Title of Invention

A MARKER DNA FRAGMENT CAPABLE OF ENHANCING STORABILITY OF SEEDS AND A PROCESS THEREFOR.

Abstract

This invention relates to a marker gene capable of enhancing storability of seeds having the undernoted DNA sequence-- CGGGCCGCGA ATTCGCCCTT AGTCCGCCTG TAACTGTAAA TTCTTCAGTT GGATGGAAAC AGTCATGTAA TTTATGCGGA GACAGAAGCT GCTGGTACAC GCCTTCTCAT CAATGGGAGA ACATGCTTAT TACAGGTGAA TATAGCTATG TTCATATTCT TTTCTGTTGC TATCAAACTA TAAAACTTAT CTTTGTTTTT CCCCTTAAGG GATGTGCAAA ATTTATACTA CAGTATCTTA AAAAATATGT TACCGTAAGA TCTTGTAGAG GCCATAAAAA AAGGGTAATG CCTGATTGAG TCTATCCTTA TATTATTTAT ATGAAGCTTG GATCTGATTA ATTTCTTCGG AATTTGGAAA ATATGATGCA ACAAGGTTTT TTCTTTGATT GGAAGTACAC TGCTTGGCAT CTTCAATCAC TCCTTATCTT TAAAAGATAA AAGAGATCCA TTATCACTAT GGAAACTTCC AATGGAAGGA TTAATGTGTG GGGATTATTT CAGCTCTGAT TTGATTGCAC GGTCCTAAAA AAAAATACCT GAACTTCCAA TTTATTTCTC TTAATGGTAC TTTACAGAAA GAGCATGATC CTTCCAAATT GTTGGCTGAT ACACCTTGCA AACTTCTTCG GTTCTTGGTT GCGGATGGCT CTCATGTAGA TGCTGATAC CCATATGCTG AGGTTGAGGT CATGAAGATG TGTATGCCGC TGTTACTACC AGCTTCTGGT GTTATTCATT TTGTCATGCC TGAGGGTCAA GCCATGCAGG TTCTATACCT CTATTTCACC CTGTTATTAT TTGTATGCAT CTTATTTGCA TACATCTTTT ACAAGGTAAC TAAAATGTCT ATTCTTTTGC AGGCGGACTA AGGGCGAATT CGTGTCGCNN The subject invention also pertains to a process for effecting enhancement in storability of seeds.

Full Text

The present invention relates to a process for enhancing storability of seeds and marker gene therefor. More particularly this invention relates to a technique for enhancing storability of seeds under varying climatic conditions, specifically in tropical and sub-tropical conditions. That seed storability is a varietal or genetic character came to be known only from germination studies. Cell molecular events associated with deterioration of germination characteristics of seeds have so far been studied only in single varieties and no broad-based studies have yet been undertaken. From a scrutiny of recorded data and observations it has been found that cell deterioration is associated with cell molecular/enzymatic damages. Since enzymatic activity is precluded in stored seeds that generally exhibit around 10-12% moisture content (m.c), which is normally accepted as non-congenial for enzymatic changes, cell damage/deterioration observed in enzymes would be the effect rather than the cause of seed deterioration. Under such circumstance, it would be logical to explore possibilities of non-enzymatic cell damage towards understanding the mechanism of cell damage and protection from spontaneous UV radiation that affect seed during post harvest storage. As mentioned earlier, seed storability is a generic trait. After fresh harvest, a seed is at its maximum vigour in relation to its germination potential. From that time onwards cells of the embryonic axis undergo gradual cell molecular deterioration until the seed is rendered non-viable, i.e. the seed fails to germinate. The rate at which loss of germination potential takes place, mainly due to cellular senescence, varies rather widely in different varieties. However, studies undertaken till date do not provide an understanding of genetic (varietal) control of storability trait of seeds. The principal object of the present invention is to provide a process for enhancing storability of seeds. A further object of this invention is to provide a process in which there is used a marker gene for achieving enhanced storage stability of seeds. A still further object of this invention is to identify DNA fragments incorporated in seeds resulting in vigour trait in seeds, e.g. in rice varieties. The foregoing objects are achieved by the present invention which provides a process for enhancing storage stability of seeds and marker gene therefor comprising in combination - (a) identifying DNA fragments by using RAPD technique for ascribing seeds with seed vigour trait, and (b) cloning and sequencing the DNA fragment which was found to match at around 94% similarity level with Acetyl Co A carboxylase in maize. The DNA fragment as aforesaid has been found to match at around >90% level in some other monocots and dicots. In the present invention cell molecular events associated with post harvest seed aging has been studied in a number of seed varieties. Studies involving cell molecular events associated with seed vigour have been used for regression analysis (ANOVA) test to identify the aforesaid DNA fragment. It is to be noted that reduction and eventual loss in germination potential on prolonged storage of seeds results in loss of large amounts of plant genetic resource in the form of planting materials. Solving the problem of seed storability and seedling vigour (manifested by early germination) is of major importance for developing sustainable agriculture. A process to enhance storage life of seeds would help to reduce large losses in seed material, particularly where cold and dry seed storage facility is lacking. Development of a DNA marker for enhancing storage - stability is likely to be treated as a major achievement in - (i) routine germplasm screening to select seed varieties with high storability, (ii) incorporating high storability trait into other elite seed varieties through, (a) breeding procedures associated with marker assisted selection, and (b) plant transformation protocols, also using marker-assisted selection of parent and progeny, as and when necessary. Studies on the mechanism by which Acetyl Co A carboxylase present in high copy number in some varieties has yielded extremely encouraging results by conferring higher storage stability in various seed varieties. While the invention has been described in detail and with reference to the specific embodiments thereof, it will be apparent to one skilled in the .art that various changes and modifications can be made without deviating or departing from the spirit and scope of the invention. Thus the disclosure contained herein includes within its ambit the obvious equivalents and substitutes as well. The present invention relates to a marker DNA fragment capable of enhancing storability of seeds and process therefore. More particularly this invention relates to the identification of a gene responsible for determining seed storability in orthodox seeds during post harvest storage specifically in tropical and sub-tropical condition, i.e. a DNA marker gene capable of being used for selection of varieties with high seed vigour storabiliti trait. That seed storability is a varietal or genetic character came to be known only from germination studies. Cell molecular events associated with deterioration of germination characteristic of seeds have so far been studied only in a single variety at a time and no broad-based study has yet been reported. From a scrutiny of recorded data and observation it has been found that seeds deterioration is associated with cell molecular/ enzymatic damages. Since enzymatic activity is precluded in stored seeds that generally exhibit around 10-12% moisture content (m. c), which is normally accepted as non-congenial for enzymatic changes, cell damage/ deterioration observed in aged seeds would not be due to degradative enzymes; such damages would be the effect of storage environment, viz. UV radiation rather than the cause of seed aging. Under such circumstance, it would be logical to explore possibilities of non-enzymatic cell damage with an aim to understand the mechanism of cell damage and protection from spontaneous UV radiation that affect seed during post tharvest storage. . As mentioned earlier, seed storability is a genetic trait. After fresh harvest, a seed is at its maximum vigour in relation to its germination potential. From that time onwards cell of the embryonic axis undergo gradual cell molecular deterioration until the seed is rendered non-viable, i.e. the seed fails to germinate. Varieties that produce seeds of low vigour are the ones with low seed storability trait. The rate at which loss of germination potential takes place, mainly due to cellular senescence, varies rather widely in different varieties. However, studies undertaken till date do not provide an understanding of genetic (varietal) control of storability trait of seeds. The primary aim of the present invention is to provide a DNA marker that may be used as a probe for selecting varieties possessing high Seed storability trait The nucleotide/ DNA sequence of the marker DNA fragment is given below: CGGGCGCGA ATTCGCCCTT AGTCCGCCTG TAACTGTAAA TTCTTCAGTT GGATGGAAAC AGTCATGTAA TTTATGCGG GACAGAAGCT GCTGGTACAC GCCTTCTCAT CAATGGGAGA ACATGCTTAT TACAGGTGAA TATAGCTATG TTCATATTCT TTTCTGTTGC TATCAAACTA TAAAACTTAT CTTTGTTTTT CCCCTTAAGG GATGTGCAAA ATTTATACTA CAGTATCTTA AAAAATATGT TACCGTAAGATCTTGTAGAG GCCATAAAAA AAGGGTAATG CCTGATTGAG TCTATCCTTA TATTATTTAT ATGAAGCTTG GATCTGATTA ATTCTTCGG AATTTGGAAA ATATGATGCA ACAAGGTTTT TTCTTTGATT GGAAGTACAC TGCTTGGCAT CTTCAATCAC TCCTTATCTT TAAAAGATAA AAGAGATCCA TTATCACTAT GGAAACTTCC AATGGAAGGA TTAATGTGTG GGGATTATTT CAGCTCTGAT TTGATTGCAC GGTCCTAAAA AAAAATACCT GAACTTCCAA TTTATTTCTC TTAATGGTAC TTTACAGAAA GAGCATGATC CTTCCAAATT GTTGGCTGAT ACACCTTGCA AACTTCTTCG GTTCTTGGTT GCGGATGGCT CTCATGTAGA TGCTGATAC CCATATGCTG AGGTTGAGGT CATGAAGATG TGTATGCCGC TGTTACTACC AGCTTCTGGT GTTATTCATT TTGTCATGCC TGAGGGTCAA GCCATGCAGG TTCTATACCT CTATTTCACC CTGTTATTAT TTGTATGCAT CTTATTTGCA TACATCTTTT ACAAGGTAAC TAAAATGTCT ATTCTTTTGC AGGCGGACTA AGGGCGAATT CGTGTCGCNN A further object of this invention is to provide a process in which there is used a marker gene for achieving enhanced storage stability of seeds. A still further object of this invention is to identify DNA fragments incorporated in seeds resulting in high storability trait in seed, e.g. in rice varieties. The present invention also relates to a process for enhancing storability of seeds and relevant gene therefor, having a partial sequence of DNA fragment of the said gene as given above, which comprises- (a) identifying DNA fragments by using RAPD technique for ascribing seeds with high seed stability trait, and (b) cloning and sequencing the DNA fragments which was found to match at around 96%-94% similarity level with Acetyl CoA Carboxylase in wheat. The foregoing process leads to development of enhanced stability of orthodox (rice) seeds by making use of the marker DNA fragment to select appropriate germplasm for use as donor in plant transgenic/plant breeding programmes. The DNA fragment as aforesaid has been found to match at around >90% level in some other monocots and dicots, e.g. rice, wheat, maize, jowar, bajra, gram, etc. The DNA sequence compared to available gene sequences in the literature on the basis of distribution of BLAST hits on query sequence has been shown in Fig. 1 of the accompanying drawings. In the present invention cell molecular events associated with post harvest seed aging has been studied in a number of varieties. Studies involving cell molecular events associated with seed storability have been used for regression analysis (ANOVA) test to identify the aforementioned DNA fragment associated with varieties exhibiting high vigour trait. In this context it may be mentioned that Acetyl Co A Carboxylase is a housekeeping enzyme generally participating in the lipid biosynthesis, e.g. Acetyl CoA -»Malonyl CoA, which is essential for cell membrane turnover/biosynthesis. During maturation associated programmed dehydration of cells, the main said enzyme gets diverted to the secondary metabolic pathway whereby they produce flavonoids in plants. Even though these are generally coloured compounds, colourless flavonoids are known to exist in plants, viz. in seeds, showing an absorption maxima (Amax) between ~280nm and 320nm, i.e. in the UV wavelength region. These compounds thus effectively serve as UV screens, practically debarring entry of UV radiation into seeds. This is particularly realized in dry stored seeds since at the moisture content level of around 8-10% by wt. prevailing in seeds, enzymatic repair is precluded; this leads to accumulation of UV induced cell damage that causes the damaging effect of UV to be exaggerated. Flavonoids also serve as non-enzymatic anti- oxidants for scavenging Reactive Oxygen Species (ROS), which are capable of functioning in dry, mature seeds. It has been possible to establish through assay of gene-product that presence of high copy no. of the aforesaid gene in seed of some varieties of rice (orthodox seed) enhances seed storage ability. Presence of band at ~902bp in RAPD analysis using OP- AC 19 primer representing a DNA segment of Acetyl CoA Carboxylase gene, as revealed by BLAST analysis shows around 94% similarity with cytosolic Acetyl CoA Carboxylase and 96% similarity with plastid Acetyl CoA Carboxylase in Triticum aestivum. Adequate support is rendered to the above proposition by the data from the curves shown in Fig.2 of the drawings, wherefirom it may be established the activity of Acetyl CoA Carboxylase enzymes (i.e. product of Acetyl CoA Carboxylase gene) is more efficient in binding to/ reacting with substrate Acetyl CoA in varieties that exhibit the aforementioned ~902bp fragment in RAPD analysis. Incidentally these are the varieties exhibiting higher storage ability of seeds. Thus, an overexpression of Acetyl CoA Carboxylase due to high copy number is responsible for high seed storability in orthodox seeds like rice-this is confirmed by the foregoing studies. Varieties that exhibit this band are also found to exhibit high vigour at the germination stage, lending credence to the age-old observation that storability is a function of high vigour status in seeds. In other words, varieties mat exhibit high vigour of seeds are the ones that show high storability under natural aging. Low vigour varieties exhibit appreciably low germination percentage after 1-2 years of natural aging. Some low vigour varieties have even been found to show no germination at all in the course of such aging, i.e. after 1-2 years, where as high vigour varieties retain >50% germination even after 2 years of aging. The aforesaid gene may be accessed or selected from a genomic library or depository NCIB under Accession No. AJ 549091 by use of the marker DNA fragment identified above. This followed by incorporation of Acetyl CoA Carboxylase gene onto the genome of low-vigour varieties for enhancing gene copy number in those low storable varieties with the object of increasing the seed storability status in these varieties by transgenic means. Turning to the drawings accompanying this specification, Fig. 1 illustrates the DNA sequence of the ~902bp fragment. Fig. 2 shows Vo-vs-[S] curves, where Vo is reduction of absorbance at 340nm and [S] is varying substrate Acetyl CoA Carboxylase concentration. Fig. 3 depicts by means of histogram germination potential of seeds of varying ages. In Fig. 2, the reduction of absorbance is akin to more production of the product NAD* at initial time, i.e. at initial 1 minute change. High vigour varieties A, B and C have low Km [Michalis-Menton constant], and also higher affinity with substrate Acetyl CoA in comparison to low vigour varieties D, E and F having higher Km values. The data showing the higher efficiency of Acetyl CoA Carboxylase gene product, i.e. Acetyl CoA Carboxylase enzyme lends support to the proposition that varieties A, B and C (which show high storage capacity) possess higher copy number of this gene compared to varieties D, E and F that are poor seed stores. In these graphs, 0-subscript bis been used for unaged rice seeds. In Fig. 3 there is shown germination ability of seeds, on the basis of percentage of seeds germinated after 120 hours following one and two years of aging under natural (ambient) conditions resulting in natural aging and consequent reduction in germination capability. The subject study has taken into account the germination of seeds of different varieties and in the histogram "O"-subscript has been used for unaged seeds, 1 for one- year aged seeds and 2 for two-year aged seeds. It is to be noted that reduction and eventual loss in germination potential on prolonged storage of seeds result in loss of large amounts of plant genetic resource. Solving the problem of seeds storability and seedling vigour (manifested by early germination) is of major importance for developing sustainable agriculture. A process to enhance storage life and germination potential of seeds would help to reduce large losses in seed material, particularly where cold and dry seed storage facility is lacking. Plant breeding/ plant transformation protocols that could introduce more copy numbers of this gene into low storers, i.e. seeds of low storage capability, would thus be able to enhance seeds(storability)even in such low storers. Development of a DNA marker for enhancing storability of germination potential of seeds is likely to be looked upon as a major achievement in- 1. routine germplasm screening to select seed varieties with high storability with an aim to (a) saving cost of seed purchase every year and (b) perpetuating elite varieties even if sowing is not possible for regeneration in some years; 2. incorporating high storability trait into other elite seed varieties by means of (a) breeding procedures connected with marker associated selection and (b) plant transformation protocols, also using marker associated selection of parent and progeny, as and when necessary. Further more, it has been rendered possible to use the presence of this fragment (namely, Acetyl CoA Carboxylase) as a means of screening rice germplasm available in the wild or from breeding progenies to select appropriate variety as in Marker Associated Selection (MAS) for cultivation or for breeding purpose as in marker-assisted breeding. This will also render it possible to develop a simple diagnostic kit for germplasm screening purpose. While the invention has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without deviating or departing from the spirit and scope of the invention. Thus the disclosure contained herein includes within its ambit the obvious equivalents and substitutes as well. Having described the invention in detail with particular reference to the accompanying drawings, it will now be more specifically defined by means of claims appended hereafter. We claim: - 1. A marker DNA fragment of a gene bearing dose similarity with Acetyl CoA Carboxylase capable of enhancing storability of seeds, such as wheat, maize, etc. having a partial sequence of DNA fragment of the said gene as claimed in Claim 1, having the following DNA sequence- CGGGCGCGA ATTCGCCCTT AGTCCGCCTG TAACTGTAAA TTCTTCAGTT GGATGGAAAC AGTCATGTAA TTTATGCGG GACAGAAGCT GCTGGTACAC GCCTTCTCAT CAATGGGAGA ACATGCTTAT TACAGGTGAA TATAGCTATG TTCATATTCT TTTCTGTTGC TATCAAACTA TAAAACTTAT CTTTGTTTTT CCCCTTAAGG GATGTGCAAA ATTTATACTA CAGTATCTTA AAAAATATGT TACCGTAAGA TCTTGTAGAG GCCATAAAAA AAGGGTAATG CCTGATTGAG TCTATCCTTA TATTATTTAT ATGAAGCTTG GATCTGATTA ATTCTTCGG AATTTGGAAA ATATGATGCA ACAAGGTTTT TTCTTTGATT GGAAGTACAC TGCTTGGCAT CTTCAATCAC TCCTTATCTT TAAAAGATAA AAGAGATCCA TTATCACTAT GGAAACTTCC AATGGAAGGA TTAATGTGTG GGGATTATTT CAGCTCTGAT TTGATTGCAC GGTCCTAAAA AAAAATACCT GAACTTCCAA TTTATTTCTC TTAATGGTAC TTTACAGAAA GAGCATGATC CTTCCAAATT GTTGGCTGAT ACACCTTGCA AACTTCTTCG GTTCTTGGTT GCGGATGGCT CTCATGTAGA TGCTGATAC CCATATGCTG AGGTTGAGGT CATGAAGATG TGTATGCCGC TGTTACTACC AGCTTCTGGT GTTATTCATT TTGTCATGCC TGAGGGTCAA GCCATGCAGG TTCTATACCT CTATTTCACC CTGTTATTAT TTGTATGCAT CTTATTTGCA TACATCTTTT ACAAGGTAAC TAAAATGTCT ATTCTTTTGC AGGCGGACTA AGGGCGAATT CGTGTCGCNN 2. A marker DNA fragment as claimed in Claim 1, which matches at around 96%- 94% similarity level with Acetyl CoA Carboxylase. 3. A process for enhancing storability of seeds and relevant gene therefor which comprises- (a) identifying DNA fragments using RAPD technique for ascribing seeds with high seed stability trait, and (b) cloning and sequencing the DNA fragment which was found to match at around 96%-94% similarity with Acetyl CoA Carboxylase in wheat. 4. A process as claimed in Claim 3, which comprises enhancing storability of orthodox (rice) seeds by making use of the DNA fragment to select appropriate germplasm for use as donor in plant transgenic/plant breeding programmes. 5. A process for enhancing storability of seeds, substantially as hereinbefore described and illustrated in the accompanying drawings. This invention relates to a marker gene capable of enhancing storability of seeds having the undernoted DNA sequence- CGGGCCGCGA ATTCGCCCTT AGTCCGCCTG TAACTGTAAA TTCTTCAGTT GGATGGAAAC AGTCATGTAA TTTATGCGGA GACAGAAGCT GCTGGTACAC GCCTTCTCAT CAATGGGAGA ACATGCTTAT TACAGGTGAA TATAGCTATG TTCATATTCT TTTCTGTTGC TATCAAACTA TAAAACTTAT CTTTGTTTTT CCCCTTAAGG GATGTGCAAA ATTTATACTA CAGTATCTTA AAAAATATGT TACCGTAAGA TCTTGTAGAG GCCATAAAAA AAGGGTAATG CCTGATTGAG TCTATCCTTA TATTATTTAT ATGAAGCTTG GATCTGATTA ATTTCTTCGG AATTTGGAAA ATATGATGCA ACAAGGTTTT TTCTTTGATT GGAAGTACAC TGCTTGGCAT CTTCAATCAC TCCTTATCTT TAAAAGATAA AAGAGATCCA TTATCACTAT GGAAACTTCC AATGGAAGGA TTAATGTGTG GGGATTATTT CAGCTCTGAT TTGATTGCAC GGTCCTAAAA AAAAATACCT GAACTTCCAA TTTATTTCTC TTAATGGTAC TTTACAGAAA GAGCATGATC CTTCCAAATT GTTGGCTGAT ACACCTTGCA AACTTCTTCG GTTCTTGGTT GCGGATGGCT CTCATGTAGA TGCTGATAC CCATATGCTG AGGTTGAGGT CATGAAGATG TGTATGCCGC TGTTACTACC AGCTTCTGGT GTTATTCATT TTGTCATGCC TGAGGGTCAA GCCATGCAGG TTCTATACCT CTATTTCACC CTGTTATTAT TTGTATGCAT CTTATTTGCA TACATCTTTT ACAAGGTAAC TAAAATGTCT ATTCTTTTGC AGGCGGACTA AGGGCGAATT CGTGTCGCNN The subject invention also pertains to a process for effecting enhancement in storability of seeds.

Documents:

00253-kol-2004-abstract.pdf

00253-kol-2004-claims.pdf

00253-kol-2004-correspondence.pdf

00253-kol-2004-description (complete).pdf

00253-kol-2004-description (provisional).pdf

00253-kol-2004-drawings.pdf

00253-kol-2004-form 1.pdf

00253-kol-2004-form 13.pdf

00253-kol-2004-form 18.pdf

00253-kol-2004-form 2 (provisional).pdf

00253-kol-2004-form 2.pdf

00253-kol-2004-form 3.pdf

00253-kol-2004-form 5.pdf

00253-kol-2004-letter patent.pdf

00253-kol-2004-pa.pdf

00253-kol-2004-reply f.e.r.pdf

253-KOL-2004-CORRESPONDENCE.pdf

253-KOL-2004-FORM 27-1.1.pdf

253-KOL-2004-FORM 27.pdf