino, di-Cl-Salkylarnino, carboxamide, amidino or guanidino; 5 R2 is hydrogen or C1 -3 alkyl; R3 is a bond, hydrogen, CI-10 alkyl, C2-10alkylene, C3-8 cycloalkyl, arylCl-5alkyl or aryl wherein R3 is optionally substituted by one or more R^; 10 Re is Cl-10 alkyl, C3-8 cycloalkyl, aryl, indanyl, indenyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, decahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, tetrahydrothiopyranyl, 15 thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, dihydrobenzofiiranyl, octohydrobenzofuranyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, tetrahydroquinolinyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-10 alkoxy, aryloxy, Cl-10 alkanoyl, 20 aroyl, Cl-10 alkoxycarbonyl, aryloxycarbonyl, Cl-10 alkanoyloxy, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, 25 indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Cl-10 alkanoylamino, aroylamino, Cl-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom 30 may be independently substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is CI-10 alkoxycarbonylamino, aryloxycarbonylamino, CI-10 5 alkylcarbamoyloxy, arylcarbamoyloxy, C1 -10 alkylsulfonylamino, arylsulfonylamino, Cl-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, 10 tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, R« may be further optionally substituted by one or more Rdj 15 R R2 and R3 together with the carbon they are attached optionally form a nonaromatic 5-7 20 membered cycloalkyl or heterocyclic ring; each R4 is independently hydrogen, hydroxy or CI-3 alkyl; R5 is a bond, hydrogen, carbonyl, Cl-10 alkyl, Cl-lOalkoxyCl-lOalkyl, Cl-25 lOalkylaminoCl-lOalkyl, Cl-lOalkylthioCl-lOalkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-10 alkoxy, aryloxy, C3-8 cycloalkyl, aryl, benzyl, tetrahydronaphthyl, indenyl, indanyl, C3-7cycloalkylsulfonylCl-5alkyl, arylsulfonylCl-5alkyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, tbiopyranyl, 30 tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridizinyl, tetrazolyl, triazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzirnidazolyl, benzthjazolyl, quinolinyl, tetrahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, quinazolinyl, tetrahydroquinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl- . 5 lOalkanoyl, aroyl, Cl-lOalkanoyloxy, benzyloxy, Cl-lOalkoxycarbonyl, arylCl- 5alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, 10 benzofuranyl, benzothienyl, benzirnidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Rs is Cl-10 alkanoylamino, aroylamino, Cl-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently 15 substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzirnidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is Cl-10 atkoxycarbonylamino, aryloxycarbonylamino, Cl-10 alkylcarbamoyloxy, 20 arylcarbamoyloxy, Cl-10 alkylsulfonylamino, arylsulfonylamino, Cl-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, 25 benzofuranyl, benzothienyl, benzirnidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is halogen, hydroxy, oxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, R5 may be further optionally substituted by one or more Rej 30 Re is CI -10 alkyl, CI -1 OalkoxyCl-1 Oaikyl, CI -1 OalkylaminoCl -1 OaUcyl, CI - lOalkylthioCl-lOalkyl wherein the sulfur atom may be oxidized to a sulfoxide or ulfone, Cl-10 alkoxy, C3-J? cycloalkyl, aryl, tetrahydronaphthyl, indenyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, thiopyranyl, tetrahydrodiiopyranyl, pyranyl, tetrahydropyranyl, tetrahydrofuranyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, 5 triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-lOalkanoyl, aroyl, Cl- lOalkanoyloxy, aryloxy, benzyloxy, Cl-10 alkoxycarbonyl, arylCl- 3alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen 10 atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or is quinoxalinyl, or Re is Cl-10 alkanoylamino, aroylamino, Cl-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, 20 morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Cl-10 alkoxycarbonylamino, aryloxycarbonylamino, Cl-10 25 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-10 alkylsulfonylarnino, arylsulfonylamino, Cl-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, 30 tetrazolyl, pyridinyl, pyrimidinyl, pyraziny l, indolyU benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re. is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Re may be further optionally substituted by one or more Rf; 5 Rf is CI-5 alkyl, C3-6 cycloalkyl, tolylsulfonyl, CI-5 alkoxy, aryl, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; 10 Rfiis hydrogen, hydroxy, nitrile or a CI-6 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, 15 S(O), S(0)2 or S and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, one or more CM alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, 20 quinazolinyl, benzoxazolyl or quinoxalinyl; wherein Ri and Rg in the formulas (la) or (lb) optionally form a 4 to 8 membered mono-or 7-12 membered polycyclo heteroring system, each aromatic or nonaromatic, wherein each heteroring is optionally substituted by one or more R7; 25 each R7 and R$ are independently: CI-5 alkyl chain optionally interrupted by one or two N, 0 or S(0)m and optionally 30 substituted by 1-2 oxo, amino, hydroxy, halogen, Cl~4alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, lienyl, pyirolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl or quinoxalinyl, 5 aiyl, aryloxy, aroyl, furanyl, tbienyl, pyrrolyl, imidazolyl, pyridinyl, pyrimidinyl, CI-5 alkanoyl, CI-5 alkoxycarbonyl, aryloxycarbonyl, benzyloxycarbonyl, Cl-5 alkanoylamino, aroylamino, Cl-5 alkylthio, arylthio Cl-5 alkylsulfonylamino, arylsulfonylamino, Cl-5 alkylaminosulfonyl, arylaminosulfonyl, C3-6 cycloalkyl and benzyloxy 10 each of the aforementioned are optionally halogenated, halogen, hydroxy, oxo, carboxy, nitrile, nitro or NH2C(0)-; m is 0,1 or 2; 15 X is =0, =S or =N-R6 wherein R5 is as defined above, and pharmaceutically acceptable derivatives thereof. 20 In another embodiment of the invention, there are provided novel compounds of the formula (la) and formula (lb) as described immediately above, and wherein: Het is piperidinyl, pyrrolidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, azetidinyl, azepanyl, oxepanyl, tetrahydrofuranyl, oxetanyl, hexahydropyrimidinyl, 25 hexahydropryidazinyl, piperazinyl, l,4,5,6^tetrahydropyrirmdinyl, octahydro-indolizinyl, octahydro-quinolizinyl, decahydro-quinolinyl, 1,2,3,4-tetrahydro-quinolinyl, dihydro-oxazolyl, 1,2-thiazinanyl-1,1-dioxide, 1,2,6-thiadiazinanyl-1,1-dioxide, isothiazolidinyl-1,1-dioxide, imidazolidinyl, pyrazolidinyl or a bridged bicyclo chosen from aza-bicyclo[3.2.1]octane, aza-bicyclo[2.2.1]heptane, aza-bicyclo[2.2.2]octane, aza- 30 bicyclo[3.2.2]nonane, aza-bicyclo[2.1.1]hexane, aza-bicyclo[3.1.1]heptane, aza-bicyclo[3.3.2]decane and 2-oxa or 2-thia-5-aza-bicyclo[2.2.1]heptane; each ring being substituted with one or more R5; Ri is a bond, hydrogen, Cl-7 alkyl, Cl-7 alkoxy, C3-7 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, tetrahydronaphthyl, Cl-7alkylsulfonylCl-7alkyl, C3-7cycloalkylsulfonylCl-7alkyl, arylsulfonylCl-7alkyl, pyirolidinyl, piperidinyl, 5 mbrpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, isoxazolyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoisoxazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; 10 Ra is a bond Cl-7 alkyl, C3-6 cycloalkyl, phenyl, naphthyl, pyirolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, 15 quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-7 alkoxy, Cl-7alkanoyl, Cl-7alkanoyloxy, aryloxy, benzyloxy, Cl-7 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, 20 triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is Cl-7 alkanoylamino, aroylamino, Cl-7 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may 25 be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, 30 isoquinolinyl, quinazolinyl or quinoxalinyl, or Rg is CI-7 alkoxycarbonylamino, aryloxycarbonylamino, CI-7 alkylcarbamoyloxy, arylcarbamoyloxy, CI-7 alkylsulfonylamino, arylsulfonylamino, CI-7 alkylarninosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-7 alkyl, 5 aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or 10 guanidino, R* may be further optionally substituted by one or more Rbj Rb is CI-5 alkyl, C3-6 cycloalkyl, aryl, CI-5 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; 15 R2 is hydrogen or methyl or ethyl; R3 is a bond, hydrogen, CI-5 alkyl, C2-5alkylene, C3-7 cycloalkyl, arylCl-3alkyl or aryl wherein R3 is optionally substituted by one or more R^; 20 Re is CI-5 alkyl, C3-7 cycloalkyl, aryl, indanyl, indenyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, 25 tetrahydrofuranyl, pyranyl, tetrahydropyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-5 alkoxy, aryloxy, Cl-5 alkanoyl, aroyl, Cl-5 alkoxycarbonyl, aryloxycarbonyl, Cl-5 alkanoyloxy, 30 aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, fiiranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, 5 or Re is Cl-5 alkanoylamino, aroylamino, Cl-5 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, fiiranyl, thienyl, pyrrolyl, 10 oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Cl-5 alkoxycarbonylamino, aryloxycarbonylamino, Cl-5 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-5 alkylsulfonylamino, 15 arylsulfonylamino, Cl-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, 20 benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more R alkyl, Cl-5 alkoxy, aryloxy, arylCl-5alkoxy, aroyl, halogen, hydroxy, oxo or cyano; Rj is hydrogen or methyl; 30 R5 is a bond, hydrogen, carbonyl, Cl-8 alkyl, Cl~8alkoxyCl-8alkyl, Cl-8alkylaminoCl-8alkyl, Cl-8alkylthioCl-8alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-8 alkoxy,, aryloxy, C3-7 cycloalkyl, aryl, benzyl, tetrahydronaphthyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, 5 thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, thiopyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, terrazolyl, triazolyl, pyrazolyl, indolyl, bej^ofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyi, isoquinolinyl, quinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is 10 selected from those herein described in this paragraph, Cl-7alkanoyl, aroyl, Cl-7alkanoyloxy, benzyloxy, C1 -7 alkoxycarbonyl, arylC 1 -4alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, 15 pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyi, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is Cl-7 alkanoylamino, aroylamino, Cl-7 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently 20 substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyi, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is Cl-7 alkoxycarbonylamino, aryloxycarbonylamino, Cl-7 alkylcarbamoyloxy, 25 arylcarbamoyloxy, Cl-7 alkylsulfonylamino, arylsulfonylamino, Cl-7 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranylj benzothienyl, 30 benzimidazolyl, benzthiazolyl, quinolinyi, isoquinolinyl, quinazolinyl or quinoxalinyl, or Rs is halogen, hydroxy, oxy, oxo, carboxy, cyano, nitro or carboxamide, R5 may be further optionally substituted by one or more R«; 5 R- is Cl-7 alkyl, Cl-7alkoxyCl-7alkyl, Cl-7alkylaminoCl-7alkyls Cl- 7alkylthioCl-7alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-7 alkoxy, C3-7 cycloalkyl, aryl, tetrahydronaphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thiopyranyl, tetrahydrothiopyranyl, tetrahydropyranyl, tetrahydrofuranyl, furanyl, thienyl, 10 oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzotbienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, CI-5 alkanoyl, aroyl, Cl-Salkanoyloxy, aryloxy, benzyloxy, CI-5 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or 15 di-substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzotbienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, 20 or R« is Cl-5 alkanoylamino, aroylamino, Cl-5 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, 25 imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R- is Cl-5 alkoxycarbonylamino, aryloxycarbonylamino, Cl-5 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-5 alkylsulfonylarnino, 30 arylsulfonylamino, Cl-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazoly], quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, 5 or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, R« may be further optionally substituted by one or more Rf; Rf is methyl, ethyl, t-butyl, tolylsulfonyl, CI-3 alkoxy, cyclopropyl, cyclohexyl, phenyl, naphthyl, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy, cyano, 10 nitro or carboxamide; Re is hydrogen, hydroxy, nitrile or a CI-6 saturated or unsaturated branched or unbranched carbon chain optionally partially 15 or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, S(O), S(0)2 or S and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, one or more Cl-4alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, 20 benzofiiranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl or quinoxalinyl; Ri and R& of the formula (la) or formula (lb) form a monocyclic 5,6 or 7 membered aromatic or nonaromatic heterocyclic ring optionally substituted by R7; 25 or a bicyclic ring having one 5,6 or 7 membered aromatic or nonaromatic heterocyclic ring fused to a second 5-7 membered aromatic or nonaromatic heterocyclic or carbocyclic ring wherein each ring is optionally independently substituted by one or more R7; 30 R7 and Rg are independently CI-5 alkyl, C3-6 cycloalkyl, aryl, CI-5 alkoxy, aryloxy, benzyloxy each of the aforementioned are optionally halogenated or Rx is halogen, hydroxy, oxo, carboxy, nitrile, nitro or NH2C(0)-; 5 m is 0,1 or 2 and X is O or S. 10 In yet another embodiment of the invention, there are provided hovel compounds of the formulas (la) and (lb) as described immediately above, and wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, oxetanyl, octahydro-indolizinyl, octahydro-15 quinolizinyl or aza-bicyclo[3.2. ljoctanyl, each ring being optionally substituted with one or more R5; Ri is a bond, CI-5 alkyl, CI-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, Cl-3alkylsulfonylCl-3alkyl, C3-6cycloalkylsulfonylCl-3alkyl, 20 arylsulfonylCl-3alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, isoxazolyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more R*; 25 Ra is a bond, CI-3 alkyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, Cl-3 alkoxy, Cl-3alkanoyl, Cl-3alkanoyIoxy, 30 aryloxy, benzyloxy, Cl-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Rj is CI-3 alkanoylamino, aroylamino, CI-3 alkylthio wherein the sulfur atom 5 may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is CI-3 alkoxycarbonylamino, aryloxycarbonylamino, CI-3 10 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-3 alkylsulfonylamino, arylsulfonylamino, Cl-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or R» is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or 15 guanidino, Ra may be further optionally substituted by one or more Rt,; Rb is Cl-3 alkyl, C3-6 cycloalkyl, aryl, Cl-3 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; 20 R2 is hydrogen or methyl; R3 is a bond, hydrogen, Cl-5 alkyl, C2-5alkylene, C4-6 cycloalkyl or arylCl-2alkyl wherein R3 is optionally substituted by one or more R^ 25 Re is CI-4 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, 30 indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benztbiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Cl-4 alkoxy, phenoxy, naphthyloxy, CI-3 alkanoyl, benzoyl, CI-3 alkoxycarbonyl, phenoxycarbonyl, CI-3 alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be 5 independently mono or di-substituted by CI-5 alkyl or aryl, or Re is CI-3 alkanoylamino, benzoylamino, CI-3 alkyltbio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-5 alkyl or aryl, 10 or Re is C1 -3 alkoxycarbonylamino, aryloxycarbonylamino, C1 -3 alkylcarbamoyloxy, arylcarbamoyloxy, CI-3 alkylsulfonylamino, arylsulfonylamino, CI-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-5 alkyl or aryl, 15 or R« is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more R R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, CI-6 alkyl, Cl-6alkoxyCl-6alkyl, Cl-6alkylaminoCl-6alkyl, Cl-6alkylthioCl-6alkyl wherein the sulfur atom may be oxidized to a sulfoxide or 25 sulfone, CI-6 alkoxy,, phenoxy, naphthyloxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, 30 isoquinolinyl and benzoxazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl-3alkanoyl, benzoyl, naphthoyl, Cl-4alkanoyloxy, benzyloxy, CI-4 alkoxycarbonyl, arylCl-2alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1 -3 alky 1, phenyl, pyrrolidinyl, piperidiny 1, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, 5 or R5 is CI-4 alkanoylamino, aroylamino, CI-4 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, 10 benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, or R5 is Cl-4 alkoxycarbonylamino, phenoxycarbonylamino, Cl-4 alkylcarbamoyloxy, phenylcarbamoyloxy, Cl-4 alkylsulfonylamino, phenylsulfonylamino, CI-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-4 alkyl, aryl, pyrrolidinyl, piperidinyl, 15 morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, R5 may be further optionally substituted by one or more R.; 20 R- is Cl-4 alkyl, Cl-4 alkoxy, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydrothiopyranyl, tetrahydropyranyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, 25 Cl-4 alkanoyl, aroyl, Cl-4alkanoyloxy, phenoxy, naphthyloxy, benzyloxy, Cl-4 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, 30 benzimidazolyl, or benzthiazolyl, or R atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-3 alkyl, phenyl, naphthyl, 5 pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R« is CI-4 alkoxycarbonylamino, phenoxycarbonylamino, CI-4 alkylcarbamoyloxy, phenylcarbamoyloxy, CI-4 alkylsulfonylamino, 10 phenylsulfonylamino, CI-4 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, duazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, 15 or R« is halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Re may be further optionally substituted by one or more Rf, Rf is methyl, ethyl, t-butyl, tolylsulfonyl, methoxy, cyclopropyl, phenyl, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or 20 carboxamide. Ri and Re of the formula (la) or Formula (lb) optionally form a monocyclic 5 or 6 membered aromatic or nonaromatic heterocyclic ring optionally substituted by R7; 25 or a bicyclic ring having one 5,6 or 7 membered aromatic or nonaromatic heterocyclic ring fused to a second 5-6 membered aromatic or nonaromatic heterocyclic or carbocyclic ring wherein each ring is optionally independently substituted by one or more R7; 30 and XisO. 5 In yet still another embodiment of the invention, there are provided novel compounds of the formulas (la) and (lb) as described immediately above, and wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrotbiopyranyl each ring being optionally substituted with one or more 10 R5; Ri is a bond, Cl-5 alkyl, Cl-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, 15 indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond, CI-3 alkyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, CI-3 20 alkoxy, Cl-3alkanoyl, Cl-3alkanoyloxy, aryloxy, benzyloxy, Cl-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is Cl-3 alkanoylamino, aroylamino, Cl-3 alkylthio wherein the sulfur atom 25 may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is Cl-3 alkoxycarbonylamino, aryloxycarbonylamino, Cl-3 30 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-3 alkylsulfonylamino, arylsulfonylamino, Cl-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein . the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidirtyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rj>; 5 Rb is methyl, ethyl, n-propyl, i-propyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, methoxy, ethoxy, n-propoxy, i-propoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; 10 R2 is hydrogen; R3 is a bond, Cl-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more R«; 15 Re is Cl-3 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1 .OJheptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1^,3,4-tetrahydronaphthyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, 20 imidazolyl, pyrimidinyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, Cl-3 alkoxy, phenoxy, naphthyloxy, Cl-2 alkanoyl, benzoyl, Cl-2 alkoxycarbonyl, phenoxycarbonyl, Cl-2alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl or aryl, or Re is Cl-2 alkanoylamino, benzoylamino, Cl-2 alkylthio wherein the sulfur 25 atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-3 alkyl or aryl, or Re is Cl-2 alkoxycarbonylamino, phenoxycarbonylamino, Cl-2 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-2 alkylsulfonylamino, 30 phenylsulfonylamino, C l-2alkylaminosulfonyU phenylaminosulfony lt amino wherein the nitrogen atom may be independently mono or di-substituted by CI-3 alkyl or phenyl, or Re is halogen, hydroxy, oxo, carboxy or cyano, Re may be further optionally substituted by one or more R benzyloxy, benzoyl, fluoro, chloro, oxo or cyano; R5 is a bond, hydrogen, carbonyl, CI-5 alkyl, Cl-5alkoxyCl-5alkyl, Cl-5alkylaminoCl-10 5alkyl, Cl-5alkylthioCl-5alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cl-5 alkoxy, phenoxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is 15 selected from those herein described in this paragraph, Cl-3alkanoyl, benzoyl, naphthoyl, Cl-3alkanoyloxy, benzyloxy, Cl-3 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, 20 or R5 is Cl-3 alkanoylamino, aroylamino, Cl-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzofuranyl, benzothienyl, 25 benzimidazolyl or benzthiazolyl, or R5 is Cl-3 alkoxycarbonylamino, phenoxycarbonylamino, Cl-3 alkylcarbamoyloxy, phenylcarbamoyloxy, Cl-3 alkylsulfonylamino, phenylsulfonylamino, Cl-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, 30 morpholinyl, thiomorpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, R5 may be further optionally substituted by one or more R«; R« is CI-3 alkyl, Cl-3 alko*y, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, 5 pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, Cl-3 alkanoyl, aroyl, ClOalkanoyloxy^phenoxy, benzyloxy, Cl-3 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 10 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R« is Cl-3 alkanoylamino, benzoylamino, Cl-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen 15 atom may be independently substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is Cl-3 alkoxycarbonylamino, phenoxycarbonylamino, Cl-3 alkylcarbamoyloxy,phenylc;arbamoyloxy, Cl-3 alkylsulfonylamino, 20 phenylsulfonylamino, Cl-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, 25 or Re is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, R« may be further optionally substituted by one or more Rfj and Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide; 30 Ri and Rg of the fonnula (la) or Formula (lb) form a bicyclic ring having one 5 or 6 membered aromatic or nonaromatic heterocyclic ring fused to a second 5-6 membered heteroaryl, heterocycle or phenyl ring; wherein each ring is optionally independently substituted by one or two R7. 5 In yet a further embodiment of the invention, there are provided novel compounds of the formulas (la) and (lb) as described immediately above, and wherein: 10 Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl or tetrahydropyranyl each ring being substituted with one or more R5; Ri is a bond, methyl, ethyl, i-propyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, 15 cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more R*; R» is a bond, methyl, ethyl, cyclopropyl, phenyl, pyrrolidinyl, piperidinyl, 20 morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein me nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Ra is acetylamino, benzoylamino, methylthio, phenylthio wherein the sulfur 25 atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Rj is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom 30 may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Ra may be further optionally substituted by one or more Rj,; Rb is methyl, cyclopropyl, phenyl, methoxy, phenoxy, benzyloxy, fluoro, 5 chloro, hydroxy, oxo, carboxy or carboxamide; R3 is a bond, CI-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; 10 R« is methyl, ethyl, n-propyl, i-propyl, C5-6 cycloalkyl, indanyl, bicyclo[2.2.1 ]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicycIo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, thienyl, oxazolyl, thiazolyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, 15 methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or aryl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be 20 oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or aryl, or Re is memoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom 25 may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro or oxo, Re may be further optionally substituted by one or moreRd; Ri is methyl, cyclopropyl, phenyl, methoxy, fluoro, chloro or oxo; 30 R5 is a bond, hydrogen, carbonyl, CI-4 alkyl, Cl-4alkoxyCl-4alkyl, Cl-4alkylaminoCl-4alkyl, Cl-4alkylthioCl-4aIkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, CI-4 alkoxy.phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, 5 piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benztbiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl-2alkanoyl, benzoyl, naphthoyl, Cl-2alkanoyloxy, benzyloxy, Cl-2 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be 10 independently mono or di-substituted by C1 -2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is Cl-2 alkanoylamino, benzoylamino, Cl-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently 15 substituted by Cl-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is Cl-2 alkoxycarbonylamino, phenoxycarbonylamino, Cl-2 alkylcarbamoyloxy, phenylcarbamoyloxy, Cl-2 alkylsulfonylamino, phenylsulfonylamino, Cl-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be 20 independently mono or di-substituted by Cl-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; 25 R« is CI-3 alkyl, Cl-2 alkoxy, C3-6 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl^Cl-2 alkanoyl, aroyl, Cl-2alkanoyloxy, phenoxy, benzyloxy, Cl-2 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl 30 wherein the nitrogen atom may be independently mono or di-substituted by CI -2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is CI-2 alkanoylamino, benzoylamino, Cl-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur 5 atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is CI-2 alkoxycarbonylamino, phenoxycarbonylamino, CI-2 10 alkylcarbamoyloxy, phenylcarbamoyloxy, Cl-2 alkylsulfonylamino, phenylsulfonylamino, Cl-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-2 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, 15 or Re is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rf, Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide and 20 Ri and Ra of the formula (la) or Formula (lb) form a bicyclic ring having one 5-6 membered aromatic or nonaromatic heterocyclic ring fused to a phenyl ring; wherein each ring is optionally independently substituted by one or two R7. 25 In yet still a further embodiment of the invention, there are provided novel compounds of the formula (la) or formula (lb) as described immediately above, and wherein: 30 Het is piperidin-4-yl, piperidin-3-yI, pyrrolidin-3-yl, azetidin-3-yI, azepan-3-yl, azepan-4-yl or tetrahydropyran-4-yI, each ring being optionally substituted with one or more R5; Ri is a bond, methyl, ethyl, i-propyl, methoxy, cyclopropyl, cyclohexyl, phenoxy, phenyl, 5 benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, fiiranyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein R\ is optionally substituted by one or more R*; Ra is methyl, phenyl, thienyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, 10 methoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is acetylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl or phenyl, 15 or Ra is methoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, hydroxy, oxo, carboxy, cyano or carboxamide; 20 R3 is a bond, methyl, ethyl, n-propyl, propenyl, butenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, n-propyl, i-propyl, cyclohexyl, cyclopenryl, indanyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, 25 bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronaphthyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro, chloro or oxo; 30 R5 is a bond, hydrogen, carbonyl, Cl-4 alkyl, Cl-2alkoxyCl-2alkyl, Cl-2alkylaminoCl-2alkyl, Cl-2alkylthioCl-2alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, CI-2 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, 5 pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, acetyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyi, benzyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, 10 or R5 is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, 15 methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylarnino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more R«; 20 Re is methyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyi, carbamoyl wherein the nitrogen atom may be independently mono or di- 25 substituted by methyl, ethyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, 30 or R« is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylarnino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R« is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R<. may be further> 5 optionally substituted by one or more Rf; and Rf is methyl, phenyl, tolylsulfonyi, phenoxy, benzyloxy, fluoro, chloro or oxo; 10 Ri and Re of the formula (la) or Formula (lb) form the bicyclic ring ; wherein W is -S(0)„-, -O-C(O)- or -N-C(O)-, n is 0,1 or 2 and wherein 15 each ring is optionally independently substituted by one or two R7. In a further embodiment of the invention, there are provided novel compounds of the formulas (la) and (lb) as described immediately above, and wherein: 20 Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yli azetidin-3-yl or tetrahydropyran-4-yl, each ring being substituted with one or more R5; Ri is i-propyl, benzyloxy, cyclohexyl, phenyl, 4-(acetylamino)-phenyl, 4-25 (methanesulfonylamino)-phenyl, 4-methoxyphenyl, 3-phenoxyphenyl, 4-chlorophenyl, 4-fluorophenyl, 2-fluorophenyl, 2-fluoro-4-chlorophenyl, naphthyl, thienylmethyl, piperidinyl, morpholinyl, pyrrolidinyl, piperazinyl, furanyl, thienyl, S-chlorothienyl, pyridin-4-yl, pyrazinyl, methylamino, ethylamino, dimethylamino or diethylamino; R3 is ethyl, n-propyl,propenyl, butenyl, i-butenyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rcj 5 Re is methyl, cyclohexyl, cyclopentyl, indanyl, 1,2,3,4-tetrahydronaphthyl, methoxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro or chloro; Rs is a bond, carbonyl, methyl, ethyl, n-propyl, n-butyl, t-butyl, i-propyl, i-butyl, 10 cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, piperidinyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy, R5 may be further optionally substituted by one or more R«; 15 Re is methyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, thienyl, 5-methylthienyl, methoxy, phenoxy, benzyloxy, piperidinyl, pyridinyl, indolyl, l-(tolyl-sulfonyl)-indolyl, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, phenyl or benzyl, or Re is hydroxy, fluoro, chloro, oxo, dimethylamino or trifluoromethyl; 20 and n is 2. 25 In another embodiment of the invention, there are provided novel compounds of the formulas (la) and (lb) as described for the broadest generic aspect above and wherein: Ri and R« remain acyclic, Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more 5 Ri is a bond, CI-5 allcyl, CI-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more R„; 10 Ra is a bond, Cl-3 alkyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, Cl-3 alkoxy, Cl-3alkanoyl, Cl-3alkanoyloxy, aryloxy, benzyloxy, Cl-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom 15 may be independently mono or di-substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Rj is Cl-3 alkanoylamino, aroylamino, Cl-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be 20 independently substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is Cl-3 alkoxycarbonylamino, aryloxycarbonylamino, Cl-3 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-3 alkylsulfonylamino, arylsulfonylamino, Cl-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein 25 the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rt>; 30 Rb is methyl, ethyl, n-propyl, i-propyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, methoxy, ethoxy, n-propoxy, i-propoxy, phendxy, benzyloxy, fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R2 is hydrogen; 5 R3 is a bond, Cl-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is Cl-3 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, 10 bicyclo[2.2. ljheptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1 .OJheptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrimidinyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, Cl-3 alkoxy, phenoxy, naphthyloxy, CI-2 alkanoyl, benzoyl, CI-2 alkoxycarbonyl, 15 phenoxycarbonyl, Cl-2alkanoyloxy,'benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl or aryl, or Re is Cl-2 alkanoylamino, benzoylamino, Cl-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen 20 atom may be independently substituted by C1 -3 alkyl or aryl, or Re is Cl-2 alkoxycarbonylamino, phenoxycarbonylamino, Cl-2 alkylcarbamoyloxy, arylcarbamoyloxy, Cl-2 alkylsulfonylamino, phenylsulfonylamino, Cl-2alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 25 alkyl or phenyl, or Re is halogen, hydroxy, oxo, carboxy or cyano, Re may be further optionally substituted by one or more Raj Rd is methyl, cyclopropyl, cyclohexyl, phenyl, benzyl, methoxy, phenoxy, 30 benzyloxy, benzoyl, fluoro, chloro, oxo or cyano; R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, Cl-5 alkyl, Cl-5alkoxyCl-5alkyl, Cl-5alkylaminoCl-5alkyl, Cl-5alkylthioCl-5alkyl wherein the sulfur atom may be oxidized to a sulfoxide or 5 sulfone, Cl-5 alkoxy, phenoxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl-3alkanoyI, benzoyl, naphthoyl, 10 CI-3alkanoyloxy, benzyloxy, C1 -3 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Rs is CI-3 alkanoylamino, aroylamino, CI-3 alkylthio wherein the sulfur atom may be 15 oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, 20 or R5 is C1 -3 alkoxycarbonylamino, phenoxycarbonylamino, C1 -3 alkylcarbamoyloxy, phenylcarbamoyloxy, CI-3 alkylsulfonylamino, phenylsulfonylamino, CI-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, 25 pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, R5 may be further optionally substituted by one or more R«; R<. is cl-3 alkyl alkoxy c3-7 cycloalkyl phenyl naphthyl indanyl> 30 pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, terrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, CI-3 alkanoyl, aroyl, Cl-3alkanoyloxy, phenoxy, benzyloxy, Cl-3 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, 5 thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is Cl-3 alkanoylamino, benzoylamino, Cl-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Cl-3 alkyl, phenyl, pyrrolidinyl, 10 piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is Cl-3 alkoxycarbonylamino, phenoxycarbonylarnino, Cl-3 alkylcarbamoyloxy, phenylcarbamoyloxy, Cl-3 alkylsulfonylamino, phenylsulfonylamino, Cl-3 alkylaminosulfonyl, phenylaminosulfonyl, amino 15 wherein the nitrogen atom may be independently mono or di-substituted by C1 -3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R« is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, R« may be further 20 optionally substituted by one or more Rfj Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide; R«is 25 hydroxy, nitrile or a CI-5 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, or S(0)2 and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, one or more CI-4 alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, 30 piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, Unzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl or quinoxalinyl; and 5 X is O. In another embodiment of the invention, there are provided novel compounds of the formula (la) and (lb) as described immediately above, and wherein: 10 Ri is a bond, methyl, ethyl, i-propyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomoipholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl 15 or amino; wherein Ri is optionally substituted by one or more Raj Ra is a bond, methyl, ethyl, cyclopropyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, phenoxycarbonyl, benzoyloxy, 20 carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by methyl, ethyl or phenyl, or Ra is acetylamino, benzoylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, 25 or Ra is memoxycarbonylamuio, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylarninosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substiruted by methyl or phenyl, or Ra is fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or 30 carboxamide, R« may be further optionally substituted by one or more R}>; Rb is methyl, cyclopropyl, phenyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide; R3 is a bond, Cl-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl 5 wherein R3 is optionally substituted by one or more Rcj Re is methyl, ethyl, n-propyl, i-propyl, C5-6 cycloalkyl, indanyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1 .0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclofl.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, thienyl, oxazolyl, thiazolyl, indolyl, benzofuranyl, 10 benzothienyl, benzthiazolyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or aryl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be 15 oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or aryl, or Re is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, 20 methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro or oxo, Re may be further optionally substituted by one or more Rj; 25 Rd is methyl, cyclopropyl, phenyl, methoxy, fluoro, chloro or oxo; R5 is a bond, hydrogen, carbonyl, Cl-4 alkyl, Cl-4alkoxyCl-4alkyl, Cl-4alkylaminoCl-4alkyl, Cl-4alkylthioCl-4alkyl wherein the sulfur atom may be oxidized to a sulfoxide or 30 sulfone, Cl-4 alkoxy,phenoxy, cyclopropyl, cyclopentyl, cycldhexyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Cl-2alkanoyl, benzoyl, naphthoyl, Cl-2alkanoyloxy, benzyloxy, CI-2 alkoxycarbonyl, benzyloxycarbonyl, 5 phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by CI-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, tftiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is CI-2 alkanoylamino, benzoylamino, CI-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized 10 to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, orRs is CI-2 alkoxycarbonylamino, phenoxycarbonylamino, CI-2 alkylcarbamoyloxy, phenylcarbamoyloxy, CI-2 alkylsulfonylamino, phenylsulfonylamino, CI-2 15 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more R«; 20 R. is Cl-3 alkyl, Cl-2 alkoxy, C3-6 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, Cl-2 alkanoyl, aroyl, Cl-2alkanoyloxy, phenoxy, 25 benzyloxy, Cl-2 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Cl-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is Cl-2 alkanoylamino, Ijenzoylamino, Cl-2 alkylthio wherein the sulfur 30 atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by CI-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is CI-2 alkoxycarbonylamino, phenoxycarbonylamino, CI-2 5 alkylcarbamoyloxy, phenylcarbamoyloxy, CI-2 alkylsulfonylamino, phenylsulfonylamino, CI-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by CI-2 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, 10 or Re is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, R« may be further optionally substituted by one or more Rf; Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide and 15 Rais nitrile or a CI-5 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, or 20 S(0)2 and wherein said chain is optionally independently substituted with oxo, -NH2, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyridinyl, pyrimidinyl or pyrazinyl, 25 In yet another embodiment of the invention, there are provided novel compounds of the formula (la) or formula (lb) as described immediately above, and wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl, azepan-3-yl, azepan-4-yl or tetrahydropyran-4-yl, each ring being optionally substituted with one or more R5; 30 Ri is a bond, methyl, ethyl, i-propyl, methoxy, cyclopropyl, cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more R«; 5 Ra is methyl, phenyl, thienyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is acetylamino, methylthio, phenylthio wherein the sulfur atom may be 10 oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl or phenyl, or Ra is methoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, 15 or Ra is fluoro, chloro, hydroxy, oxo, carboxy, cyano or carboxamide; R3 is a bond, methyl, ethyl, n-propyl, propenyl, butenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rcj Re is methyl, ethyl, n-propyl, i-propyl, cyclohexyl, cyclopentyl, indanyl, 20 bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1 .OJheptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronaphthyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be 25 oxidized to a sulfoxide or sulfone, fluoro, chloro or oxo; and wherein the configuration at the stereocenter defined by R2 and R3 when they are different and the carbon they are attached to is defined as L; and 30 R5 is a bond, hydrogen, carbonyl, CI-4 alkyl, Cl-2alkoxyCl-2alkyl, Cl-2alkylaminoCl-2alkyl, Cl-2alkylthioCl-2alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, CI-2 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, 5 pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, acetyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, benzyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, 10 or R5 is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, 15 methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more R,,; 20 R« is methyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di- 25 substituted by methyl, ethyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, 30 or R« is methoxycarbonylamino, emoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R« may be further 5 optionally substituted by one or more Rfj Rf is methyl, phenyl, tolylsulfonyl, phenoxy, benzyloxy, fluoro, chloro or oxo; R«is nitrile or 10 a C1 -5 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, or S(0)2 and wherein said chain is optionally independently substituted with oxo, -NH2, morpholinyl or piperazinyl. 15 In yet still another embodiment of the invention, there are provided novel compounds of the formulas (la) and (lb) as described immediately above, and wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl or tetrahydropyran-4-yl, each ring being substituted with one or more R5; 20 Ri is i-propyl, benzyloxy, cyclohexyl, phenyl, 4-(acetylamino)-phenyl, 4-(methanesulfonylamino)-phenyl, 4-methoxyphenyl, 3-phenoxyphenyl, 4-chlorophenyl, 4-fluorophenyl, 2-fluorophenyI, 2-fluoro-4-chlorophenyl, naphthyl, thienylmethyl, piperidinyl, morpholinyl, pyrrolidinyl, piperazinyl, furanyl, thienyl, 5-chlorothienyl, 25 pyridin-4-yl, pyrazinyl, methylamino, ethylamino, dimethylamino or diethylamino; R3 is ethyl, n-propyl,propenyl, butenyl, i-butenyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more R«; Re is methyl, cyclohexyl, cyclopentyl, indanyl, 1,2,3,4-tetrahydronaphthyl, methoxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro or chloro; 5 Rs is a bond, carbonyl, methyl, ethyl, n-propyl, n-butyl, t-butyl, i-propyl, i-butyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, piperidinyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy, R5 may be further optionally substituted by one or more Re; 10 Re is methyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, thienyl, 5-methylthienyl, methoxy, phenoxy, benzyloxy, piperidinyl, pyridinyl, indolyl, l-(tolyl-sulfonyl)-indolyl, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, phenyl or benzyl, 15 or R« is hydroxy, fluoro, chloro, oxo, dimethylamino or trifluoromethyl; R$ is acetyl, Cl-3alkylaminocarbonyl orCl-3alkoxycarbonyl. 20 In yet a further embodiment of the invention, there are provided novel compounds of the formulas (la) and (lb) as described immediately above, and wherein: 25 Het is piperidin-4-yl or pyrrolidin-3-yl; Ri is morpholin-4-yl, p-fluorophenyl orp-methoxyphenyl; R5 is methyl, propyl, n-pentyl or cyclohexyl 30 and R6 is acetyl, ethylaminocarbonyl or ethoxycarbonyl. The activity of particular compounds disclosed herein against cathepsin K may be determined without undue experimentation by one of ordinary skill in the art in view of the art, the guidance provided throughout this specification and by the screens described in the section entitled "Assessment of Biological Properties." 5 The following subgeneric aspect of the compounds of the formulas (la) and (lb) is postulated to possess Cathepsin K activity: The broadest embodiment of the formula (la) and (lb) as described hereinabove and 10 wherein Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more R5; 15 Ri is a bond, CI-4 alkyl, CI-4 alkoxy, cyclopropyl, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, 20 benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more R„; Ra is methyl, ethyl, propyl, i-propyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, 25 imidazolyl, methoxy, ethoxy, acetyl, acetoxy, phenoxy, naphthyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, phenoxycarbonyl, naphthyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, 30 or Ra is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ethylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, 5 or Ra is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, CI-2 alkylcarbamoyloxy, phenylcarbamoyloxy, naphthylcarbamoyloxy, CI-2 alkylsulfonylamino, phenylsulfonylamino, naphthylsulfonylamino, CI-2 alkylaminosulfonyl, phenylaminosulfonyl, naphthylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl, 10 phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rj,; 15 Rb is methyl, ethyl, cyclopropyl, cyclohexyl, phenyl, methoxy, ethoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R2 is hydrogen or methyl; 20 R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more R«; 25 Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, naphthyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrimidinyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or 30 di-substituted by methyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl or phenyl, 5 or Re is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Re is chloro, fluoro, hydroxy, oxo, carboxy or cyano; 10 R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl or tetrahydrothiophenyl; 15 R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, Cl-5 alkyl, Cl-5alkoxyCl-5alkyl, Cl-5alkylaminoCl-5alkyl, Cl-5alkylthioCl-5alkyl wherein the sulfur atom may be oxidized to a sulfoxide or 20 sulfone, Cl-5 alkoxy, phenoxy, naphthyloxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, acetyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, benzyloxycarbonyl, 25 benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is acetylamino, benzoylamino, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, 30 or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, phenylsulfonylamino, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more R«; 5 Re is methyl ethyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, methoxy, ethoxy, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, carbamoyl wherein the nitrogen atom may be 10 independently mono or di-substituted by methyl, ethyl or phenyl, or R. is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, If or Rj is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, 20 or R- is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rf, Rf is methyl, phenyl, tolylsulfonyl, phenoxy, benzyloxy, fluoro, chloro or oxo. 25 Preferred cathepsin K inhibitors are those as described immediately above and wherein: Ri is a bond, methyl, ethyl, n-propyl, i-propyl, methoxy, ethoxy, benzyloxy, cyclopropyl, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, 30 morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Rj is optionally substituted by one or more Raj Ra is methyl, cyclopropyl, phenyl, halogen, hydroxy, oxo, carboxy, cyano, nitro or 5 carboxamide; R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-butenyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; 10 Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by methyl or phenyl, 15 or Re is acetylamino, benzoylamino, memylthio, methoxycarbonylamino, metfrylcarbamoyloxy, methylsulfonylamino, methylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, or Re is fluoro or oxo; 20 R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, pyrrolidinyl orpiperidinyl; 25 R5 is methyl, ethyl, n-propyl, n-butyl, n-pentyl, 2-pentyl, 3-pentyl, phenethyl, phenpropyl, 2,2-dimethylpropyl, t-butyl, i-propyl, i-butyl, cyclopropyl, cyclopentyl, cyclohexyl, cyclopropylmethyl, cyclopentylmethyl, cyclohexylmethyl, phenyl, benzyl, 2-methylbenzyl, 3-methylbenzyl, 4-methylbenzyl, 2,6-dimethylbenzyl, 2,5-dimethylbenzyl; 2,4-dimethylbenzyl, 2,3-dimethylbenzyl, 3,4-dimethylbenzyl, 3,5-dimethylbenzyi, 2,4,6- 30 trimethylbenzyl, 2-methoxybenzyl, 3-methoxybenzyl, 4-methoxybenzyl, 2-phenoxybenzyl, 3-phenoxybenzyl, 4-phenoxybenzyl, 2-benzyloxybenzyl,3- included in the present invention. Each stereogenic carbon may be in the R or S configuration unless otherwise specified, or a combination of configurations. Some of the compounds of formulas (I), (II), (la) and (lb) can exist in more than one 5 tautomeric form. The invention includes all such tautomers. It shall be understood by one of ordinary skill in the art that all compounds of the invention are those which are chemically stable. 10 The invention includes pharmaceutically acceptable derivatives of compounds of formula (I), (II), (la) and (lb). A "pharmaceutically acceptable derivative" refers to any pharmaceutically acceptable acid, salt or ester of a compound of this invention, or any other compound which, upon administration to a patient, is capable of providing (directly or indirectly) a compound of this invention, a pharmacologically active metabolite or 15 pharmacologically active residue thereof. In addition, the compounds of this invention include prodrugs of compounds of the formulas (I), (II), (la) and (lb). Prodrugs include those compounds that, upon simple transformation, are modified to produce the compounds of the invention. Simple 20 chemical transformations include hydrolysis, oxidation and reduction which occur enzymatically, metabolically or otherwise. Specifically, when a prodrug of this invention is administered to a patient, the prodrug may be transformed into a compound of formula (I), (H), (la) and (lb), thereby imparting the desired pharmacological effect. 25 In order that the invention herein described may be more fully understood, the following detailed description is set forth. As used herein, the following abbreviations are used: BOC or t-BOC is tertiary-butoxycarbonyl; t-Bu is tertiary-butyl; 30 DMF is dimethylformamide; EtOAc is ethyl acetate; THF is tetrahydrofuran; AT is argon; EDC is l-(3-dimethylaminopropyl)-3-ethylcarbodimide hydrochloride and HOBT is 1-hydroxybenzotriazole. 5 Also, as used herein, each of the following terms, used alone or in conjunction with other terms, are defined as follows (except where noted to the contrary): 10 The term "alky!" refers to a saturated aliphatic radical containing from one to ten carbon atoms or a mono- or polyunsaturated aliphatic hydrocarbon radical containing from two to twelve carbon atoms. The mono- or polyunsaturated aliphatic hydrocarbon radical containing at least one double or triple bond, respectively. "Alkyl" refers to both branched and unbranched alkyl groups. Examples of "alkyl" include alkyl groups which 15 are straight chain alkyl groups containing from one to eight carbon atoms and branched alkyl groups containing from three to eight carbon atoms. Other examples include lower alkyl groups which are straight chain alkyl groups containing from one to six carbon atoms and branched alkyl groups containing from three to six carbon atoms. It should be understood that any combination term using an "alk" or "alkyl" prefix refers to analogs 20 according to the above definition of "alkyl". For example, terms such as "alkoxy", "alkythio" refer to alkyl groups linked to a second group via an oxygen or sulfur atom. "Alkanoyl" refers to an alkyl group linked to a carbonyl group (C=0). Each alkyl or alkyl analog described herein shall be understood to be optionally partially or fully halogenated. 25 The term "cycloalkyl" refers to the cyclic analog of an alkyl group, as defined above. Examples of cycloalkyl groups are saturated or unsaturated nonaromatic cycloalkyl groups containing from three to eight carbon atoms, and other examples include cycloalkyl groups having three to six carbon atoms. Each cycloalkyl described herein 30 shall be understood to be optionally partially or fully halogenated. The term "aryl" refers to phenyl and naphthyl. The term "halo" refers to a halogen radical selected from fluoro, chloro, bromo or iodo. Representative halo groups of the invention are fluoro, chloro and bromo. 5 The term "heteroaryl" refers to a stable 5-8 membered (but preferably, 5 or 6 membered) monocyclic or 7-12 membered polycyclic, preferably bicyclic aromatic heterocycle radical. Each neterocycle consists of carbon atoms and from 1 to 4 heteroatoms chosen from nitrogen, oxygen and sulfur. The heterocycle may be attached by any atom of the cycle, which results in the creation of a stable structure. Examples of "heteroaryl" include 10 radicals such as furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, oxadiazolyl, triazolyl, tetrazolyl, thiadiazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, indolyl, isoindolyl, benzofuranyl, benzothienyl, indazolyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, purinyl, quinolizinyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazolinyl, 15 quinoxalinyl, naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl and phenoxazinyl, The term "heterocycle" refers to a stable 4-8 membered (but preferably, 5 or 6 membered) monocyclic or 7-12 membered polycyclic, preferably bicyclic heterocycle 20 radical which may be either saturated or unsaturated, and is non-aromatic. Each heterocycle consists of carbon atoms and from 1 to 4 heteroatoms chosen from nitrogen, oxygen and sulfur. The heterocycle may be attached by any atom of the cycle, which results in the creation of a stable structure. Examples of "heterocycle" include radicals such as pyrrolinyl, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, piperidinyl, morpholinyl, 25 thiomorpholinyl, pyranyl, thiopyranyl, piperazinyl, indolinyl, azetidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, hexahydropyrimidinyl, hexahydropyridazmyl, l,4,5,6-tetrahydropyrimidin-2-yIamine, dihydro-oxazolyl, 1,2-thiazinanyl-1,1 -dioxide, 1,2,6-thiadiazinanyl-1,1 -dioxide, isothiazolidinyl-1,1 -dioxide and imidazolidrayl-2,4-dione. 30 The terms "heterocycle", "heteroaryl" or "aryl", when associated with another moiety, unless otherwise specified shall have the same meaning as given above. For example, "aroyl" refers to phenyl or naphthyl linked to a carbonyl group (C=0). 5 Each aryl or heteroaryl unless otherwise specified includes it's partially or fully hydrogenated derivative. For example, quinolinyl may include decahydroquinolinyl and tetrahydroquinolinyl, naphthyl may include it's hydrogenated derivatives such as tetrahydranaphthyl. Other partially or fully hydrogenated derivatives of the aryl and heteroaryl compounds described herein will be apparent to one of ordinary skill in the art. 10 The term heterocycle as it pertains to "Het" shall to be understood to mean a stable non-aromatic spiroheterocycle, 4-8 membered (but preferably, 5 or 6 membered) monocyclic, 7-12 membered polycyclic, preferably bicyclic heterocycle radical which may be either saturated or unsaturated or a C6-C10 bridged bicyclo wherein one or more carbon atoms 15 are optionally replaced by a heteroatom. Each heterocycle consists of carbon atoms and from 1 to 4 heteroatoms chosen from nitrogen, oxygen and sulfur. The heterocycle may be attached by any atom of the cycle, which results in the creation of a stable structure. Examples of "Het" include the following heterocycles: azepanyl, piperidinyl, pyrrolidinyl, azetidinyl, oxepanyl, terrahydropyranyl, tetrahydrothiopyranyl, 20 tetrahydrofuranyl, oxetanyl, azocanyl, oxocanyl, 1,3-diazocanyl, 1,4-diazocanyl, 1,5-diazocanyl, 1,3-dioxocanyl, 1,4-dioxocanyl, 1,5-dioxocanyl, 1,3-oxazocanyl, 1,4-oxazocanyl, 1,5-oxazocanyl, 1,3-diazepanyl, 1,4-diazepanyl, 1,3-dioxepanyl, 1,4-dioxepanyl, 1,3-oxazepanyl, 1,4-oxazepanyl, 1,2-thiazocanyl-1,1 -dioxide, 1,2,8-thiadiazocanyl-1,1 -dioxide, 1,2-thiazepanyl-1,1 -dioxide, 1,2,7-thiadiazepanyl-1,1- 25 dioxide, tetrahydrothiophenyl, hexahydropyrimidinyl, hexahydropyridazinyl, piperazinyl, 1,4,5,6-tetrahyoYopyrimidinyl, pyrazolidinyl, dihydro-oxazolyl, dihydrothiazolyl, dihydroimidazolyl, isoxazolinyl, oxazolidinyl, 1,2-thiazinany 1-1,1-dioxide, 1,2,6-thiadiazinanyl-1,1-dioxide, isothiazolidinyl-l,l-dioxide, imidazolidinyl-2,4-dione, imidazolidinyl, morpholinyl, dioxanyl, tetrahydropyridinyl, thiomorpholinyl, 30 thiazolidinyl, dihydropyranyl, dithianyl, decahydro-quinolinyl, decahydro-isoquinolinyl, 1,2,3,4-tetrahydro-quinolinyl, indolinyl, octahydro-quinolizinyl, dihydro-indolizinyl, octahydro-indolizinyl, octahydro-indolyl, decahydroquinazolinyl, decahydroquinoxalinyl, 1,2,3,4-tetrahydroquinazoIinyl or 1,2,3,4-tetrahydroquinoxalinyl, aza-bicydo[3.2.1]octane, aza-bicyclo[2.2.1]heptane, aza-bicydo[2.2.2Joctane, aza-bicyclo[3.2.2]nonane, aza-bicyclo[2.1.1]hexane, aza-bicyclo[3.1.1]heptane, aza~ 5 bicyclo[3.3.2]decane and 2-oxa or 2-thia-5-aza-bicyclo[2.2. l]heptan eeach heterocyclic ring being substituted with one or more R5. The substituent R5 is defined above. As used herein above and throughout this application, "nitrogen" and "sulfur" include any oxidized form of nitrogen and sulfur and the quateraized form of any basic nitrogen. 10 In order that this invention be more fully understood, the following examples are set forth. These examples are for the purpose of illustrating preferred embodiments of this invention, and are not to be construed as limiting the scope of the invention in any way. 15 The examples which follow are illustrative and, as recognized by one skilled in the art, particular reagents or conditions could be modified as needed for individual compounds. Starting materials used in the scheme below are either commercially available or easily prepared from commercially available materials by those skilled in the art. 20 GENERAL SYNTHETIC METHODS The invention also provides processes of making the present novel compounds. Compounds of the invention may be prepared by methods described below. Standard peptide coupling, protection and deprotection reactions (see for example M. Bodanszky, 25 1984, The Practice of Peptide Synthesis, Springer-Verlag) are employed in these syntheses and are incorporated herein by reference in their entirety. COMPOUNDS OF THE FORMULAS (I) AND (II): 30 Compounds of the invention having formulas (I) and (II) may be prepared by Method A as illustrated in Scheme I. Scheme I (Method A) 5 According to Method A a suitably protected amino acid bearing "Het" is allowed to react with ammonia under standard coupling conditions. An example of a suitable protecting group is the f-butoxycarbonyl (BOC) group. An example of standard coupling conditions would be combining the starting materials in the presence of a coupling reagent such as 10 l-(3-dimemylammopropyl)-3^mylcarbodiimide(EDC) with 1-hydroxybenzotriazole / (HOBT), in a suitable solvent such as DMF or methylene chloride. A base such as N- / methylmorpholine may be added. This is followed by deprotection to give amino acid amide DI. An amino acid ester (IV) bearing R2, R3 and optionally R4 other than H is then reacted with an activated acid [R|C(0)L] such as acid chloride (L = Cl) in the presence of a suitable base such as N,N-diisopropylethylamine to provide V. Alternately, one may 5 use the carboxylic acid [R]C(0)L, L = OH] and activate using standard peptide coupling conditions, such as EDC and HOBT as described above. If R4 is H in V, one may optionally react V with an alkyl halide in the presence of a suitable base such as sodium hydride, in a suitable solvent such as DMF or THF to provide V in which R4 is alkyl Conversion to the carboxylic acid provides VI. Standard peptide coupling of III and VI, 10 followed by dehydration of the amide provides the desired nitrile I or II. An example of suitable dehydration conditions is cyanuric chloride in DMF. In a variation (Method B) illustrated in Scheme II, an amino acid amide bearing "Het" is coupled with an amine-protected amino acid bearing R2 and R3. A suitable protecting 15 group and coupling conditions would be as described above. Deprotection is then followed by reaction with RiC(0)L (as described in Method A). Conversion of the amide to the nitrile as above provides I or II. Scheme II (Method B) 20 / Compounds of the invention having formula (I) and (II) may also be prepared by Method 5 C as illustrated in Scheme HI. Scheme HI (Method C) 10 In this variation (Method C) an amino nitrile bearing "Het" is coupled with an amine protected amino acid bearing R2 and R3. A suitable protecting group and coupling conditions are described above. Deprotection is then followed by reaction with RiC(0)L as described above to furnish the nitrile (I/II). Compounds of the invention having formulas (I) and (II) may also be prepared by as 5 outlined below in Scheme IV (Method D). Scheme IV (Method D) 10 In a further variation (Method D) illustrated in Scheme IV, an amino acid ester (IV) bearing R2, R3 and optionally R4 other than H is reacted with RjC(0)L as described in Method A. Conversion to the carboxylic acid provides VI. Standard peptide coupling of 15 an amino nitrile bearing "Het" with VI yields the desired nitrile (I/II). The intermediate aminonitrile used in Methods C, and D above may be prepared as outlined in Scheme V 20 Scheme V In this method, a ketone bearing "Het" is reacted with an a primary amine or an ammonium salt, such as ammonium chloride, and a cyanide salt, such as potassium 5 cyanide or sodium cyanide, in a suitable solvent, such as water or a solution of ammonia in methanol, at about room temperature to reflux temperature. In each of the methods described above, required starting materials are either commercially available or easily prepared by those skilled in the art, for example see: 10 Leung, M.-k.; Lai, J.-L.; Lau, K.-H.-; Yu, H.-h.; Hsiao, J.-J. J. Org. Chem. 1996, 61, 4175-4179. Mee, J. D. J. Org. Chem. 1975,40,2135-2136. Micovic, I. V.; Roglic, G. M.; Ivanovic, M. D.; Dosen-Micovic, L.; Kiricojevic, V. D.; Popovic, J. B. J. Chem. Soc, Perkin Trans. 1,1996,2041-2050. 15 Tornus, L; Schaumann, E. Tetrahedron 1996,52,725-732. Jadhav, P. K.; Woerner, F. J. Tetrahedron Letters 1995,36,6383-6386. Kochhar, K. S.; et al. Tetrahedron Letters 1984,25,1871-1874. Fordon, K. J.; Crane, C. G.; Burrows, C. J. Tetrahedron Letters 1994, 35,6215-6216. These references are incorporated herein by reference in 20 their entirety, roMPornvns OF THE FORMULAS rial AND m>v. The invention also provides processes of making the present novel compounds of formula 25 (la) and (lb). Compounds of the invention may be prepared by methods described below. A key intermediate in the preparation of compounds of formula (la) and (lb) is the 5 dipeptide nitrile intermediate (VII). 10 The synthesis of intermediates of formula (VII) is described in US provisional patent application no. 60/153,738 and outlined below in Schemes VI and VII. Scheme VI 15 As illustrated in Scheme VI, an amino acid bearing a suitable protecting group R' (VIII), is reacted with an amino nitrile (IX) under suitable coupling conditions. An example of a suitable protecting group is the f-butoxycarbonyl (BOC) group. An example of standard coupling conditions would be combining the starting materials in the presence of a 5 coupling reagent such as l-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) with 1-hydroxybenzotriazole (HOBT), in a suitable solvent such as DMF or methylene chloride. A base such as N-methylmorpholine may be added. This is followed by deprotection to give amino acid nitrile VII. 10 The intermediate aminonitrile (IX) used in Scheme VI above may be prepared as outlined in Scheme VII. Scheme VII 15 In this method, a ketone bearing "Het" (XI) is reacted with an a primary amine or an ammonium salt, such as ammonium chloride, and a cyanide salt, such as potassium cyanide or sodium cyanide, in a suitable solvent, such as water or a solution of ammonia in methanol, at about room temperature to reflux temperature. 20 Compounds having formula (la/lb) may be prepared by Methods E-H, as illustrated in Schemes VHI-DC. 25 Scheme VII (Method E) According to Method E, a dipeptide nitrile intermediate (VII), or a basic salt thereof, is allowed to react with (XII) in the presence of a suitable coupling agent to provide the desired product (la/lb). Suitable reaction conditions are 5 known to those skilled in the art and some examples of suitable coupling agents include 2-chloro-l-methylpyridinium iodide (Yong, Y.F. et al., J. Org. Chem. 1997, 62,1540), phosgene or triphosgene (Barton, D.H. et al., J. Chem. Soc. Perkin Trans. 1,1982,2085), alkyl halides (Brand, E. and Brand, F. C, Org. Synth., 1955,3,440) carbodiimides (Poss, M. A. et al., 10 Tetrahedron Lett., 1992,40, 5933) and mercury salts (Su, W., Synthetic Comm., 1996,26,407 and Wiggall, K. J. and Richardson, S. K. J., Heterocyclic Chem., 1995,32,867). Compounds having formulas (la) and (lb) may also be prepared by Method 15 B as illustrated in Scheme IV, where R is an alkyl or aryl group. Scheme VTfl (Method F) 20 According to Method F a dipeptide nitrile intermediate (VII), or a basic salt thereof, is allowed to react with XII, with or without an added base such as triethylamine, to provide the desired product (la/lb). Suitable reaction conditions are known to those skilled in the art and examples of such amine additions may be found in the chemical literature, for 25 example Haake, M. and Schummelfeder, B., Synthesis, 1991,9, 753; Dauwe, C. and Buddrus, J., Synthesis 1995,2,171; Ried, W. and Piechaczek, D., Justus Liebigs Ann. Chem. 1966,97, 696 and Dean, W. D. and Papadopoulos, E. P., J. Heterocyclic Chem., 1982,19,1117. The intermediate XII is either commercially available or can be synthesized by methods known to those skilled in the art and described in the literature, for example Francesconi, I. et at, J. Med. Chem. 1999,42,2260; Kurzer, F., Lawson, A.,Org. Synth. 1963, 645, 5 and Gutman, A. D. US 3984410,1976. In a similar reaction, intermediate XIV having a halogen or other suitable leaving group (X) may be used in place of intermediate XIII, as illustrated in Method G, Scheme IX.: 10 Scheme IX (Method G) According to Method G, a dipeptide nitrile intermediate, or a basic salt thereof, is allowed 15 to react with intermediate XIV, with or without an added base such as triethylamine, to provide the desired product (la/lb). Procedures for accomplishing this reaction are known to those skilled in the art and described in the chemical literature (for example, Dunn, A. D., Org. Prep. Proceed. Int., 1998,30,709; Lindstroem, S. et al., Heterocycles, 1994,38,529; Katritzky, A. R. and Saczewski, F., Synthesis, 1990, 561; Hontz, A. C. 20 and Wagner, E. C, Org Synth., 1963, IV, 383; Stephen, E. and Stephen, H., J. Chem. Soc., 1957,490). Compounds having formula (la/lb) in which Ri is an amine may also be prepared by 25 Method H as illustrated in Scheme X. Scheme X (Method H) According to Method H, a carbodiimide (XV) derivative of (VII) is allowed to react with an amine (Rj) to provide the desired guanidine (la/lb) product. The conversion of amines 5 to carbodiimides is known to those in the art and described in the literature (for example, Pri-Bar, I. and Schwartz, J., J. Chem. Soc. Chem. Commun., 1997,347; Hirao, T. and Saegusa, T., J. Org. Chem., 1975,40,298). The reaction of carbodiimides with amine nucleophiles is also described in the literature (for example, Yoshiizumi, K. et al., Chem. Pharm. Bull, 1997,45,2005; Thomas, E. W. et al., J. Med. Chem., 1989, 32,228; 10 Lawson, A. and Tinkler, R. B., J. Chem. Soc. C, 1971,1429. In a modification of Method H, one may start with the thiourea XVI (formed by reaction of the corresponding amine with an isothiocyanate ReN=C=S) and then form the corresponding carbodiimide (XV) in situ by reaction with a suitable desulfurizing agent, 15 such as HgCb, in a suitable solvent such as DMF or acetonitrile. Compounds of formula (lb), where Rj is an amine may be prepared using a general 20 procedure described by M. Haake and B. Schurnmfelder (Synthesis, 1991,753). According to this procedure (Method I, Scheme XT), intermediate XVII bearing two suitable leaving groups Z, such as phenoxy groups, is reacted sequentially with amines Ri and ReRgNH in a suitable solvent such as methanol or isopropanol to provide the desired product. Reaction of the first amine may be carried out at about room temperature and reaction of the second amine is preferentially carried out with heating at the reflux temperature of the solvent. If XIII is allowed to react with a bifunctional nucleophile intermediate XVIII, where Y is a nucleophilic heteroatom such as N, O or S, one may 5 obtain the product of formula (lb) where R\ and R$ form a heterocyclic ring. Intermediate XVII may be prepared by reaction of VII (R4 = H) with dichlorodiphenoxymethane, which in turn, may be prepared by heating diphenyl carbonate with PC15 (R-L. Webb and C.S. Labow, J. Het. Chem., 1982, 1205). 10 Scheme XI (Method I) 15 In order that this invention be more fully understood, the following examples are set forth. These examples are for the purpose of illustrating embodiments of this invention, and are not to be construed as limiting the scope of the invention in any way. The examples which follow are illustrative and, as recognized by one skilled in the art, 20 particular reagents or conditions could be modified as needed for individual compounds. Starting materials used in the scheme below are either commercially available or easily prepared from commercially available materials by those skilled in the art. 5 SYNTHETIC EXAMPLES EXAMPLE 1 Morpholine-4-carboxylic acid rW4-cyano-l-methyI-piperidin-4-vlcarbamoylV2-10 cyclohexvl-ethyll-amide (a) 4-Amino-4-cyano-l-methyIpiperidine. A solution of ammonium chloride (1.89 g, 35.37mmol) and potassium cyanide (2.30 g, 15 35.37 mmol) was prepared in 50 mL of water. l-Methyl-4-piperidone (1.0 g, 8.84 mmol) was added to the solution and stirred for 2 days. The solution was brought to pH 11 with solid sodium carbonate and the reaction solution was extracted 3 x 100 mL of EtOAc. The organic layer was dried over anhydrous Na2S04, decanted and concentrated to an orange oil (857 mg). 'H NMR showed that the oil was a 2:1:1 mixture of the desired 20 aminonitrile, cyanohydrin and starting ketone. The crude mixture was used in the next step without further purification. (b) N-(4-morpholinecarbonyl)-L-cyclohexyl alanine methyl ester. 25 Methyl L-p-cyclohexylalanine hydrochloride (1.45 g, 6.54 mmol) was dissolved in 20 mL of DMF and 10 mL of Hunig's base was added to give a clear colorless solution. 4-Morpholinecarbonyl chloride (1.17 g, 7.85 mmol) was added and the resulting reaction was stirred at ambient temperature for 6 h. The reaction mix was concentrated in vacuo and the residue was taken up in 200 mL of CH2CI2 and washed with 1x100 mL of EtOAc 30 and 2x100 mL of brine. The organic layer was dried over Na2S04, decanted, and concentrated to a semi-solid (1.86 g) which was used in the next step without further purification. (c) N-(4-morpholinecarbonyl)-L-cyclohexyl alanine N-(4-Morpholinecarbonyl)-L-cyclohexyl alanine methyl ester (1.86 g, 6.23 mmol) was dissolved in 50 mL of MeOH to which was added 50 mL THF and 50 mL of water. LiOH monohydrate (2.61 g, 62.3 mmol) was added to the reaction solution andthe 5 reaction was monitored at 5 min and every 20 min thereafter using 5% MeOH in CH2CI2. The starting material was consumed at 2 h and the reaction was washed with 150 mL of diethyl ether with the organic layer being discarded. The aqueous layer was brought to pH 1 with concentrated HC1 and the product was extracted with 2x100 mL of EtOAc. The combined organic layers were dried overNa2SC>4, decanted and concentrated to 10 white solid foam (1.63 g): !H NMR (CDC13) 8 8.90-7.90 (br, 1H), 5.05-4.99 (m, 1H), 4.55-4.39 (m, 1H), 3.71-3.62 (m, 4H), 3.50-3.36 (m, 4H), 1.90-0.83 (m, 13H). (d) Morpholine-4-carboxylic acid [l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylJ-amide 15 N-(4-Morpholinecarbonyl)-L-cycIohexyl alanine (350 mg, 1.23 mmol) was dissolved in 15 mL of DMF. EDC (235 mg, 1.23 mmol) and HOBT (166 mg, 1.23 mmol) were added and the resulting mixture was stirred at ambient temperature for 20 min during which time the solids went into solution. 4-Amino-4-cyano-l-methylpiperidine (310 mg of the 20 2:1:1 mixture of aminonitrile:cyanohydrin:ketone, £ 1.1 mmol aminonitrile) was dissolved in 5 mL of DMF, N-methylmorpholine was added to this solution (497 mgs, 4.92 mmol), and the resultant solution added to the solution of the activated ester. The resulting mixture was stirred at ambient temperature for 16 h. The volatiles were removed in vacuo and the resulting residue was dissolved in 200 mL of EtOAc and 25 washed sequentially with 2x200 mL saturated sodium bicarbonate and 1x100 mL brine. The organic layer was dried over anhydrous Na2S04, decanted, and concentrated to a thick oil. The oil was purified by column chromatagraphy on Si02 using as eluent 100% CH2CI2 to 12% MeOH in CH2C12 to give the desired product as a white powder (225 mg): !H NMR (CDCl3) 5 7.55 (s, 1H), 5.13-5.08 (m, 1H), 4.40-4.20 (m, 1H), 3.77-3.62 30 (m, 4H), 3.51-3.33 (m, 4H), 2.88-2.55 (m, 2H), 2.53-2.39 (m, 2H), 2.30 (s, 3H), 2.10-0.83 (m, 17H). Following the above procedures the following compounds can be synthesised; Morpholine-4-carboxylic acid [ l-(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-5 naphthalen-2-yl-ethyl]-amide Morpholine-4-carboxylie acid [2~(3 -chloro-phenyl)-1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl) -ethyl]-amide 10 Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-(3,4-dichloro-phenyl) -ethyl]-amide Morpholine-4-carboxylicacid[2-(4-chloro-phenyl)-l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl) -ethyl]-amide 15 Morpholine-4-carboxylic acid [1 -(4-cyano- l-metbyl-piperidin-4-ylcarbamoyl) -pentyl]- amide Morpholine-4-carboxylic acid [1-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl) -3-20 methyl-butyl]-amide Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -phenyl-2,6-dioxo-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide 25 Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -pheny l-2,6-dioxo-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide Moipholine-4-carboxylicacid[l-(4-cyano-2-oxo-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide 30 MorphoIine-4-carboxylicacid[l-(4-cyanc^2-oxo-piperidui-4-yIcarbamoyI)-3,3-dimethyI-butyl]-amide Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -methy l-2-oxo-piperidin-4-y Icarbamoy l)-2-cyclohexyl-ethylj-amide 5 Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -methyl-2-oxo-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide Morpholine-4-carboxylic acid [ 1 -(5-cyano-1,1 -dioxo-1 X6-[ 1,2]thiazinan-5-ylcarbamoyl)-2-cyclohexyl-ethyl3-amide 10 Morpholine-4-carboxylic acid [ 1 -(5-cyano-1,1 -dioxo-1 X6~[ 1,2]thiazinan-5-ylcarbamoyl)-3,3-dimethyl-butyI]-amide Morpholine-4-carboxylic acid [ 1 -(5-cyano-2-methyl-1,1 -dioxo-1 X,6-[ 1,2]thiazinan-5-15 y lcarbamoyl)-2-cyclohexyl-ethy l]-amide Morpholine-4-carboxylic acid [ 1 -(5-cyano-2-methyl-1,1 -dioxo-1 X.6-[ 1,2] thiazinan-5-ylcarbaraoyl)-3,3-dimethyl-butyl]-amide 20 Moipholine-4-carboxylic acid [l-(5-cyano-2-oxo-hexahydro-pyrimidin-5-ylcarbamoyl)-3,3-dimethyl-butyI]-amide Morpholine-4-carboxylic acid [1 -(5-cyano-1,3-dimethyl-2-oxo-hexahydro-pyrimidin-5-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide 25 Morpholine-4-carboxylic acid [1-(4-cyano-1,1-dioxo-1X.6-[1,2,6]thiadiazinan-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide Morpholine-4-carboxylic acid [l-(4-cyano-2,6-dimethyl-1,1 -dioxo- IX6-30 [1,2,61thiadiazinan-4-yIcarbamoyI)-2-cyclohexyl-ethyl]-amide Morpholine-4-carboxylic acid [ 1 -(3-cyano-5-oxo-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide Morpholine-4-carboxylic acid [ 1 -(3-cyano 1 -methyl-5-oxo-pyrrolidin-3-ylcarbamoyl)-2-5 cyclohexyl-ethylj-amide Morpholine-4-carboxylicacid,[l-(3-cyano-5-oxo-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide 10 Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -methyl-5-oxo-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide 15 EXAMPLE 2 Morpholine-4-carboxylic acid fl-(4-cyano-tetrahydro-pyran-4-ylcarbamoyI)-2-cyclohexvl-ethy^-amide. 20 (a) 4-Amino-4-cyano-tetrahydropyran. A solution of ammonium chloride (2.12 g, 39.57mmol) and potassium cyanide (2.58 g, 39.57 mmol) was prepared in 50 mL of water. Tetrahydropyran-4-one (1.0 g, 9.89 mmol) was added to the solution and stirring was continued for 2 days. The solution was 25 brought to pH 11 with solid sodium carbonate and the reaction solution was extracted 3 x 100 mL of EtOAc. The organic layer was dried over anhydrous Na2SC>4, decanted, and concentrated to an clear oil (1.02 g). JH NMR showed that the oil was a 7 to 1 mixture of the desired aminonitrile and cyanohydrin. The crude mixture was used in the next step without further purification. 30 (b) Morpholine-4-carboxylic acid [l-(4-cyano-tetrahydro-pyran-4-ylcarbamoyI)-2-cycIohexyl-ethyI]-amide. N-(4-morpholinecarbonyl)-L-cyclohexyl alanine (350 mg, 1.23 mmol) was dissolved in 15 mL of DMF. EDC (235 mg, 1.23 mmol) and HOBT (166 mg, 1.23 mmol) were added and the resulting mixture was stirred at ambient temperature for 20 min during which time the solids went into solution. 4-Amino-4-cyano-tetrahydropyran (161 mg of the 7:1 5 mixture of aminonitrile, =1.1 mmol aminonitrile) was dissolved in 5 mL of DMF, N-methylmorpholine was added to this solution (497 mgs, 4.92 mmol), and the resultatnt solution added to the solution of the active ester. The resulting mixture was stirred at ambient temperature for 16 h. The volatiles were removed in vacuo and the resulting residue was vigorously stirred for 30 min with 100 mL of a 1 to 1 mixture of water and 10 saturated sodium bicarbonate to give a fluffy white solid that was collected by filtration. The solid was washed with 3x50 mL of water and dried to give the desired product (210 mg): lH NMR (CDC13) 5 7.80 (s, 1H), 5.25-5.15 (m, 1H), 4.41-20 (m, 1H), 3.97-3.62 (m, 8H), 3.50-3.41 (m, 4H), 2.50-2.37 (in 1H), 2.35-2.20 (m, 1H), 2.05-1.88 (m, 2H), 1.79-0.75 (m, 13H). 15 EXAMPLE 3 4-ryano-4-l3-cvdoheyyl-2-f(niorpho1ine-4-carbony1Vamino)-propionylainino)-piperidine-1-carhoxylic acid ethvl ester 20 (a) 4-Amino-4-cyano-piperidine-l-carboxyIic acid ethyl ester. A solution of ammonium chloride (31 g, 584 mmol) and potassium cyanide (7.61 g, 116.8 mmol) was prepared in 250 mL of water. l-(Ethoxycarbonyl)-4-piperidone (10 g, 25 58.4 mmol) was added to the solution followed by 50 mL of MeOH and stirring was continued for 3 days. The solution was brought to pH 11 with solid sodium carbonate (20g) and the reaction solution was extracted with 3 x 250 mL of EtOAc. The organic layers were combined, dried over Na2S04, decanted and concentrated to an thick oil. The oil was triturated with 500 mL ofhexane and the resulting solid was collected by 30 filtration (8.3g). !H NMR showed that the product was better than 95% pure. (b) 4-Cyano-4-{3-cyclohexyI-2-[(morphoIine-4-carbonyl)-amino]-propionyIamino}-piperidine-l-carboxylic acid ethyl ester N-(4-morpholinecarbonyl)-L-cyclohexyI alanine (555 mg, 1.95 mmol) was dissolved in 5 15 mL of DMF. EDC (373 mg, 1.95 mmol) and HOBt (264 mg, 1.95 mmol) were added and the resulting mixture was stirred at ambient temperature for 20 min during which time the solids went into solution. 4-Amino-4-cyano-piperidine-l-carboxylic acid ethyl ester (350 mg, 1.77 mmol) was dissolved in 5 mL of DMF and added to the solution of the active ester followed by addition of 2 mL of N-methyhnorpholine. The resulting ] 0 mixture was stirred at ambient temperature for 16 h. The volatiles were removed in vacuo and the resulting residue was dissolved in 200 mL of EtOAc and washed sequentially with 2x200 mL saturated sodium bicarbonate, 1x100 mL brine. The organic layer was dried oyer Na2S04, decanted, and concentrated to a white solid. The solid was purified by column chromatagraphy on Si02 using as eluent 100% CH2CI2 to 5% MeOH 15 in CH2C12 to give the title compound as a white powder (51 lmg): m.p. 140-143 °C. EXAMPLE 4 Morpholine-4-carboxvlic acid [W4-cyano-1-phenethvl-piperidin-4-vlcarbamoylV-2-20 cyclohexyl-ethylj-amide (a) 4-Amino-4-cyano-l-phenethylpiperidine was prepared according to the procedure from Example 1, step a, starting with l-phenylethyl-4-piperidone. 25 (b) The title compound was prepared starting from N-(4-Morpholinecarbonyl)-L-cyclohexyl alanine and 4-amino-4-cyano-l-phenethylpiperidine according to the procedure from Example 2, step b, except that the compound was purified by HPLC using a 20 x 250 mm Cis reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 496 = M+l. 30 EXAMPLE 5 Morpholine-4-carboxylic acid fl-fl-benzyl-4-cyano-piperidin-4-ylcarbamoyIV2-cvclohexvl-ethylj-amide 5 (a) 4-Amino-4-cyano-1 -benzylpiperidine was prepared according to the procedure from Example 1, step a, starting with l-benzyl-4-piperidone (b) The title compound was prepared starting from N-(4-Morpholinecarbonyl)-L- 10 cyclohexyl alanine and 4-amino-4-cyano-l -benzylpiperidine according to the procedure from Example 2, step b, except that the compound was purified by HPLC using a 20 x 250 mm Cls reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 482 = M+l. 15 EXAMPLE 6 MorphoIine-4-carboxvIic acid [l-(4-cyann-1 -propyl-piperidin-4-vlcarbamoyn-2-cyclohexvl-ethyl]-amide 20 (a) 4-Amino-4-cyano-1 -propylpiperidine was prepared according to the procedure from Example 1, step a, starting with l-propyl-4-piperidone. (b) The title compound was prepared starting from N-(4-Morpholinecarbonyl)-L-cyclohexyl alanine and 4-amino-4-cyano-l-propylpiperidine according to the procedure 25 from Example 2, step b, except that the compound was purified by HPLC using a 20 x 250 ram C18 reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 434 - M+l. EXAMPLE 7 30 4-Cyano-4-{3-cyclohexvl-2-ffmorpholine-4-carbonyn-ainino]-propionvlamino}-piperidiqe-1-carboxylic acid benzyl ester (a) A solution of sodium cyanide (1052 mg, 21.5 mmol), ammonium chloride (1265 5 mg, 23.65 mmol), and benzyl 4-oxo-l-piperidine-carboxylate (5.0 gm, 21.5 mmol), was prepared in 5 M ammonia in methanol (8.6 mL, 43 mmol). The solution was brought to reflux for 4 h and then allowed to cool to room temperature. The solution was then filtered and washed with methanol (100 mL) and the filtrate was concentrated in vacuo. The resulting oil was taken up in MTBE (250 mL) and filtered again. The filter cake was 10 washed with MTBE (100 mL) and the filtrate was concentrated in vacuo to yield 4- amino-4-cyano-piperidine-l-carboxylic acid benzyl ester as a clear oil (3.5 g) which was used without further purification. (b) The title compound was prepared starting from N-(4-Morpholinecarbonyl)-L- 15 cyclohexyl alanine and 4-amino-4-cyano-piperidine-l-carboxylic acid benzyl ester according to the procedure from Example 2, step b, except that the compound was purified by HPLC using a 20 x 250 mm Ci8 reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 526 = M+l. 20 EXAMPLE 8 Morpholine-4-carboxyIic acid fl-f4-cvano-tetrahydro-thiopyran-4-yIcarbamoylV2-cyclohexyl-ethyll-amide 25 (a) 4-Amino-tetrahydro-thiopyran-4-carbonitrile was prepared according to the procedure from Example 7, step a, starting from tetrahydrothiopyran-4-one. (b) The title compound was prepared starting from N-(4-Morpholinecarbonyl)-L-cyclohexyl alanine and 4-aniino-4-cyano-tetrahydrothiopyrane according to the procedure 30 from Example 2, step b, except that the compound was purified by reverse phase HPLC "using a 20 x 250 mm Cjg reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 409 = M+l. EXAMPLE 9 5 Morpholine-4-carboxvlic aqd [l-(4-cyano-l-pyrimidin-2-yl-piperidin-4-vlcarbamovn-2-cvcloheYvWthvl]-amide (a) 4-Amino-4-cyano-1 -pyrimidin-2-yl-piperidine was prepared according to the 10 procedure from Example 7, step a, starting with l-(pyrirnidin-2-yl)-4-piperidone with the exception that a 2 M ammonia in methanol solution replaced the 5 M ammonia in methanol solution. (b) The title compound was prepared starting from N-(4-Morpholinecarbonyl)-L- 15 cyclohexyl alanine and 4-amino-4-cyano-1 -pyrimidin-2-yl-piperidine according to the procedure from Example 2, step b, except that the compound was purified by HPLC using a 20 x 250 mm Cig reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 469 = M+l. 20 EXAMPLE 10 MorphoIine-4-carhoxvlie acid [1 -f4-cvano-2.6-diphenyl-piperldin-4-vlcarhamovn-2-cyclohexvl-ethyll-amide 25 (a) 4-Arnmo-4-cyano-2,6-diphenyl-piperidine was prepared according to the procedure from Example 9, step a, starting from 2,6-diphenyl-4-piperidone. (b) The title compound was prepared starting from N-(4-MorpholinecarbonyI)-L-cyclohexyl alanine and 4-amino-4-cyano-2,6-diphenyI-piperidine according to the 30 procedure from Example 2, step b, except that the compound was purified by HPLC using a 20 x 250 mm Cu reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 544 = M+l. EXAMPLE 11 5 Morpholine-4-carboxylic acid [l-(4-cyano-2.6-diphenyl-piperidin-4-ylcarbamoylV 3,3-dimetby]-bqty|)-amide (a) 2-Amino-4,4-dimethyl-pentanoic acid methyl ester 10 2-Amino-4,4-dimethyl-pentanoic acid (1.00 g, 6.84 mmol) was suspended in 50 mL of methanol and cooled in an ice bath. Thionyl chloride (1.82 g, 15.0 mmol) was added dropwise, at which time all the acid went into solution. The reaction was then removed from the ice bath and heated to reflux for 3.5 h. The reaction mixture was concentrated in 15 vacuo and the resulting solid (1.10 g) was used in the next step without further purification. MS, m/z 159.9 = M+l (b) 4,4-Dimethyl-2-[(morpholine-4-carbonyl)-amino]-pentanoic acid methyl ester 20 2-Arxiino-4,4-dimethyl-pentanoic acid methyl ester (5,35 g, 27.4 mmol) was dissolved in 100 mL of dichloromethane. Hunig's base (7.07 g, 54.7 mmol) and 4-morpholinecarbonyl chloride (4.08 g, 27.4 mmol) were added and the reaction was stirred at ambient temperature 16 h. The reaction mixture was concentrated in vacuo and taken up in 150 mL EtOAc. A white precipitate formed and was filtered and washed with 25 EtOAc. EtOAc solutions were combined and washed with 3 x 50 mL 1 N HC1 (aq), 3 x 50 mL saturated NaHCCh (aq), and 1 x 50 mL brine. The organic layer was dried over Na2S04, decanted, and concentrated to a white solid (6.33 g). MS, m/z 273 = M+l (c) N-(4-morphoIinecarboEyl)-L-neopentyl glycine 30 ^,4-Dimethyl-2-[(morpholine-4-carbonyl)-amino]-pentanoic acid methyl ester (6.33 g, 23.2 mmol) was dissolved in 100 mL of THF and 50 mL of methanol. The solution was cooled on an ice bath and lithium hydroxide monohydrate (5.80 g, 116 mmol) was added as a suspension in 50 mL of water. The reaction was stirred at ambient temperature for 1 5 h. Additional water was added to the reaction (25 mL) and the mixture was extracted with diethyl ether 2 x 75 mL. The organic layer was discarded The aqueous layer was acidified to pH 2 with 20% HC1 (aq) and the product was extracted with 3 x 75 mL EtOAc. The EtOAc layer was washed with 1 x 50 mL brine and dried over Na2SC>4, decanted, and concentrated in vacuo to a white solid (5.85 g). MS, m/z 259 = M+l 10 (d) Morpholine-4-carboxylic acid [l-(4-cyano-2,6-diphenyl-piperidin-4-ylcarbamoyl)-3^-dimethyI-buryI]-amide N-(4-morpholinecarbonyl)-L-neopentyl glycine (214 mg, 0.83 mmol) was dissolved in 25 15 mL of dichloromethane. EDC (175 mg, 0.91 mmol), HOBT (123 mg, 0.91 mmol), 4-amino-4-cyano-2,6-diphenylpiperidine (Example 10) (278 mg, 0.91 mmol), and N-methylmorpholine (420 mg, 4.2 mmol) were added to the solution. The reaction was stirred at ambient temperature for 16 h. The reaction was concentrated in vacuo and the resulting residue was dissolved in 150 mL of EtOAc. The EtOAc layer was washed with 20 2 x 50 mL saturated NaHC03) 1 x 50 mL brine, then dried over Na2S04, decanted, and concentrated to an oil. Product was recrystallized from EtOAc/ hexanes to yield a white solid (42 mg). MS, m/z 518 = M+l EXAMPLE 12 25 MorphoKne-4-carboxvlic acid ri-(l-acervl-4-cyano-piperidin-4-ylcarhamovlV2-eyclohexvl-ethylj-amide (a) 4-Amino-4-cyano-l-acetylpiperidine was prepared according to the procedure 30 from Example 9, step a, starting with l-acetyl-4-piperidone. (b) The title compound was prepared starting from N-(4-morpholinecarbonyl)-L-cyclohexyl alanine and 4-amino-4-cyano-l-acetylpip'eridine according to the procedure from Example 2, step b, except that the compound was purified by HPLC using a 20 x 250 mm Ci8 reverse phase column with the method being 30% acetonitrile in water to 5 100% acetonitrile. MS, m/z 433 = M+l. EXAMPLE 13 Morpholine-4-carboxylic acid [l-(4-cyano-tetrahydro-pyran-4-ylcarbamoylV3J-10 dimethyl-bntylj-amide (a) 4-Amino-4-cyano-tetrahydropyran was prepared according to the procedure from Example 1, step a, starting from tetrahydropyran-4-one. 15 (b) The title compound was prepared starting from N-(4-morpholinecafbonyl)-L-neopentyl glycine (Example 11, step c) and 4-amino-4-cyano-tetrahydropyrane according to the procedure from Example 2, step b, except that the compound was purified by HPLC using a 20 x 250 mm C\% reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 367 - M+l. 20 EXAMPLE 14 Morphpline-4-carboxylic acid tl*(4-cyano-tetrahydro-thiopyran-4-ylcarbamoylV3T3-dimethvl-butvl]-amide 25 The title compound was prepared starting from N-(4-Morpholinecarbonyl)-L-neopentyl glycine (Example 11, step c) and 4-ammcH^cyancHtetrahydrothiopyran (Example 8) according to the procedure from Example 1, step d, except that the compound was purified by HPLC using a 20 x 250 mm Ci$ reverse phase column with the method being 30 30% acetonitrile in water to 100% acetonitrile. MS, m/z 383 = M+l. EXAMPLE 15 Morpholine-4-carboxvIic acid [l-(l-benzyI-4-cyano-piperidin-4-vlcarbamoyIV3.3-dimethvl-hutvll-amide 5 The title compound was prepared starting born N-(4-Morpholinecarbonyl)-L-neopentyl glycine (Example 11, step c) and 4-amino-4-cyano-l-benzylpiperidine (Example 5, step a) according to the procedure from Example 1, step d, except that the compound was purified by HPLC using a 20 x 250 mm Cjg reverse phase column with the method being 10 30% acetonitrile in water to 100% acetonitrile. MS, m/z 456 = M+l. EXAMPLE 16 Morpholine-4-carboxvlic acid [l-(l-isopropyl-4-cyano-piperidin-4-ylcarbamoy0-3.3-15 diroertivI-bnrvD-amide (a) 4-Amino-4-cyano-1 -isopropylpiperidine was prepared according to the procedure from Example 1, step a, starting from l-/-propyl-4-piperidone. 20 (b) The title compound was prepared starting from N-(4-morpholinecarbonyl)-L-neopentyl glycine (Example 11, step c) and 4-amino-4-cyano-l-isopropylpiperidine according to the procedure from Example 1, step d, except that the compound was purified by HPLC using a 20 x 250 mm Cig reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 456 = M+l. 25 EXAMPLE 17 MorphoIine-4-carboxylic arid fl-n-phenethyl-4-cvano-piperidin-4-yIcarbamoyn-30 3.3-dimethvl-biityIJ-amide The title compound was prepared starting from N-(4-morpholinecarbonyl)-L-neopentyl glycine (Example 11, step c) and 4-amino-4-cyano-l-phenethylpiperidine (Example 4) according to the procedure from Example 1, step d, except that the compound was purified by HPLC using a 20 x 250 mm Cjg reverse phase column with the method being 5 30% acetonitrile in water to 100% acetonitrile. MS, m/z 470 = M+l. EXAMPLE 18 10 Morpholine-4-carboxyIic acid fl-(l-n-propyl-4-cyano-piperidin-4-ylcarbamoyl)-3.3-dimethvl-butvll-amide The title compound was prepared starting from N-(4-morpholinecarbonyl)-L-neopentyl glycine (Example 11, step c) and 4-amino-4-cyano-l-n-propylpiperidine (Example 6) 15 according to the procedure from Example 1, step d, except that the compound was purified by HPLC using a 20 x 250 mm Cis reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 408 = M+1. 20 EXAMPLE 19 4-Cyano-4-{3.3-dimethyl-2-frmorpholine-4-carbonyl)-amino]-pentanoylainino}-piperidine-1-carboxyHc acid benzyl ester 25 The title compound was prepared starting from N-(4-morpholinecarbonyl)-L-neopentyl glycine (Example 11, step c) and 4-aminc-4-cyano-piperidine-l-carboxylic acid benzyl ester (Example 7, step a) according to the procedure from Example 1, step d, except that the compound was purified by HPLC using a 20 x 250 mm Cis reverse phase column with the method being 30% acetonitrile in water to 100% acetonitrile. MS, m/z 500 = 30 M+l. EXAMPLE 20 Morpholine-4-carboxylic acid [l-n-acetyl-4-cyano-piperidin-4-yIcarbamovD-3.3-dimethvl-butvl]-amide 5 (a) l-Acetyl-4-amino-piperidin-4-carbonitrile l-Acety]-4-amino-piperidin-4-carbonitrile Was prepared from N-acetyl-4-piperidone according to the procedure from Example 9, step a. 10 (b) The title compound was prepared starting from l-Acetyl-4-amino-piperidine-4-carbonitrile and N-(4-morphoIinecarbonyl)-L-neopentyl glycine (Example 11, step c) according to the procedure from Example 11, step d and purified by reverse phase HPLC (43 mg). MS, m/z 408 = M+l. IS EXAMPLE 21 MorphoIine-4-carboxvIic acid [l^l-benzoyl-4-cyano-piperidin-4-ylcarbamoyl)-3.3-20 dimethvl-biitvlj-amide (a) 4-Amino-1 -benzoyl-piperidine-4-carbonitrile was prepared from N-benzoyl-4-piperidone according to the procedure from Example 9, step a. MS, m/z 168 = M+l 25 (b) The title compound was prepared starting from 4-amino- l-benzoyI-piperidine-4-carbonitrile andN-(4-morpholinecarbonyl)-L-neopentyl glycine (Example 11, step c) according to the procedure from Example 11, step d and purified by reverse phase HPLC (66 mg). MS, m/z 470 = M+l 30 EXAMPLE 22 4-Cyano-4-{4.4-dimethyi-2-^morphoKne-4-carbonyI)-amino]-pentanoyIamino}-piperidine-l-earboxylic acid ethyl ester 5 (a) 4-Amino-4-cyano-piperidine-l-carboxylic acid ethyl ester was prepared according to the procedure from Example 1, step a, from 4-oxopiperidine-l-carboxylic acid ethyl ester. (b) The title compound was prepared starting from 4-Amino-4-cyano-piperidine-1 -10 carboxylic acid ethyl ester and N-(4-morpholinecarbonyl)-L-neopentyl glycine (Example 11, step c) according to the procedure from Example 11, step d and purified by reverse phase HPLC (67 mg). MS, m/z 438 = M+l EXAMPLE 23 15 Morpholine-4-carboxylic acid {l-[4-cyano-l-(2-dimethylamino-acetyl)-piperidin-4-ylcarhamoyl]-2-cyclohexyl-ethyI}-amide The title compound was prepared from N.Nniimethylarninoglycine and morpholine-4-carboxylic 20 acid [l-(4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide hydrochloride using the coupling method described in Example 1-part (d). The product was purified by reverse phase preparative HPLC to give the title compound as an off-white solid; MS, m/z 477 = M+l. EXAMPLE 24 25 4-Acetylamino-A^[1^4-cyano-tetrahydro-pvran-4-ylcarbamoyn-2-cyclohexyl-ethyI]-henzamide (a) f-Butoxycarboxylic acid [l-(4-cyano-tetrahydro-pyran-4-y!carbamoyl)-2-cyclohexyl- 30 etbyl]-amide. ^Butoxycarboxylicacid[l-(4-cyano-tetrahydro-pyran-4-ylcarbamoyl)-2-cyclohexyl-etiiyl]-amide was prepared from N-Boc-L-cyclohexylalanine and 4-amino-4-cyano-tetrahydropyran by the method of Example 2-part (b). The product was used in the next step without further purification. 5 (b) [l-(4-cyano-tetrahydro-pyran-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amine hydrochloride. f-Butoxycarboxylic acid [ 1 -(4-cyano-tetrahydro-pyran-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide (1000 mg, 2.62 mmol) was dissolved in 15 mL of 4 M HCI in dioxane. The solution was 10 stirred at ambient temperature for 1 hr. The volatiles were removed in vacuo and the resulting paste was triturated with 25 mL of diethyl ether to give a fine white solid that was collected by filtration and dried in vacuo. The product was used without further purification. 15 (c) 4-Acetylamino-iV-[l-(4-cyano-tetrahydro-pyran-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide. 4-Acetamidobenzoic acid (353 mg, 1.98 mmol), EDC (378 mg, 1.98 mmol), and HOBT (268 mg, 1.98 mmol) were combined in 15 mL of DMF and stirred for 20 min. Solid [l-(4-cyano- 20 tetrahydro-pyran^ylcarbamoyl)-2 Following the above procedures the following compounds can be synthesised; 4-Chloro-N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide 30 ^f-[l_(4.Cyano-l-memyl-piperidm■4-ylcarbamoyl)-2-cyclohexyl-ethyl]-4-methoxy-benzamide N-[H4-Cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cycloliexyl-ethyl]-isonicotinamide Pyrazine-2-carboxylic acid [l-(4-Cyano-l-methyI-piperidin-4-yIcarbamoyI)-2-5 cyclohexyl-ethyl]-amide N-[ 1 -(4-Cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyI]-3-phenoxy-benzamide 10 Furan-2-carboxylic acid [ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylj-amide Thiophene-2-carboxylic acid [1-(4-cyano-1-methyl-piperidin-4-ylcarbamoyl)-2-15 cyclohexyl-ethylj-amide 5-Chloro-thiophene-2-carboxylic acid [ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylj-amide 20 N-(4-Cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-2-(2-thiophen-2-yl-acetylamino)-propionamide. EXAMPLE 25 25 Morpholine>4-carboxyHcacidtl-f4-cvano-l-inethvl-piperidin-4-vlcarbaniovn-3.3-dimethy1-butylj-amide (a) /-Butoxycarboxylic acid [1^4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3,3- 30 dimethyl-butyl]-amide. /-Butoxycarboxylic acid [ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-buty 1]-amide was prepared from N-Boc-L-neopentylglycine and 4-amino-4-cyano-l-methyl-piperidine by a method analogous to that of Example 2-part (b). The product was used without further 35 purification. (b) {l- dihydrochloride. [ 1 -(4-Cyano-1 -methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-ainine dihydrochloride was prepared by a method analogous to that of Example 24-part (b). The product was used without further purification. 5 (c) MorphoIine-4-carboxylic acid [l-{4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3^-dimethyl-butylj-amide. [l-(4-cyanc>-l-memyl-piperidin^ylcarbamoyl)-3,3-dimethyl-butyl]-amine dihydrochloride (350 10 mg, 1.03 mmol) was mixed in 10 mL of DMF to which was added 1 mL of N-methyl morpholine followed by addition of 4-morpholine carbonyl chloride (180 mg, 1.20 mmol) as a solution in 5 mL of DMF. The reaction was stirred for 16 hours at which time the volatiles were removed in vacuo. The residue was redissolved in 150 mL of EtOAc and washed sequentially with 50 mL of saturated aqueous bicarbonate and 50 mL of brine. The organic layer was dried over sodium 15 sulfate, decanted and concentrated. The product was purified by flash chromatography on silica gel using 100% methylene chloride to 12 % methanol in methylene chloride as eluent to give the title compound as a thick oil (85 mg); MS, m/z 380 = M+l. Following the above procedures the following compounds can be synthesised; 20 4-Chloro-N-[l-(4^yano-l-memyl-piperid^^ylcarbamoyl)-3,3-dimethyl-butyl]-benzamide N-[l-(4^yano-l-memyl-piperidm^ylcarbamoyl)-3,3wlimemyl-butyl]^methoxy-25 benzamide N-[l-(4-cyano-l-memyl-pir>eriofo^yIc^bam Pyrazine-2-carboxylic acid [1^4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-30 butyfj-amide Furan-2 4,4-DimethyI-2-(2-thiophen-2-yl-acetylamino)-pentanoic acid (4-cyano-1 -methyl-piperidin-4-yl)-ainide 10 N-[ 1 -(4-Cyano-1 -methyl-piperidin-4-ylcarbamoyl)-3,3-dimeuiyl-butyl]-3-phenoxy-benzamide 5-Chloro-thiophene-2-carboxylicacid[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide. 15 EXAMPLE 26 4-Acetylamino-A^1^4^yano-l-methyl-piperidin^-ylcarbamoyl)-2-cyclohexyl-ethyl]- benzamide 20 The title compound was prepared by a method analogous to that of Example 24; MS, m/z 454 = M+l. EXAMPLE 27 25 4-Acetylamino-JV-fl-(4-cyano-l-methvl-piperidin-4-ylcarbamoyD-33-dimethyI-butyl]- The title compound was prepared by a method analogous to that of Example 24; MS, m/z 428 = 30 M+l. EXAMPLE 28 4-Cyano^{3-cyclohexyI-2-[(morphoIine-4-carbonyIVamino}-propionylamino}-pjlperidine-1-carboxylic acid t-butyl ester 5 (a) 4-Amino-4-cyano-piperidine-l-carboxyIic acid t-butyl ester. 4-Amino-4-cyano-piperidiiie-1 -carboxylic acid t-butyl ester was prepared by a method analogous to that of Example 3-part (a). The product was used without further purification. 10 (b) 4-Cyano-4-{3-cyclohexyl-2-[(morpholine-4-carbonyl)-amino]-propionylamino}- piperidine-1-carboxylic acid /-butyl ester. 4-Cyano^{3-cyclohexyl-2-[(morphoUne-4-carbonyI)-amino]-propionylanuno}-piperidine-l-15 carboxylic acid *-butyl ester was prepared by a method analogous to that of Example 3-part (b); MS, m/z 391, M- /-butoxycarbonyl). EXAMPLE 29 20 Morpholine-4-carboxylic acid fl-f4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexvI-ethyl|-amide hydrochloride 4-Cyano-4-{3-cyclohexyl-2-[(morpholme-4-ca^ carboxylic acid r-butyl ester (1000 mg, 2.03 mmol) was dissolved in 20 mL of 4 M HC1 in 25 dioxane and stirred for 1 hour at which time the volatiles were remove in vacuo. The resulting residue was triturated with 100 mL of diethyl ether and the resulting solid was collected by filtration under inert atmosphere (the solid is very hygroscopic) and washed 2x50 mL of diethyl ether and dried in vacuo to yield the title compound as a bright white powder (802 mg); MS, m/z 392, M-35). 30 EXAMPLE 30 MorphoIme-4-carboxvIic acid {l-f4-cyano-l-fl-methy[-ethyIVpiperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyll-amide 5 (a) 4-Amino-4-cyano-l-(l-methyl-ethyI)-piperidine. 4-Aniino-4-cyano-l-(l-methyI-ethyI)-piperidine was prepared by a method analogous to that of Example 1-part (a). The product was used without further purification. 10 (b) Morpholine-4-carboxylic acid {l-[4-cyano-l-(l-methyl-ethyl)-piperidin-4-ylcarbamoyl]-2-cycIohexyI-ethyl}-amide. Morpholine-4-carboxylic acid {l-[4-cyano-l-(l-methyl-ethyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide was prepared by a method analogous to that of Example 1-part (d); MS, 15 m/z434 = M+l. EXAMPLE 31 Morpholine-4-carboxvlicacid{l-T3-cyano-l-ben2vl-pvrrolidin-3-vlcarbamovIl>2-20 cyclohexyl-ethyl}-amide (a) 3-Amino-3-cyano-l-benzylpyrrolidine. 3-Amino-3-cyano-l-benzylpyrrolidine was prepared by a method analogous to mat of Example 25 1-part (a) with the exception that no sodium carbonate was added to the reaction mixture. The product was extracted from the crude reaction with 3x100 mL of EtOAc and was used without purification. (b) MorphoIine-4-carboxyIic acid {l-[3-cyano-l-benzyl-pyrroKdin-3-ylcarbainoyI]-2- 30 cyclohexyl-etbylj-amide. Separated diastereomers. DiaStereomeric morpholine-4-carboxylic acid {l-[3-cyano-l-ben2yl-pyrrolidin-3-ylcarbamoyrj-2-cyclohexyl-ethyl}-amide was prepared by a method analogous to that of Example 1-part (d). The purification was done by reverse phase preparative HPLC (Hypersil HyPURITYTM,Cl 8 column, 250 x 21.2 5u) to separate the two diastereomers; MS, m/z 468 = M+l. 5 EXAMPLE 32 Morpholine-4-carboxyljc acid [144-evanft-2.6-dimethvl-piperidin-4-ylcarbamovD-2-cyclohexvl-ethylj-amide 10 (a) Cis-2,6~dimethyl-4-piperidone. Into a mixture of dimethyl acetonedicarboxylate (10 g, 57.4 mmol) and acetaldehyde (4.4 g, 100 mmol) maintained at -25 °C was bubbled ammonia until the solution was saturated (careful 15 bubbling required due to exothermic dissolution of NH3). The resulting solution was stored at 0 °C for 20 hours, by which time it was a white sludge. To this was added 25 mL of 3 N hydrochloric acid and the solution was heated on the steam-bath. Carbon dioxide began to evolve soon, but after 24 hours was still evolving very slowly. The solution was evaporated almost to dryness. To the tan heavy precipitate was added 25 mL of water and the solution was 20 again evaporated. To the residue was added a solution of 10 g of sodium carbonate in 45 mL of water and 20 mL of chloroform. The layers were shaken and separated. The water layer was extracted six times with 20 mL protions of methylene chloride. The organic layers were dried over magnesium sulfate and concentrated to give the desired crude product which was used without further purification. 25 (b) 4-Amino-4-cyano-2,6-dimethyl-piperidine. To a mixture of ammonium chloride (0.58 g, 9.98 mmol), sodium cyanide (0.50 g, 11.0 mmol), ammonium hydroxide (2 mL) was added a solution of cis-2,6-dimethylpiperidone (1.27 g, 9.98 30 mmol) in 5 mL of methanol. The resulting mixture was refluxed for 4 hours. The reaction mixture was evaporated to dryness and the residue was taken up in 50 mLEtOAc, washed with saturated sodium bicarbonate 3 x 50 mL. The organic layer was evaporated to dryness and purified by flash chromatography on silica gel using 90 to 9 methylene chloride and methanol to give the desired product. 5 (c) MorphoIine-4-carboxyIic acid [l-(4-cyano-2,6-dimethyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylj-amide. The title compound was prepared by the standard method of Example 1-part (d); MS, m/z 420 = M+l. 10 EXAMPLE 33 Morpholine-4-carboxylic acid [1 -(4-cyano-13-dimethyl-piperidin-4-vlcarbamovD-2-cyclohexyl-ethyl]-amide 15 (a) l,3-DiinethyI-4-piperidone hydrochloride. To a solution of methylamine (100 mL of 2.0 M solution in methanol) was added, over the course of 1 hour at 0 °C, a solution of methyl methacrylate (30.2 g, 300 mmol) in 20 mL of 20 methanol. The resulting solution was allowed to stand for three days, at which time the volatiles were removed on a rotovap and title residue was vacuum distilled to give the desired product as a clear oil, b.p. 48-49 C at 8.5 ynm The oil was dissolved in 100 mL of methanol and methyl acrylate (14.8 g, 200 mmol) was added and the reaction was allowed to stand for 3 days. The volatiles were removed. 25 30 mL of Xylene was prepared over sodium (2.42 g) and refluxed for 2 hours and cooled to 60 °C. To this mixture was added the diester and the reaction was refluxed until the sodium particles had disappeared. The resulting dark red liquid was cooled and poured into 150 mL of ice water. The phases were separated and the xylene extracted with 50 mL of concentrated 30 hydrochloric acid and, after washing with 50 mL of isopropyl ether, the aqueous layer was cooled, basified with potassium carbonate and extracted eight times with 75 mL portions of ethyl #ier. The combined ethereal extracts were dried over potassium carbonate and treated with excess dry ethereal hydrogen chloride; the resulting salt was filtered and dried. The salt was taken up in 60 mL of 6 N hydrochloric acid and heated on a water bath for three 5 hours, at the end of which time the initially vigorous carbon dioxide evolution had become negligible. The resulting solution was evaporated to dryness and dried in vacuo, to yield 1,3-dimethyl-4-piperidone hydrochloride (5g) which was used in the next step without further purification. 10 (b) 4-Amino-4-cyano~l,3-diinethylpiperidine. The title compound was prepared as described in the previous example for 4-arnino-4-cyano-2,6-dimethylpiperidine. The crude product was used in the next step without further purification. 15 (c) Morpholine-4-carboxylic acid [l-(4-cyano-1^3-dimethyI-piperidin-4-ylcarbamoyI)-2-cyclohexyl-ethy I] -amide. The title compound was prepared as in Example 1-part (d); MS, m/z 420 = M+l. 20 EXAMPLE 34 4-Cyano^{3-cyclQhexyl-2-[({4-acerylamino}-phenyl-l-carbonylVamino]-propionylamino}-piperidine-1-carhoxvlic acid ethvl ester 25 The title compound was prepared by a method analogous to that of Example 24; MS, m/z 512 = M+l. EXAMPLE 35 30 4-AcetyIamino-JV-[l-r4-cvano-l-benzyl-piperidin-4-ylcarbamoyIV2-<:yclohexvl-ethyl> The title compound was prepared by a method analogous to that of Example 24; MS, m/z 530 = M+l. 5 EXAMPLE 36 4-Acetylamino-A^-{l-[4-cyano-l^l-methyl-ethylVpiperidin^-yIcarbanioyl]-2-cyclohexyl-ethvty-benzarnide 10 The title compound was prepared by the method of Example 24; MS, m/z 482 = M+l. EXAMPLE 37 Morpholine-4-carboxylicacid{l-f3-cyano-l-henzyl-piperidin-3-yIcarbamoyI]-2-cyclohexyl-15 ethyl}-amide The title compound, separated into two diastereomers, was prepared by a method analogous to that of Example 31; MS, m/z 482 = M+l. 20 EXAMPLE 38 4-Cyano-4-{3-cyclohexyI-2-[f{4-acetylamino}-phenyl-l-carbonyl)-amino]-propionylamino}-piperidine-1-earboxylic acid benzyl ester 25 The title compound was prepared by a method analogous to that of Example 24; MS, m/z 574 = M+L EXAMPLE 39 30 Ar-[l-f4-cyano-l-methyl-piperidin-4-ylcarbamoyn-2-cyclohexyl-ethyl]-ben2amide The title compound was prepared by a method analogous to that of Example 24; MS, m/z 397 = M+l. EXAMPLE 40 5 4-Acetylamino-A^{l-[4-cyano-l-(2-phenyl-ethylVpiperidin-4-ylcarbamoyl]-2-cyclohexyl-ethylj-benzamide The title compound was prepared by a method analogous to that of Example 24; MS, m/z 544 = 10 M+l. EXAMPLE 41 ^^^getylamino-methvlV-A^-ri-f^cvano-l-methvl-piperidin^-vlcarhamnyl^-cvclohexvl-15 ethvlj-benzamide (a) 4-(Acetylamino-methyl)-benzoic acid. Methyl-4-(acetylamino-methyl)-benzoate was prepared from acetic acid and methyl 4-20 (aminomethyl)benzoate using a method analogous to that of Example 1-part (d). The crude N-acyl ester was saponified using a method analogous to that of Example 1-part (c). The crude product was used without further purification. (b) 4^Acerylainino-methyJ)-iV-[l-(4-cyano-l-methyI-piperidin-4-y]carbainoyl)-2- 25 cycloheacyl-ethylj-benzamide. The title compound was prepared by a method analogous to that of Example 24-part (c); MS, m/z 468 = M+l. 30 EXAMPLE 42 Morpholine-4-carboxvlic acid IW3-cvano-8-methyl-8-aza-bicvclo[3.2.11oct-3-vIcarhamnvn-2-cyclohexvl-ethvll-amide (a) 3-Amino-3-cyano-8-methyl-8-aza-bicyclo[3.2.1Joctane. 5 The aminonitrile was prepared from tropinone using a method analogous to that of Example 1-part (a). (b) MorphoIine-4-carboxyIic acid [l-(3-cyano-8-methyl-8-aza-bicycIo[3.2.1]oct-3- 10 ylcarbamoyl)-2-cyclohexyl-ethyI]-amide. The title compound was prepared using a method analogous to that of Example 1-part (d); MS, m/z432 = M+l. 15 EXAMPLE 43 Morpholine-4-carboxvIic acid [l-fl-carbamimidoyI-4-cyano-piperidin-4-ylcarbamoytV2-cyclohexyl-ethyl]-amidej>-toluenesulfonate 20 (a) l-Carbamimidoyl-l,23-benztriazole/?-toluenesulfonate. A mixture of benztriazole (11.9 g, 100 mmol), cyanamide (4.2 g, 100 mmol), and p-toluene sulfonic acid hydrate (19.2 g, 100 mmol) in dioxane was refluxed for 24 hours. The reaction mixture was allowed to cool to room temperature and was diluted with ether, stirred vigorously, 25 then filtered. The filter cake was washed with ether and recrystallized from ethanol to give the desired product as a white solid (b) Morpholine-4-carboxyIic acid [l-(l-carbamiinidoyl-4-cyano-piperidin-4-ylcarbamoyI>2-cyclohexyl-ethyl]-amide/>-toluenesulfonate. 30 MorphoIine-4-carboxylic acid [ 1 -(4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide hydrochloride (0.2 g, 0.47 mmol) was dissolved in 3 mL of DMF and 2 equiv of Hunig's base was added followed by l-carbamimidoyl-l,2,3-benztriazolep-toluenesulfonate (0.16 g, 0.47 mmol). The reaction was stirred 24 hours at which time the solvent was removed in vacuo. The 5 resulting paste was purified by preparative HPLC to give the title compound; MS, m/z 434, M+l-/>-toluene sulfonate). EXAMPLE 44 10 4-Acetvlamino-Ar-fl-(4-cyano-tetrahydro-pvran-4-ylcarbamoylV3.3-dimethyI-bntyl]-benzamide 4-Amino-4-cyano-tetrahydropyran prepared according to the procedure from Example 1, step a, starting from tetrahydropyran-4-one. 15 The title compound was prepared from 4-amino-4-cyano-tetrahydropyran, L-neopenyyl glycine and 4-acetylaminobenzoic acid analogous to the procedure described in Example 24. 20 EXAMPLE 45 Morpholine-4-carboxylic acid {l-(4-cyano-l-methanesnlfonvl-piperidin-4-yIcarbamoyn-2-cyclohexyl-ethvll-amide. 25 The title compound is prepared by treatment of morphoIine-4-carboxylic acid [l-(4-cyano-piperidin-4-yIcarbamoyl)-2-cyclohexyI-ethyI]-amide hydrochloride with methanesulfonyl chloride and a tertiary amine base such as iV-methylmorpholine in a solvent such as methylene chloride. 30 EXAMPLE 46 4-Aeetylamino-piperidine-l-carboxvIicacid[l-f4-cyano-l-methy]-piperidin-4-ylcarbamoyn-2-cvcIohexyl-ethyl]-amide. The title compound is prepared by a method analogous to that of Example 24. 5 EXAMPLE 47 Morpholine-4-carboxylic acid {l-[l-f2-chloro-benzylV3-cyano-pyrroHdin-3-ylcarbamoyl]-2-cvclohexyl-ethvl}-amide. 10 The title compound is prepared by a method analogous to that of Example 31. EXAMPLE 48 15 MorphoHne-4-carboxylic acid fl-fl-benzvlcarbamoyl-4-cyano-piperidin-4-vlcarbamoylV-3,3-dimethyl-frqtyII-ainjde, The title compound is prepared from morpholine-4-carboxylic acid [l-(4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide hydrochloride and benzyl isocyanate in the presence of 20 a tertiary amine base such as #-metbylmorpholine in a solvent such as methylene chloride. EXAMPLE 49 Morpholine-4-carboxyIic acid [l-ri-phenylcarbamoyl-4-cyano-piperidin-4-vlcarbamoyIV 25 3.3-dimethyl-hiitvl]-amide. The title compound is prepared from morpholine-4-carboxylic acid [ l-(4-cyano-piperidin-4-ylcaitamoyl)-33- MorphoIjne-4-carboxvlic acid {l-f4-cvano-l-(morpholine-4-carbony0-piperidin-4-ylcarbamoyn-3.3-dimethvI-butyl]-amide. 5 The title compound is prepared from morpholine-4-carboxylic acid [l-(4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide hydrochloride and 4-morpholine carbonyl chloride in the presence of a tertiary amine base such as N-memylmorpholine in a solvent such as methylene chloride. 10 EXAMPLE 51 )Mprpb.oline-4-carboxylic acid (l-l^cyanp-l-tCpyridin^-ylmethylVcarbamoylj-piperidin-^ yIcarbamoyl}-3.3-dimethvM>utvn-amide. 15 The title compound is prepared from morpholine-4-carboxylic acid [l-(4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide hydrochloride and 3-pyridyl-methyl isocyanate in the presence of a tertiary amine base such as AT-methylmorpholine in a solvent such as methylene chloride. 20 EXAMPLE 52 Morpholine-4-carboxyIic ac'd fl -f4-cvano-l-f4-methyl-piperazine-l -carbonylVpiperidin-4-vIcarbamovn-2-cvcIohexvl-ethyll-amide. 25 The title compound is prepared from morpholine-4-carboxylic acid [l-(4-cyano-piperidm-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide hydrochloride and 4-methyl-piperzine carbonyl chloride in the presence of a tertiary amine base such as AT-methylmorpholine in a solvent such as methylene chloride. 30 EXAMPLE 53 4-f4-Cyano-4-{3-cyclohexyl-2-ffmorphoIine-4-carbonyl>-amino]-propionylamino}-piperidin-1-yn-butvric acid. The title compound is prepared from morpholine-4-carboxylic acid [l-(4-cyano-piperidin-4-5 ylcarbamoyl)-2-cyclohexyl-ethylJ-amide hydrochloride and 4-bromo-butyric acid in the presence of a hindered tertiary amine base such as Hunig's base in a solvent such as methylene chloride. EXAMPLE 54 10 Morpholine-4-carbox,ylic acid [l-f4-cyano-l-cyclopropyI-piperidin-4-ylcarbamoyn-2-cyclohexyl-ethyl]-amide. The title compound may be prepared from morpholine-4-carboxylic acid [l-(4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide hydrochloride and 1-emoxy-l-trimethylsilyloxy-15 cyclopropane using a reducing agent such sodium cyanoborohydride in a solvent system such as acetic acid in methanol. EXAMPLE 55 20 Morpholine-4-carboxylic acid {l-[4-cyano-l»f2-dimethylamino-ethyIVpiperidin-4-ylcarbamoyl]-2-cyciohexyl-ethyI}-amide. The title compound is prepared by the method of Example 33. 25 EXAMPLE 56 Morpholine-4-carboxylic acid [1 -(4-cyano-l -phenvl-piperidin-4-yIcarbamovlV2-cvclohgYyl-ethvl]-amide. 30 The title compound is prepared by a method analogous to that of Example 58. EXAMPLE 57 Morpholine-4-carboxvuc acid {l-[4-cyano-l-fl.l-dimethyl-ethylVpiperidin-4-ylcarbamoyI]-5 2-cyclohexvl-ethvl}-amide. The title compound can be prepared by a method analogous to that of the method of Example 59. EXAMPLE 58 10 Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -phenyl-piperidin-4-vIcarbamoylV3.3-dimethvl-butviyamide. (a) A^Phenyl-4-piperidone. 15 l,4-Dioxa-8-azaspiro[4.5]-decane (2.0 g, 14.0 mmol, 1.0 equiv), Pd2(DBA)3 (0.31 g, 0.34 mmol, 0.024 equiv), BINAP (0.64 g, 1.0 mmol, 0.073 equiv), NaO-r-Bu (3.9g, 41 mmol, 3.0 equiv) and bromobenzene (2.6 g, 17.7 mmol, 1.3 equiv) were combined under AT in 50 mL of dry toluene. The resulting mixture was refluxed under Ar for 4 h. The reaction 20 mix was cooled and poured into 250 mL of saturated sodium bicarbonate solution. The product was extracted with 3 x 100 mL CH2CI2. The organic extracts were combined and concentrated. The product was purified by flash chromatography on S1O2 using 50% hexanes in CH2CI2 to pure CH2CI2 to give the AT-phenyl ketal (2.9 g). The purified ketal was dissolved in mixture of 50 mL 1,4-dioxane, 50 mL water, and 20 mL concentrated 25 HCL The mixture was refluxed for 3 h at which time mass spectrometry showed disappearance of the starring ketal. The cooled mixture was carefully poured into 600 mL of saturated sodium bicarbonate solution and the product extracted with 3 x 200 mL EtOAc. The combined organic extracts were combined and dried over Na2S04, decanted and concentrated to a red oil (2.3 g) which was used without further purification; MS, m/z 176=M+1. 5 (b) 4-Airuno-4-cyano-l-phenyl-piperidine. iV-Phenyl-4-piperidone (2.3 g, 13 mmol, 1.0 equiv) was dissolved in 26 mL of 2 M NH3 in MeOH and NaCN (0.76 g, 15 mmol, 1.2 equiv) and NH4CI (0.80 g, 15 mmol, 1.2 10 equiv) were added and the mixture was refluxed for 2 h at which time an additional 26 mL of 2 M NH3/MeOH was added followed by another 2 h of reflux. The reaction mixture was cooled and filtered. The filtrate was concentrated. The crude product was purified by flash chromatography on SiCb eluting with 100% CH2CI2 and 2% MeOH in CH2CI2 to give the pure product (1.92 g) as a thick yellow oil which solidified on 15 standing; MS, m/z 202*M+L (c) Morpholine-4-carboxylic acid [l-(4-cyano-l-phenyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide. A^-(4-moipholinecarbonyI)-L-neopenylgIycine (0.2 g, 0.97 mmol, 1.0 equiv) and EDC (0.19 g, 0.97 mmol, 1.0 equiv) were combined in 10 mL of CH2CI2 and stirred for 15 min at room temperature. A solution of 4-amino-4-cyano-l-phenyl-piperidine (0.20 g, 0.97 5 mmol, 1.0 equiv) in 5 mL of CH2CI2 and A^methyl-morpholine (0.31 g, 3.1 mmol, 4.0 equiv) were added and stirring was continued for 16 h. The reaction was concentrated in vacuo and the residue was triturated with 100 mL saturated sodium bicarbonate solution with rapid stirring for 2 h. The resulting solid was collected by filtration and recrystallized from CH3CN and water (2 to 1) to yield the title compound as an off-white 10 solid (165 mg, 39%); MS, m/z 443=M+1. Following the above procedures the following compounds can be synthesized: Morpholine-4-carboxylic acid {l-[4-cyano-l-(2-methoxy-phenyl)-piperidin-4-15 ylcarbamoyl]-3,3-dimethyl-butyl}-amide Morpholine-4-carboxylic acid {l-[4-cyano-l-(3-methoxy-phenyl)-piperidin-4-ylcarbamoyl]-3,3 Morpholine-4-carboxylic acid {l-[4-cyano-l-(2-methyl-phenyl)-piperidin-4-ylcarbamoyl]-3,3-dimethyl-butyl}-amide Morpholine-4-carboxylic acid {l-[4-cyano-l-(3-methyl-phenyl)-piperidin-4-yIcarbamoyl]-3,3-dimethyl-butyl}-amide 5 Morpholine-4-carboxylie acid {1 -[4-cyano-1 -(4-methyl-pheny l)-piperidin-4-ylcarbamoyl]-3,3-dimethyl-butyl} -amide Morpholine-4-carboxylic acid {1 -[4-cyano-l-(2-phenyl-phenyl)-piperidin-4-ylcarbamoyl]-3,3-dimethyl-butyl} -amide 10 Morpholine-4-carboxylic acid {l-[4-cyano-l-(3-phenyI-phenyI)-piperidin-4-ylcarbamoyl]-3,3-dimethyl-butyl} -amide Morpholine-4-carboxylic acid {l-[4-cyano-l-(4-phenyl-phenyl)-piperidin-4-15 ylcarbamoyl]-3,3-dimethyI-butyl}-amide Moipholine-4-carboxylic acid {l-[4-cyano-l-(2-methoxy-phenyl)-piperidin-4-ylcatbamoyl]-2-cyclohexyl-ethyl}-amide 20 Morpholine-4-carboxylic acid {l-[4-cyano-l-(3-methoxy-phenyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyI} -amide Moipholine-4-carboxylic acid {1-[4-cyano-l-(4-methoxy-phenyl)-piperidm-4-ylcaibamoyl]-2-cyclohexyl-etbyl}-amide 25 Morpholine-4-carboxylic acid {l-[4-cyano-l-(2-methyl-phenyl)-piperidin-4-ylcarbamoyl3-2-cyclohexyl-ethyl} -amide MorphoIine-4-carboxylic acid {l-[4-cyano-U(3-methyl-phenyl)-piperidin-4-30 ylcarbamoyl]-2-cyclohexyl-ethyl}-amide Morpholine-4-carboxylic acid {l-[4-cyano-l-(4-methyl-phenyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide Moipholine-4-carboxylic acid {l-[4-cyano-l-(2-phenyl-phenyl)-piperidin-4-5 ylcarbamoyl]-2-cyclohexyl-ethyl}-amide Morpholine-4-carboxylic acid {l-[4-cyano-l-(3-phenyl-phenyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide 10 MorphoIine-4-carboxyIic acid {1 -[4-cyano-1 -(4-phenyl-phenyI)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide EXAMPLE 59 15 MorphoIine-4-carboxvlic acid [1 -(] -fer^butyU^yanc-piperidin^vlcaiframoyn-3.3-dimethvl-butylj-amide. (a) iV-Methoxy-7V-methyl-actylamide. 20 Acrolyl chloride (20 g, 221 mmol, 1.0 equiv) was dissolved n 500 mL of CH2CI2 and cooled to 0 °C. Solid #,0-dimethyl-hydroxylamine hydrochloride (21.5 g, 221 mmol, 1.0 equiv) was added all at once. Et3N was added dropwise over a 2 h period to give a thick yellow mixture. The reaction was stirred for an additional hour during which time 25 it was allowed to warm to room temperature. The mixture was poured into 1 L of water. Layers were separated and the organic layer was washed with 1 x 500 mL water, 1 x 500 mL brine and dried over Na2SC>4. The solution was decanted and concentrated in vacuo to give the desired product as a yellow oil (23 g, 90%) which was used without further purification. (b) 3-(/-Butyl-amino)-A'-methoxy-A'-niethyl-propanamide. iNT-Meflioxy-i^-methyl-acrylamide (5 g, 43.4 mmol, 1.0 equiv) was dissolved in t-5 butylamine (3.36 g, 46 mmol, 1.06 equiv). The resulting solution was stirred at room temperature for 48 h. The excess primary amine was removed in vacuo and the crude product was purified by flash chromatography on silica using 100% CH2CI2 to 2% MeOH in CH2CI2 to give the desired product as a light yellow oil (5.7g, 70%); MS, m/z 189=M+1. 10 (c) l-f-Butyl-4-piperidone. 3-(/-Butyl-amino)-JV:-methoxy-iV:-methyl-propanamide (5 g, 26.6 mmol, 1.0 equiv) was dissolved in dry THF (50 mL) under Ar. The solution was cooled to -78 °C and a 1 M 15 solution of vinylmagnesium bromide (66.5 mL, 66.5 mmol, 2.5 equiv) was added dropwise over a 20 min period. The reaction was then stirred at -78 °C for 30 min and at 0 °C for 30 min at which time the reaction solution was transferred via a double-ended cannula into ice-cold saturated sodium bicarbonate solution under Ar. The mixture was stirred for 10 min and the crude product was extracted 2 x 150 mL EtOAc. The organic 20 extracts were combined and concentrated in vacuo to a red oil. Purification was done by flash chromatography on silica using 100% CH2Cb through 4,8, and 16% MeOH in CH2C12. The product was isolated as an orange oil (1.3 g, 32%); MS, m/z 156=M+1. (dX 4-Amino-l-f-butyl-4-cyano-piperidine. l-t-Butyl-4-piperidone(U g, 8.4 mmol, 1.0 equiv), NaCN(0.61 g, 12.6 mmol, 1.5 equiv), and NH4CI (0.67 g, 12.6 mmol, 1.5 equiv) were combined in 34 mL of 2 M NH3 5 in MeOH. The mixture was refluxed for 2 h at which time an additional 34 mL of 2 M NH3 in MeOH was added followed by another 2 h at reflux. The mixture was cooled and filtered. The filtrate was concentrated in vacuo and the residue was triturated with CH2CI2 and filtered again. The solution was concentrated to a thick red oil which was used wimout further purification; MS, m/z 182=M+1. 10 (e) Morpholine-4-carboxylic acid [l-(l-tert-butyl-4-cyano-piperidin-4-ylcarbamoyl)-3^-dimethyl-butyi]-amide. 7V-(4-morpholinecarbonyl>L-neopenylglycine (0.070 g, 0.27 mmol, 1.0 equiv) and EDC 15 (0.057 g, 0.30 mmol, 1.1 equiv) were combined in 10 mL of DMF and stirred for 15 min at room temperature. A solution of 4-amino-l-/-butyl-4-cyano-piperidine (0.054 g, 0.30 mmol, 1.1 equiv) in 5 mL of DMF and iV-methyl-morpholine (O.llg, 1.1 mmol, 4.0 equiv) were added and stirring was continued for 16 h. The reaction was diluted with 50 mL of saturated sodium bicarbonate solution and the product was extracted with 3x50 20 mLEtOAc. The organic extracts were combined and concentrated in vacuo. The product was purified by semi-prep reverse-phase HPLC using 20 to 60% CH3CN in water over a 25 min gradient to yield the title compound as a white solid after concentration (25 mg, 22%); MS, m/z 422=M+1. 5 EXAMPLE 60 MorphoIine-4-carboxylic acid [l-f4-cyano-1.2-dimethyl-piperidin-4-ylcarbamoyI>-33-dimethyl-butyll-amide. 10 (a) 3-(Benzyl-methyl-ainino)-butyric acid methyl ester, Benzyl-methyl-amine (20 g, 165 mmol, 1.0 equiv) was added neat to methyl crotonate (19.8 g, 198 mmol, 1.2 equiv). The resulting solution was stirred at room temperature for 15 72 h. The excess crotonic ester was removed in vacuo to yield the desired product (40.3 g, ~100%) which was used without further purification; MS, m/z 222=M+1. (b) 3-Methylamino-butyric acid methyl ester. 20 3-(Beri2yl-memyl-arnino)-butyric acid methyl ester (15 g, 67.8 mmol, 1.0 equiv) was placed in a Parr hydrogenation bottle and dissolved in 50 mL of MeOH. 20% Palladium hydroxide on carbon (0.5 g, 0.94 mmol, 0.014 equiv) was added and the mixture was shaken at 50 psi H2 for 16 h. The reaction was judged as complete when the uptake of H2 had stopped. The bottle was opened and 10 g of diatomaceous earth in 100 mL of MeOH 25 was added. The mixture was filtered on a pad of diatomaceous earth which was then washed with 2 x 100 mL of MeOH. The filtrates were combined and concentrated in vacuo to yield the desired product as an oil that is somewhat volatile (7.6 g, 85%). The crude product was used without further purification; MS, m/z 132=M+1. 5 (c) 3-[(2-Methoxycarbonyl-ethyI)-methyl-amino]-butyric acid methyl ester. 3-Methylamino-butyric acid methyl ester (7.6g, 58 mmol, 1.0 equiv) was added neat to methyl acrylate (7.5 g, 87 mmol, 1.5 equiv). The resulting solution was refluxed for 16 h. The reaction was cooled and diluted with hexanes (200 mL) and an insoluble polymer 10 separated out. The hexane solution was decanted and the polymer washed 2 x 100 mL hexanes with vigorous stirring. The combined hexane solutions were then concentrated in vacuo. The crude product was purified by flash chromatography on S1O2 using pure CH2CI2 as an eluent. The pure product was isolated as a clear colorless oil (7.3 g, 58%); MS,m/z218=M+l. 15 (d) l,2-Dimethyl-4-piperidone. A 1 M solution of T1CI4 in CH2CI2 (23 mL, 23 mmol, 1.0 equiv) was added to a flask under Ar and cooled to -15 °C with a MeOH/ice water bath. 3-[(2-Methoxycarbonyl-20 emyl)-memyl-amino]-butyric acid methyl ester (5 g, 23 mmol, 1.0 equiv) was added dropwise over a 25 min period as a solution in 75 mL of dry CH2CI2 to give a dark red mixture that was difficult to stir with a magnetic stir bar. Stirring was continued an additional 1 h and then Et3N (5.1 g, 50.6 mmol, 22 equiv) was added dropwise over a 30 min period and then the reaction was stirred an additional 1.5 h at -15 °C. The reaction mix was poured into 150 mL of brine and 150 mL of CH2CI2 was added. After thorough mixing, the pH of the water was brought to 8-9 with Et3N. The mix was filtered and the gel-like solid was washed 3 x 100 mL CH2CI2. The filtrate layers were separated and the aqueous layer was washed 3 x 50 mL CH2CI2. All of the organic layers were combined 5 and concentrated to a thick red oil. The residue was taken up in 150 mL of concentrated HC1 and the solution was refluxed 4 h. The cooled reaction solution was evaporated to dryness and the residue was dissolved in 200 mL of saturated sodium bicarbonate solution. The product ketone was extracted with 2 x 100 mL of EtOAc. The organic layers were combined and dried over Na2SC>4. The product was purified by flash 10 chromatography on S1O2 using pure CH2CI2 to 4% MeOH in CH2CI2 as eluent. The product was isolated as an orange oil (1.23g, 42%); MS, m/z 128=M+1. (e) 4-Amino-4-cyano-l,2-dimethyl-piperidine. 15 l,2-Dimethyl-4-piperidone (1.23g, 9.67 mmol, 1.0 equiv) was dissolved in 39 mL of 2 M NH3 in MeOH (8 equiv NH3)- To this solution was added NaCN (0.52g, 10.6 mmol, 1.1 equiv) and NH4CI (0.57g, 10.6 mmol, 1.1 equiv). The resulting mixture was refluxed for 2 h at which time an additional 39 mL of 2 M NH3 in MeOH was added followed by an additional 2 h of reflux. The reaction was cooled and filtered. The filtrate was 20 concentrated and taken up in 100 mL of CH2CI2 giving more salt precipitate which was removed by a second filtration. The filtrate was then concentrated to thick orange oil (1.32g, 89%). lB NMR showed a 3 to 1 mixture of diastereomers of unknown configuration. The crude product was used without further purification; MS, m/z 154=M+1. 25 (f) Morpholine-4-carboxyIk acid [l-(4-cyano-l,2-dimethyI-piperidin-4-ylcarbamoyl)-3^-dimetIiyl-butyl]-aniide. Morpholine-4-carboxylic acid [ 1 -(4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimetiiyl-butyl]-amide hydrochloride (0.050 g, 0.12 mmol, 1.0 equiv), cyclohexanone (0.015 g, 0.15 mmol, 1.2 equiv), and Na(OAc)3BH (0.046 g, 0.22 mmol, 1.75 equiv) were mixed in 15 5 mL of 1% AcOH in THF. The reaction was stirred at room temperature for 16 h. The reaction was diluted with 25 mL of saturated sodium bicarbonate solution and the product was extracted 4 x 25 mL EtOAc. The organic extracts were combined and concentrated. The crude product was purified by semi-prep reverse-phase HPLC using 20 to 80% CH3CN in water over a gradient of 25 min to yield the desired product, pure, as a white 10 solid (0.012g, 21%); MS, m/z 448=M+1. Following the above procedures the following compound was synthesised: Morpholine-4-carboxyIic acid {l-[4-cyano-l-(tetrahydro-pyran-4-yI)-piperidin-4-15 ylcarbamoyl]-3,3-dimethyl-butyl}-amide; MS, m/z 450=M+1 Following the above procedures the following compounds can be synthesized; Morpholine-4-carboxyIic acid [l-(l-butyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3-20 dimethyl-butyl]-amide Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -pentyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butylj-amide MwphoIine-4-carboxylic acid [l-(4-cyano-l-hexyl-piperidin-4-ylcaibamoyl)-3}3-dimethyl-butyl]-amide Morpholine-4-carboxylic acid {1 -[4-cyano-1 -(1 -ethyl-propyl)-piperidin-4-yIcarbamoy 1] -5 3,3-dimethyl-butyl}-amide Moipholine-4-carboxylic acid {l-[4-cyano-l-(2-methyl-cyclohexyl)-piperidin-4-ylcarbamoyl]-3,3-dimethyl-butyl}-amide 10 Morpholine-4-carboxylic acid {l-[4-cyano-l-(3-methyl-cyclohexyI)-piperidin-4-ylcarbamoyl]-3,3-dimethyl-butyI}-amide Morpholine-4-carboxylic acid {l-[4-cyano-l-(4-methyl-cyclohexyl)-piperidin-4-ylcarbamoyl]-3,3-dimetbyl-butyl}-amide 15 Morpholine-4-carboxylic acid {l-[4-cyano-l-(2-phenyl-cyclohexyl)-piperidin-4-ylcarbamoyl]-3,3-dimethyl-butyl}-amide MorphoIine-4-carboxylic acid {l-[4-cyano-l-(3-phenyl-cyclohexyl)-piperidin-4-20 ylcarbamoyI]-3,3-dimethyI-butyI}-amide Morpholine-4-carboxylic acid {l-[4-cyano-l-(4-phenyl-cyclohexyl)-piperidin-4-y]carbamoyl]-3,3-diniethyl-butyl}-amide 25 Moipholine-4-carboxylic acid {l-[4-cyano-l-(cyclohexyl-methyl)-piperidin-4-yIcarbamoyl]-3,3-dimethyl-butyl}-amide Moipholine-4-carboxylic acid {l-[4-cyano-l-(cyclopropyl-methyl)-piperidin-4-ylcarbaraoy I]-3,3-diraethy 1-buty 1} -amide 30 ^Iorpholine-4-carboxylic acid [l-(l-butyl-4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide Moipholine-4-carboxylic acid [l-(4-cyano-l-pentyl-piperidin-4-ylcarbamoyl)-2-5 cyclohexyl-ethyl]-amide Morpholine-4-carboxylicacid[l-(4-cyano-l-hexyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylj-amide 10 Moipholine-4-carboxylic acid {1 -[4-cyano-1 -(l-ethyl-propyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide Motpholine-4-carboxylic acid {1-[4-cyano- l-(2-methyl-cyclohexyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl} -amide 15 Morpholine-4-caiboxylic acid {1 -[4-cyano- l-(3-methyl-cyclohexyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide Morpholine-4-carboxylic acid {1 -[4-cyano- l-(4-methyl-cyclohexyI)-piperidiii-4-20 ylcarbamoyI]-2-cyclohexyl-ethyl}-amide Morpholine-4-carboxylic acid {1 -[4-cyano- l-(2-phenyl-cyclohexyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide 25 MorphoIine-4-carboxylic acid {1 -[4-cyano-1 -(3-phenyl-cyclohexyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide Moipholine-4-carboxylic acid {1 -[4-cyano- l-(cyclopropyl-methyl)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide 30 Morpholine-4-carboxylic acid {l-[4-cyano-l-(4-phenyl-cycIohexyI)-piperidin-4-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide Morpholme-4-carboxylic acid {l-[4-cyano-l-(cyclohexyl-methyl)-piperidin-4-5 ylcarbamoyI]-2-cyclohexyl-ethyl}-amide EXAMPLE 62 Morpholine-4-carboxylic acid [ 1 -(3-cvano-1 -cyclopropylmethyl-pyrrolidin-3-10 ylcarbamoyl)-2-cyclohexyl-ethylJ-amide. (a) 1 -Cyclopropylmemyl-3-hydroxy-pyrrolidine. 3-Hydroxy-pyrrolidine (5.65 g, 65 mmol, 1.0 equiv) was dissolved in 100 mL of 1% 15 AcOH in THF and cooled to 0 °C. Na(OAc)3BH (24 g, 114 mmol, 1.75 equiv) and cyclopropylcarboxaldehyde (5.0 g, 71 mmol, 1.1 equiv) were added and the resulting mixture was stirred at 0 °C for 1 h and room temperature overnight (16 h). The reaction was diluted with 200 mL of 2 N NaOH, and the product was extracted 3x200 mL of CH2CI2. The organic extracts were combined, dried over NaaSO^ decanted and 20 concentrated to yield the desired product as a free-flowing oil (7.26 g, 79%) which was used without further purification; MS, m/z 142=M+1. (b) l-Cyclopropylmethyl-pyrrolidin-3-one. i solution of oxalyl chloride (13.1 g, 103 mmol, 2.0 equiv) was prepared in 200 mL of dry CH2C12 and cooled under Ar to -78 °C. DMSO (16.1 g, 206 mmol, 4.0 equiv) was added as a solution in 20 mL of CH2CI2 dropwise over a 30 min period giving vigorous gas formation. After addition, the mixture was stirred for an additional 15 min and then a 5 solution of l-cyclopropylmethyl-3-hydroxy-pyrrolidine (7.26 g, 52 mmol, 1.0 equiv) in 50 mL of CH2CI2 was added dropwise over a 30 min period. After complete addition the reaction was stirred an additional a hour at -78 °C. BtiN (31 g, 309 mmol, 6.0 equiv) was added over a period of 10 min. The cold-bath was removed and the mixture was stirred while warming for 1 h. The mixture was diluted with 500 mL of water and 100 10 mL of CH2Q2. After thorough mixing, the layers were separated and the organic layer was washed with 200 mL of water, dried over Na2S04, decanted, and concentrated to a yellow oil (6.1 g, 85%) which was used without further purification. (c) 3-Amino-3-cyano-l-cyclopropyl-pyrrolidine. 15 l-Cyclopropylmethyl-pyrrolidin-3-one (6.1 g, 44 mmol, 1.0 equiv), NaCN (2.4 g, 48 mmol, 1,1 equiv) and NH4CI (2.6 g, 48 mmol, 1.1 equiv) were mixed in 88 mL of 2 M NH3 in MeOH, and the resulting mixture was refluxed for 2 h at which time another 88 mL of 2 M NH3 in MeOH was added followed by another 2 h at reflux. The reaction 20 mixture was cooled, filtered, concentrated, and taken up in 100 mL of CH2CI2. The mixture was filtered a second time and concentrated to a red oil (5.9 g) which was used without further purification. (d) Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclopropylmethyl-pyrrolidin-3- 25 ylcarbamoyl)-2-cyclohexyl-ethyl]-amide. N-(4-morpholinecarbonyl)-L-cyclohexyl alanine (l.OOg, 3.52 mmol, 1.00 equiv) and EDC (1.01 g, 4.58 mmol, 1.30 equiv), and HoBt (0.72 g, 4.58 mmol, 1.30 equiv) were mixed 20 mL of DMF for 15 min followed by addition of 3-amino-3-cyano-l-5 cyclopropyl-pyrrolidine (0.86 g, 5.28 mmol, 1.5 equiv) and N-methyl-morpholine (1.42 g, 14.1 mmol, 4.0 equiv). The resulting solution was stirred at room temperature for 16 h. The reaction solution was diluted with 100 mL saturated sodium bicarbonate solution and the product was extracted with 2x100 mL EtOAc. The organic extracts were combined and concentrated. The crude product was purified by semi-prep reverse-phase HPLC 10 using 40 to 90% CH3CN in water over a gradient time of 30 min to give the desired product in two peaks (diastereomers) eluting at 9.5 min and 10.3 min respectively (128 mg and 98 mg, 15% total purified yield); MS, m/z 432=M+1 for both peaks. Following the above procedures the following compounds were also prepared: 15 MorphoIine-4-carboxylic acid {l-[3-cyano-l-(2-chloro-benzyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 502=M+1 Morpholine-4-carboxylic acid {l-[3-cyano-l-(cyclohexyl-methyl)-pyrrolidin-3-20 ylcarbamoyl]-2-cyclohexyl-ethyl} -amide; MS, m/z 474=M+1 Morpholine-4-carboxylic acid {l-[3-cyano-l-(l-methyl-ethyl)-pyrrolidin-3-ylcarbamoyI]-2-cyclohexyl-ethyl}-amide MS, m/z 420=M+1 25 Morpholine-4-carboxylic acid {l-[3-cyano-l-(3-ben2yloxy-benzyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 574=M+1 Moipholine-4-carboxylic acid {1 -[3-cyano-1 -(2-benzyIoxy-ben2yl)-pyirolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 574=M+1 5 Morpholine-4-carboxylic acid {l-[3-cyanol-(3,5-difluoro-benzyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl} -amide; MS, m/z 504=M+1 MorphoIine-4-carboxylic acid {1 -[3-cyano-1 -(2,6-difluoro-benzyl)-pyrrolidin-3-ylcarbaraoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 504=M+1 10 MorphoIine-4-carboxyIic acid {1-[3-cyano-l-(3-trifluoromethyI-benzyI)-pyrroIidin-3-ylcarbamoyl]-2-cycIohexyI-ethyl}-amide; MS, m/z 536=M+1 Morpholine-4-carboxylic acid {l*[3-cyano-l-(3-phenoxy-benzyl)-pyrrolidin-3-15 ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 560=M+1 Moipholine-4-carboxylic acid [l-(3-cyano-l -cyclohexyl-pyirolidin-3-ylcarbamoy])-2-cyclohexyl-ethyl]-amide; MS, m/z 460=M+1 20 Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(1 -methyl-piperidine-4-yl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 475=M+1 Morpholine-4-carboxylic acid {1-[3-cyano-1-(3-methyI-benzyl)-pyrrolidin-3-ylcarbamoyI]-2-cyclohexyl-ethyl}-amide; MS, m/z 482=M+1 25 Morpholine-4-carboxyIic acid {l-[3-cyano-l-(2-phenoxy-benzyl)-pyiToIidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 560=M+1 Morpholine-4-carboxylic acid {1-[3-cyano-l-(4-fluoro-benzyl)-pyrrolidin-3-30 ylcarbamoyl3-2-cyclohexyl-etbyl}-amide; MS, m/z 486=M+1 Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(2,4,6-trimethyl-benzyI)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 510=M+1 Motpholine-4-carboxylic acid {l-[3-cyano-l-(l#-mdol-3-ylmemyl)-pyrroIidin-3-5 ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 507=M+1 Morpholine-4-carboxylic acid [1 -(3-cyano-1 -cyclopropyI-pyrroIidin-3-yIcarbamoyl)-2-cyclohexyl-ethylj-amide; MS, m/z 418=M+1 10 MorphoIine-4-carboxylic acid {l-[3-cyano-l-(l-pyridin-3-ylmethyI)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 469=M+1 Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -cyclohexylmethyl-pyrrolidin-3-ylcarbamoyI)-3,3-dimethyl-butyl]-amide; MS, m/z 448=M+1 15 Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-2-hydroxyniethyl-pyirolidin-3-ylcarbamoyl)-3,3-dimetbyl-butyl]-amide; MS, m/z 472=M+1 MorphoIine-4-carboxylic acid [ 1 -(3-cyano- l-isobutyl-pyirolidin-3-ylcarbamoyl)-2-20 cyclohexyl-ethyl]-amidej MS, m/z 434=M+1 MoiphoIme-4-carboxyUcacid[l-(3-cyano-l-isopropyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; MS, m/z 394=M+1 25 Morpholine-4-caiboxylic acid [l-(3-cyano-l-isobutyl-pyirolidin-3-ylcarbamoyl)-3,3-dimethyl-butylj-amide; MS, m/z 408=M+1 Morpholine-4-carboxylic acid {l-[3-cyano-l-(l-etbyl-propyl)-pyrrolidiii-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 448=M+1 30 Mifpholine-4-carboxylic acid {l-[3-cyano-l-(l-ethyl-propyl)-pyrrolidin-3-ylcarbamoyl]-3,3-dimethyl-butyl}-amide; MS, m/z 422=M+1 MorphoIine^carboxylicacid[l-(3-cyano-l-phenethyl-pyn"olidin-3-ylcarbamoyl)-2-5 cyclohexyI-ethyI]-amide; MS, m/z 482=M+1 MorphoIine-4-carboxylic acid [ 1 -(3-cyano-1 -methyl-piperidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; MS, m/z 406=M+1 10 Morpholine-4-carboxylic acid [1-(3-cyano-l-propyl-pyrrolidm-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; MS, m/z 3 94=M+1 Morpholine-4-carboxylicacid[l-(3-cyano-l-propyI-pyrroIidin-3-ylcarbanioyl)-2-cycIohexyl-ethyl]-amide; MS, m/z 420=M+1 15 Morpholine-4-carboxylic acid {1-[3-cyano-1-(/ra«j-4-methyl-cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 474=M+1 Morpholine-4-carboxylic acid {l-[3-cyano-l-(ciy-4-methyl-cyclohexyl)-pyrrolidin-3-20 ylcarbamoyI]-2-cyclohexyl-ethyl}-amide;MS,m/z474=M+l MorphoIine-4-carboxylic acid [ 1 -(3-cyano-1 -cyclopentyl-pyrrolidin-3-yIcarbamoyl)-3,3-dimethyl-butyl]-amide; MS, m/z 420=M+1 25 Moipholine-4-carboxyIic acid [ ] -(3-cyano-1 -isobutyl-piperidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; MS, m/z 448=M+1 Morpholine-4-carboxylic acid [ 1 -(3-cyano-1 -cyclopentyl-pyrrolidra-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; MS, m/z446=M-H 30 1 -Benzyl-3-cyano-3- {3-cyclohexyl-2-[(morpholine-4-carbonyl)-araino]-propionylamino}-pyrrolidine-2-carboxylic acid methyl ester; MS, m/z 526=M+I Morpholine-4-carboxylic acid {l-[3-cyano-l -(cij-4-methyl-cyclohexyl)-pyrrolidin-3-5 y]carbamoyl]-3,3-dimethyl-butyl}-amide; MS, m/z 448=M+1 Morpholme-4-carboxylic acid {I -[3-cyano-1 ^trans^-meihyl-cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-3,3-dimethyl-butyl}-amide; MS, m/z 448=M+1 10 Morpb.oline-4-carboxylic acid [l-(3-cyano-l-cyclohexyl-pyrrolidin-3-ylcarbamoyl)-2-(4-iodo-phenyl)-ethyl]-amide; MS, m/z 580=M+1 Morpholine-4-carboxylic acid {l-[3-cyano-l-(3-methoxy-benzyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 498=M+1 15 Morpholine-4-carboxylic acid {l-[3-cyano-l-(naphthalen-2-ylmethyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 518=M+1 Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclopentylmethyl-pyrrolidin-3-20 ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; MS, m/z 460=M+1 Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclohexylmethyl-pyrrolidin-3-ylcarbamoyl)-3-methyl-butyl]-amide; MS, m/z 434=M+1 25 [l-(3-Cyano-l^yclohexyImemyl-pyrroHdm-3-ylcarbamoyl)-3-methyI-butyl]-carbamic acid benzyl ester; MS, m/z 455=M+1 EXAMPLE 63 30 Morpholine-4-carboxylic acid (l-{3-cyano-l-[l-(toluene-4~sulfonyl)-l^T-indol-3-ylmethyl]-pyrrolidin-3-ylcarbamoyl} -2-cyclohexyl-etbyl)-amide. (a) 1 -[l-(Toluene-4-sulfonyl> l//-indoI-3-ylmethyl]-3-hydroxy-pyrroIidine. l-(Toluene-4-sulfonyl)-lH-indole-3-carboxaldehyde (prepared as described in Chatterjee, 5 R. K.; Indian J. Chem Sect. B 1994,33(1), 32-37) was reacted with 3-hydroxypyrrolidine as described for cyclopropylcarboxaldehyde in Example 60 part (a) to provide the desired product. (b) Morpholine-4-carboxylic acid (l-{3-cyano-l-[l-(toluene-4- sulfonyl)-l#-indol-3- 10 ylmethyl]-pyrroHdin-3-ylcarbamoyl}-2-cyclohexyl-ethyl)-arnide The title compound was prepared from the product of part (a) and N-(4-morpholinecarbonyi)-L-cyclohexyl alanine by the procedure described in Example 60; MS,m/z661=M+l. 15 EXAMPLE 64 Morpholme-4-carhoxvlic acid {1 -[4-cvano-1 -(\ -methyl-piperidine-4-carbonvn-piperidin-4-ylcarbamoyl]-2-cyclohexy]-ethyl}-amide. 5 A solution of l-methyl-piperidin-4-yI carboxylic acid (0.050 g, 0.30 mmol, 1.0 equiv) and EDC (0.057 g, 0.30 mmol, 1.0 equiv) was prepared in 15 mL of DMF. After 15 min morpholine-4-carboxylic acid [ 1 -(4-cyano-piperidin-4-ylcarbamoyl>2-cyclohexyl-ethyl]- 10 amide hydrochloride (0.128 g, 0.30 mmol, 1.0 equiv) was added followed by N-methyl-morpholine (0.12 g, 1.2 mmol, 4.0 equiv) followed by stirring overnight (16 h). The reaction mixture was diluted with 100 mL of saturated sodium bicarbonate solution and the product was extracted with 2x50 mL of EtOAc. The combined organic extracts were concentrated. The crude product was purified by semi-prep reverse-phase HPLC using 15 20 to 80% CH3CN in water over a gradient of 25 min to yield the desired product as a white solid (39 mg); MS, m/z 517=M+1. Following the above procedure the following compound was also synthesized; 20 Morpholine-4-carboxylic acid {l-[4-cyano-l-(pyridine-4-carbonyl)-piperidin^4-ylcarbamoyrj-2-cyclohexyl-ethyl} -amide; MS, m/z 497=M+1 EXAMPLE 65 N-[ 1 -T4-Cyano-1 -meth vl-piperidin-4-vlcarbamovlV2-cvclohexvl-ethvn-4-methanesulfonylamino-benzamide. 5 ' (a) 4-Methanesulfonylamino-benzoic acid. Ethyl 4-amino-benzoate (5 g, 30 mmol, 1.0 equiv) was mixed in 50 mL of CH2CI2 with Et3N (6.1 g, 60 mmol, 2.0 equiv). The solution was cooled to 0 °C and methanesulfonyl chloride (3.8 g, 33 mmol. 1.1 equiv) was added as a solution in 15 mL of CH2O2 10 dropwise over a 15 min period. The reaction was stirred for 4 h at which time it was diluted with 50 mL of water. Layers were separated and the organic layer was washed with 50 mL of saturated sodium bicarbonate solution and concentrated. The resulting ester was dissolved in 50 mL of MeOH and treated with 50 mL of 5 N NaOH for 4 h. The reaction solution was extracted with Et20 and the aqueous layer was acidified to give 15 a white precipitate that was collected by filtration. The solid was dried and used without further purification. (b) JV-[H4-Cyano-l-memyl-piperidm-^ylcarbamoyI)-2-cycIohexyl-ethyI]-4-methanesulfonylamino-benzamide. 20 This compound was prepared from the product of part (a) using the procedure described in Example 24 to yield the desired product as a white solid; MS, m/z 490=M+1. Following the above procedures the following compounds were also prepared: N-[ 1 -(1 -ben2yl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyIj-4-5 methanesulfonylamino-benzamide; MS, m/z 526=M+1 N-[ 1 -(1 -beri2yl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-4-methanesulfonylamino-benzamide; MS, m/z 552=M+1 10 N~[ l-(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-4-methanesulfonylamino-benzamide; MS, m/z 464=M+1 EXAMPLE 66 15 Morpholme-4-carboxylic acid [ 1 -H -benzyl-3-cyano-1 -oxy-pyrrolidinT3-ylcarbamoyD-2-cvclohexvl-ethv1]-amide. (a) Morpholine-4-carboxylic acid [l-(l-ben2yl-3-cyano-l-oxy-pyrrolidin-3- 20 ylcarbamoyl)-2-cyclohexyl-ethyl]-amide. Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrroHdin-3-ylcarbamoyl)-2-cycIohexyl-ethyI]-amide (0.50 g, 1.1 mmol, 1.0 equiv) was dissolved in CH2C12 (25 mL) and cooled to -78 °C under Ar. Solid K2C03 (0.22 g, 1.7 mmol, 1.5 equiv) was added 25 followed by addition of solid m-CPBA (0.24 g, 1.1 mmol, 1.0 equiv). The resulting lecture was stirred at -78 °C for 2 h and, then, allowed to warm to room temperature. The reaction mixture was filtered and the solvent removed in vacuo. The residue was purified by flash chromatography on silica gel using 10-75% MeOH-EtOAc as a gradient eluent to give the desired product (0.32 g, 62%) as a white solid; MS, m/z 484=M+1. 5 EXAMPLE 66 3-Cyano-3-{3-cyclohexyI-2-[rmorphoIine-4-carbonyIVamino]-propionylamino}-pyrrolidine- 1-carboxylic acid benzyl ester. 10 (a) 3-Hydroxy-pyrrolidine-l-carboxylic acid benzyl ester. 3-Hydroxy-pyrrolidine (10 g, 115 mmol, 1.0 equiv) was dissolved in 2 N NaOH (100 mL) and the mixture was cooled to 0 °C. Benzylchloroformate (21 g, 126 mmol, 1.1 15 equiv) was added dropwise over a 45 min period. After addition, the reaction was stirred at room temperature for 4 h at which time the pH was adjusted to 7-8 using concentrated HC1. The product was extracted with 3x 100 mL of CH2CI2. The organic extracts were combined and dried over Na2SC>4, decanted and concentrated in vacuo to yield the desired product as a light yellow oil (24.1 g, 95%) that was used without further purification. 20 (b) 3-Oxo-pyrrolidine-l-carboxylic acid benzyl ester. A solution of oxalyl chloride (12.6 g, 99 mmol, 2.0 equiv) was prepared in 250 mL of dry CH2C12 and cooled under Ar to -78 °C. DMSO (15.5 g, 199 mmol, 4.0 equiv) was added dropwise over a 15 min period giving vigorous gas formation. After addition, the mixture was stirred for an additional 25 min and then a solution of 3-hydroxy-5 pyrrolidine-1-carboxylic acid benzyl ester (11 g, 50 mmol, 1.0 equiv) in 20 mL of CH2CI2 was added dropwise over a 10 min period. After complete addition the reaction was stirred an additional a hour at -78 °C. Et3N (55 mL, 398 mmol, 8.0 equiv) was added over a period of 10 min. The cold-bath was removed and the mixture was stirred while warming for 2 h. The mixture was diluted witii 500 mL of water. After thorough mixing, 10 the layers were separated and the aqueous layer was extracted 2x150 mL of CH2CI2. The combined organic layers were washed with 200 mL of sodium bicarbonate solution and 200 mL of brine, dried over Na2S04, decanted, and concentrated to a yellow oil. The product was purified by flash chromatography on silica gel using CH2CI2 as eluent to yield the desired product as a colorless oil (8.5 g). 15 (c) 3-Amino-3-cyano-pyrrolidine-l-carboxylic acid benzyl ester. 3-Amino-3-cyano-pyrrolidine-1-carboxylic acid benzyl ester was prepared from the ketone from part (b) using the procedure described in Example 1 part (a) to yield the 20 desired product as a 2 to 1 to 1 mixture of amino-nitrile, cyanohydrin and starting ketone that was used without further purification. (d) 3-Cyano-3- {3-cyclohexyl-2-[(moroholme-4-carbonyl)-amino]-propionylamino} - pyrrolidine-1 -carboxylie acid benzyl ester. 3-Cyano-3- {3-cyclohexyl-2-[(morpholine^-carbonyl)-amino]-propionylamino} -pyrrolidine-1-carboxylic acid benzyl ester was prepared from the amine from part (c) using the procedure described in Example 1 part (a) to yield after purification on silica, 5 the desired product as an off-white hard foam; MS, m/z 512=M+1. Following the above procedures the following compound was also synthesized; 3-Cyano-3- {3-cyclohexyl-2-[(morpholme-4-carbonyl)-arnmo]-propionylamino} -10 pyrrolidine-1-carboxylic acid (2-propen-l-yl) ester, MS, m/z 462=M+1. EXAMPLE 6S Morpholine-4-carboxvlic acid (1 -[3-cvano-1 ^5.5-dimethvl-3-oxo-cvclohex-1 -enylV 15 pyrrolidin-3-vlcarbamoyl]-2-cyclohexvl-ethvU-amide. . 3-Cyano-3-{3 4-Cvano-4-{3-cvclohexvl-2-r(piperidme-4-carbonvlVaminol-propionvlamino}-piperidine-1-carboxylic acid ethyl ester. 15 (a) 4-Cyano-4- {3-cyclohexyl-2-[(l-^butoxycarbonyl-piperidUne-4H»rbonyl)-amino]-propionylamino}-piperidine-l-carboxylic acid ethyl ester. This intermediate was prepared from 1-t-butoxycarbonyl-piperidine carboxylic acid and 4- (b) 4~Cyano-4- {3-cyclohexyl-2-[(piperid^ne-4-carbonyl)-arru^o3-propionylamino} -piperidine-1-carboxylic acid ethyl ester. The ester from (a) was dissolved in 10 mL of 4 N HC1 in 1,4-dioxane at 0 °C for 1 hour. The solution was concentrated in vacuo and the salt neutralized by sodium bicarbonate solution and the product extracted with CH2CI2. After concentration of the organic 5 extract, the crude product was purified by reverse-phase HPLC to yield the desired product; MS, m/z 462=M+1. Following the above procedures the following compounds were also synthesized: 10 4-Cyano-4-{3-cyclohexyl-2-[(4-methyl-piperazme-l-carbonyl)-amino]-propionylamino}-piperidine-1-carboxylic acid ethyl ester, MS, m/z 477=M+1 4-Methyl-piperazine-l-carboxylic acid [l-(4-cyano-tetrahydro-pyran-4-ylcarbamoyl)-2-cyclohexyl-ethyljamide; MS, m/z 406=M+L 15 EXAMPLE 70 Morpholine-4-carboxylic acid [l-(l->benzyl-3-cyano-azetidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide. 20 (a) 3-Amino-l-benzyI-3-cyano-azetidine. l-Benzyl-3-oxo-azetidine (1.6 g, 10 mmol, 1.0 equiv), prepared as described in the literature (Katritzky, A. R.; Cundy, D. J.; J. Heterocyclic Chem. 1994,31 271-275), was dissolved in dry MeOH and the solution was cooled to -78 °C. Gaseous ammonia was 5 was bubbled through the solution for 30 mins at which time 3 angstrom molecular sieves were added and the mixture transferred to a pressure tube. The solution was heated for 30 min at 60 °C. The mixture was cooled to -78 °C, the tube opened and KCN (0.65 g, 10 mmol, 1.0 equiv) and NH4CI (0.27 g, 5 mmol, 0.5 equiv) were added and the tube was resealed and heated at 60 °C for 4 h. The reaction mixture was filtered and the filtrate 10 was evaporated. The crude residue was purified by flash chromatography using 2% MeOH in CH2CI2 to give the desired product (0.11 g, 6%) as a brown oil; MS, m/z 188=M+1. (b) Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-azetidin-3-ylcarbamoyl)-2- 15 cyclohexyl-ethyl]-amide. The title compound was prepared from 3-ainino-l-benzyl-3-cyano-azetidine and JV-(4* morpholinecarbonyl)-L-cyclohexyl alanine using to the procedure described in Example 1 step (d) to yield the desired product as a white solid; MS, m/z 454=M+1. 20 EXAMPLE 71 Morpholine-4-carboxylic acid [ 1 -(3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethylj-amide. 5 3 -Cyano-3- {3-cyclohexyl-2-[(morpholine-4-carbonyl)-amino]-propionylamino } -pyrrolidine-1-carboxylie acid benzyl ester (0.1 g, 0.20 mmol, 1.0 equiv) was dissolved in 15 mL of absolute EtOH. 10% Pd on carbon (20 mg) was added and the mixture was 10 stirred under 1 atm of H2 until the starting material disappeared by TLC (5% MeOH in CH2CI2. The crude mixture was filtered on diatomaceous earth and the filtrate was concentrated. The crude material was purified by reverse-phase HPLC to give two diastereomers; MS, m/z 378=M+1. 15 - EXAMPLE 72 Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(2-methyl-2-phenyl-propyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide. Reductive animation of morpholine-4-carboxylic acid [l-(3~cyano~pyrrolidin-3-ylcarbamoyI)-2-cyclohexyl-ethyl]-amide with 2,2-dimethyl-2-phenyl-acetaldehyde and Na(OAc>}BH in 1% AcOH in THF provided the desired product; MS, 510=M+1. 5 Following the above procedure the following compounds were also synthesized; Morpholine-4-carboxylic acid {l-[3-cyano-l-(indan-2-ylmediyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; MS, m/z 508=M+1 10 Morpholine-4-carboxylic acid {l-[3-cyanc-H5-methyl-thiophen-2-ylmemyl)-pyrrolidin-3-ylcarbamoyI]-2-cyclohexyl-ethyl}-amide; MS, m/z 488=M+1. EXAMPLE 72 15 2-{[AcetyHmino-(4-memoxy-phenyl)-memyl]-ammo}-N-(4-cyano-l-memyl-piperidin-4-yl>3-cyclohexyl-propionamide (Method E). (a) N-(4-methoxy-thiobenzoyl)acetamide. 5 A solution of acetyl chloride (4.69 g, 59.8 mmol) in acetone (20 mL) was added dropwise to a solution of 4-methoxythiobenzamide (5.00 g, 29.9 mmol) and pyridine (4.76 g, 60.1 mmol) in acetone (30 mL). The reaction mixture was heated to reflux for 30 min then poured onto ice water. The resulting precipitate was isolated via filtration and dried under vacuum overnight to provide a light yellow/orange solid (4.52 g, 72%). !H 10 NMR (400 MHz, CDC13) 5 2.56 (s, 3H), 3.87 (s, 3H), 6.89 (dd, J= 6.9,2.0 Hz, 2H), 7.77 (dd,J = 6.9,2.0Hz,2H). (b) 2- {[Acetylimino-(4-methoxy-phenyl)-methyl]-amino} -N-(4-cyano-1 -methyl- 15 piperidin-4-yl)-3-cyclohexyl-propionamide. 2-Chloro-N-methylpyridinium iodide (660 mg, 2.58 mmol), was added to a solution of N-(4-methoxy-thiobenzoyI)acetamide (420 mg, 2.01 mmol), 2-amino-N-(4-cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-propionamide bis hydrochloride salt (730 mg, 2.00 mmol), 20 and N,N-diisopropylethylamine (1.05 mL, 6.02 mmol) in dichloromethane (8.0 mL). The reaction mixture was stirred at room temperature for 2 h, then diluted with dichloromethane (100 mL)and washed with 2x150 mL of saturated sodium bicarbonate. The organic phase was dried (MgSC>4) and concentrated. The resulting residue was chromatographed over 100 g of flash silica first using EtOAc, then 25 dichloromethane/methanol 9:1 as the eluant to provide the desired product as an off white solid (377 mg, 40%). *H NMR (400 MHz, DMSO-d6) 5 0.70-0.90 (m, 2H), 1.00-1.30 (m, 4H), 1.35-1.65 (m, 8H), 1.72 (s, 3H), 1.85-2.20 (m, 6H), 2.48-2.60 (m, 1H), 3.78 (s, 3H), 4.20-4.35 (m, 1H), 6.95-6.99 (m, 2 H), 7.33 (d, J= 8.4 Hz, 1H), 7.72 (d, J= 8.4 Hz, 1H). MS,m/z468 = M+l. 30 EXAMPLE 73 2-[(Acetylimino-phenyl-methyl)-amino]-N-(4-cyano-1 -methyl-piperidin-4-yl)~3 -5 cyclohexyl-propionamide. (a) Thiobenzoyl acetamide was prepared according to the procedure from Example 1, step a, starting with thiobenzamide. 10 (b) The title compound was prepared starting from thiobenzoyl acetamide and 2-amino-N-(4-cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-propionamide bis hydrochloride salt according to the procedure from Example 72, step b. MS, m/z 438 = M+l. EXAMPLE 74 15 2- {[AcetyIimino-(4-fluoro-phenyl)-methyI]-amino} -N-(4-cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-propionamide. 5 (a) N-(4-Fluoro-thiobenzoyl )acetamide was prepared according to the procedure from Example 72, step a, starting with 4-fluorothiobenzamide. (b) The title compound was prepared starting from N-(4-fluoro-thiobenzoyl) acetamide and 2-amino-N-(4-cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-propionamide bis hydrochloride salt according to the procedure from Example 72, step b. MS, m/z 456 10 -M+l. EXAMPLE 75 2-[(Acetylimmo-phenyl-memyl)]-aniko]-N-[3 EXAMPLE 76 cyclohexyl-propionamide bis hydrochloride salt according to the procedure from Example 76, step b,. MS, m/z 519 =* M+l. EXAMPLE 80 5 N-(4-Cyano-l-memyl-piperidin-4-yl)-3-cyclohexyl-2-[(ethylcarbamoylimino-phenyl-methyl)-amino]-propionamide (Method F). 10 (a) Benzimidic acid methyl ester. Benzimidic acid methyl ester hydrochloride (5 g, 29.1 mmol) was partitioned between 15 saturated sodium carbonate solution (200 mL) and diethyl ether (100 mL). The organic layer was dried (MgS04) and concentrated to provide the desired product as a colorless liquid (3.20 g, 81%). This material was used without further purification. 'H NMR (400 MHz, CDC13) 6 3.93 (s, 3H), 7.39-7.46 (m, 3H), 7.75 (d, J = 1.1 Hz, 2H). 20 (b) l-Ethyl-3-(methoxy-phenyl-methylene)-urea. A neat mixture of benzimidic acid methyl ester (750 mg, 5.56 mmol) and ethyl isocyanate (808 mg, 11.3 mmol) was stirred at 50 °C for 24 h. Excess isocyanate was removed under vacuum to provide the desired product as a colorless viscous oil (1.09 g, 25 95%). This materia! was used without further purification. !JI NMR (400 MHz, CDCh) (c) N-(4-Cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-2-[(ethylcarbamoyHmino- 5 phenyl-methyl)-ammo]-propionamide. A solution of l-ethyl-3-(methoxy-phenyl-methyIene)-urea (350 mg, 1.70 mmol), 2-araino-N-(4-cyano-1 -methyl-piperidin-4~yl)-3-cyclohexyI-propionamide bis hydrochloride salt (512 mg, 1.40 mmol) and N,N-diisopropylethylamine (352 mg, 2.73 10 mmol) in dry methanol (5.0 mL) was stirred at room temperature for 60 h. The reaction mixture was concentrated and the resulting residue was chromatographed over 50 g of flash silica gel using dichloromethane to 5% methanol in dichloromethane as the eluant. This provided the desired product as a light yellow solid (280 mg, 43%) which was further purified by HPLC using a 20 x 250 mm Cig reverse phase column with the 15 method being 20% acetonitrile in water to 90% acetonitrile in water. MS, m/z 467 = M+l. EXAMPLE 81 20 N-r4-Cvano-l-methvl-piperidin^-vn-3-cvclohexvl-2-f1.1-dioxo-lJJ-lX,6-hen2o[d]isothiazol-3-ylammoVpropionamide fMethod G). . 25 (a) A suspension of 3-chloro-benzo[d]isothiazole 1,1 -dioxide (300 mg, 1.49 mmol) and 2-amino -N-(-4-cyano-l-memyl-piperidin-4-yl)-3-cycIohexylpropionamide bis hydrochloride salt (500 mg, 1.37 mmol) was prepared in 5.5 mL of acetonitrile. Triethylamine (575 4.10 mmol) was added and the reaction mixture was stirred at room temperature for 1 day. The suspension was filtered to remove triethylamine hydrochloride and the filtrate was concentrated. The resulting residue was 5 chromatographed over 50 g of flash silica using dichloromethane/ methanol 9:1 as the eluant to provide the desired product as a light yellow solid (310 mg, 49%). ]H NMR 10 EXAMPLE 82 15 N-f 4-Cvano-1 -propyl-piperidin-4-ylV 3-cyclohex vl-2-C 1.1 -di oxo-1H-1X6-benzo[d]isothiazol-3-ylammoVpropionamide. 20 The title compound was prepared starting from 3-chloro-benzo[d]isothiazole 1,1 -dioxide and 2-amino -N-(-4-cyanc-l-propyl-piperidin-4-yl)-3-cyclohexylpropionamide bis hydrochloride salt according to the procedure from Example 81, except that the compound was further purified by HPLC using a 20 x 250 mm Cig reverse phase column with the method being 20% acetonitrile in water to acetonitrile. MS, m/z 486 = M+l. 25 EXAMPLE 83 5 2-f 1.1 -dioxo-1 H-17i6-benzo[ d"iisothia2ol-3-vlamino^-4.4-dimethy1-pentanoic acidf4-cyano-l-propylpiperidin-4-ylVamide. The title compound was prepared starting from 3-chloro-benzo[d]isothiazole 1,1-dioxide and 2-amino -4,4-dimethyl-pentanoic acid (4-cyano-l-propyl-piperidin-4-yI)amide bis 10 hydrochloride salt according to the procedure from Example 81, except that the compound was further purified by HPLC using a 20 x 250 mm Cig reverse phase column with the method being 20% acetonitrile in water to acetonitrile. MS, m/2 460 = M+l. 15 EXAMPLE 84 N-P-Cvano-U) -eftyl-propylVpvrroIidm~3-vll-3^vclohexyl-2-f 1.1 -dioxo-1//-1I6-20 benzo[d3isothiazol-3-vlaminoVpropionamide. The title compound was prepared starting from 3-chloro benzo[d]isothiazole 1,1-dioxide and2-animc^-N-[3-cyano-l-(l-ethyl-propyl)-pyrrolidm-3-yl]-3-cyclohexyl-propionamide bis hydrochloride salt according to the procedure from Example 81, except that the 5 compound was further purified by HPLC using a 20 x 250 mm Cig reverse phase column with the method being 40% acetonitrile in water to acetonitrile. MS, m/z 500 = M+l. 10 EXAMPLE 85 N-(3-Cyano-l -cyclohexyl-pyrrolidin-3-ylV3-cyclohexyl-2-f 1.1 -dioxo- 1H-1X6-15 benzofd|isothiazol-3-vlaminoVpropionamide. The title compound was prepared starting from 3-chloro benzo[dJisothiazole 1,1-dioxide and 2-amino~N-{3-cyano-1 -cyclohexyl-pyrrolidin-3-yl)-3-cyclohexyl-propionamide bis hydrochloride salt according to the procedure from Example 81, except that the 20 compound was further purified by HPLC using a 20 x 250 mm Cig reverse phase column with the method being 40% acetonitrile in water to acetonitrile. MS, m/z 512 = M+l. EXAMPLE 86 25 N-(4-Cyano-methyl-piperidin-4-vn-3-cvclnhexyl-2-(f3-oxo-3H-isoindol-l-ylamma)-propionamide. The title compound was prepared starting from 3-imino-2, 3-dihydro-isoindol-l-oneand 2-amino-N-(4-cyano-1 -methyl-piperidin-4~yl)-3-cyclohexyl-propionamide bis hydrochloride salt according to the procedure from Example 81, except that refluxing 5 THF was used as the solvent. The compound was further purified by HPLC using a 20 x 250 mm Cis reverse phase column with the method being 20% acetonitrile in water to acetonitrile. MS, m/z 422.5 = M+1. EXAMPLE 87 10 4T4-Dimethyl-2-f3-oxo-3H-isoindol-l -ylamino)-pentanoicacid-(4-cyano-1 -propyl-piperidm-4-ylVamide. The title compound was prepared from 3-imino-2,3-dihydro-isoindol-l-oneand 2-amino 15 -4,4-dimethyI-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)amide bis hydrochloride salt according to the procedure from Example 86. MS, m/z 424.5 = M+l. EXAMPLE 88 N-f4-cvano-l-methyl-piperidin-4-y1V3-cyclohexvl-2-f5.6-difluoro-3'Oxo-3H-isoindol-l-ylamino') propionamide. 5 (a) 2-Chloro-4,5-difluorobenzoic acid methyl ester. 2-Chloro-4,5-difluorobenzoic acid (1.93 g, 10 mmol) was dissolved in 20 mL of acetone. 10 Cesium carbonate (5.29 g, 15 mmol) was added followed by iodomethane (1.0 mL, 15 mmol). This reaction mixture was heated under reflux for 1 h and then cooled to room temperature. This suspension was then diluted with 40 mL of ethyl ether. The solid was removed by filtration and washed with ethyl ether. The filtrate was evaporated in vacuo to give the title compound in quantitative yield as a clear oil. 15 (b) 2-Cyano-4,5-difluorobenzoic acid methyl ester. The above oil (2.06 g, 10 mmol) was dissolved in 10 mL of JV-methyl pyrrolidinone. Copper (I) cyanide (1.79 g, 20 mmol) was added. This mixture was heated at 195 °C 20 - under nitrogen for 1 h. After cooling to room temperature, this solution was diluted with 100 mL of water. The resulting solid was collected by filtration. This solid was then suspended in a rapidly stirred solution of potassium cyanide (0.5 g) in 30 mL of water for 1 h. EtOAc (30 mL) was added. The mixture was filtered through diatomaceous earth. The organic phase was separated and the aqueous phase was extracted with EtOAc (20 mL x 2). The combined organic phase was washed with brine and dried over magnesium sulfate. The solvent was removed in vacuo. The residue was crystallized from ethyl ether and petroleum ether to give the title compound as a yellow solid (1.26 g, 64 %). 5 (c) 5,6-Difluoro-2,3-dmydro-3-miino-lif-isoindol-l-one. The above solid (0.493 g, 2.5 mmol) was dissolved in 20 mL of MeOH. This solution was saturated with ammonia at 0 °C and then stirred in a pressure tube at room temperature for 3 days. The solid was collected by filtration and washed with ethyl ether 10 to give the title compound as a yellow solid (0.363 g, 80 %). The title compound was prepared from 5,6^fluoro-2,3- 20 N-r4-cvano-l-methvl-piperidin-4-vlV3-cvclohexvl-2-(,2-oxo-2H-benzorelfl.31oxazin-4-ylaminoVpropionarmde. The title compound was prepared starting from 4-chloro-benzo[e][l,3] oxazin-2-one 25 (prepared from benzo [e][l,3] oxazin-2,4-dione and PCls in refluxing toluene) and 2- amino-N-(4-cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-propionamide bis hydrochloride salt according to the procedure from Example 81. MS, m/z 438 = M+l. 5 ■';■ EXAMPLE 90 10 N-f4~cyano-1 -methvl-piperidm-4-vlV2-r4-cyano-pvrimidin-2-vlaminoV3 -cvclohexvl-propionamide fMethod G\. 2-Chloro^pyrimidinecarbonitrile (0.3 mmol, Daves, G. D. Jr., O'Brien, D. E., Cheng, C. 15 C. J. Het. Chem, 1964,1,130) and 2-amino-iV-(4-cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-propionamide (0.7 mmol) were dissolved in acetonitrile (10 mL) containing Af.A'-diisopropylethylamine (0.6 mmol). The solution was heated to a gentle reflux for 17 h. The volatiles were evaporated and the residue was subjected to chromatography (silica gel, eluant = EtOAc then MeOH). The methanolic fraction was concentrated to a 20 colorless solid which was rechromatographed (10% MeOH/EtOAc) to afford the title compound as a colorless solid (52%). The material was recrystallized from dichloromethane/petroleum ether. EXAMPLE 91 25 N-r4-cvano-l-methvl-piperidin^ylV2-r4-trifluoromethvl-pvrimidin-2-vlamiiio')-3-cyclohexyl-propionamide. 5 The title compound was prepared from 2-chloro-4-trifluoromethyl pyrimidine and 2-amino-A^-(4-cyano-l-memyl-piperidin-4-yl)-3-cyclohexyl-propionamide according to the procedure from Example 90. MS, m/z 439.5 *= M+l. 10 EXAMPLE 92 N-(4-cyano-1 -methyl-piperidine-4-yl)-3-cyclohexyl-2[N-cyano-morpholine-4-15 carboxmudoyl)-amino]-propionamide (Method H). (a) 2^-Cyano-iminomethylene-amino)-N-(4-cyano-l -methyl-piperidine-4-yl)-3-cyclohexyl-propionamide. 20 A solution of diphenylcyanocarbonimidate (455 mg, 1.91 mmol), 2-amino-N-(4-cyano-l-metfryl-piperidin-4-yl)-3-cyclohexyl-propionamide bis hydrochloride salt (680 mg, 1.86 mmol) and N,N-diisopropylethylamine (482 mg, 3.73 mmol) in isopropanol (5.0 mL) was stirred overnight at room temperature. The reaction mixture was then filtered to provide 5 the desired carbodiimide as a white powder (140 mg, 22%). This material was used without further purification. !H NMR (400 MHz, CDC13) 8 0.80-1.00 (m, 2H), 1.05-1.20 (m, 1H), 1.20-1.40 (2H), 1.50-1.85 (m, 8H), 2.32 (s, 3H), 2.40-2.50 (m, 2H), 2.55-2.70 (m, 4H), 2.85-2.95 (m, 2H), 4.10-4.20 (m, 1H), 8.77 (br s, 1H). MS, m/z 343 = M+l. 10 (b) 2-(N-C^ano-benzimidoyl-amino)-N-(4-cyano-l-methyl-piperidine-4-yl)-3-cyclohexyl-propionamide. A suspension of 2-(N-Cyano-mmomemylene-amino)-N-(4-cyano-1 -methy l-piperidine-4-yl)-3-cyclohexyl-propionamide (120 mg, 0.35 mmol) in tetrahydrofuran (1 mL) was 15 treated with morpholine (4 mL, 45.9 mmol). The reaction mixture was stirred at room temperature for 3 days then concentrated to dryness. The residue was purified by HPLC using a 20 x 250 mm Ci8 reverse phase column with the method being 20% acetonitrile in water to 90% acetonitrile in water. MS, m/z 430 = M+l. 20 EXAMPLE 93 N-(4-Cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-2-{[(diethyl-carbamoylimino)-morpholin-4-yl-methyl]-amino}-propionamide (Method H). (a) N,N-Diethyl carbamoyl tbiocyanate. 5 A suspension of sodium tbiocyanate (3.30 g, 40.7 mmol) in dry acetonitrile (25 mL) at 80°C was treated dropwise with a solution of N,N-diethyl carbamoyl chloride (5.0 g, 36.9 mmol) in diy acetonitrile (15 mL). The reaction mixture was stirred at 80°C for 50 min, cooled to room temperature, then filtered through a fine glass frit. The resulting filtrate 10 was used as a 0.9 M solution of N,N-diethyl carbamoyl thiocyanate in acetonitrile. (b) N-(4-Cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-2-(3-diethylamino-carbonyl- thioureido)-propionamide 15 A solution of 2-amino -N-(-4-cyano-1 -propyl-piperidin-4-yl)-3-cyclohexylpropionamide bis hydrochloride salt (560 mg, 1.53 mmol) and triethylamine (500 uL, 3.59 mmol) in acetonitrile (4 mL) was treated with a solution of N,N-diethyl carbamoyl thiocyanate in acetonitrile (3.0 mL, 2.7 mmol). The reaction mixture was stirred overnight at room temperature and concentrated on a rotary evaporator. The resulting residue was 20 chromatographed (ethyl acetate: hexanes 1:1 then ethyl acetate and finally methanol: methylene chloride 1:9 as the eluant) to provide the desired product as a light yellow solid (340 mg, 49%). MS, m/z 451.3 = M+l. The title compound was prepared by treating a solution of the resulting thiourea (340 mg, 25 0.75 mmol) and triethylamine (230 uL, 1.65 mmol) in dry acetonitrile (4 mL) with mercury (H) chloride (225 mg, 0.83 mmol) and morpholine (200 uJL, 2.23 mmol). The reaction mixture was stirred at room temperature for 4 h then filtered through a 0.45 urn filter disc. The resulting filtrate was filtered through a column of silica (5% methanol/methylene chloride as the eluant) and the resulting crude product was further 30 purified by HPLC using a 20 x 250 mm Cig reverse phase column with the method being 20% acetonitrile in water to acetonitrile. MS, m/z 504.6 = M+l. following examples were prepared by Method H in a parallel fashion: EXAMPLE 94 5 {[l-(4-cyano-lmethyl-piperidin^ylcarbamoyl)-2-cyclohexyl-ethylaniino]-pyrrolidin-l-yl-methyl}-carbamic acid ethyl ester. MS, m/z 461 = M+l. EXAMPLE 95 10 {[ 1 -(4-cyano-1 -methyl-piperidin^ylcarbamoyl)-2-cyclohexyl-ethylamino]-piperidin-1 -yl-methyl}-carbamic acid ethyl ester. MS, m/z 477 = M+l. EXAMPLE 96 15 {A2epan-l-yl-[l-(4-cyano-lmethyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]-methylene}-carbamic acid ethyl ester. MS, m/z 490 = M+1. EXAMPLE 97 20 {Azocan-1 -yl-[ 1 -(4-cyano- lmemyl-piperidm^-y lcarbamoyl)-2K;yclohexyl-ethylaminoJ-methylene}-carbamic acid ethyl ester. MS, m/z 504 =M+1. EXAMPLE 98 25 1- {[ 1 -(4-Cyano- l-memyl-piperidm-4-ylcarbamoyl)-2-cyclohexyl-emylamino]-emoxycarbonylimmo-methyl}-piperidine-4-carboxylic acid ethyl ester. MS, m/z 548 = M+l. 30 EXAMPLE 99 1 - {[ 1 -(4-Cyano-1 -methyl-piperidin-4-ylcarbamoy l)-2-cyclohexyl-ethylamino]-elhoxycarbonylimino-methyl}-piperidine-3-carboxylic acid ethyl ester. MS, m/z 548 = M+l. 5 EXAMPLE 100 10 [[l-(4-Cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]-(4-pyrrolidin-l-yl-piperidin-l-yI)-methylene]-carbamic acid ethyl ester. MS, m/z 545 = M+l. 15 EXAMPLE 101 {[l>4']Bipiperidinyl-r-yl-[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyIamino]-methyIene}-carbamic acid ethyl ester. MS, m/z 559 ^M+l. 20 EXAMPLE 102 [[l-(4-Cyano-l-memyl-piperidin^-ylcarbamoyl)-2-cyclohexyl-emylamino]-(4-phenyl-piperazin-l-yl)-methylene]-carbamic acid ethyl ester. MS, m/z 553 =M+1. 25 EXAMPLE 103 [[1 -(4-Cyano-l -memyl-piperidin^ylcarbamoyl)-2 30 EXAMPLE 104 ^-Acetyl-piperazin-1 -yl)-[ 1 -(4-cyano-1 -me&yl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]-metfaylene}-carbamic acid ethyl ester. MS, m/z 519 = M+l. EXAMPLE 105 5 4- {[ 1 -(4-Cyano-1 -methyl -piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethy lamino]-ethoxycarbonylimino-methyl}-piperazine-l-carboxylic acid ethyl ester. MS, m/z 549 = M+l. 10 EXAMPLE 106 [[ 1 -(4-Cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]-(3,3,5-trimethyl-6-aza-bicyclo[3.2.1]oct-6-yl)-methylene]-carbamic acid ethyl ester. MS, m/z 544 =M+1. 15 The following examples may also be made by the methods described above: 2-[(EmyIcarbamoylimmo-morpholin^-yl-memyl)-amino]^,4-dimethyl-pentanoicacid(4-cyano-1 -propyl-piperidin-4-yl)-amide 2-[(MemanesulfonyUmincHmorpholin-4-yl-memyl)-animo]-4,4-dimethyl-pentanoicacid(4-cyano-1 -propyl-piperidin-4-y l)-amide 2-[(Caibamoylimmo-morpholm-4-yl-memyI)-amino]-4,4-dimethyl-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)-amide 2-[(EmylcarbamoymTimo-morpholm-4-yl-methyl)-ammo]^,4-dimethyl-peiitanoic acid (4-cyano-1 -methyl-piperidin-4-yl)-amide 2-[(Carbamoylmimo-morpholin-4-yl-memyl)-ammo]-4,4-dimethyl-pentanoic acid (4-cyano-1-methyl-piperidin-4-yl)-amide 2-[(Methanesulfonylimmo-morpholm^ cyano- l-methyl-piperidin-4-yl)-amide {[l-(4-Cyano-l-methyl-piperidin^ylcarbamoyl)-33-diniethyl-butylamino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester {[ 1 -(3-Cyano-1 -cyclohexylmethyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butylamino]-moipholin-4-yl-roethylene}-carbamicacid ethyl ester 2-[(Ethylcarbamoylimino-morpholin^yl-methyl)-aiiiino3^,4-dimethyl-pentanoicacid(3-cyano-1 -cyclohexylmethyl-pyrrolidin-3-yl)-amide 2-[(Carbamoyh^riino-moipholiB-4-yl-methyl)-amino]-4,4-dimethyl-pentanoic acid (3-cyano-1 -cyclohexylmethyl-pyrrolidin-3-yl)-amide 2-[(Methanesulfonylimino-morpholin-4-yl-me^ cyano 1 -cyclohexylme(hyl-pyrrolidin-3-yI)-aniide 2-[(Methanesulfonylimino-morpholin4-yl-mefliyl)-amino]-4,4-dimethyl-pent2noicacid(3-cyano-1 -cyclohexyl-pyrrolidin-3-yl)-amide 2-[(Ethylcarbamoyliinino-morpholin^-yl-methyl)-amino]^,4-diinethyl-pentanoicacid(3-cyano-1 -cyclohexyl-pyrrolidm-3-yl)-amide 2-[(Carbamoylimino-morpholin-4-yl-methyI)-amino]-4,4-dimethyl-pentanoicacid(3-cyano-l-cyclohexyl-pyrrolidin-3-yl)-amide {[l-(3-Cyano-l-cyclohexyl-pyiroh'din-3-yl(^rbamoyl)-3,3-dimethyl-butylainino]-moipholin-4-yl-methylene}-carbamic acid ethyl ester ({l-[3-Cyano-l -(4-methyl-cyclohexyl)-pyn-oUdin-3-ylcarbamoyl]-3,3-dimethyl-butylamino}-moipholin-4-yl-methylene)-carbaniic acid ethyl ester 2^(Ethylcarbamoylimino-moipholin4-yl-^ acid [3- cyano-1 -(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-amide 2^Carbamoylimino-morphoIin^-yl-methyl)-ammo]-4,4-dimethyl-pentanoic acid [3-cyano-1 -(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-amide 2-[(Methanesidfonyliinino-moipholin^^^ cyano-1 -(4-methyl-cycIohexyI)-pyrroIidin-3-yl]-amide 2-[(Methanesulfonylimino-morphoIin-4-yl-rae&yl)-amino]-4}4-diniethyl-pentanoicacid[3-cyano-l-(l-ethyl-propyl)-pyrrolidin-3-yl]-amide 2-[(CarbamoyIimino-mo]^hoIin^yl-methyl)-ainiiio]^Adimethyl-pentanoic acid [3-cyano-l-(l-ethyl-propyl)-pyiTOlidin-3-yl]-amide 2-[(Ethylcarbamoyiimino-moipholin^-yl-methyl)-aniino]^J4-dimethyl-pentanoicacid[3-cyano-l-(l-ethyl-propyl)-pyrrolidin-3-yl]-amide ( {1 -[3-Cyano-1 -(1 -ethyl-propyI)-pyrrolidin-3-ylcarbamoyl]-3,3-dimetfayl-butylamino} -moipholin-4-yl-methylene)-carbamic acid ethyl ester ({l-[3-C^ano-l-(l-H-indol-3-ylmethyl)-pyrroUdin-3-ylcarbamoyl]-3,3-dimethyl-butylamino}-morpholin-4-yI-methyIene)-carbamic acid ethyl ester 2-[(Ethylcarbamoyliinino-moipholin^-yl-methyl)-ainino]^,4-dimethyl-peiitanoicacid[3-cyano-l-(l-H-indol-3-ylmethyl)-pyrrolidin-3-yl]-amide 2-[(Methanesulfonylimino-morphoUn^-yl-methyI)-amino]^,4-dimethyl-pentanoicacid[3-cyano-l-(l-H-indol-3-ylmethyl)-pyrrolidin-3-yl]-amide 2-[(CarbamoylimincHmorpholin^yl-methyl)-amino]^}4-dimethyl-pentanoic acid [3-cyano-l-(l-H-indoI-3-ylinethyl)-pyrrolidin-3-yl]-amide 2-[(C^ibamoyliminc-moipholin^yl-methyl)-amino]-4)4-dimethyl-pentanoic acid (1-ben2yl-3-cyano-pyTrolidin-3-yl)-amide 2-[(Ethylcarbamoylimino-morpholin^yl-^ benzyl-3-cyano-pyrrolidin-3-yl)-amide {[ 1 -(1 -Benzyl-3-cyano-pyrroUdbO-ylcarbamoyl>3,3-dimethyl-butylamino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester 2-[(MetbanesulfonyHmino-morpholm-4-yl-methyl)-amino]-4,4-dimethyl-pentanoic acid (1 -benzyl-3-cyano-pyrrolidin-3-yl)-amide 2-[(Methanesulfonylimino-morpholin^yl-methyl)-amino]^,4-dimethyl-pentanoic acid (3-cyano-1 -phenethyl-pyirolidin-3-yl)-amide {[l-(3-Cyano-l-phenethyl-pyrrolidin-3-ylc^rbamoyl)-3,3-dimetbyl-butylamino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester 2-[(Ethylcarbamoylimmo-moipbolin^ cyano-1 -phenethyl-pyrrolidin-3-yl)-amide 2-[(C^bamoylimino-morpholin^yl-methyl)-amino]^,4-dimethyl-pentanoic acid (3-cyano-1 -phenethy I-pyrrolidin-3-yl)-amide N-(4-Cyano-l-propyl-piperidin^yl)-3-cyclohexyl-2-[(ethylcarbamoylimino-morpholin-4-yl-methyl)-amino]-propionamide N-(4-Cyano-1 -propyl-piperidin^yl)-3-cyclohexyl-2-[(methanesulfonylimino-morpholin-4-yl-methyl)-amino]-propionamide 2-[(Carbamoylimino-moipholin^yl-methyl)-airdno]-N-(4 N*-Cyano-l-methyl-piperidin^-yl)-3-cyclohexyl-2-[(methanesiJfonylimino-moiphoIin-4-yl-methyl)-amino]-propionamide {[ 1 -(3-Cyano-1 ^;yclohexylmethyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethylamino]-morpholin-4-yl-methylene}-carbainic acid ethyl ester N-(3-Cyano-l-cyclohexylmethyl-pyrrolidin-3-yl)-3-cyclohexyl-2-[(ethylcarbamoylimino-morpholin-4-yl-methyl)-amino]-propionaraide N-(3-Cyano-l-cyclohexylmethyl-pyiToUdin-3-yl)-3-cyclohexyl-2-[(methanesulfonylimino^ morpholin-4-yl-methyl)-amino]-propionamide 2-[(Carbamoylimino-moiphol]m^yl-methyl)-amino]-N-(3-cyano-l-cyclohexylmethyl-pyiTolidin-3-yl)-3-cyclohexyl-propionamide N-(3-Cyano-l-cyclohexyl-pyrrolidin-3-yl)-3-cyclohexyl-2-[(meflianesulfonylimino-morpholin-4-yl-methyl)-amino]-propionamide N-(3-Cyano-l-cyclohexyl-pyrrolidin-3-yl)0-cyclohexyl-2-[(ethylcarbamoylimino-morpholin^yl-methyl)-aniino]-propionamide 2-[(C^bamoylimmo-morpholin^yl-methyl)-amino]-N-(3-cyano-l-cyclohexyl-pyrrolidin-3-yl)-3-cyclohexyl-propionamide {[1 -(3-Cyanol -cyclohexyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethylamino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester ( {1 -[3-Cyano-l -(4-methyl-cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethylamino}-morpholin-4-yl-metiiylene)-carbainic acid ethyl ester N-[3-Cyano-l-(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-3-cyclohexyl-2-[(ethylcarbamoylimino-morpholin^-yl-methyl)-amino]-propionamide 2-[(Carbamoylimino-morpholin^yl-methyl)-araino]-N-[3-cyano-l-(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-3-cycIohexyl-propionamide N-[3-Cyano-l-(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-3-cyclohexyl-2-[(mettianesiilfonyliminmoipholin^yl-meihyl)-ainino]-propionamide N-[3-Cyano-l-(l-ethyl-propyl)-pyrrolidin-3-yl]-3-cyclohexyl-2-[(methanesulfonylimino-morpholin-4-yl-methyl)-amino]-propionainide 2-[(Carbamoylimino-moipholin-4-yl-methyl)-amino]-N-[3-cyano-l-(l-ethyl-propyl)-pyrrokdin-3-yl]-3-cyclohexyl-propionamide N-[3-Cyano-l-(l-ethyI-propyl)-pyrrolidin-3-yl]-3-cyclohexyl-2-[(ethylcarbamoylimino-morpholin-4-yl-metbyl)-amino]-propionamide ({l-[3-Cyano-l-(lH-indol-3-ylmethyl)-pyrrolidin-3-ykarbamoyl]-2-cyclohexyl-ethylamino}-morpholin-4-yl-methylene)-cari)amic acid ethyl ester N-[3-Cyano-l-(-H-indol-3-ylmethyl)-pyrrolidin-3-yl]-3-cyclohexyl-2-[(ethylcarbamoylimino-morpholin-4-yl-methyl)-amino]-propionamide N-[3-Cyano-l-(l-H-indol-3-ylmethyl)-pyrrolidin-3-yl]-3-cyclohexyI-2-[(methanesulfonylimino-morpholin-4-yl-methyl)-amino]-propionamide 2-[(Carbamoylimino-morpholin^yl-methyl)-amino]-N-[3-cyano-1 -(lH-indol-3-ylmethyl)-pyrrolidin-3-ylJ-3-cyclohexyl-propionamide N-(l-Beix^l-3-cyanc>-pyrrolidin-3-yl)-2-[(carbam^ 3-cyclohexyl-propionamide N-(l-Ben2yI-3-cyano-pyrroUdin-3-yl)-3^yclohexyI-2-[(ethylcarbamoyIimino-morpholin-4-yl-metiiyl)-amino]-propionamide {[HI -Benzyl-3-cyano-pyrTOlidin-3-ylcarbamoyl)-2^yclohexyl-ethylamino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester N-(l-Ben2yl~3-cyano-pyn^lidin-3-yl)-3-cycto^ 4-yl-methyl)-amino]-propionamide >^-Cyano-l-phenethyl-pyrrolidin-3-yl)-3-cyclohexyl-2-[(methanesulfonylimino-morpholin-4-yl-methyl)-amino]-propionamide {[ 1 -(3-Cyano-1 -phenethyl-pyn,oUdin-3-ylcarbamoyl)-2-cyclohexyl-ethylaniino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester N^3-Cyano-l-phenethyl-pyrroUdin-3-yl)-3-cyclohexyl-2-[(ethylcarbamoylimino-morpholin-4-yl-methyl)-amino]-propionamide 2-[(Carbamoylimino-morpholin^-yl-methyl)-amino]-H-(3-cyano-l-phenethyl-pyrrolidin-3-yl)-3-cyclohexyl-propionamide {[ 1 -(4-Cyano-1 -propyl-piperidin-4-ylcarbamoyl)-3-methyl-butylamino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester 2-[(Ethylcarbamoylimino-morpholin^-yl-methyl)-amino]-4-methyl-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)-amide 2-[(Methanesulfonylimino-moiphoIm^yl-methyI)-amino]^-methyl-pentanoicacid(4-cyano-1 -propyl-piperidin-4-yl)-amide 24(Carbamoylimino-morpholin^yl-methyl)-amino]-4-methyl-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)-amide 2-[(Ethylcart>amoylimino-morphoUn-4-yl-me^ acid (4- cyano-1 -methyl-piperidin-4-yl)-amide 2-[(C^rbamoylimino-morpholin^yl-methyl)-arnino]-4-methyl-pentanoic acid (4-cyano-1-methyI-piperidin-4-yI)-amide 2-[(Metbanesulfonyliininc~morpholin-4-yl-methyl)-amino]^methyl-pentanoic acid (4-cyano-1 -methyl-piperidiii-4-yl)-amide {[ 1 -(4-Cyano-1 -methy l-piperidin-4-y lcarbamoy l)-3 -methy 1-butylamino] -morpholin-4-y 1-methylene}-carbamic acid ethyl ester {[l-(3-Cyano-l-cyclohexylmethyl-pyrrolidin-3-ylcarbamoyl)-3-methyl-butylamino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester 2-[(EthylcarbamoyIimino-moxpholin^-yl-methyl)-amino]-4-methyl-pentanoicacid(3-cyano-l-cyclohexylmethyl-pyrrolidin-3-yl)-amide 2-[(Methanesulfonylimino-morphoIin^yl-methyl)-aniino]-4-methyl-pentanoicacid(3-cyano-1 -cyclohexylmethyl-pyrroIidin-3-yl)-amide 2-[(Carbamoylimino-morpholin-4-yl-methyl)-amino]-4-methyl-pentanoic acid (3-cyano-l -cycIohexylmethyl-pyrrolidin-3-yl)-amide 2-[(Methanesulfonyliminc~morpholin^yl-methyl)-amino]-4-methyl-pentanoic acid (3-cyano-1 -cyclohexyl-pyrrolidin-3-yl)-amide 2-[(Ethylcarbamoylimino-morpholin^-yl-methyl)-amino]-4-methyl-pen1anoicacid(3-cyano-1 -cyclohexyl-pyrrolidin-3-yl)-amide 2-[(Cait»amoylimino-morpholin^yl-methyl)-amino]-4-methyl-pentanoic acid (3-cyano-l-cyclohexyl-pyrroIidin-3-yI)-amide {[l-(3-Cyano-l^yclohexyl-pynolidin-3-ylcarbamoyl)-3-methyl-butylamino]-morphoiin-4-yl-methylene}-carbamic acid ethyl ester ({l-[3-Cyano-l-(4-methyl^yclohexyl)-pym)lidin-3-yIcarbamoyI]-3-methyI-butylamino}-morpholin-4-yl-methylene)-carbamic acid ethyl ester 2-[(Ethylcarbamoyliminc~morpholin^ acid [3- cyano-1 -(4-methyI-cyclohexyl)-pyrrolidin-3-yl]-amide 2-[(Carbamoylimino-moipholin^yl-methyl)-amino]-4-methyl-pentaiioic acid [3-cyano-1-(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-amide 2-[(MethanesulfonyHmino-moipholin^yl-methyl)-amino]^-metiiyl-pentanoicacid[3-cyano-1 -(4-methyl-cyclohexyl)-pyrrolidin-3-ylJ-amide 2-[(MethanesulfonyUmino-morpholin^yl-methyl)-amino]-4-methyl-pentanoicacid [3-cyano-l-(l-ethyl-propyl)-pyrrolidin-3-yl]-amide 2-[(Carbamoylimino-morpholin-4-yl-methyl)-amino]-4-methyl-pentanoic acid [3-cyano-1 -(1 -ethyl-propyl)-pyrrolidin-3-yl]-amide 2-[(EthylcarbamoyUmino-moipholin^yl-methyl)-aniino]-4-methyl-pentanoic acid [3-cyano-1 -(1 -ethyl-propyl)-pyiTolidin-3-yl]-amide ({l-[3-Cyano-l-(l-ethyl-propyl)-pyrrolidin-3-ylcarbamoyl]-3-methyl-butylamino}-morpholin-4-yl-methylene)-carbamic acid ethyl ester ({l-[3-Cyano-l-(l-H-indol-3-ylmethyl)-pyrrolidinO-ylcarbamoyl]-3-methyl-butylamino}-morphoIin-4-yl-methylene)-carbamic acid ethyl ester 2-[(Ethylcarbamoylimino-morpholin^-yl-methyl)-amino]-4-methyl-pentarioicacid [3-cyano-l-(l-H-indol-3-ylmethyl)-pyrrolidin-3-yl]-aniide 2-[(Metbanesulfonylimino-moipholin^-yl-methyl)-amino]^methyl-pentanoic acid [3-cyano-1 -(1 -H-indol-3-ylmethyl)-pyrrolidin-3-yl]-amide 2-[(Carbamoylimino-morpholin^yl»methyl)-amino]-4-methyl-pentanoic acid [3-cyano-1 -(1 -H-indol-3-yhnethyl)-pyrrolidin-3-yl]-amide 2-[(Carbamoylirnino-morpholin-4-yl-methyl)-amino]-4-methyl-pentanoicacid(l-benzyl-3-cyano-pyrrolidin-3-yl)-amide 2-[(Ethylcaibamoylimino-morpnolin^-yl-me±yl)-an3ino]-4-methyl-pentanoic acid (1-benzyl-3-cyano-pyrrolidin-3-yl)-amide 2-[(Carbamoylirj^o-morpholin-4-yl-methyl)-amino]-4-methyl-peEtanoicacid(l-benzyl-3-cyano-pyrrolidin-3-yl)-amide 2-[(Methanesulfonyliminc-morpholin-4-yl-methyl)-arnino]-4-methyl-pentanoic acid (1-ben2yl-3-cyano-pyTTolidin-3-yl)-amide 2-[(Methanesulfonylimino-morpholin^-yl-methyl)-amino]-4-methyl-pentanoicacid(3-cyano-1 -phenethyl-pyrrolidin-3-yl)-arnide {[l-(3-Cyano-l-phenethyl-pyn-olidin-3-ylcarbamoyl)-3-methyl-butylamino]-morpholin-4-yl-methylene}-carbamic acid ethyl ester 2-[(Ethylcarbamoylimino-morpholin^-yl-methyl)-amino]-4-methyl-pentanoicacid(3-cyano-l-phenethyl-pyrrolidin-3-yl)-amide 2-[(Carbamoylimino-morpholin-^yl-methyl)-amino3-4-methyI-pentanoic acid (3-cyano-1-phenethyl-pyrrolidin-3-yl)-amide {[1^4-Cyano-l-propyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butylamino]-phenyl-methylene}-carbamic acid ethyl ester 2-[(Ethylcarbamoylimino-phenyl-methyl)-amino]^}4-dimethyl-pentanoic acid (4-cy ano-1 -propyl-piperidin-4-yl)-amide 2-[(Methanesulfonyliminc-phenyl-methyl)-amino]-4,4-dimethyl--pentanoic acid (4-cyano-l -propyl-piperidin-4~yl)-amide 2-[(Carbamoyliminc-phenyl-methyI)-amino]^,4-dimethyl-pentanoic acid (4-cyano-l-propyl-piperidin~4-yl)-amide {[l-(3-Cyano-l-cyclohexylmethyl-pyrroUdh-3-ylcarbamoyl)-3-methyl-butylamino]-piperazin-l-yl-methylene}-carbamic acid ethyl ester 2-[(EthylcarbamoyUminc-piperazin-l-yl-metbyl)-amino]-4-methyl-pentanoic acid (3-cyano-1 -cyclohexylmethyl-pyrrolidin-3-yl)-aniide 2-[(Methanesulfonylimino-piperazin- l-yl-methyl)-amino]-4-methyl-pentanoic acid (3-cyano-1 -cyclohexylmethyl-pyrrolidin-3-yl)-amide 24(Carbamoylimino-piperazdn-l-yl-methyl)-amino]^-methyl-pentanoicacid(3-cyano-l-cyclohexylmethyl-pyrrolidin-3-yl)-aniide ({^3-Cyano-l-(4-methyl-cyclohexyl)-pyrrolidin-3-ylcarbamoyI]-2-cyclohexyl-ethylamino}-pyridin-4-yl-methylene)-carbaniic acid ethyl ester N-[3-Cyano-l-(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-3-cyclohexyl-2-[(ethylcarbamoylimbo-pyridin^yl-metb.yl)-amino]-propionamide 2-[(Carbamoylimino-pyridin^-yl-methyl)-amino]-N-[3-cyano-l-(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-3-cyclohexyl-propionamide N-[3-Cyano-1 -(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-3-cyclohexyl-2-[(methanesulfonylimino-pyridin^-yl-methyl)-amino]-propionamide N-(4-Cyano-l-metbyl-piperidin^-yl)-3^yclohexyl-2-[(ethylcarbamoylimino-pyrazin-2-yl-methyl)-amino]-propionamide 2-[(Carbamoylimino-p>razin-2-yl-methyl)-amino]-N-(4-oyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-propionamide N-(4-Cyanc-l-methyl-piperidk^yl)-3 {[ 1 -(1 -Benzyl-3 -cyano-pyrrolidin-3-ylcarbamoy l)-3-methyl-butylamino]-carbamoylimino-methylj-carbamic acid ben2yl ester {[Hl-Benzyl-3-cyanc-pyrrohdin-3-ylcarbamoyl)-3-methyl-butylamino]-ethylcarbamoylimino-inethylj-carbainic acid benzyl ester {[ 1 -(1 -Benzyl-3-cyano-pyrrolidin-3 -ylcarbamoyl)-3-methyl-burylamino]-methanesdfonylimino-methyl}-carbamic acid benzyl ester 2-(l»1 -Dioxo- 1H-1 X,6-ben2o[d]isothiazol-3-ylamino)-4,4-diniethyl-pentanoic acid (4-cyano-1 -methyl-piperidin-4-yl)-amide 2-(l,l-Dioxo-lH-lX -benzo[d]isothiazol-3-ylamino)-4,4-dimethyl-pentanoic acid (3-cyano-l-cyclohexyimethyI-pyrrotidin-3-yl)-amide £ 2-(l, 1-Dioxo-1H-IX -benzo[d]isotbiazoI-3-yIamino)-4,4-dimethyl-pentanoic acid [3-cyano-l-(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-amide £ 2-(l,l-Dioxo-lH-lX -benzp[d]isotbiazol-3-ylamino)-4}4-dimethyl-pentanoic acid [3-cyano-l-(l-ethyl-propyl)-pyrrolidin-3-yl]-amide 2-(l,l-Dioxo-lH-lX -ben2o[d]isothiazol-3-ylamino)-4,4-dimethyl-pentanoic acid [3-cyano-l-(lH-indol-3-ylmethyl)-pyrrolidin-3-yl]-amide 2-(l,l-Dioxo-lH-lX -benzo[d]isothiazol-3-ylamino)-4,4-dimethyl-pentanoic acid (3-cyano-1 -phenethyl-pyrrolidin-3-yl)-amide 2-( 1,1 -Dioxo-1H-1 ^6-benzo[d]isotbJazol-3-ylamino)-4,4-dimethyl-pentanoic acid (1 -benzyl-3-cyano-pyrrolidin-3-yl)-amide N-(3-Cyano-l-cyclohexylmethyl-pyrrolidin-3-yl)-3-cyclohexyl-2-(l>l-dioxo-lH-lA.6-benzo[d]isotbiazol-3-ylamino)-propionamide N-[3-Cyano-1 -(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-3-cyclohexyl-2-(l, 1 -dioxo-1H-1X6-benzo[d]isotbiazol-3-ylamino)-propionamide N-p-Cyano-l-ClH-indol-S-ylmethyO-pyrrolidin-S-yll-S-cyclohexyl-l-Cl.I-dioxo-lH-R6-benzo[d]isothiazol-3-ylamino)-propionamide N-(3-Cyano-1 -phenethyl-pyrrolidin-3-yl)-3-cyclohexyl-2-(l, 1 -dioxo-1H-1X6-benzo[d]isothiazol-3-ylamino)-propionamide N-( 1 -Ben2yl-3-cyano-pyirolidin-3-yl)-3-cyclohexyl-2-( 1,1 -dioxo- 1H-1X6-ben2©[d3isotbiazol-3-ylamino)-propionamide 2-(l,l-Dioxo-lH-lX -benzo[d]isothiazol-3-ylamino)-4-methyl-pentanoic acid (4-cyano-l-propyl-piperidin-4-yl)-amide 2~(l,l-Dioxo-lH-lA, -benzo[d]isothiazol-3-ylamino)-4-methyl-pentanoic acid (4-cyano-l-propyl-piperidin-4-yl)-amide 2~(l,l-Dioxo-lH-lX -benzo[d]isothiazol-3-ylamino)-4-methyl-pentanoic acid (3-cyano-l-cyclohexylmethyl-pyrrolidin-3-yl)-amide 2-(l,l-Dioxo-lH-l>.6-benzo[d]isothiazol-3-ylamino)-4-methyl-pentanoicacid(3-cyano-l-cyclohexyl-pyrrolidin-3-yl)-amide 2~(1,1 -Dioxo-1H-1 A,6-benzo[d]isothiazol-3-ylamino)-4-methyl-pentanoic acid [3-cyano-1 -(4-methyl-cyclohexyl)-pyrroiidin-3-yl]-amide 2-(l,l-Dioxo-lH-lX, -benzo[d]isothiazol-3-yIamino)-4-methyl-pentanoic acid [3-cyano-l-(1 -ethyl-propyl)-pyrrolidin-3-yl]-amide 2-(l,l-Dioxo-lH-lA, -benzo[d]isothiazol-3-ylamino)-4-methyl-pentanoic acid [3-cyano-l-(lH-indoi-3-ylmethyI)-pyrrolidin-3-yI]-amide 2-(l,l-Dioxo-lH-lA, -benzo[d]isotbiazol-3-ylamino)-4-methyl-pentanoic acid (3-cyano-l-phenethyl-pyrrolidin-3-yl)-amide 2-(l,l-Dioxo-lH-lA, -benzo[d]isotbiazol-3-ylamino)-4-methyl-pentanoic acid (l-benzyI-3-cyano-pyrroIidin-3-yl)-amide N-(4-Cyano-1 -propyl-piperidin-4-yl)-3-cyclohexyl-2-(3-oxo-3H-isoindol-1 -ylamino)-propionamide 4-Methyl-2-(3-oxo-3H-isoindol-1 -ylamino)-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)-amide N-(4-Cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-2-(3J4-dihydro-lH-pyrano[4,3-c]pyridin-5-ylamino)-propionamide 2-(3,4-Dihydro-lH-pyrano[4,3-c]pyridin-5-ylaraino)^}4-dimethyl-pentanoic acid (4-cyano-1-methyl-piperidin-4-yl)-amide 2-(3,4-Dihydro-lH-pyrano[43-c]pyridin-5-ylamino)-4-methyl-pentanoicacid(4-cyano-l-methyl-piperidin-4-yl)-amide N-(3-Cyano-l -cyclohexylmethyl-pyrrolidin-3-yl)-3-cyclohexyl-2-(isoquinolin-1 -ylamino)-propionamide 2-(Isoquinolin-1 -ylanimo)-4,4-dimethy 1-pentanoic acid (3-cyano-1 -cyclohexy lmethyl-pyrrolidin-3-yl)-amide 2-(IsoquinoIin-1 -ylamino)-4-methyl-pentanoic acid (3-cyano-1 -cyclohexylmethyl-pyrrotidin-3-yl)-aimde 2-(Imidazo[ 1,5-a]pyridin-3-ylatnino)-4-methyl-pentanoic acid (3-cyano-1 -cyclohexyl-pyirolidin-3-yl)-amide 2-(Imidazo[ 1,5-a]pyridin-3-ylamino)-4,4-dimethyl-pentanoic acid (3-cyano-1 -cyclohexyl-pyrrolidin-3 -yl)-amide N-(3-Cyano-l-cyclohexyl-pyn-olidm-3-yl)-3-cyclohexyl-2-(imidazo[l,5-a]pyridin-3-ylamino)-propionaniide N-[3-Cyano-l-(4-methyl-cyclohexyl)-pyn'olidin-3-yI3-3-cyclohexyl-2-(8-oxo-8,9-dihydro-7H-purin-6-ylamino)-propionamide 4-Methyl-2-(8-oxc-8,9-dihydro-7H-purin-6-ylamino)-pentanoic acid [3-cyano-1 -(4-methyl-cyclohexyl)-pyrrolidin-3-yl]-amide 4,4-DimethyI-2-(8-oxo-8,9-dihydro-7H-purin-6-ylamino)-pentanoic acid [3-cyano-l-(4-metnyl-cyclohexyl)-pyrroUdin-3-yl]-amide 2-{l-[3-Cyano-l-(l-ethyl-propyl)-pyirolidin-3-ylcaitamoyl]-3,3-dimethyl-butylaniino}-pyrimidine-4-carboxyHc acid amide 2-{l-[3-C^ano-l-(l-ethyl-propyl)-pyirolidin-3-ylcarbamoyl]-3-methyl-butylamino}-pyrimidine-4-carboxylic acid amide ^l-[3-C^ano-l-(l-ethyl-propyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyIamino}-pyrimidine-4-carboxylic acid amide 4-Methyl-2-(2-oxo-l,2-dihydro-quinazolin-4-ylamino)-pentanoic acid (3-cyano-l-cyclopentylmethyl-pyrrolidin-3-yl)-amide N-(3-Cyano-1 -cyclopentylmethyl-pyrrolidin-3-yl)-3-cyclohexyl-2-(2-oxo-1,2-dihydro-quinazoIin-4-ylamino)-propionamide 4,4-Dimethyl-2-(2-oxo-1 ^-dihydro-quinazolin-4-ylamino)-pentaiioic acid (3-cyano-1 -cyclopentylmethyl-pyrrolidin-3-yl)-amide N-(4-Cyano-1 -propyl-piperidin-4-yl)-3-cyclohexyl-2-(4-oxo-3,4-dihydro-phthalazin-1 -ylamino)-propionamide 4-Methyl-2-(4-oxo-3,4-dihydro-phthalazin-l -ylamino)-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl>amide 4,4-Dimemyl-2-(4^xo-3,4-dmydrc-phmalazin-l-ylamino)-pentanoic acid (4-cyano-l-propyl-piperidin-4-yl)-ajnide 2-(lH-Indazol-3-ylamino)-4-methyl-pentanoicacid(4-cyano-l-methyl-piperidin-4-yl)-amide 2-(lH-mdazol-3-ylammo)^,4-dimethyl-pentanoicacid(4-cyano-l-propyl-piperidin-4-yl)-amide N-[4-Cyano-l-(2-hydroxy-emyl)-piperidm^yl]-3-cyclohexyl-2-(lH-indazol-3-ylamino)-propionamide 4-Memyl-2-(2^xc-2H-bai2o[e][13]oxazin^ylamino)-pentanoicacid(4-cyano-l-methyl-piperidin-4-yl)-amide 4,4-Dimemyl-2-(2 N-[4-Cyano-l-(2-hydroxy-ethyl)-piperidin-4-yl]-3-cyclohexyl-2-(2-oxo-2H-benzo[e][ 1,3]oxazin-4-ylamino)-propionamide 2-(6-Hydroxy-1,1 -dioxo- 1H-1X -benzo[d]isothiazol-3-ylamino)-4,4-dimethyl-pentanoic acid (4-cyano-l-propyl-piperidin-4-yl)-amide Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -propyl-piperidin-4-ylcarbamoyl)-3,3-dhnelhyl-butylammo]-morpholin-4-yl-meihyleneainide 4-Methyl-piperazine-l-carboxylicacid[l-(4-cyano-l-propyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butylamino]-morpholin-4-yl-methyIeneainide 4,4-Dimethyl-2-{[moipholin^yl-(2-morphoIin-4-yl-ethylcarbamoylimino)-methyl]-amino}-pentanoic acid (4-cyano-l-propyl-piperidin-4-yl)-amide N-(4-Cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-2-{[N-(5-methyl-oxazol-2-yl)-morphoIine-4-carboximidoyl]-amino}-propionamide N-{4-Cyano-l-metliyl-piperidin^yl)-3-cyclohexyl-2-{[N-(l-methyl-lH-inudazol-2-yl)-morpholine-4-carboximidoyl]-amino} -propionamide N-(4-Cyano-1 -methyl~piperidin-4-yl)-3-cyclohexyl-2- {[N-(2-mcthyl-2H-[ 1,2,4] triazol-3-yI)-morpholine^carboximidoyl]-amino}-propionamide [[l-(4-CyancHl-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylaniino]-(2-oxa-5-aza-bicyclo[2.2.1]hept-5-yl)-methylene]-carbamic acid ethyl ester [[ 1 -(4-Cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]-(2-methoxymethyl-morpholin-4-yl)-methylene]-carbamic acid ethyl ester [[l-(4-Cyano-l-methyl-piperidin-4-yl(»rbamoyI)-2-cyclohexyl^thylainino]-(2,6-dime&yl-morpholm-4-yl)-methylene]-carbandc acid ethyl ester N-(4-Cyanc~1 -methyl-piperidin-4-yl)-3-cyclohexyl-2- {[N-(4-methoxy-phenyI)-moipholine-4-carboximidoyI]-amino}-propionamide 4-( {N-[ 1 -(4-Cyano-1 -methyl-piperidin~4-ylcarbamoyl)-2-cyclohexyl-ethy 1]-morpholine-4-carboximidoyl}-amino)-benzainide 2-( {N-[ 1 -(4-Cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-moq)holine-4-carboximidoyl}-amino)-oxazole-5-carboxylic acid amide 2-( {N-[ 1 -(4-Cyano-l -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-morpholine^cari>oximidoyl}-amino)-oxa2ole-4-carboxylic acid amide 5-({N-[l-(4-Cyanol-methyl-piperidin-4-ylcarbanioyl)-2-cyclohexyl-ethyl]-morpholine^carboximidoyl}-amino)-pyridine-2-carboxylic acid amide 2-({N-[l-(4-Cyano-l-methyl-piperidin-4-yIcarbamoyl)-2-cycIohexyl-ethyI]-morpholme-4^arboxiimdoyl}-aniino)-3H-imida2ole-4-carboxylic acid amide 2-[(N-Benzooxazol-2-yl-morpholine-4-carboximidoyl)-amino]-N-(4-cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-propionamide N-(4-Cyano-l-memyl-piperidm^yl)-3-cyclohexyl-2-[(N-thiazol-2-yl-morpholme-4-carboximidoyl)-amino]-propionamide N-(4-Cyano-l-memyl-piperidin-4-yl)-3-cyclohexyl-2-{[N-(5-phenyl-tbiazol-2-yl> morpholme^caiboximidoyl]-amino} -propionamide 2-{[N^5-Caibamoylmethyl^xazol-2-yl)-moiphplme-4-caiboxm]idoyl]-ammo}-N-(4-cyano-l-methyl-piperidih-4-yl)-3-cyclohexyl-propionamide N-(4-Cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-2- {[N-(2-methyl-oxazol-5-yl)-morpholine^carboximicioyl]-amino}-propionamide N-(4-Cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-2-(5,6-dihydro-8H-imidazo[5,1 -c][ 1,4]oxazin-3-ylamino)~propionamide .,N-(4-Cyano-l-methyl-piperidin-4-yI)-3-cyclohexyl-2-(5,6,8,8a-tetraiiydro-lH-imidazo[5,1 -c][ 1,4]oxazin-3-ylamino)-propionamide [[H4-Cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]-(2-methylcarbamoyl-morpholin-4-yl)-methylene]-carbamic acid ethyl ester {[l-(4-Cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]-[3-(l-methylcarbamoyl-2-phenyl-ethylcarbamoyl)-morpholin-4-yl]-methylene}-carbamic acid ethyl ester N-(4^yano-l-methyl-piperidin^yl)-3 ([ 1 -(4-cyano-1 -methyl-piperidin-4-yl-carbamoyl)-2-(6-dimethylaminomethy,naphthalen-2-yl-ethylamiDo]-rnorpholin-4-yl-raethylene)-carbamic acid ethyl ester 2-(Benzooxazol-2-ylammo)-N-(4-cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-propionamide 2-(Benzooxazol-2-ylarnino)-4,4-dimethyl-pentanoic acid (4-cyano 1 -propyl-piperidin-4-yl)-amide 2-(Benzothiazol-2-ylamino)-N-(4-cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-propionamide 2-(Benzothiazol-2-ylamino)-4,4-dimethyl-pentanoic acid (4-cyano-l-propyl-piperidin-4-yl)-amide 2-( 1 H-Benzoimidazol-2-ylamino)--N-(4-cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyl-propionamide 2-(lH-Benzoimidazol-2-ylamino)-4,4-dimethyl-pentanoic acid (4-cyano-l -propyl-piperidin-4-yl)-amide N-(4-Cyano-l-methyl-piperidin^-yl)-3-cyclohexyl-2-(6-methanesulfonylamino-2H-indazol-3-ylamino)-propionamide 2-(6-Methanesulfonylamino-2H-indazol-3-ylamino)-4,4-dimethyl-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yI)-amide \ 2-(Benzo[d]isoxazol-3-ylamiiio)-N-(4-cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl- propionamide 2-(Benzo[d]isoxazol-3-ylamino)-4,4-dimethyl-hexanoic acid (4-cyano-l-propyl-piperidin-4-yl)-amide 2-(Ben2o[d]isothiazol-3-ylamino)-N-(4-cyano-l-methyl-piperidin-4-yl)-3-cycIohexyl-propionamide 2-(Benzo[d]isothiazol-3-ylamino)-4J4-dimethyl-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)-amide N-(4-Cyano-l-methyl-piperidin^-yl)-3-cyclohexyl-2-(7-methanesulfonylamino-imidazo[ 1,5-d]pyridin-3-ylamino)-propionamide 2-(7-Methanesulfonylamino-imidazo[l}5-a]pyridin-3-ylainino)-4,4-dimethyl-pentanoic acid (4-cyano-1 -propyl-piperidin-4-yl)-amide 2-[l-(2-Carbamoyl-ethyI)-lH-imid^oI-2-ylamino]^,4- 4,4-Dimethy]-2-(3-ureido-pyridin-2-ylamino)-pentanoic acid (4-cyano-1-propy 1-piperidin-4-yl)-amide 2-[ 1 -(2-Carbamoyl-ethyl)-1 H-imidazol-2-y lamino]-N-(4-cyano-1 -methyl-piperidin-4-yl)-3-cyclohexyI-propionamide 4,4-Dimediyl-2-(4-trifluoromethyl-pyrimidin-2-ylainino)-pentanoic acid (4-cyano-1-propyl-piperidin-4-yl)-amide {[ 1 -(1 -Ben2yl-4-cyano-piperidin-4-ylcarbamoyl)-2 {[l-(4-C^ano-l-ethyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butylamino]-morpholin-4-yl-methylene}-carbamic acid cyclopentyl ester {[1 -(4-Cyano-1 -phenethyl-piperidin-4-ylcarbamoyl)-3,3-diinethyl-butylainino]-morpholin-4-yl-methylene}-carbamic acid 2-methoxy-ethyl ester {[l-(4-Cyano-I-cyclohexyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butylaminoj-phenyl-methylene}-carbamic acid ethyl ester 5 METHODS OF THERAPEUTIC USE The compounds of the invention are useful in inhibiting the activity of cathepsin S, K, F, 10 L and B. In doing so, these compounds are useful in blocking disease processes mediated by these cysteine proteases. Compounds of this invention effectively block degradation of the invariant chain to CLIP by cathepsin S, and thus inhibit antigen presentation and antigen-specific immune 15 responses. Control of antigen specific immune responses is an attractive means for treating autoimmune diseases and other undesirable T-cell mediated immune responses. Thus, there is provided methods of treatment using the compounds of this invention for such conditions. These encompass autoimmune diseases and other diseases involving inappropriate antigen specific immune responses including, but not limited to, 20 rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, ulcerative colitis, multiple sclerosis, GuiUain-Barre syndrome, psoriasis, Grave's disease, myasthenia gravis, scleroderma, glomerulonephritis, atopic dermatitis, insulin-dependent diabetes mellitus and asthma. The compounds of the invention can also be used to treat other disorders associated with extracellular proteolysis such as Alzheimer's disease and 25 atherosclerosis. The compounds of the invention can also be used to treat other disorders associated with inappropriate autoimmune responses, T-cell mediated immune responses, or extracellular proteolysis mediated by. cathepsin S, unrelated to those listed above or discussed in the Background of the Invention. Therefore, the invention also provides methods of modulating an autoimmune disease comprising administering to a patient in 5 need of such treatment a pharmaceutically effect amount of a compound according to the invention. Compounds of the invention also inhibit cathepsin K. In doing so, they may block inappropriate degradation of bone collagen and other bone matrix proteases. Thus, there 10 is provided a method for treating diseases where these processes play a role such as osteoporosis. Inhibition of cathepsins F, L, and B are also within the scope of the invention due to similarity of the active sites in cysteine proteases as described above. For therapeutic use, the compounds of the invention may be administered in any 15 conventional dosage form in any conventional manner. Routes of administration include, but are not limited to, intravenously, intramuscularly, subcutaneously, intrasynovially, by infusion, sublingually, transdermally, orally, topically or by inhalation. The preferred modes of administration are oral and intravenous. 20 The compounds of this invention may be administered alone or in combination with adjuvants that enhance stability of the inhibitors, facilitate administration of pharmaceutical compositions containing them in certain embodiments, provide increased dissolution or dispersion, increase inhibitory activity, provide adjunct therapy, and the like, including other active ingredients. Advantageously, such combination therapies 25 utilize lower dosages of the conventional therapeutics, thus avoiding possible toxicity and adverse side effects incurred when those agents are used as monotherapies. Compounds of the invention may be physically combined with the conventional therapeutics or other adjuvants into a single pharmaceutical composition. Advantageously, the compounds may then be administered together in a single dosage form. In some embodiments, the 30 pharmaceutical compositions comprising such combinations of compounds contain at least about 15%, but more preferably at least about 20%, of a compound of the invention (w/w) or a combination thereof. Alternatively, the compounds may be administered separately (either serially or in parallel). Separate dosing allows for greater flexibility in the dosing regime. 5 As mentioned above, dosage forms of the compounds of this invention include pharmaceutically acceptable carriers and adjuvants known to those of ordinary skill in the art. These carriers and adjuvants include, for example, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, buffer substances, water, salts or electrolytes and cellulose-based substances. Preferred dosage forms include, tablet, capsule, caplet, 10 liquid, solution, suspension, emulsion, lozenges, syrup, reconstitutable powder, granule, suppository and transdermal patch. Methods for preparing such dosage forms are known (see, for example, H.C. Ansel and N.G. Popovish, Pharmaceutical Dosage Forms and Drug Delivery Systems, 5th ed., Lea and Febiger (1990)). Dosage levels and requirements are well-recognized in the art and may be selected by those of ordinary skill 15 in the art from available methods and techniques suitable for a particular patient. In some embodiments, dosage levels range from about 10-1000 mg/dose for a 70 kg patient. Although one dose per day may be sufficient, up to 5 doses per day may be given. For oral doses, up to 2000 mg/day may be required. As the skilled artisan will appreciate, lower or higher doses may be required depending on particular factors. For instance, 20 specific dosage and treatment regimens will depend on factors such as the patient's general health profile, the severity and course of the patient's disorder or disposition thereto, and the judgment of the treating physician. ASSESSMENT OF BIOLOGICAL PROPERTIES 25 Expression and Purification of recombinant human Cathepsin S Cloning of human cathepsin S: U937 RNA was subjected to reverse transcriptase / polymerase chain reaction with 30 primer A (5 'cacaatgaaacggctggtttg 3') and primer B (5 'ctagatttctgggtaagaggg 3') designed to specifically amplify the cathepsin S cDNA. The resulting 900 bp DNA fragment was subcloned into pGEM-T (Promega) and sequenced to confirm its identity. This construct was used for all subsequent manipulations. This procedure is typical for cloning of known genes and is established in its field. 5 Human Pre-Pro-Cat S was removed from pGem-T vector (Promega, 2800 Woods Hollow Rd, Madison, WI 53711) by digestion with restriction enzyme SacII, followed by treatment with T4 DNA polymerase to generate a blunt end, and a second restriction enzyme digest with Sail. It was subcloned into pFastBacl donor plasmid (GibcoBRL, 8717 Grovemont CT., Gaithersburg, MD 20884) which had been cut with restriction 10 enzyme BamHl and blunt-ended and then cut with restriction enzyme Sail. The ligation mixture was used to transform DH5a competent cells (GibcoBRL) and plated on LB plates containing lOOug/ml ampicillin. Colonies were grown in overnight cultures of LB media containing 50ug/ml Ampicillin, plasmid DNA isolated and correct insert confirmed by restriction enzyme digestion. Recombinant pFastfiac donor plasmid was 15 transformed into DHlOBac competent cells (GibcoBRL). Large white colonies were picked from LB plates containing 50ug/ml kanamycin, 7ug/ml gentamicin, lOug/ml tetracycline, lOOug/ml Bluo-gal, and 40ug/ml IPTG. DNA was isolated and used to transfect Sf9 insect cells using CellFECTIN reagent (GibcoBRL). Cells and supernatant were harvested after 72 hours. Viral supernatant was passaged twice and presence of Cat 20 S confirmed by PCR of the supernatant, SF9 cells were infected with recombinant baculovirus at a MOI of 5 for 48-72 hrs. Cell pellet was lysed and incubated in buffer at pH 4.5 at 37 for 2 hours to activate Cat S from pro-form to active mature form (Bromme, D & McGrath, M., Protein Science, 1996, 25 5:789-791.) Presence of Cat S was confirmed by SDS-PAGE and Western blot using rabbit anti-human proCat S. Inhibition of Cathepsin S 30 Human recombinant cathepsin S expressed in Baculovirus is used at a final concentration of lOnM in buffer. Buffer is 50mM Na Acetate, pH 6.5,2.5mMEDTA, 2.5mMTCEP. Enzyme is incubated with either compound or DMSO for 10 min at 37C. Substrate 7- fift^D-4-methylcoumarin, CBZ-L-valyl-L-valyl-L-arginineamide (custom synthesis by Molecular Probes) is diluted to 20uM in water (final concentration of 5uM), added to assay and incubated for additional 10 minutes at 37 C. Compound activity is measured by diminished fluorescence compared to DMSO control when read at 360nm excitation 5 and 460nm emission. Examples listed above were evaluated for inhibition of cathepsin S in the above assay. All had IC50 values of 100 micromolar or below. 10 Inhibition of Cathepsin K. F. L and B: Inhibition of these enzymes by particular compounds of the invention may be determined without undue experimentation by using art recognized methods as provided hereinbelow each of which is incorporated herein by reference: 15 Cathepsin B, and L assays are to be found in the following references: 1. Methods in Enzymology, Vol.244, Proteolytic Enzymes: Serine and Cysteine Peptidases, Alan J. Barrett, ed. 20 Cathepsin K assay is to be found in the following reference: 2. Bromme, D., Okamoto, K., Wang, B. B., and Biroc, S. (1996)7. Biol. Chem. Ill, 25 2126-2132. Cathepsin F assays are to be found in the following references: 30 3. Wang, B., Shi, G.P., Yao, P.M., Li, Z., Chapman, H.A., and Bromme, D. (1998) J. Biol. Chem. 273,32000-32008. 4. Santamaria, L, Velasco, G., Pendas, A.M., Paz, A., and Lopez-Otin, C (1999) J. Biol. Chem. 274,13800-13809. 35 Preferred compounds to be evaluated for inhibition of Cathepsin K, F, L and B in the above assays desirably have IC50 values of 100 micromolar or below. We Claim: 1. A compound of formula (I): wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, hexahydropyrimidinyl, hexahydropyridazinyl, piperazinyl, l,4,5,6-tetrahydropyrimidin-2-ylamine, dihydro-oxazolyl, 1,2-thiazinanyl-1,1 -dioxide, 1,2,6-thiadiazinanyl-1, 1 -dioxide, isothiazolidinyl-1, 1-dioxide or imidazolidinyl-2,4-dione, each being optionally substituted with one or more R5; Y is O or S; Rx is C1-5 alkyl, C1-5 alkoxy, aryloxy, C3-7 cycloalkyl, phenyl, benzyl, naphthyl, tetrahydronaphthyl, Ci-salkylsulfonyl Ci-salkyl, C3- 7cycloalkylsulfonylCi-5alkyl, arylsulfonylCi-salkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl, quinoxalinyl, or amino; wherein Ri is optionally substituted by one or more Ra; Ra is C1-5 alkyl, C3-7 cycloalkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-5 alkoxy, C1-5 alkanoyl, Ci-salkanoyloxy, aryloxy, benzyloxy, C1-5 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-8 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is C1-5 alkanoylamino, aroylamino, C1-5 alkylthio, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, C1-5 alkoxycarbonylamino, aryloxycarbonylamino, C1-5 alkylcarbamoyloxy, arylcarbamoyloxy, C1-5 alkylsulfonylamino, arylsulfonylamino, C1-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Ra may be further optionally substituted by one or more Rbj Rb is C1-5 alkyl, C3-6 cycloalkyl, aryl, C1-5 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino; R2 is hydrogen or C1-3 alkyl; R3 is hydrogen, C1-5 alkyl, C2-5alkylene, C3-7 cycloalkyl, arylCi-3alkyl or aryl wherein R3 is optionally substituted by one or more Re; Re is C1-5 alkyl, C3-7 cycloalkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-5 alkoxy, aryloxy, C1-5 alkanoyl, aroyl, C1-5 alkoxycarbonyl, aryloxycarbonyl, C1-5 alkanoyloxy, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is C1-5 alkanoylamino, aroylamino, Ci-s alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, Ci-s alkoxycarbonylamino, aryloxycarbonylamino, C1-5 alkylcarbamoyloxy, arylcarbamoyloxy, C1-5 alkylsulfonylamino, arylsulfonylamino, C1-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more Rdj Rd is C1-5 alkyl, C3-6 cycloalkyl, aryl, arylalkyl, C1-5 alkoxy, aryloxy, aryl Ci-salkoxy, aroyl, amino, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino; R4 is hydrogen or C1-3 alkyl; R5 is Cis alkyl chain optionally interrupted by one or two O or S, phenyl, naphthyl, arylCl-3alkyl, furanyl, thienyl, pyrrolyl, imidazolyl, pyridinyl, pyrimidinyl, CI-5 alkanoyl, aroyl, CI-5 alkoxycarbonyl, aryloxycarbonyl, benzyloxycarbonyl, carbamoyl wherein the nitrogen atom may be independantly mono or disubstituted by CI-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl, pyrrolyl, thiazolyl, imidazolyl, pyridinyl, benzimidazolyl or quinolinyl, or R5 is C1-5 alkanoylamino, aroylamino, C1-5 alkylthio wherein the sulfur atom may be oxidised to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidised to a sulfoxide or sulfone, C1-5 alkylsulfonylamino, arylsulfonylamino, C1-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or disubstituted by alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyridinylcarbonyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl or arylsulfonyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, R5 may be further optionally substituted by one or more Rcj Re is C1-5 alkyl, C3-6 cycloalkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl, quinoxalinyl, C1-5 alkoxy, aryloxy, aroyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, furanyl, thienyl, pyrrolyl or pyridinyl, halogen, hydroxy, oxo, carboxy, cyano, nitro, benzyloxy, arylCi-3alkoxycarbonyl, amidino or guanidino; X is O or S and pharmaceutically acceptable derivatives of the kind such as herein described. 2. The compound as claimed in claim 1 wherein: Het is piperidinyl, pyrrolidinyl, tetrahydropyranyl or tetrahydrothiopyranyl each ring being substituted with one or more Rs; YisO; Ri is Ci-3 alkyl, C1-3 alkoxy, C3-7 cycloalkyl, phenyl, benzyl, naphthyl, tetrahydronaphthyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl, pyridinyl, isoxazolyl, pyrazinyl, indolyl, quinolinyl, benzofuranyl, benzimidazolyl, benzoisoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is C1-3 alkyl, phenyl, naphthyl, piperidinyl, indolinyl, morpholinyl, piperazinyl, furanyl, thienyl, benzimidazolyl, C1-3 alkoxy, Ci-3 alkanoyl, phenoxy, naphthyloxy, benzyloxy, C1-3 alkoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, phenyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl or pyridinyl, or Ra is C1-5 alkanoylamino, benzoylamino, Ci-3alkylsulfonyl, phenylsulfonyl, ureido wherein either nitrogen atom may be independently substituted by alkyl, phenyl, piperidinyl, morpholinyl, furanyl, thienyl or pyridinyl, C1-3 alkoxycarbonylamino, C1-5 alkylcarbamoyloxy, C1-5 alkylsulfonylamino, phenylsulfonylamino, C1.5 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, phenyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl or pyridinyl, halogen, hydroxy, oxo, carboxy, nitro or cyano, Ra may be further optionally substituted by one or more Rt>; Rb is halogen, hydroxy, benzyloxy, oxo or cyano; R2 is hydrogen; R3 is C1-5 alkyl or C2-5 alkylene, C4-6 cycloalkyl or benzyl wherein R3 is optionally substituted by one or more Re; Re is C1-4 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, C1-4 alkoxy, phenoxy, benzoyl, benzyloxy, indolinyl, imidazolyl, Ci-3alkylthio, Ci-3alkylsulfonyl, halogen, hydroxy, oxo, carboxy, nitro or cyano, Re may be further optionally substituted by one or more Ri; Rd is methyl, phenyl, benzyl, benzyloxy, Ci-3alkoxy, halogen, hydroxy, nitro or cyano; R4 is hydrogen; R5 is Ci-4alkyl chain optionally interrupted by one O or S atom, phenyl, phenylCi-2alkyl, furanyl, pyrimidinyl, thienyl, C1-3 alkanoyl, benzoyl, Cl-4 alkoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or disubstituted by C1-5 alkyl, phenyl, piperidinyl, morpholinyl, piperazinyl, furanyl, thienyl or pyridinyl, C1-3 alkylthio, phenylthio, C1-5 alkylaminosulfonyl, phenylaminosulfonyl, Ci-salkylamino wherein the nitrogen atom may be independently mono- or disubstituted by naphthylsulfonyl or pyridinylcarbonyl, halogen, hydroxy, carboxy, oxo or cyano, R5 may be further optionally substituted by one or more Re; Re is C1-3 alkyl, C5-6 cycloalkyl, phenyl, naphthylmethyl, piperidinyl, morpholinyl, piperazinyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, benzinmidazolyl, quinolinyl, isoquinolinyl, C1-4 alkoxy, benzoyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, phenyl, piperidinyl, morpholinyl, furanyl, thienyl or pyridinyl, halogen, hydroxy, oxo or cyano; and XisO. 3. The compound as claimed in claim 2 wherein: Ri is methyl, ethyl, phenyl, piperidinyl, morpholinyl, piperazinyl, pyridinyl, pyrazinyl, furanyl, thienyl, benzyl, benzofuranyl, cyclohexyl, quinolinyl or amino; wherein Ri is optionally substituted by one or more Raj Ra is C1-3 alkyl, phenyl, piperidinyl, thienyl, C1-3 alkoxy, phenoxy, Ci-3alkanoyl, C1-3 alkoxycarbonyl, benzyloxy, C1-3 alkanoylamino, thiophenyl, benzimidazolyl, C1-3 alkylthio or chloro, Ra may be further optionally substituted by one or more Rb; Rb is bromo, chloro, fluoro, iodo, hydroxy, oxo or cyano; R3 is methyl, ethyl, n-propyl, n-butyl, isobutyl, propenyl, butenyl, isobutenyl, C3-7 cycloalkyl or benzyl wherein R3 is optionally substituted by one or more Rc; Re is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxy, ethoxy, methylthio, ethylthio, cyclohexyl, phenyl, naphthyl, imidazolyl, indolinyl, bromo, chloro, fluoro, iodo, hydroxy, oxo, carboxy, nitro, benzoyl, benzyloxy, N-benzylimidazolyl or cyano, Re may be further optionally substituted by one or more Rd; Rd is methyl, methoxy, ethoxy, chloro, fluoro, nitro or hydroxy; Rs is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, phenyl, methoxycarbonyl, ethoxycarbonyl, n-propoxycarbonyl, isopropoxycarbonyl, n-butoxycarbonyl, isobutyloxycarbonyl, tert-butoxycarbonyl and pyrimidinyl, R5 may be further optionally substituted by one or more Re; Re is methyl, ethyl, n-propyl, isopropyl, phenyl, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, tert-butoxycarbonyl, bromo, chloro, fluoro, iodo, hydroxy, oxo or cyano. 4. The compound as claimed in claim 3 wherein: Het is piperidinyl or pyrrolidinyl; Ri is N-acetylaminophenyl, chlorophenyl, methoxyphenyl, m-phenoxyphenyl, morpholinyl, pyrazinyl, pyridinyl, furanyl, chlorothienyl, thienyl or thienylmethyl; R3 is n-butyl, isobutyl, 2,2-dimethylpropyl, cyclohexylmethyl, p-methoxybenzyl or 2-naphthylmethyl; and wherein the configuration at the stereocenter defined by R2 and R3 when they are different and the carbon they are attached to is defined as L; and R5 is methyl, propyl, isopropyl, ethoxycarbonyl, benzyloxycarbonyl, benzyl, phenethyl, N,N-dimethylaminoacetyl or pyrimidinyl. 5. The compound as claimed in claim .4 wherein: Het is piperidin-4-yl or pyrrolidinyl; Ri is morpholinyl or N-acetylaminophenyl; R3 is 2,2-dimethylpropyl or cyclohexylmethyl; and Rs is methyl, propyl, isopropyl, ethoxycarbonyl, ben2yloxycarbonyl, benzyl, phenethyl, N,N-dimethylaminoacetyl or pyrimidinyl. 6. A compound of formula (II): wherein: Het is azepanyl, piperidinyl, pyrrolidinyl, azetidinyl, oxepanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, oxetanyl, azocanyl, oxocanyl, 1,3-diazocanyl, 1,4-diazocanyl, 1,5-diazocanyl, 1,3-dioxocanyl, 1,4-dioxocanyl, 1,5-dioxocanyl, 1,3-oxazocanyl, 1,4- oxazocanyl, 1,5-oxazocanyl, 1,3-diazepanyl, 1,4-diazepanyl, 1,3- dioxepanyl, 1,4-dioxepanyl, 1,3-oxazepanyl, 1,4-oxazepanyl, 1,2- thiazocanyl-1, 1-dioxide, 1,2,8-thiadiazocanyl-l, 1-dioxide, 1,2- thiazepanyl-1, 1-dioxide, 1,2,7-thiadiazepanyl-l, 1-dioxide, tetrahydrothiophenyl, hexahydropyrimidinyl, hexahydropyridazinyl, piperazinyl, 1,4,5,6-tetrahydropyrimidinyl, pyrazolidinyl, dihydro- oxazolyl, dihydrothiazolyl, dihydroimidazolyl, isoxazolinyl, oxazolidinyl, 1,2- thiazinanyl-1,1-dioxide, l,2,6-thiadiazinanyl-l,l- dioxide, isothiazolidinyl-1, 1-dioxide, imidazolidinyl-2,4-dione, imidazolidinyl, morpholinyl, dioxanyl, tetrahydropyridinyl, thiomorpholinyl, thiazolidinyl, dihydropyranyl, dithianyl, decahydro- quinolinyl, decahydro-isoquinolinyl, 1,2,3,4-tetrahydro-quinolinyl, indolinyl, octahydro-quinolizinyl, dihydro-indolizinyl, octahydro- indolizinyl, octahydro-indolyl, decahydroquinazolinyl, decahydroquinoxalinyl, 1,2,3,4-tetrahydroquinazolinyl or 1,2,3,4-tetrahydroquinoxalinyl; A Ce-Cio bridged bicyclo wherein one or more carbon atoms are optionally replaced by a heteroatom chosen from N, O and S; each being optionally substituted with one or more R5; Y is C(O), C(S) or S(0)2; Ri is a bond, hydrogen, C1-10 alkyl, C1-10 alkoxy, aryloxy, C3-8 cycloalkyl, C3-8 cycloalkyloxy, aryl, benzyl, tetrahydronaphthyl, indenyl, indanyl, C1-10 alkylsulfonylCi-ioalkyl, C3-8cycloalkylsulfonyl Ci-ioalkyl, arylsulfonylCi-ioalkyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, tetrahydrothiopyranyl, thiopyranyl, furanyl, tetrahydrofuranyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, tetrazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzisoxazolyl, quinolinyl, tetrahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, quinazolinyl, tetrahydroquinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, hydroxy or amino; wherein Ri is optionally substituted by one or more Raj Ra is a bond, Ci-io alkyl, C3-8 cycloalkyl, aryl, tetrahydronaphthyl, indenyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Ci-io alkoxy, Ci-ioalkanoyl, Ci-ioalkanoyloxy, aryloxy, benzyloxy, Ci-ioalkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is Ci-10 alkanoylamino, aroylamino, C1-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is Ci-10 alkoxycarbonylamino, aryloxycarbonylamino, C1-10 alkylcarbamoyloxy, arylcarbamoyloxy, C1-10 alkylsulfonylamino, arylsulfonylamino, C1-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is halogen, hydroxy, oxo.carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rt>; with the proviso that Rl and Ra simultaneously cannot be a bond; Rb is a Ci-6 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more carbon atoms are optionally replaced by O, N, S(O), S(0)2 or S and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, or one or more C1-4 alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl; or Rb is C3-6 cycloalkyl, aryl, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, monoCi-salkylamino, di-Ci-5alkylamino, carboxamide, amidino or guanidino; R2 is hydrogen or CI-3 alkyl; R3 is a bond, hydrogen, C1-10 alkyl, C2-ioalkylene, C3-scycloalkyl, aryl Ci-salkyi or aryl wherein R3 is optionally substituted by one or more Re; Re is Ci-10 alkyl, C3-8 cycloalkyl, aryl, indanyl, indenyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronaphthyl, decahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, tetrahydrothiopyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, dihydrobenzofuranyl, octohydrobenzofuranyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, tetrahydroquinolinyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-10 alkoxy, aryloxy, C1-10 alkanoyl, aroyl, C1-10 alkoxycarbonyl, aryloxycarbonyl, C1-10 alkanoyloxy, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Ci-10 alkanoylamino, aroylamino, C1-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Ci-io alkoxycarbonylamino, aryloxycarbonylamino, Ci-io alkylcarbamoyloxy, arylcarbamoyloxy, Ci-io alkylsulfonylamino, arylsulfonylamino, Ci-io alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more Rd; Rd is C1-5 alkyl, C3-6 cycloalkyl, aryl, aryl Ci-salkyl, C1-5 alkoxy, aryloxy, aryl Ci-salkoxy, aroyl, amino, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino; R2 and R3 together with the carbon they are attached optionally form a nonaromatic 5-7 membered cycloalkyl or heterocyclic ring; R4 is hydrogen, hydroxy or C1-3 alkyl; R5 is a bond, hydrogen, carbonyl, C1-10 alkyl, CiioalkoxyCi-ioalkyl, Ci- loalkylaminoCi-ioalkyl, CiioalkylthioCi-ioalkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-10 alkoxy, aryloxy, C3-8 cycloalkyl, aryl, benzyl, tetrahydronaphthyl, indenyl, indanyl, C3- 7cycloalkylsulfonyl Ci-salkyl, arylsulfonyl Ci-salkyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, thiopyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridizinyl tetrazolyl, triazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, tetrahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, quinazolinyl, tetrahydroquinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-ioalkanoyl, aroyl, Ci-loalkanoyloxy, benzyloxy, Ci-ioalkoxycarbonyl, arylCi-salkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is C1-10 alkanoylamino, aroylamino, C1-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is Ci-io alkoxycarbonylamino, aryloxycarbonylamino, Ci-io alkylcarbamoyloxy, arylcarbamoyloxy, Ci-io alkylsulfonylamino, arylsulfonylamino, Ci-io alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is halogen, hydroxy, oxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, R5 may be further optionally substituted by one or more ReJ Re is Ci-10 alkyl, Ci-ioalkoxyCi-ioalkyl, Ci-ioalkylaminoCi-ioalkyl, Ci- loalkylthioCi-ioalkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-10 alkoxy, C3-8 cycloalkyl, aryl, tetrahydronaphthyl, indenyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, thiopyranyl, tetrahydrothiopyranyl, pyranyl, tetrahydropyranyl, tetrahydrofuranyl, furanyl, thienyl, pyrrolyl,oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Ci-ioalkanoyl, aroyl, Ciioalkanoyloxy, aryloxy, benzyloxy, C1-10 alkoxycarbonyl, arylCi-3alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Ci-10 alkanoylamino, aroylamino, C1-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Ci-io alkoxycarbonylamino, aryloxycarbonylamino, Ci-io alkylcarbamoyloxy, arylcarbamoyloxy, Ci-io alkylsulfonylamino, arylsulfonylamino, Ci-io alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Re may be further optionally substituted by one or more Rf; Rf is C1-5 alkyl, C3-6 cycloalkyl, tolylsulfonyl, C1.5 alkoxy, aryl, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; X is O or S and pharmaceutically acceptable derivatives of the kind such as herein described. 7. The compound as claimed in claim 6 wherein: Het is piperidinyl, pyrrolidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, azetidinyl, azepanyl, oxepanyl, tetrahydrofuranyl, oxetanyl, hexahydropyrimidinyl, hexahydropryidazinyl, piperazinyl, 1,4,5,6-tetrahydropyrimidinyl, octahydro-indolizinyl, octahydro-quinolizinyl, decahydro-quinolinyl, 1,2,3,4-tetrahydro-quinolinyl, dihydro-oxazolyl, 1,2-thiazinanyl-1,1- dioxide, 1,2,6-thiadiazinanyl-l, 1-dioxide, isothiazolidinyl-1, 1-dioxide, imidazolidinyl, pyrazolidinyl or a bridged bicyclo chosen from azabicyclo[3.2.1]octane, aza-bicyclo[2.2.1]heptane, aza- bicyclo[2.2.2]octane, azabicyclo[3.2.2]nonane, aza- bicyclo[2.1. ljhexane, aza-bicyclo[3.1. l]heptane, azabicyclo[3.3.2]decane and 2-oxa or 2-thia-5-aza- bicyclo[2.2. l]heptane; each ring being substituted with one or more R5; Y is C(O) or S(0)2; Ri is a bond, hydrogen, C1-7 alkyl, C1-7 alkoxy, C3-7 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, tetrahydronaphthyl, Ci-7alkylsulfonyl Ci- 7alkyl, C3-7cycloalkylsulfonylCi-7alkyl, aiylsulfonylCi-7alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, isoxazolyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoisoxazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond C1-7 alkyl, C3-6 cycloalkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-7 alkoxy, Ci-7alkanoyl, Ci-7alkanoyloxy, aryloxy, benzyloxy, C1-7 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is C1-7 alkanoylamino, aroylamino, C1-7 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is C1-7 alkoxycarbonylamino, aryloxycarbonylamino, C1-7 alkylcarbamoyloxy, arylcarbamoyloxy, C1-7 alkylsulfonylamino, arylsulfonylamino, C1-7 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-7alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rb; Rb is C1-5 alkyl, C3-6 cycloalkyl, aryl, C1-5 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; R2 is hydrogen or methyl or ethyl; R3 is a bond, hydrogen, C1-5 alkyl, C2-5alkylene, C3-7cycloalkyl, arylCi-3alkyl or aryl wherein R3 is optionally substituted by one or more Rcj Re is C1-5 alkyl, C3-7 cycloalkyl, aryl, indanyl, indenyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-5 alkoxy, aryloxy, C1-5 alkanoyl, aroyl, C1-5 alkoxycarbonyl, aryloxycarbonyl, C1-5 alkanoyloxy, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetraolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is C1-5 alkanoylamino, aroylamino, C1-5 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is C1-5 alkoxycarbonylamino, aryloxycarbonylamino, C1-5 alkylcarbamoyloxy, arylcarbamoyloxy, C1-5 alkylsulfonylamino, arylsulfonylamino, C1-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more Rd; Rd is C1-5 alkyl, C3-6 cycloalkyl, aryl, arylCi-4 alkyl, C1-5 alkoxy, aryloxy, arylCi-5alkoxy, aroyl, halogen, hydroxy, oxo or cyano; 265 R4 is hydrogen or methyl; R5 is a bond, hydrogen, carbonyl, Ci-s alkyl, Ci-salkoxyCi-salkyl, Ci-8alkylarninoCi-8alkyl, Ci-salkylthioCi-salkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-8 alkoxy, aryloxy, C3-7 cycloalkyl, aryl, benzyl, tetrahydronaphthyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, thiopyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, tetrazolyl, triazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-7alkanoyl, aroyl, Ci-7alkanoyloxy, benzyloxy, C1-7 alkoxycarbonyl, arylCi^alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is C1-7 alkanoylamino, aroylamino, C1-7 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is C1-7 alkoxycarbonylamino, aryloxycarbonylamino, C1-7 alkylcarbamoyloxy, arylcarbamoyloxy, C1-7 alkylsulfonylamino, arylsulfonylamino, C1-7 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 halogen, hydroxy, oxy, oxo, carboxy, cyano, nitro or carboxamide, R5 may be further optionally substituted by one or more Re; Re is C1-7 alkyl, Ci-7alkoxyCi-7alkyl, Ci-7alkylaminoCi-7alkyl, C1-7 alkylthioCi-7alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-7 alkoxy, C3-7 cycloalkyl, aryl, tetrahydronaphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thiopyranyl, tetrahydrothiopyranyl, tetrahydropyranyl, tetrahydrofuranyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-5 alkanoyl, aroyl, Ci-salkanoyloxy, aryloxy, benzyloxy, C1-5 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is C1-5 alkanoylamino, aroylamino, C1-5 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is C1-5 alkoxycarbonylamino, aryloxy carbonylamino, C1-5 alkylcarbamoyloxy, arylcarbamoyloxy, C1-5 alkylsulfonylamino, arylsulfonylamino, C1-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Re may be further optionally substituted by one or more Rf; Rf is methyl, ethyl, t-butyl, tolylsulfonyl, C1-3 alkoxy, cyclopropyl, cyclohexyl, phenyl, naphthyl, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; and XisO. 8. The compound as claimed in claim 7 wherein: ; 1 Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, oxetanyl, octahydro-indolizinyl, octahydro-quinolizinyl or aza- bicyclo[3.2.1]octanyl, each ring being optionally substituted with one or more R5; Ri is a bond, C1-5 alkyl, C1-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, Ci-3alkylsulfonylCi-3alkyl, C3-6cycloalkylsulfonylCi-3alkyl, arylsulfonylCi-3alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, isoxazolyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Raj Ra is a bond, C1-3 alkyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, C1-3 alkoxy, Ci-3alkanoyl, Ci-3alkanoyloxy, aryloxy, benzyloxy, C1-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Ra is C1-3 alkanoylamino, aroylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is C1-3 alkoxycarbonylamino, ary loxy car bony lamino, C1-3 alkylcarbamoyloxy, arylcarbamoyloxy, C1-3 alkylsulfonylamino, arylsulfonylamino, C1-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rt>; Rb is C1-3 alkyl, C3-6 cycloalkyl, aryl, C1-3 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; R2 is hydrogen or methyl; R3 is a bond, hydrogen, C1-5 alkyl, C2-salkylene, C4-6 cycloalkyl or arylCi-2alkyl wherein R3 is optionally substituted by one or more Re; Re is C1-4 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-4 alkoxy, phenoxy, naphthyloxy, C1-3 alkanoyl, benzoyl, C1-3 alkoxycarbonyl, phenoxycarbonyl, C1-3 alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl or aryl, or Re is C1.3 alkanoylamino, benzoylamino, C1.3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-5 alkyl or aryl, or Re is C1-3 alkoxycarbonylamino, aryloxycarbonylamino, C1-3 alkylcarbamoyloxy, arylcarbamoyloxy, C1-3 alkylsulfonylamino, arylsulfonylamino, C1-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl or aryl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more Rd; Rd, is C1-3 alkyl, C3-6 cycloalkyl, phenyl, benzyl, C1-3 alkoxy, phenoxy, phenylCi-3alkoxy, benzoyl, halogen, hydroxy, oxo or cyano; R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, C1-6 alkyl, Ci-6alkoxyCi-6alkyl, Ci-ealkylaminoCi-ealkyl, Ci-6alkylthioCi-6alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-6 alkoxy,, phenoxy, naphthyloxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl and benzoxazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-3alkanoyl, benzoyl, naphthoyl, Ci-4alkanoyloxy, benzyloxy, C1.4 alkoxycarbonyl, arylCi-2alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is C1-4 alkanoylamino, aroylamino, C1-4 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, or R5 is C1-4 alkoxycarbonylamino, phenoxycarbonylamino, C1-4 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-4 alkylsulfonylamino, phenylsulfonylamino, C1-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-4 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, R5 may be further optionally substituted by one or more Re; Re is C1-4 alkyl, C1-4 alkoxy, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydrothiopyranyl, tetrahydropyranyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-4 alkanoyl, aroyl, Ci-4alkanoyloxy, phenoxy, naphthyloxy, benzyloxy, C1-4 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, or benzthiazolyl, or Re is C1-4 alkanoylamino, benzoylamino, C1-4 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is C1-4 alkoxycarbonylamino, phenoxycarbonylamino, C1-4 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-4 alkylsulfonylamino, phenylsulfonylamino, C1-4 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Re may be further optionally substituted by one or more Rf; Rf is methyl, ethyl, t-buryl, tolylsulfonyl, methoxy, cyclopropyl, phenyl, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide. 9. The compound as claimed in 8 wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more R5; Ri is a bond, C1-5 alkyl, C1-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Raj Ra is a bond, C1-3 alkyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, C1-3 alkoxy, Ci-3alkanoyl, Ci-3alkanoyloxy, aryloxy, benzyloxy, C1-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is C1-3 alkanoylamino, aroylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is C1-3 alkoxycarbonylamino, aryloxycarbonylamino, C1-3 alkylcarbamoyloxy, arylcarbamoyloxy, C1-3 alkylsulfonylamino, arylsulfonylamino, C1-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rb; Rb is methyl, ethyl, n-propyl, i-propyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, methoxy, ethoxy, n-propoxy, i-propoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R2 is hydrogen; R3 is a bond, C1-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rcj Re is C1-3 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrimidinyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, C1.3 alkoxy, phenoxy, naphthyloxy, C1-2 alkanoyl, benzoyl, C1-2 alkoxycarbonyl, phenoxycarbonyl, Ci.2alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl or aryl, or Re is Ci-2 alkanoylamino, benzoylamino, C1.2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl or aryl, or Re is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, arylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, Ci-aalkylarninosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl or phenyl, or Re is halogen, hydroxy, oxo, carboxy or cyano, Re may be further optionally substituted by one or more Rd; Rd is methyl, cyclopropyl, cyclohexyl, phenyl, benzyl, methoxy, phenoxy, benzyloxy, benzoyl, fluoro, chloro, oxo or cyano; R5 is a bond, hydrogen, carbonyl, C1-5 alkyl, Ci-salkoxyCi-salkyl, Ci-5alkylaminoCi-5 alkyl, Cl-5alkylthioCi-5alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-5 alkoxy, phenoxy, C3-ecycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-3alkanoyl, benzoyl, naphthoyl, Cisalkanoyloxy, benzyloxy, C1-3 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is C1-3 alkanoylamino, 272 aroylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, pyrrolidinyi, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, or R5 is C1.3 alkoxycarbonylamino, phenoxycarbonylamino, C1-3 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-3 alkylsulfonylamino, phenylsulfonylamino, C1-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyi, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, R5 may be further optionally substituted by one or more Re; Re is C1-3 alkyl, C1-3 alkoxy, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyi, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, C1-3 alkanoyl, aroyl, Ci-3alkanoyloxy, phenoxy, benzyloxy, C1-3 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyi, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re C1-3 alkanoylamino, benzoylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, pyrrolidinyi, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is C1-3 alkoxycarbonylamino, phenoxycarbonylamino, C1-3 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-3 alkylsulfonylamino, phenylsulfonylamino, C1-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyi, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, Re may be further optionally substituted by one or more Rf; and Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide. 10. The compound as claimed in claim 9 wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl or tetrahydropyranyl each ring being substituted with one or more R5; Y is C(O); Ri is a bond, methyl, ethyl, i-propyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more Raj Ra is a bond, methyl, ethyl, cyclopropyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Ra is acetylamino, benzoylamino, methylthio, phenylthio wherein the sulfur atom may he oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Ra is methoxycarbonylamino, phenoxy carbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methyl- sulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Ra may be further optionally substituted by one or more Rt>; Rb is methyl, cyclopropyl, phenyl, methoxy, phenoxy, ben2yloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide; R3 is a bond, C1-3 alkyl, C2-4alkylene, Csecycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rcj Re is methyl, ethyl, n-propyl, i-propyl, C5-6 cycloalkyl, indanyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, thienyl, oxazolyl, thiazolyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or aryl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or aryl, or Re is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro or oxo, Re may be further optionally substituted by one or more Rdj Rd is methyl, cyclopropyl, phenyl, methoxy, fluoro, chloro or oxo; R5 is a bond, hydrogen, carbonyl, C1-4 alkyl, Ci-4alkoxyCi-4alkyl, Ci- 4alkylaminoCi-4alkyl, Ci-4alkylthioCi-4alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-4 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-2alkanoyl, benzoyl, naphthoyl, Ci-2alkanoyloxy, benzyloxy, Ci-2alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 C1-2 alkanoylamino, benzoylamino, C1-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, C1-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; Re is C1-3 alkyl, C1-2 alkoxy, C3-6cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, C1-2 alkanoyl, aroyl, Ci- 2alkanoyloxy, phenoxy, benzyloxy, C1-2 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is C1-2 alkanoylamino, benzoylamino, C1-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, C1-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rf; and Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide. 11. The compound as claimed in claim 10 wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl, azepan-3-yl, azepan-4-yl or tetrahydropyran-4-yl, each ring being optionally substituted with one or more R5; Ri is a bond, methyl, ethyl, i-propyl, methoxy, cyclopropyl, cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more Raj Ra is methyl, phenyl, thienyl, methoxy, acetyl, acetoxy, phenoxy, benzloxy, methoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is acetylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl or phenyl, or Ra is methoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, hydroxy, oxo, carboxy, cyano or carboxamide; R3 is a bond, methyl, ethyl, n-propyl, propenyl, butenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more RcJ Re is methyl, ethyl, nrpropyl, i-propyl, cyclohexyl, cyclopentyl, indanyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4 tetrahydronaphthyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro, chloro or oxo; R5 is a bond, hydrogen, carbonyl, C1-4 alkyl, Ci-2alkoxyCi-2alkyl, Ci-2alkylaminoCi-2alkyl, Ci-2alkylthioCi-2alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-2 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, acetyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, benzyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; Re is methyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by methyl, ethyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Re is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rf; and Rf is methyl, phenyl, tolylsulfonyl, phenoxy, benzyloxy, fluoro, chloro or oxo. 12. The compound as claimed in claim 11 wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl or tetrahydropyran-4-yl, each ring being substituted with one or more Rs; Ri is i-propyl, benzyloxy, cyclohexyl, phenyl, 4-(acetylamino)-phenyl, 4-(methanesulfonylamino)-phenyl, 4-methoxyphenyl, 3- phenoxyphenyl, 4-chlorophenyl, 4- fluorophenyl, 2-fluorophenyl, 2-fluoro-4-chlorophenyl, naphthyl, thienylmethyl, piperidinyl, morpholinyl, pyrrolidinyl, piperazinyl, furanyl, thienyl, 5-chlorothienyl, pyridin-4-yl, pyrazinyl, methylamino, ethylamino, dimethylamino or diethylamino; R3 is ethyl, n-propyl, propenyl, butenyl, i-butenyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, cyclohexyl, cyclopentyl, indanyl, 1,2,3,4-tetrahydronaphthyl, methoxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro or chloro; R5 is a bond, carbonyl, methyl, ethyl, n-propyl, n-butyl, t-butyl, i- propyl, i-buryl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, piperidinyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy, R5 may be further optionally substituted by one or more Re; Re is methyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, thienyl, 5-methylthienyl, methoxy, phenoxy, benzyloxy, piperidinyl, pyridinyl, indolyl, l-(tolyl-sulfonyl)-indolyl, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, phenyl or benzyl, or Re is hydroxy, fluoro, chloro, oxo, dimethylamino or trifluoromethyl; 13. The compound as claimed in claim 12 wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl or azetidin-3-yl, each ring being substituted with one or more R5; Ri is phenyl, 4-(acetylamino)-phenyl, 4-(methanesulfonylamino)-phenyl, 3- phenoxyphenyl, 4-chlorophenyl, 4-fluorophenyl, thienylmethyl, morpholinyl, pyrrolidinyl, piperidinyl, piperazinyl, 5-chlorothienyl, pyridin-4-yl or pyrazinyl; R3 is n-butyl, i-butyl, 2,2-dimethylpropyl, cyclohexylmethyl, propenyl, i- butenyl, 4- methoxybenzyl, 4-chlorobenzyl, 3,4-dichlorobenzyl, 3-chlorobenzyl, 2,4-dichlorobenzyl, 4-methylbenzyl, 3-methylbenzyl or naphth-2-ylmethyl; wherein the configuration at the stereocenter defined by R2 and R3 when they are different and the carbon they are attached to is defined as L; and R5 is a bond, methyl, ethyl, n-propyl, n-butyl, n-pentyl, 2-pentyl, 3- pentyl, phenethyl, phenpropyl, 2,2-dimethylpropyl, t-butyl, i-propyl, i- butyl, cyclopropyl, cyclopentyl, cyclohexyl, cyclopropylmethyl, cyclopentylmethyl, cyclohexylmethyl, phenyl, benzyl, naphthylmethyl, indanylmethyl, pyridinylmethyl, indolylmethyl, thienylmethyl, 5- methylthienylmethyl, piperidinyl, piperidinylcarbonyl, pyridinylcarbonyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, t-butoxycarbonyl, methylcarbamoyl, phenylcarbamoyl, benzylcarbamoyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, methylcyclohexyl, methylbenzyl, methoxybenzyl, phenoxybenzyl, benzyloxybenzyl, N-[(4-methylphenyl)-sulfonyl]- indolylmethyl, fluorobenzyl, difluorobenzyl, chlorobenzyl, N,N-dimethylaminoacetyl, trifluoromethylbenzyl, fluoro, oxo or carboxy. 14. The compound as claimed in claim 8 wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more Rs; 0-7A Ri is a bond, C1-4 alkyl, C1-4 alkoxy, cyclopropyl, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is methyl, ethyl, propyl, i-propyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, ethoxy, acetyl, acetoxy, phenoxy, naphthyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, phenoxycarbonyl, naphthyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ethylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, phenylcarbamoyloxy, naphthylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, naphthylsulfonylamino, C1-2 alkylaminosulfonyl, phenylaminosulfonyl, naphthylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rt>; Rb is methyl, ethyl, cyclopropyl, cyclohexyl, phenyl, methoxy, ethoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R2 is hydrogen or methyl; R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more RcJ Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, naphthyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrimidinyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Rc is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl or phenyl, or Rc is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylqarbamoyloxy, methylsulfonyl- amino, phenylsulfonylamino, methylaminosulfonyl, phenylamino-sulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Rc is chloro, fluoro, hydroxy, oxo, carboxy or eyano; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl or tetrahydrothiophenyl; R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, C1-5 alkyl, Ci-salkoxyCi-salkyl, Ci-salkylaminoCi-salkyl, Ci-salkylthioCi-salkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-5 alkoxy, phenoxy, naphthyloxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, acetyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, benzyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by methyl, ethyl or phenyl, or R5 is acetylamino, benzoylamino, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, phenylsulfonylamino, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; Re is methyl ethyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl,piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, methoxy, ethoxy, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Re is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoy- loxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rfj Rf is methyl, phenyl, tolylsulfonyl, phenoxy, benzyloxy, fluoro, chloro or oxo. 15. The compound as claimed in claim 14 wherein: Ri is a bond, methyl, ethyl, n-propyl, i-propyl, methoxy, ethoxy, benzyloxy, cyclopropyl, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is methyl, cyclopropyl, phenyl, halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-butenyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, carbamoyl wherein 282 the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Re is acetylamino, benzoylamino, methylthio, methoxycarbonylamino, methylcarbamoyloxy, methylsulfonyl-amino, methylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, or Rc is fluoro or oxo; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, pyrrolidinyl or piperidinyl; R5 is methyl, ethyl, n-propyl, n-butyl, n-pentyl, 2-pentyl, 3-pentyl, phenethyl, phenpropyl, 2,2-dimethylpropyl, t-butyl, i-propyl, i-butyl, cyclopropyl, cyclopentyl, cyclohexyl, cyclopropylmethyl, cyclopentylmethyl, cyclohexylmethyl, phenyl, benzyl, 2- methylbenzyl, 3-methylbenzyl, 4-methylbenzyl, 2,6-dimethylbenzyl, 2,5- dimethylbenzyl, 2,4-dimethylbenzyl, 2,3-dimethylbenzyl, 3,4- dimethylbenzyl, 3,5-dimethylbenzyl, 2,4,6-trimethylbenzyl, 2- methoxybenzyl, 3-methoxybenzyl, 4-methoxybenzyl, 2-phenoxybenzyl, 3-phenoxy benzyl, 4-phenoxybenzyl, 2-benzyloxybenzyl,3- benzyloxybenzyl, 4-benzyloxyben2yl, 2-fluorobenzyl, 3-fluorobenzyl, 4- fluorobenzyl, 2,6-difluorobenzyl, 2,5-difluorobenzyl, 2,4- difluorobenzyl, 2,3-difluorobenzyl, 3,4-difluorobenzyl, 3,5- difluorobenzyl, 2,4,6-triflurobenzyl, 2-trifluoromethylben2yl, 3- trifluoromethylben2yl, 4-trifluoromethylbenzyl, naphthylmethyl, indanylmethyl, pyridinylmethyl, indolylmethyl, thienylmethyl, 5- methylthienylmethyl, piperidinyl, piperidinylcarbonyl, pyridinylcarbonyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, t-butoxycarbonyl, methylcarbamoyl, phenylcarbamoyl, benzylcarbamoyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy. 16. The compound as claimed in claim 15 wherein: Ri is methoxy, benzyloxy, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Raj Ra is methyl, phenyl, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide;R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-butenyl or benzyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, rnethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, acetylamino, methylthio, methylsulfonylamino or fluoro; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl or tetrahydrofuranyl; R5 is methyl, ethyl, n-propyl, n-butyl, phenethyl, phenpropyl, t-buryl, i-propyl, i-butyl, cyclopropyl, cyclohexyl, cyclopropylmethyl, cyclohexylmethyl, phenyl, benzyl, 2-methoxybenzyl, 3-methoxybenzyl; 4-methoxybenzyl 4-fluorobenzyl, 3,5-difluorobenzyl, 4- trifluoromethylbenzyl, naphthylmethyl, pyridinylmethyl, indolylmethyl, thienylmethyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, t-butoxycarbonyl, phenylcarbamoyl, phenylsulfonylamino or fluoro. 17. The compound as claimed in claim 16 wherein: Het is pyrrolidinyl, piperidinyl or tetrahydropyranyl; Ri is benzyloxy, phenoxy, naphthyloxy, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyridinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or phenylamino; R3 is n-propyl, i-butyl, propenyl, i-butenyl or 2,2dimethylpropyl; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, or cycloheptyl; R5 is methyl, ethyl, n-propyl, phenethyl, t-butyl, i-propyl, i-butyl, cyclohexyl, cyclohexylmethyl, benzyl, 4-fluorobenzyl, naphthylmethyl, acetyl, benzoyl or benzyloxycarbonyl. 18. A compound selected from the group consisting of: Morpholine-4-carboxylic acid [l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 4-Acetylamino-iVL[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; 4-Acetylamino-iV-[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]- benzamide; Morpholine-4-carboxylic acid [1-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3,3- dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [l-(l-benzyl-4-cyano-piperidin-4-ylcarbamoyl)-2- cyclohexyl-ethyl]-aimde; Morpholine-4-carboxylic acid [l-(4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]- amide hydrochloride; Morpholine-4-carboxylic acid {1-[4-cyano-l-(l-methyl-ethyl)-piperidin-4-ylcarbamoyl] -2 -cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid [1-(4-cyano-l-phenethyl-piperidin-4-ylcarbamoyl)-2- cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-ben2yl-pyrrolidin-3-ylcarbamoyl]-2- cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid [1-(4-cyano-l-propyl-piperidin-4-ylcarbamoyl)-2- cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1-(4-cyano-1-isopropyl-piperidin-4-ylcarbamoylj-3,3- dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [l-(l-phenethyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [l-(l-n-propyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3- dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [l-(l-benzyl-4-cyano-piperidin-4-ylcarbamoyl)-3,3- dimethyl-butyl]-amide; 4-Acetylamino-iV-[ 1 -(1 -benzyl-4-cyano-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; 4-Acetylamino-JV-[ 1 -(4-cyano-1 -isopropyl-piperidin-4-ylcarbarmoyl)-2-cyclohexyl-ethyl]-benzamide; Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-piperidin-3-ylcarbamoyl-2 - cyclohexyl-ethyl] -amide; N- [ 1 - (4-cyano-1 -methyl-piperidin-4-ylcarbamoy 1) -2-cyclohexyl-ethyl]-benzamide; 4-(Acetylamino-methyl)-JV-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; N-[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-isonicotinamide; Pyrazine-2-carboxylic acid [1-(4-cyano-l-methyl-piperidin-4- ylcarbamoyl)-2- cyclohexyl-ethylj-amide; 5-Chloro-thiophene-2-carboxylic acid [1 -(4-cyano-1-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; 4-Chloro-JV-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-benzamide; JV-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-3-phenoxy-benzamide; i\T-[l-(l-Ben2yl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl-ethyl]- isonicotinamide; Pyrazine-2-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3- ylcarbamoyl)-2- cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(cyclohexyl-methyl)-pyrrolidin-3- ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid [l-(3-cyano-l-benzyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; JV-[l-(l-Benzyl-3-cyano-pyiTolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-benzamide; Pyrazine-2-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3- ylcarbamoyl)-3,3- dimethyl-butyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(l-methyl-ethyl)- pyrrolidin-3-ylcarbamoyl]-2-cyclohesyl-ethyl-amide; N-[ 1 -(1 -benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-4- methanesulfonylamino-benzamide; N-[ 1 -(1 -Benzyl-3-cyano-pyirolidin-3-ylcarbarmoyl)-2-cyclohexyl-ethyl]-4- methanesulfonylamino-benzamide; N-[ 1 -(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-benzamide; i\r-[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethyl]-4-fluoro- benzamide; JV-[l-(4-cyano-l-methyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-4- methanesulfonylamino-benzamide; Morpholine-4-carboxylic acid [1-(3-cyano-l-cyclohexyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-arnide; Morpholine-4-carboxylic acid [1-(3-cyano-l-ethyl-pyrrolidin-3-ylcarbamoyl)-2- cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [1-(3-cyano-l-methyl--pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(3-methyl-ben2yl)-pyrrolidin-3- ylcarbamoyl] -2 -cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(2-methyl-pent-2-enyl)-pyrrolidin-3 -ylcarbamoyl] -2 -cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(lH-indol-3-ylmethyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Pyrrolidine-1-carboxylic acid [l-(l-beri2yl-3-cyano-pyrrolidin-3-ylcarbamoyl)-2- cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [1-(3-cyano-1-cyclohexylmethyl- pyrrolidin-3- ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [1-(3-cyano-l-isobutyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohe3cyl-ethyl]-amide; Morpholine-4-carboxylic acid [1-(3-cyano-l-isopropyl-pyrrolidin-3-ylcarbamoyl)-3,3- dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [1-(3-cyano-l-isobutyl-pyrrolidin-3-ylcarbamoyl)-3,3- dimethyl-butyl]-amide; Morpholine-4-carboxylic acid {1 -[3-cyano-1 -(1 -ethyl-propyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid {1-[3-cyano- l-(l-ethyl-propyl)-pyrrolidin-3-ylcarbamoy 1 ]-3,3-dimethyl-butyl}-amide; Morpholine-4-carboxylic acid [ 1-(3-cyano-l-phenethyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [1 -(3-cyano-1-cyclopropylmethyl-pyrrolidin-3- ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [1-(3-cyano-1-methyl-piperidin-3-ylcarbamoyl)-2- cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [l-(l-ben2yl-3-cyano-azetidin-3- ylcarbamoyl)-2- cyclohexyl-ethyl]-amide; OCT Morpholine-4-carboxylic acid [l-(3-cyano-l-propyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [1 -(3-cyano-l-propyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-(3-cyano-l-(trans-4-methyl- cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethyl}-amide; Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclopentyl-pyrrolidin-3-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [l-(3-cyano-l-isobutyl-piperidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclopentyl-pyrrolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [l-(3-cyano-pyirolidin-3-ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(trans-4-methyl- cyclohexyl)-pyrrolidin-3-ylcarbamoyl]-3,3-dimethyl-butyl}-amide; Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl}-2- naphthalen-2-yl-ethyl]-amide; Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl) -2- (4-chloro-phenyl) -ethyl] -amide; Morpholine-4-carboxylic acid {l-[3-cyano-l-(5-methyl-thiophen-2-ylmethyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohe3Qrl-ethyl}-amide; Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3-methyl-but-3-enyl]-amide; Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclopentylmethyl-pyrrolidin-3- ylcarbamoyl)-2-cyclohexyl-ethyl]-amide; Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclohexy]methyl- pyrrolidin-3- ylcarbamoyl)-3-methyl-butyl]-amide; 4-Chloro-JV-[ 1 -(4-cyano-1 -propyl-piperidm-4-ylcarbamoyl)-3,3-dimethyl-butylj-benzamide; Pyrazine-2-carboxylic acid [1 -(4-cyano- l-propyl-piperidin-4- ylcarbamoyl)-3,3-dimethyl-butyl]-amide; 4,4-dimethyl-2-(2-thiophen-2-yl-acetylamino)-pentanoic acid (4-cyano-1 -propylpiperidin-4-yl)-amide; Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3-methylbutyl]-amide; Morpholine-4-carboxylic acid [1-(4-cyano-l-cyclohexyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butyl]-amide; Morpholine-4-carboxylic acid [2-(4-chloro-phenyl)-l-(4-cyano-1 -propyl-piperidin-4-ylcarbamoyl) -ethyl] -amide; Morpholine-4-carboxylic acid [l-(4-cyano-l-propyl-piperidin-4-ylcarbamoyl)-2-(3,4- dichloro-phenyl)-ethyl]-amide; Morpholine-4-carboxylic acid [1-(4-cyano-l-propyl-piperidin-4-ylcarbamoyl]-2-naphthalen-2-yl-ethyl]-amide; Morpholine-4-carboxylic acid [ 1 -(4-cyano-1 -propyl-piperidin-4-ylcarbamoyl)-3 -methyl-butyl]-amide; Morpholine-4-carboxylic acid [1 -(4-cyano-1,2~dimethyl-piperidin-4-ylcarbamoyl) -3,3-dimethyl-butyl] -amide and the pharmaceutically acceptable derivatives of the kind such as herein described. 19. The compound as claimed in claim 14 wherein the compound is selected from: [ 1 -(1 -Benzyl-4-cyano-piperidin-4-ylcarbamoyl)-3-methyl-butyl]-carbamic acid benzyl ester; [ 1 -(1 -Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl-cyclohexyl]-carbamic acid t-butyl ester; [ 1 -(4-Cyano-1 -methyl-piperidin-4-ylcarbamoyl)-3-methyl-butyl]-carbamic acid benzyl ester, [ 1 -(1 -Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl]-cyclohe3c^l]-carbamic acid benzyl ester; Naphthalene-2-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl) -3-methyl-butyl] -amide; Morpholine-4-carboxylic acid [1 -(4-cyano- l-propyl-piperidin-4-ylcarbamoyl) -3-methyl-butyl] -amide; Naphthalene-2-carboxylic acid [l-(3-cyano-l-cyclohe3^1methyl-pyrrolidin-3- ylcarbamoyl)3~methyl-butyl]-amide; [ 1 -(1 -Benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl)-3-methyl-butyl]-carbamic acid benzyl ester; Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl) -3-methyl-butyl] -amide; [ 1 -(3-Cyano-1 -cyclohexylmethyl-pyrrolidin-3-ylcarbamoyl)-3-methyl-butyl]-carbamic acid benzyl ester; Morpholine-4-carboxylic acid [l-(3-cyano-l-cyclohexylmethyl- pyrrolidin-3-ylcarbamoyl)-3-methyl-butyl]-amide; Morpholine-4-carboxylic acid [l-(l-benzyl-3-cyano-pyrrolidin-3-ylcarbamoyl) -3-methyl- but-3-enyl] -amide and the pharmaceutical^ acceptable derivatives of the kind such as herein described. 20. A compound of formula (la) or (lb): wherein: Het is azepanyl, piperidinyl, pyrrolidinyl, azetidinyl, oxepanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, oxetanyl, azocanyl, oxocanyl, 1,3-diazocanyl, 1 ,4-diazocanyl, 1,5-diazocanyl, 1,3-dioxocanyl, 1,4-dioxocanyl, 1,5-dioxocanyl, 1,3-oxazocanyl, 1,4- oxazocanyl, 1,5-oxazocanyl, 1,3-diazepanyl, 1,4-diazepanyl, 1,3- dioxepanyl, 1,4-dioxepanyl, 1,3-oxazepanyl, 1,4-oxazepanyl, 1,2- thiazocanyl-1,1- dioxide, 1,2,8-thiadiazocanyl-1,1-dioxide, 1,2- thiazepanyl-1,1 -dioxide, 1,2-7-thiadiazepanyl-1,1 -dioxide, tetrahydrothiophenyl, hexahydropyrimidinyl, hexahydropyridazinyl, piperazinyl, 1,4,5,6-tetrahydropyrimidinyl, pyrazolidinyl, dihydro- oxazolyl, dihydrothiazolyl, dihydroimidazolyl, isoxazolinyl, oxazolidinyl, 1,2-thiazinanyl-1,1 -dioxide, l,2,6-thiadiazinanyl-l,l- dioxide, isothiazolidinyl-1,1-dioxide, imidazolidinyl-2,4-dione, imidazolidinyl, morpholinyl, dioxanyl, tetrahydropyridinyl, thiomorpholinyl, thiazolidinyl, dihydropyranyl, dithianyl, decahydro- quinolinyl, decahydro-isoquinolinyl, 1,2,3,4-tetrahydro-quinolinyl, indolinyl, octahydro-quinolizinyl, dihydro-indolizinyl, octahydro- indolizinyl, octahydro-indolyl, decahydroquinazolinyl, decahydroquinoxalinyl, 1,2,3,4-tetrahydroquinazolinyl or 1,2,3,4-tetrahydroquinoxalinyl; A C6-C10 bridged bicyclo wherein one or more carbon atoms are optionally replaced by a heteroatom chosen from N, O and S; each being optionally substituted with one or more R5; Ri is a bond, hydrogen, C1-10 alkyl, C1-10 alkoxy, aryloxy, C3-8 cycloalkyl, C3-8 cycloalkyloxy, aryl, benzyl, tetrahydronaphthyl, indenyl, indanyl, Ci-ioalkylsulfonylCi-ioalkyl, C3-8cycloalkylsulfonylCi- loalkyl, arylsulfonylCi-ioalkyl, heterocyclyl selected from azepanyl, azocanyl, pyrrolidinyl, piperidihyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, tetrahydrothiopyranyl, thiopyranyl, furanyl, tetrahydrofuranyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, tetrazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzisoxazolyl, quinolinyl, tetrahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, quinazolinyl, tetrahydroquinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, hydroxy or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond, C1-10 alkyl, C3-8 cycloalkyl, aryl, tetrahydronaphthyl, indenyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-10 alkoxy, Ci-ioalkanoyl, C1-10 alkanoyloxy, aryloxy, benzyloxy, C1-10 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is Ci-10 alkanoylamino, aroylamino, Ci-10 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quindlinyl, isoquinoliny, quinazolinyl or quinoxalinyl, or Ra is Ci-10 alkoxycarbonylamino, aryloxycarbortylamino, Ci-10 alkylcarbamoyloxy, arylcarbamoyloxy, Ci-10 alkylsulfonylamino,arylsulfonylamino, Ci-io alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra maybe further optionally substituted by one or more Rb; with the proviso that Ri and Ra simultaneously cannot be a bond; Rb is a Ci-6 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more carbon atoms are optionally replaced by O, N, S(O), S(0)2 or S and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, or one or more C1-4 alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl; or Rb is C3-6 cycloalkyl, aryl, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, mono-Ci-salkylamino, di-Ci-salkylamino, carboxamide, amidino or guanidino; R2 is hydrogen or C1-3 alkyl; R3 is a bond, hydrogen, C1-10 alkyl, C2-ioalkylene, C3-8 cycloalkyl, arylCi-5alkyl or aryl wherein R3 is optionally substituted by one or more Re; Rc is Ci-10 alkyl, C3-8 cycloalkyl, aryl, indanyl, indenyl, bicyclo[2.2. ljheptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronaphthyl, decahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, tetrahydrothiopyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, dihydrobenzofuranyl, octohydrobenzofuranyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, tetrahydroquinolinyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-10 alkoxy, aryloxy, C1-10 alkanoyl, aroyl, C1-10 alkoxycarbonyl, aryloxycarbonyl, C1-10 alkanoyloxy, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Ci-io alkanoylamino, aroylamino, Ci-io alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Ci-io alkoxycarbonylamino, aryloxycarbonylamino, Ci-io alkylcarbamoyloxy, arylcarbamoyloxy, Ci-io alkylsulfonylamino, arylsulfonylamino, Ci-io alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more Rd; Rd is Ci-s alkyl, C3-6 cycloalkyl, aryl, arylCi-salkyl, C1-5 alkoxy, aryloxy, arylCi-salkoxy, aroyl, amino, halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino; R2 and R3 together with the carbon they are attached optionally form a nonaromatic 5-7 membered cycloalkyl or heterocyclic ring; each R4 is independently hydrogen, hydroxy or C1.3 alkyl; R5 is a bond, hydrogen, carbonyl, C1-10 alkyl, Ci-ioalkoxyCi-ioalkyl, Ci- loalkylaminoCi-ioalkyl, Ci-ioalkylthioCi-ioalkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-10 alkoxy, aryloxy, C3-8 cycloalkyl, aryl, benzyl, tetrahydronaphthyl, indenyl, indanyl, C3- 7cycloalkylsulfonylCi-5alkyl, arylsulfonylCi-salkyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, thiopyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridizinyl, tetrazolyl, triazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, tetrahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, quinazolinyl, tetrahydroquinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyolyl moiety is selected from those herein described in this paragraph, Ci-ioalkanoyl, aroyl, Ci-loalkanoyloxy, benzyloxy, Ci-ioalkoxycarbonyl, arylCi-salkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is Ci-io alkanoylamino, aroylamino, Ci-io alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is Ci-10 alkoxycarbonylamino, aryloxycarbonylamino, C1-10 alkylcarbamoyloxy, arylcarbamoyloxy, C1-10 alkylsulfonylamino, arylsulfonylamino, C1-10 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is halogen, hydroxy, oxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, R5 may be further optionally substituted by one or more Re; Re is Ci-10 alkyl, Ci-ioalkoxyCi-ioalkyl, Ci-ioalkylaminoCi-ioalkyl, Ci-ioalkylthioCi-ioalkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Ci-10 alkoxy, C3-8 cycloalkyl, aryl, tetrahydro- naphthyl, indenyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, thiopyranyl, tetrahydro-thiopyranyl, pyranyl, tetrahydropyranyl, tetrahydrofuranyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, benzisoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Ci-ioalkanoyl, aroyl, Ci-loalkanoyloxy, aryloxy, benzyloxy, Ci-10 alkoxycarbonyl, arylCi-3alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Ci-io alkanoylamino, aroylamino, Ci-io alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently subsituted by Ci-10 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is Ci-io alkoxycarbonylamino, aryloxycarbonylamino, Ci-io alkylcarbamoyloxy, arylcarbamoyloxy, Ci-io alkylsulfonylamino, arylsulfonylamino, Ci-io alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-io alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Re may be further optionally substituted by one or more Rf; Rf is C1-5 alkyl, C3-6 cycloalkyl, tolylsulfonyl, C1-5 alkoxy, aryl, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; Re is hydrogen, hydroxy, nitrile or a C1-6 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally, replaced by O, NH, S(O), S(0)2 or S and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, one or more C1-4 alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl or quinoxalinyl; wherein Ri and Re in the formulas (I) or (II) optionally form a 4 to 8 membered mono- or 7-12 membered polycyclo heteroring system, each aromatic or nonaromatic, wherein each heteroring is optionally substituted by one or more R7; each R7 and Rs are independently: C1-5 alkyl chain optionally interrupted by one or two N, O or S(0)m and optionally substituted by 1-2 oxo, amino, hydroxy, halogen, Ci-4alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl or quinoxalinyl, aryl, aryloxy, aroyl, furanyl, thienyl, pyrrolyl, imidazolyl, pyridinyl, pyrimidinyl, C1-5 alkanoyl, C1-5 alkoxycarbonyl, aryloxycarbonyl, benzyloxycarbonyl, C1-5 alkanoylamino, aroylamino, C1-5 alkylthio, arylthio C1-5 alkylsulfonylamino, arylsulfonylamino, C1-5 alkylaminosulfonyl, arylaminosulfonyl, C3-6 cycloalkyl and benzyloxy each of the aforementioned are optionally halogenated, halogen, hydroxy, oxo, carboxy, nitrile, nitro or NH2C(0)-; m is 0, 1 or 2; X is =0, =S or =N-R6 wherein R6 is as defined above, and pharmaceutically acceptable derivatives of the kind such as herein described. 21. The compound as claimed in claim 20 wherein: Het is piperidinyl, pyrrolidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, azetidinyl, azepanyl, oxepanyl, tetrahydro-furanyl, oxetanyl, hexahydropyrimidinyl, hexahydropryidazinyl, piperazinyl, 1,4,5,6-tetrahydropyrimidinyl, octahydro-indolizinyl, octahydro-quinolizinyl, decahydro-quinolinyl, 1,2,3,4-tetrahydro-quinolinyl, dihydro-oxazolyl, 1,2 thiazinanyl-1,1-dioxide, 1,2,6-thiadiazinanyl-1, 1-dioxide, isothiazolidinyl-1,1 -dioxide, imidazoli-dinyl, pyrazolidinyl or a bridged bicyclo chosen from azabicyclo[3.2.1]octane, aza-bicyclo[2.2.1]heptane, azabicyclo[2.2.2] octane, aza-bicyclo[3.2.2]nonane, aza-bicyclo[2.1 .l]hexane, aza-bicyclo[3.1.1]heptane, aza-bicyclo[3.3.2]decane and 2-oxa or 2-thia-5-aza-bicyclo[2.2. l]heptane; each ring being substituted with one or more R5; Ri is a bond, hydrogen, C1-7 alkyl, C1-7 alkoxy, C3-7 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, tetrahydronaphthyl, Ci-7alkylsulfonylCi- 7alkyl, C3-7cycloalkylsulfonlylCi-7alkyl, arylsulfonylCi-7alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, isoxazolyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoisoxazoyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond C1-7 alkyl, C3-6 cycloalkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1.7 alkoxy, Ci-7alkanoyl, Ci-7alkanoyloxy, aryloxy, benzyloxy, C1.7 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is C1-7 alkanoylamino, aroylamino, C1-7 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is C1-7 alkoxycarbonylamino, aryloxycarbonylamino, C1-7 alkylcarbamoyloxy, arylcarbamoyloxy, C1-7 alkylsulfonylamino, arylsulfonylamino, C1-7 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rbj Rb is C1-5 alkyl, C3-6 cycloalkyl, aryl, C1-5 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxmide, amidino or guanidino; R2 is hydrogen or methyl or ethyl; R3 is a bond, hydrogen, C1-5 alkyl, 2-5alkylene, C3-7 cycloalkyl, arylCi-3alkyl or aryl wherein R3 is optionally substituted by one or more Re; Re is C1-5 alkyl, C3-7 cycloalkyl, aiyl, indanyl, indenyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0] heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-5 alkoxy, aryloxy, C1-5 alkanoyl, aroyl, C1-5 alkoxycarbonyl, aryloxycarbonyl, C1-5 alkanoyloxy, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is C1-5 alkanoylamino, aroylamino, C1-5 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl; thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Rc is C1-5 alkoxycarbonylamino, aryloxycarbonylamino, C1-5 alkylcarbamoyloxy, arylcarbamoyloxy, C1-5 alkylsulfonylamino, arylsulfonylamino, C1-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Rc is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Rc may be further optionally substituted by one or more Rd; Rd is C1-5 alkyl, C3-6 cycloalkyl, aryl, arylCi-4 alkyl, C1-5 alkoxy, aryloxy, arylCi-salkoxy, aroyl, halogen, hydroxy, oxo or cyano; R4 is hydrogen or methyl; Rs is a bond, hydrogen, carbonyl, Ci-salkyl, Ci-salkoxyCi-salkyl, Ci-salkylaminoCi-salkyl, Ci-salkylthioCi-salkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Ci-8 alkoxy, aryloxy, C3-7 cycloalkyl, aryl, benzyl, tetrahydronaphthyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, tetrahydropyranyl, thiopyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, tetrazolyl, triazolyl, pyrazolyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl and quinoxalinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-7alkanoyl aroyl, Ci-7alkanoyloxy, benzyloxy, C1-7 alkoxycarbonyl, arylCi-4alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-7 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is C1-7 alkanoylamino, aroylamino, C1-7 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-7alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is C1-7 alkoxy carbonylamino, aryloxycarbonylamino, C1-7 alkylcarbamoyloxy, arylcarbamoyloxy, C1-7 alkylsulfonylamino, arylsulfonylamino, C1-7 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by Ci-7alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or R5 is halogen, hydroxy, oxy, oxo, carboxy, cyano, nitro or carboxamide, R5 may be further optionally substituted by one or more Re; Re is C1-7 alkyl, Ci-7alkoxyCi-7alkyl, Ci-7alkylaminoCi-7alkyl, Ci-7alkylthioCi-7alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-7 alkoxy, C3-7 cycloalkyl, aryl, tetrahydronaphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thiopyranyl, tetrahydrothiopyranyl, tetrahydropyranyl, tetrahydrofuranyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, Ci-s alkanoyl, aroyl, Ci-salkanoyloxy, aryloxy, benzyloxy, C1-5 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re, is C1-5 alkanoylamino, aroylamino, C1-5 alkylthio wherein the sulfur atom may be oxidized to sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomolpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is C1-5 alkoxycarbonylamino, aryloxycarbonylamino, Ci- 5alkylcarbamoyloxy, arylcarbamoyloxy, C1-5 alkylsulfonylamino, arylsulfonylamino, C1-5 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl or quinoxalinyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Re may be further optionally substituted by one or more Rf; Rf is methyl, ethyl, t-butyl, tolylsulfonyl, C1-3 alkoxy, cyclopropyl, cyclohexyl, phenyl, naphthyl, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R6 is hydrogen, hydroxy, nitrile or a C1-6 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, S(O), S(0)2 or S and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, one or more C1-4 alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl or quinoxalinyl; Ri and Re of the formula (la) or formula (lb) form a monocyclic 5, 6 or 7 membered aromatic or nonaromatic heterocyclic ring optionally substituted by R7; or a bicyclic ring having one 5, 6 or 7 membered aromatic or nonaromatic heterocyclic ring fused to a second 5-7 membered aromatic or nonaromatic heterocyclic or carbocyclic ring wherein each ring is optionally independently substituted by one or more R7; R7and Rs are independently C1-5 alkyl, C3-6 cycloalkyl, aryl, C1-5 alkoxy, aryloxy, benzyloxy each of the aforementioned are optionally halogenated or R is halogen, hydroxy, oxo, carboxy, nitrile, nitro or NH2C(0)-; M is 0, 1 or 2 and X is O or S. 22. The compound as claimed in claim 21 wherein Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, oxetanyl, octahydro-indolizinyl, octahydro-quinolizinyl or aza- bicyclo[3.2.1]octanyl, each ring being optionally substituted with one or more R5; Ri is a bond, C1-5 alkyl, C1-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, Ci-3alkylsulfonylCi-3alkyl, C3-6cycloalkylsulfonylCi-3alkyl, arylsulfonylCi-3alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, isoxazolyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond, C1-3 alkyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, C1-3 alkoxy, Ci-3alkanoyl, Ci-3alkanoyloxy, aryloxy, benzyloxy, C1-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Ra is C1-3 alkanoylamino, aroylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ■7m arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomoipholinyl or piperazinyl, or Ra is C1-3 alkoxycarbonylamino, aryloxycarbonylamino, C1.3 alkylcarbamoyloxy, arylcarbamoyloxy, C1.3 alkylsulfonylamino, arylsulfonylamino, C1-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomoipholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rt,; Rb is C1-3 alkyl, C3-6 cycloalkyl, aryl, C1-3 alkoxy, aryloxy, benzyloxy, halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino; R2 is hydrogen or methyl; R3 is a bond, hydrogen, C1-5 alkyl, C2-5alkylene, C4-6 cycloalkyl or arylCi-2alkyl wherein R3 is optionally substituted by one or more Re; Re is C1-4 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0] heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4- tetrahydronapbthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomoipholinyl, indolinyl, furanyl, tetrahydrofuranyl, pyranyl, tetrahydropyranyl, thienyl, pyrrolyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzafuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-4 alkoxy, phenoxy, naphthyloxy, Ci-3 alkanoyl, benzoyl, C1-3 alkoxycarbonyl, phenoxycarbonyl, C1-3 alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl or aryl, or Re is C1-3 alkanoylamino, benzoylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-5 alkyl or aryl, or Re is C1-3 alkoxycarbonylamino, aryloxycarbonylamino, C1-3 alkycarbamoyloxy, arylcarbamoyloxy, C1-3 alkylsulfonylamino, arylsuflonylamino, C1-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-5 alkyl or aryl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro, amidino or guanidino, Re may be further optionally substituted by one or more RdJ Rd is C1-3 alkyl, C3-6 cycloalkyl, phenyl, benzyl, C1-3 alkoxy, phenoxy, phenylCi-3alkoxy, benzoyl, halogen, hydroxy, oxo or cyano; R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, Ci-e alkyl, Ci-6alkoxyCi-6alkyl, Ci- 6alkylaminoCi-6alkyl, Ci-6alkylthioCi-6alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-6 alkoxy, , phenoxy, naphthyloxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, tetrahydrothiopyranyl, furanyl, tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl and benzoxazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-3alkanoyl, benzoyl, naphthoyl, Ci-4alkanoyloxy, benzyloxy, Ci^alkoxycarbonyl, arylCi-2alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is C1-4 alkanoylamino, aroylamino, C1-4 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, or R5 is C1-4 alkoxycarbonylamino, phenoxycarbonylamino, C1-4 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-4 alkylsulfonylamino, phenylsulfonylamino, C1-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-4 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Rs may be further optionally substituted by one or more Re; Re is C1-4 alkyl, C1-4 alkoxy, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydrothiopyranyl, tetrahydropyranyl, 303 tetrahydrofuranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, C1-4 alkanoyl, aroyl, Ci-4alkanoyloxy, phenoxy, naphthyloxy, benzyloxy, Ci-4 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, or benzthiazolyl, or Re is C1-4 alkanoylamino, benzoylamino, Ci^ alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is C1-4 alkoxycarbonylamino, phenoxycarbonylamino, C1-4 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-4 alkylsulfonyl-amino, phenylsulfonylamino, C1-4 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thio¬morpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Re may be further optionally substituted by one or more Rf; Rf is methyl, ethyl, t-butyl, tolylsulfonyl, methoxy, cyclopropyl, phenyl, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide. Ri and Re of the formula (la) or Formula (lb) optionally form a monocyclic 5 or 6 membered aromatic or nonaromatic heterocyclic ring optionally substituted by R7; or a bicyclic ring having one 5, 6 or 7 membered aromatic or nonaromatic heterocyclic ring fused to a second 5-6 membered aromatic or nonaromatic heterocyclic or carbocyclic ring wherein each ring is optionally independently substituted by one or more R7; R7 and R8 are independently Ci~4 alkyl, C5-6 cycloalkyl, C1-4 alkoxy, halogen, hydroxy, oxo, carboxy, nitrile, nitro or NH2C(0)-; and XisO. 23. The compound as claimed in claim 22 wherein Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more R5; Ri is a bond, C1-5 alkyl, C1-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond, C1-3 alkyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, C1-3 alkoxy, Ci-3alkanoyl, Ci-3alkanoyloxy, aryloxy, benzyloxy, C1-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is C1-3 alkanoylamino, aroylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is C1-3 alkoxycarbonylamino, aryloxycarbonylamino, C1-3 alkylcarbamoyloxy, arylcarbamoyloxy, C1-3 alkylsulfonylamino, arylsulfonylamino, C1.3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rbj Rb, is methyl, ethyl, n-propyl, i-propyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, methoxy, ethoxy, n-propoxy, i-propoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R2 is hydrogen; R3 is a bond, C1-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is C1-3 alkyl, C5-6 cycloalkyl, phenyl, naphthyl, indanyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4. l.OJheptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrimidinyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, C1-3 alkoxy, phenoxy, naphthyloxy, C1-2 alkanoyl, benzoyl, C1-2 alkoxycarbonyl, phenoxycarbonyl, Ci-2alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl or aryl, or Re is C1-2 alkanoylamino, benzoylamino, C1-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C 1.3 alkyl or aryl, or Re is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, arylcarbamoyloxy, Ci-2 alkylsulfonylamino, phenylsulfonylamino, Ci.2alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl or phenyl, or Re is halogen, hydroxy, oxo, carboxy or cyano, Re may be further optionally substituted by one or more Rd; Rd is methyl, cyclopropyl, cyclohexyl, phenyl, benzyl, methoxy, phenoxy, benzyloxy, benzoyl, fluoro, chloro, oxo or cyano; R5 is a bond, hydrogen, carbonyl, Ci-5 alkyl, Ci-salkoxyCi-salkyl.Ci-5alkylaminoCi-5alkyl, Ci-salkylthioCi-salkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-5 alkoxy, phenoxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-3alkanoyl, benzoyl, naphthoyl, Ci-3alkanoyloxy, benzyloxy, C1-3 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is C1-3 alkanoylamino, aroylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, or Rs is C1-3 alkoxycarbonylamino, phenoxycarbonylaniino, C1-3 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-3 alkylsulfonylamino, phenylsulfonylamino, C1-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzmidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, R5 may be further optionally substituted by one or more Re; Re is C1-3 alkyl, C1-3 alkoxy, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, C1-3 alkanoyl, aroyl, Ci-3alkanoyloxy, phenoxy, benzyloxy, C1-3 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is C1-3 alkanoylamino, benzoylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is C1-3 alkoxycarbonylamino, phenoxycarbonylaniino, C1-3 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-3 alkylsulfonylamino, phenylsulfonylamino, C1-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, Re may be further optionally substituted by one or more Rf; and Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide; Ri and Re of the formula (la) or Formula (lb) form a bicyclic ring having one 5 or 6 membered aromatic or nonaromatic heterocyclic ring fused to a second 5-6 membered heteroaryl, heterocycle or phenyl ring; wherein each ring is optionally independently substituted by one or two R7. 24. The compound as claimed in claim 23 wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl or tetrahydropyranyl each ring being substituted with one or more R5; Ri is a bond, methyl, ethyl, i-propyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is a bond, methyl, ethyl, cyclopropyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by methyl, ethyl or phenyl, or Ra is acetylamino, benzoylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Ra is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Ra may be further optionally substituted by one or more Rb; Rb is methyl, cyclopropyl, phenyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide; R3 is a bond, C1-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, n-propyl, i-propyl; C5-6 cycloalkyl, indanyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l)pentanyl, cubanyl, 1,2,3,4 tetrahydronaphthyl, thienyl, oxazolyl, thiazolyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or aryl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or aryl, or Re is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro or oxo, Re may be further optionally substituted by one or more Ra; Rd is methyl, cyclopropyl, phenyl, methoxy, fluoro, chloro or oxo; Rs is a bond, hydrogen, carbonyl, C1-4 alkyl, Ci-4alkoxyCi-4alkyl, Ci-4alkylaminoCi-4alkyl, Ci^alkylthioCi-4alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-4 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-2alkanoyl, benzoyl, naphthoyl, Ci-2alkanoyloxy, benzyloxy, C1-2 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyramidinyl, or R5 is C1-2 alkanoylamino, benzoylamino, C1-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, C1-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; Re is C1-3 alkyl, C1-2 alkoxy, C3-6 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, C1-2 alkanoyl, aroyl, Ci-2alkanoyloxy, phenoxy, benzyloxy, C1-2 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is C1-2 alkanoylamino, benzoylamino, C1-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, C1-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independentiy mono or di-substituted by C1-2 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rf; Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide and Ri and Re of the formula (la) or Formula (lb) form a bicyclic ring having one 5-6 membered aromatic or nonaromatic heterocyclic ring fused to a phenyl ring; wherein each ring is optionally independently substituted by one or two R7. 25. The compound as claimed in claim 24 wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl, azepan-3-yl, azepan-4-yl or tetrahydropyran-4-yl, each ring being optionally substituted with one or more R5; Ri is a bond, methyl, ethyl, i-propyl, methoxy, cyclopropyl, cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is methyl, phenyl, thienyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is acetylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl or phenyl, or Ra is methoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, hydroxy, oxo, carboxy, cyano or carboxamide; R3 is a bond, methyl, ethyl, n-propyl, propenyl, butenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, n-propyl, i-propyl, cyclohexyl, cyclopentyl, indanyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4. l.Ojheptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro, chloro or oxo; R5 is a bond, hydrogen, carbonyl, C1-4 alkyl, Ci-2alkoxyCi-2alkyl, Ci-2alkylaminoCi-2alkyl, Ci-2alkylthioCi-2alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-2 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, aceryloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, benzyloxy carbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or /sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, in methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Rs is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; Re is methyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by methyl, ethyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Re is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rr, and Rf is methyl, phenyl, tolylsulfonyl, phenoxy, benzyloxy, fluoro, chloro or oxo; Ri and Re of the formula (la) or Formula (lb) form the bicyclic ring 9 wherein W is -S(0)n-, -O-C(O)- or -N-C(O)-, n is 0, 1 or 2 and wherein each ring is optionally independently substituted by one or two R7. 26. The compound as claimed in claim 25 wherein Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl or tetrahydropyran-4-yl, each ring being substituted with one or more Rs; Ri is i-propyl, benzyloxy, cyclohexyl, phenyl, 4-(acetylamino)-phenyl, 4-(methanesulfonylamino)-phenyl, 4-methoxyphenyl, 3- phenoxyphenyl, 4-chlorophenyl, 4- fluorophenyl, 2-fluorophenyl, 2-fluoro-4-chlorophenyl, naphthyl, thienylmethyl, piperidinyl, morpholinyl, pyrrolidinyl, piperazinyl, furanyl, thienyl, 5-chlorothienyl, pyridin-4-yl, pyrazinyl, methylamino, ethylamino, dimethylamino or diethylamino; R3 is ethyl, n-propyl, propenyl, butenyl, i-butenyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, cyclohexyl, cyclopentyl, indanyl, 1,2,3,4-tetrahydronaphthyl, methoxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro or chloro; R5 is a bond, carbonyl, methyl, ethyl, n-propyl, n-butyl, t-butyl, i- propyl, i-buryl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, piperidinyl, tetrahydroyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy, Rs may be further optionally substituted by one or more Re; Re is methyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, thienyl, 5-methylthienyl, methoxy, phenoxy, benzyloxy, piperidinyl, pyridinyl, indolyl, l-(tolyl-sulfonyl)-indolyl, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, phenyl or benzyl, or Re is hydroxy, fluoro, chloro, oxo, dimethylamino or trifluoromethyl; and n is 2. 27. The compound as claimed in claim 20 wherein: Ri and Re remain acyclic; Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more R5; Ri is a bond, C1-5 alkyl, C1-5 alkoxy, C3-6 cycloalkyl, aryloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Raj ^ 1 ^ Ra is a bond, C1-3 alkyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, C1.3 alkoxy, Ci-3alkanoyl, Ci-3alkanoyloxy, aryloxy, benzyloxy, C1-3 alkoxycarbonyl, aryloxycarbonyl, aroyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is C1-3 alkanoylamino, aroylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, arylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by Ci-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is C1-3 alkoxycarbonylamino, aryloxycarbonylamino, C1-3 alkylcarbamoyloxy, arylcarbamoyloxy, C1-3 alkylsulfonylamino, arylsulfonylamino, C1-3 alkylaminosulfonyl, arylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, aryl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rb; Rb is methyl, ethyl, n-propyl, i-propyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, methoxy, ethoxy, n-propoxy, i-propoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R2 is hydrogen; R3 is a bond, C1-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rc; Re is C1-3 alkyl, C5-6 cyclolkyl, phenyl, naphthyl, indanyl, bicyclo[2.2. ljheptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrimidinyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, C1-3 alkoxy, phenoxy, naphthyloxy, C1-2 alkanoyl, benzoyl, C1-2 alkoxy carbonyl, phenoxycarbonyl, Ci-2alkanoyloxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl or aryl, or Rc is Ci-2 alkanoylamino, benzoylamino, C1-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl or aryl, or Re is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, arylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, Ci-2alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl or phenyl, or Re is halogen; hydroxy, oxo, carboxy or cyano, Re may be further optionally substituted by one or more Rd; Rd is methyl, cyclopropyl, cyclohexyl, phenyl, benzyl, methoxy, phenoxy, benzyloxy, benzoyl, fluoro, chloro, oxo or cyano; R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, C1-5 alkyl, Ci-salkoxyCi-salkyl, Ci-5alkylaminoCi-salkyl, Ci-salkylthioCi-salkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, Cis alkoxy, phenoxy, C3-6 cycloalkyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-3alkanoyl, benzoyl, naphthoyl, Ciaalkanoyloxy, benzyloxy, C1.3 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is C1-3 alkanoylamino, aroylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzofuranyl, benzothienyl, benzimidazolyl or benzthiazolyl, or R5 is C1-3 alkoxycarbonylamino, phenoxycarbonylamino, C1-3 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-3 alkylsulfonylamino, phenylsulfonylamino, C1-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or R5 is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, R5 may be further optionally substituted by one or more Re; Re is C1-3 alkyl, C1-3 alkoxy, C3-7 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, C1-3 alkanoyl, aroyl, Ci- 3alkanoyloxy, phenoxy, benzyloxy, C1-3 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is C1-3 alkanoylamino, benzoylamino, C1-3 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-3 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is C1-3 alkoxycarbonylamino, phenoxycarbonylamino, C1-3 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-3 alkylsulfonylamino, phenylsulfonylamino, C1-3 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-3 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Re is halogen, hydroxy, oxo, carboxy, cyano or carboxamide, Re may be further optionally substituted by one or more Rf; Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide; R6 is hydroxy, nitrile or a C1-5 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, or S(0)2 and wherein said chain is optionally independently substituted with 1-2 oxo groups, -NH2, one or more C1-4 alkyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, indolinyl, pyranyl, thiopyranyl, furanyl, thienyl, pyrrolyl, oxazolyl, isoxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, benzofuranyl, benzothienyl, benzimidazolyl, benzthiazolyl, quinolinyl, isoquinolinyl, quinazolinyl, benzoxazolyl or quinoxalinyl; and XisO. 28. The compound as claimed in claim 27 wherein: Ri is a bond, methyl, ethyl, i-propyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more Raj Ra is a bond, methyl, ethyl, cyclopropyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Ra is acetylamino, benzoylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Ra is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, bromo, iodo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide, Ra may be further optionally substituted by one or more Rb; Rb is methyl, cyclopropyl, phenyl, methoxy, phenoxy, ben2yloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide; R3 is a bond, C1-3 alkyl, C2-4alkylene, C5-6 cycloalkyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, n-propyl, i-propyl, C5-6 cycloalkyl, indanyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, thienyl, oxazolyl, thiazolyl, indolyl, benzofuranyl, benzothienyl, benzthiazolyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or aryl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or aryl, or Re is methoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di- substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro or oxo, Re may be further optionally substituted by one or more R Rd is methyl, cyclopropyl, phenyl, methoxy, fluoro, chloro or oxo; Rs is a bond, hydrogen, carbonyl, C1-4 alkyl, Ci-4alkoxyCi-4alkyl, Ci-4alkylaminoCi-4alkyl, Ci^alkylthioCi-4alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-4 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, benzyl, indanyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl and benzthiazolyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, Ci-2alkanoyl, benzoyl, naphthoyl, Ci-2alkanoyloxy, benzyloxy, C1-2 alkoxycarbonyl, benzyloxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazoly, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or R5 is C1-2 alkanoylamino, benzoylamino, C1-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazoiyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl or benzthiazolyl, or Rs is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, C1-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Rs is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, Rs may be further optionally substituted by one or more Re; Re is C1-3 alkyl, C1-2 alkoxy, C3-6 cycloalkyl, phenyl, naphthyl, indanyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, tetrahydropyranyl, indolyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, benzimidazolyl, benzthiazolyl, benzoxazolyl, C1-2 alkanoyl, aroyl, Ci-2alkanoyloxy, phenoxy, benzyloxy, C1-2 alkoxycarbonyl, phenoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is C1-2 alkanoylamino, benzoylamino, C1-2 alkylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by C1-2 alkyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl or pyrimidinyl, or Re is C1-2 alkoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, phenylcarbamoyloxy, C1-2 alkylsulfonylamino, phehylsulfonylamino, C1-2 alkylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by C1-2 alkyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, or pyrimidinyl, or Re is fluoro, chloro, bromo, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rfj Rf is methyl, phenyl, tolylsulfonyl, methoxy, phenoxy, benzyloxy, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide and Re is nitrile or a C1-5 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, or S(0)2 and wherein said chain is optionally independently substituted with oxo, -NH2, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyridinyl, pyrimidinyl or pyrazinyl. 29. The compound as claimed in claim 28 wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl, azepan-3-yl, azepan-4-yl or tetrahydropyran-4-yl, each ring being optionally substituted with one or more R5; Ri is a bond, methyl, ethyl, i-propyl, methoxy, cyclopropyl, cyclohexyl, phenoxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, thiazolyl, imidazolyl, pyridinyl, pyrazinyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is methyl, phenyl, thienyl, methoxy, acetyl, acetoxy, phenoxy, benzyloxy, methoxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is acetylamino, methylthio, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl or phenyl, or Ra is methoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, 31Q amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Ra is fluoro, chloro, hydroxy, oxo, carboxy, cyano or carboxamide; R3 is a bond, methyl, ethyl, n-propyl, propenyl, butenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, n-propyl, i-propyl, cyclohexyl, cyclopentyl, indanyl, bicyclo[2.2. l]heptanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1 .OJheptanyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, 1,2,3,4-tetrahydronaphthyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro, chloro or oxo; and wherein the configuration at the stereocenter defined by R2 and R3 when they are different and the carbon they are attached to is defined as L; and Rs is a bond, hydrogen, carbonyl, C1-4 alkyl, Ci-2alkoxyCi-2alkyl, Ci-2alkylaminoCi-2alkyl, Ci-2alkylthioCi-2alkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-2 alkoxy, phenoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, acetyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, benzyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl ethyl or phenyl, or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; Re is methyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di- substituted by methyl, ethyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Re is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rf; Rf is methyl, phenyl, tolylsulfonyl, phenoxy, ben2yloxy, fluoro, chloro or oxo; R6 is nitrile or a C1-5 saturated or unsaturated branched or unbranched carbon chain optionally partially or fully halogenated wherein one or more C atoms are optionally replaced by O, NH, or S(0)2 and wherein said chain is optionally independently substituted with oxo, -NH2, morpholinyl or piperazinyl. 30. The compound as claimed in claim 29 wherein: Het is piperidin-4-yl, piperidin-3-yl, pyrrolidin-3-yl, azetidin-3-yl or tetrahydropyran-4-yl, each ring being substituted with one or more Rs; Ri is i-propyl, benzyloxy, cyclohexyl, phenyl, 4-(acetylamino)-phenyl, 4-(methanesulfonylamino)-phenyl, 4-methoxyphenyl, 3- phenoxyphenyl, 4-chlorophenyl, 4- fluorophenyl, 2-fluorophenyl, 2-fluoro-4-chlorophenyl, naphthyl, thienylmethyl, piperidinyl, morpholinyl, pyrrolidinyl, piperazinyl, furanyl, thienyl, 5-chlorothienyl, pyridin-4-yl, pyrazinyl, methylamino, ethylamino, dimethylamino or diethylamino; R3 is ethyl, n-propyl, propenyl, butenyl, i-butenyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Rc; Re is methyl, cyclohexyl, cyclopentyl, indanyl, 1,2,3,4-tetrahydronaphthyl, methoxy, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, fluoro or chloro; Rs is a bond, carbonyl, methyl, ethyl, n-propyl, n-butyl, t-butyl, i- propyl, i-butyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, piperidinyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy, R5 may be further optionally substituted by one or more Re; Re is methyl, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, thienyl, 5-methylthienyl, methoxy, phenoxy, benzyloxy, piperidinyl, pyridinyl, indolyl, -l(tolyl-sulfonyl)-indolyl, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, phenyl or benzyl, or Re is hydroxy, fluoro, chloro, oxo, dimethylamino or trifluoromethyl; and Re is acetyl, Ci-3alkylaminocarbonyl or Ci-3alkoxycarbonyl 31. The compound as claimed in claim 30 wherein: Het is piperidin-4-yl or pyrrolidin-3-yl; Ri is morpholin-4-yl, p-fluorophenyl or p-methoxyphenyl; R5 is methyl, propyl, n-pentyl or cyclohexyl and R6 is acetyl, ethylaminocarbonyl or ethoxycarbonyl. 32. The compound as claimed in claim. 20 wherein: Het is piperidinyl, pyrrolidinyl, azetidinyl, azepanyl, oxepanyl, tetrahydropyranyl, oxetanyl or tetrahydrothiopyranyl each ring being optionally substituted with one or more R5; Ri is a bond, Ci^ alkyl, C1-4 alkoxy, cyclopropyl, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Ra; Ra is methyl, ethyl, propyl, i-propyl, cyclopropyl, cyclohexyl, phenyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, thienyl, imidazolyl, methoxy, ethoxy, acetyl, acetoxy, phenoxy, naphthyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, phenoxycarbonyl, naphthyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ethylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, C1-2 alkylcarbamoyloxy, phenylcarbamoyloxy, naphthylcarbamoyloxy, C1-2 alkylsulfonylamino, phenylsulfonylamino, naphthylsulfonylamino, Ci-2alkylaminosulfonyl, phenylaminosulfonyl, naphthylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl or piperazinyl, or Ra is halogen, hydroxy, oxo, carboxy, cyano, nitro, carboxamide, amidino or guanidino, Ra may be further optionally substituted by one or more Rbj Rb is methyl, ethyl, cyclopropyl, cyclohexyl, phenyl, methoxy, ethoxy, phenoxy, benzyloxy, fluoro, chloro, bromo, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R2 is hydrogen or methyl; R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-butenyl, cyclohexyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, naphthyl, bicyclo[3.1.0]hexanyl, bicyclo[l.l.l]pentanyl, cubanyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrimidinyl, methoxy, ethoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, phenoxycarbonyl, acetoxy, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl or phenyl, or Rc is methoxycarbonylamino, phenoxycarbonylamino, 323 methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonyl- amino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl or phenyl, or Rc is chloro, fluoro, hydroxy, oxo, carboxy or cyano; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl or tetrahydrothiophenyl; R4 is hydrogen; R5 is a bond, hydrogen, carbonyl, C1-5 alkyl, Ci-salkoxyCi-salkyl, Ci-salkylaminoCi-salkyl, Ci-salkylthioCi-salkyl wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, C1-5 alkoxy, phenoxy, naphthyloxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, benzyl, heterocyclyl selected from pyrrolidinyl, piperidinyl, morpholinyl, tetrahydropyranyl, pyridinyl, and pyrimidinyl, heterocyclyloxy wherein the heterocyclyl moiety is selected from those herein described in this paragraph, acetyl, benzoyl, acetyloxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, benzyloxycarbonyl, benzoyloxy, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is acetylamino, benzoylamino, phenylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or R5 is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, phenylsulfonylamino, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or R5 is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, R5 may be further optionally substituted by one or more Re; Re is methyl ethyl, methoxy, ethoxy, cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, indanyl, piperidinyl, morpholinyl, indolyl, thienyl, pyridinyl, methoxy, ethoxy, acetyl, benzoyl, acetyloxy, phenoxy, benzyloxy, methoxycarbonyl, ethoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is acetylamino, benzoylamino, methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, phenylthio methylthio wherein the sulfur atom may be oxidized to a sulfoxide or sulfone, ureido wherein either nitrogen atom may be independently substituted by methyl, ethyl or phenyl, or Re is methoxycarbonylamino, ethoxycarbonylamino, phenoxycarbonylamino, methylcarbamoyloxy, phenylcarbamoyloxy, methylsulfonylamino, phenylsulfonylamino, methylaminosulfonyl, phenylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, ethyl or phenyl, or Re is fluoro, chloro, hydroxy, oxo, carboxy or carboxamide, Re may be further optionally substituted by one or more Rf; Rf is methyl, phenyl, tolylsulfonyl, phenoxy, benzyloxy, fluoro, chloro or oxo. 33. The compound as claimed in claim 32 wherein Ri is a bond, methyl, ethyl, n-propyl, i-propyl, methoxy, ethoxy, benzyloxy, cyclopropyl, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more R»; Ra is methyl, cyclopropyl, phenyl, halogen, hydroxy, oxo, carboxy, cyano, nitro or carboxamide; R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, butenyl, benzyl or naphthylmethyl wherein R3 is optionally substituted by one or more Re; Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, methoxy, phenoxy, acetyl, benzoyl, methoxycarbonyl, carbamoyl wherein the nitrogen atom may be independently mono or di substituted by methyl or phenyl, or Rc is acetylamino, benzoylamino, methylthio, methoxycarbonylamino, methylcarbamoyloxy, methylsulfonylamino, methylaminosulfonyl, amino wherein the nitrogen atom may be independently mono or di-substituted by methyl, or Rc is fluoro or oxo; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyblohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl, tetrahydrofuranyl, pyrrolidinyl or piperidinyl; Rs is methyl, ethyl, n-propyl, n-butyl, n-pentyl, 2-pentyl, 3-pentyl, phenethyl, phenpropyl, 2, 2-dimethylpropyl, t-butyl, i-propyl, i-butyl, cyclopropyl, cyclopentyl, cyclohexyl, cyclopropylmethyl, cyclopentylmethyl, cyclohexylmethyl, phenyl, benzyl, 2- methylbenzyl, 3-methylbenzyl, 4-methylbenzyl, 2, 6-dimethylbenzyl, 2,5- dimethylbenzyl, 2,4-dimethylben2yl, 2,3-dimethylben2!yl, 3,4- dimethylbenzyl, 3,5-dimethylben2yl, 2,4,6- trimethylbenzyl, 2- methoxybenzyl, 3-methoxybenzyl, 4-methoxybenzyl, 2- phenoxyben2yl, 3-phenoxybenzyl, 4-phenoxybenzyl, 2- benzyloxybenzyl, 3-benzyloxybenzyl, 4-benzyloxybenzyl, 2- fluorobenzyl, 3-fluorobenzyl, 4-fluorobenzyl, 2, 6-difluorobenzyl, 2,5- difluorobenzyl, 2,4-difluoroben2yl, 2,3-difluorobenzyl, 3,4- difluorobenzyl, 3,5-difluorobenzyl, 2,4,6-triflurobenzyl, 2- txifluoromethylbenzyl, 3- trifluoromethylbenzyl, 4- trifluoromethylbenzyl, naphthylmethyl, indanylmethyl, pyridinylmethyl, indolylmethyl, thienylmethyl, 5-methylthienylmethyl, piperidinyl, piperidinylcarbonyl, pyridinylcarbonyl, tetrahydropyranyl, pyrimidinyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, t- butoxycarbonyl, methylcarbamoyl, phenylcarbamoyl, benzylcarbamoyl, methylsulfonylamino, phenylsulfonylamino, methylamino, dimethylamino, fluoro, oxo or carboxy. 34. The compound as claimed in claim 33 wherein: Ri is methoxy, benzyloxy, cyclohexyl, phenoxy, naphthyloxy, phenyl, benzyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or amino; wherein Ri is optionally substituted by one or more Raj Ra is methyl, phenyl, fluoro, chloro, hydroxy, oxo, carboxy or carboxamide; R3 is a bond, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, n-pentyl, propenyl, i-butenyl or benzyl wherein R3 is optionally substituted by one or more Rc; Re is methyl, ethyl, cyclohexyl, cyclopentyl, phenyl, furanyl, tetrahydropyranyl, thienyl, oxazolyl, thiazolyl, methoxy, phenox-y, acetyl, benzoyl methoxycarbonyl, acetylamino, methylthio, methylsulfonylamino or fluoro; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, cycloheptyl, tetrahydropyranyl, tetrahydrothiopyranyl or tetrahydrofuranyl; R5 is methyl, ethyl, n-propyl, n-butyl, phenethyl, phenpropyl, t-butyl, i-propyl, i-butyl, cyclopropyl, cyclohexyl, cyclopropylmethyl, cyclohexylmethyl, phenyl, benzyl, 2-methoxybenzyl, 3-methoxybenzyl, 4-methoxybenzyl 4-fluorobenzyl, 3,5-difiuorobenzyl, 4- trifluoromethylbenzyl, naphthylmethyl, pyridinylmethyl, indolylmethyl, thienylmethyl, acetyl, benzoyl, ethoxycarbonyl, benzyloxycarbonyl, t-butoxycarbonyl, phenylcarbamoyl, phenylsulfonylamino or fluoro. 35. The compound as claimed in claim 34 wherein: Het is pyrrolidinyl, piperidinyl or tetrahydropyranyl; Ri is benzyloxy, phenoxy, naphthyloxy, phenyl, naphthyl, pyrrolidinyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyridinyl, indolyl, quinolinyl, benzofuranyl, benzthienyl, benzimidazolyl, benzthiazolyl, benzoxazolyl or phenylamino; R3 is n-propyl, i-butyl, propenyl, i-butenyl or 2,2-dimethylpropyl; R2 and R3 together with the carbon they are attached optionally form a ring selected from cyclopentyl, cyclohexyl, or cycloheptyl; R5 is methyl, ethyl, n-propyl, phenethyl, t-butyl, i-propyl, i-butyl, cyclohexyl, cyclohexylmethyl, benzyl, 4-fluorobenzyl, naphthylmethyl, acetyl, benzoyl or benzyloxycarbonyl. 36. A compound as claimed in claim 20 selected from: {[l-(4-Cyano-1 -propyl-piperidin-4-ylcarbamoyl)-3,3-dimethyl-butylimino]-morpholin-4-yl-methyl}-carbamic acid ethyl ester; N-(4-Cyano-methyl-piperidin-4-yl)-3-cyclohexyl-2-(3-oxo-3H-isoindol-1 -ylamino) -propionamide; 4,4-Dimethyl-2-(3-oxo-3H-isoindol-l-ylamino)-pentanoicacid-(4-cyano-1 -propyl-piperidin-4-yl)-amide; N-(4-cyano-l-methyl-piperidin-4-yl)-3-cyclohexyl-2-(2-oxo-2H-benzo[e][l,3] oxazin-4- ylamino)-propionamide; {[l-(4-cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]-piperidin-l-yl-methyl}-carbamic acid ethyl ester; '2-[(Acetylimino-phenyl-methyl)-amino]-N-(4-cyano-l-methyl-piperidin-4-yl)- 3-cyclohexyl-propionamide; {'[l-(4-Cyano-1 -methyl-piperidin-4-ylcarbamoyl)-2-cyclohexyl-ethylamino]- morpholin-4-yl-methylen}-carbamic acid ethyl ester; 42-[(Acerylimino-phenyl-methyl)-amino]-N-[3-cyano-1 -(1 -ethyl-propyl)-pyrrolidin-3-yl]-3-cyclohexyl-propionamide; '({1 -{3-Cyano-1 -(1 -ethyl-propyl)-pyrrolidin-3-ylcarbamoyl]-2-cyclohexyl-ethylamino}-morpholin-4-yl-methylene)-carbamic acid ethyl ester; -(1, 1-dioxo- lH-A6-benzo[d]isothiazol-3-ylamino)-propionamide; TM-[3-Cyano- 1 -(1 -ethyl- propyl)-pyrrolidin-3-yl]-3-cyclohexyl-2 -(1,1 -dioxo-1 H-A6-benzo[d]isothiazol-3-ylamino)-propionamide; N-(3-cyano-1 -cyclohexyl-pyrrolidin-3-yl)-3-cyclohexyl-2-( 1,1 -dioxo-1H-X6-benzo[d]isothiazol-3-ylamino)-propionamide; N-(3-Cyano-1 -cyclohexyl-pyrrolidin-3-yl)-3-cyclohexyl-2-( 1,1 -dioxo-1 H-A6-benzo[d]isothiazol-3-ylamino)-propionamide; N-(4-Cyano-1 -propyl-piperidin-4-yl)-3-cyclohexyl-2-( 1,1 -dioxo-1H-A6-benzo[d]isothiazol-3-ylamino)-propionamide; '2-(l,l-Dioxo-lH-A6-benzo[d]isothiazol-3-ylamino)4,4-dimethyl-pentanoic acid (4- cyano-l-propyl-piperidin-4-yl)-amide and the pharmaceutically acceptable derivatives of the kind such as herein described. 37. A method of making a compound of formula (I) R wherein Y, X, Ri, R2, R3, R4, Het and R5 are as claimed in claim 1; said method comprising: a) reacting an amino acid ester (IV), wherein R' is a protecting group, under suitable reaction condititions with a RiC(0)L wherein L is a leaving group selected from CI and OH: b) removing the protecting group R' from the compound produced in step a) to produce the corresponding carboxylic acid; c) reacting the product of step b) under coupling conditions consisting of EDC and HOBT in a solvent selected from DMF and methylene chloride, with an amino nitrile bearing "Het-R5" shown below to produce a compound of the formula (I): Dated this 18th day of February, 2002. [RANJNA MEHTA-DUTT] OF REMFRY & SAGAR ATTORNEY FOR THE APPLICANT |
|---|
in-pct-2002-00205-mum-abstract(06-06-2007).doc
in-pct-2002-00205-mum-abstract(06-06-2007).pdf
in-pct-2002-00205-mum-cancelled pages(06-06-2007).pdf
in-pct-2002-00205-mum-claims(granted)-(06-06-2007).doc
in-pct-2002-00205-mum-claims(granted)-(06-06-2007).pdf
in-pct-2002-00205-mum-correspondence(18-06-2007).pdf
in-pct-2002-00205-mum-correspondence(ipo)-(14-06-2007).pdf
in-pct-2002-00205-mum-form 1(06-06-2007).pdf
in-pct-2002-00205-mum-form 1(18-02-2002).pdf
in-pct-2002-00205-mum-form 13(06-06-2007).pdf
in-pct-2002-00205-mum-form 13(18-06-2007).pdf
in-pct-2002-00205-mum-form 19(22-08-2003).pdf
in-pct-2002-00205-mum-form 2(granted)-(06-06-2007).doc
in-pct-2002-00205-mum-form 2(granted)-(06-06-2007).pdf
in-pct-2002-00205-mum-form 3(06-06-2007).pdf
in-pct-2002-00205-mum-form 5(06-06-2007).pdf
in-pct-2002-00205-mum-petition under rule 137(06-06-2007).pdf
in-pct-2002-00205-mum-power of authority(06-06-2007).pdf
in-pct-2002-00205-mum-power of authority(18-02-2002).pdf
| Patent Number | 208841 | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Indian Patent Application Number | IN/PCT/2002/00205/MUM | |||||||||||||||||||||||||||||||||
| PG Journal Number | 35/2007 | |||||||||||||||||||||||||||||||||
| Publication Date | 31-Aug-2007 | |||||||||||||||||||||||||||||||||
| Grant Date | 13-Aug-2007 | |||||||||||||||||||||||||||||||||
| Date of Filing | 18-Feb-2002 | |||||||||||||||||||||||||||||||||
| Name of Patentee | BOEHRINGER INGELHEIM PHARMACEUTICALS, INC. | |||||||||||||||||||||||||||||||||
| Applicant Address | 900 RIDGEBURY ROAD, RIDGEFIELD, CONNECTICUT 06877, U.S.A. | |||||||||||||||||||||||||||||||||
Inventors:
|
||||||||||||||||||||||||||||||||||
| PCT International Classification Number | N/A | |||||||||||||||||||||||||||||||||
| PCT International Application Number | PCT/US00/23584 | |||||||||||||||||||||||||||||||||
| PCT International Filing date | 2000-08-28 | |||||||||||||||||||||||||||||||||
PCT Conventions:
|
||||||||||||||||||||||||||||||||||