Title of Invention | SINGLE CHAIN ANTIGEN-BINDING POLYPEPTIDES FOR POLYMER CONJUGATION |
---|---|
Abstract | The present invention relates to monovalent and multivalent single- chain antigen-binding polypeptides with site-specific modifications. The provided polypeptides are capable of being covalently linked or conjugated to polyalkylene oxides at the modified sites. The resulting conjugates retain antigen binding properties and exhibit prolonged circulating time and reduced antigenicity relative to unconjugated single chain antigen binding polypeptides. Methods and compositions for making and using the single chain antigen-binding polypeptides with site-specific modifications are also provided. |
Full Text | FORM-2 THE PATENTS ACT, 1970 (39 of 1970) & THE PATENTS RULES, 2003 COMPLETE Specification (See section 10 and rule 13) SINGLE CHAIN ANTIGEN-BINDING POLYPEPTIDES FOR POLYMER CONJUGATION ENZON PHARMACEUTICALS, INC., U. S. Company of 685 Route 202/206, Bridgewater, New Jersey 08807, U.S.A. THE FOLLOWING SPECIFICATION PARTICULARLY DESCRIBES THE INVENTION AND THE MANNER IN WHICH IT IS TO BE PERFORMED. SINGLE CHAIN ANTIGEN-BINDING POLYPEPTIDES FOR POLYMER CONJUGATION Field of The Invention The present invention relates to monovalent and multivalent single-chain antigen-binding polypeptides with site-specific modifications facilitating site-specific covalent linkage of polymers to die inventive polypeptides. The invention provides such modified single-chain antigen-binding polypeptides, vectors and host cells encoding the same, as well as methods of making and using the polypeptides. The invention also provide for conjugates of the modified single-chain antigen-binding polypeptides with polymers, such as polyalkylene oxide ("PAO") to provide new and improved prodrugs, and methods of making and using these conjugates. Description of the Related Art Naturally occurring antibodies are immunoglobulins produced by the immune system of vertebrates, including mammals, in response to the presence of one or more specific substances, i.e., antigens, when these are recognized as foreign by the immune cells of the animal. In humans, there are five classes of antibodies which have the ability to selectively recognize and preferentially bind to specific antigens. Each antibody class has the same basic structure or multiples of that structure. The basic unit consists of two identical polypeptides called heavy or H chains (molecular weight in IgG approximately 50,000 Daltons each) and two identical polypeptides called light or L chains (molecular weight approximately 25,000 Daltons each). Each of the five antibody classes has a similar set of light chains and a distinct set of heavy chains. A light chain is composed of one variable and one constant domain, while a heavy chain is composed of one variable and three or more constant domains. The variable domains determine the specificity of the immunoglobulin, the constant regions have other functions. Broadly, pairs of suitable light and heavy polypeptide chains are associated in natural antibodies, and in other types of antibodies, to form antigen binding 2 sites. Each individual light and heavy chain folds into regions of approximately 110 amino acids, assuming a conserved three-dimensional conformation. The light chain comprises one variable region (VL) and one constant region (CL), while the heavy chain comprises one variable region (VH) and three constant regions (CH1 , CH2 and CH3)- Pairs of regions associate to form discrete structures. In particular, the light and heavy chain variable regions associate to form an "Fv" area which contains the antigen-binding site. The constant regions are not necessary for antigen binding and in some cases can be separated from the antibody molecule by proteolysis, yielding biologically active (i.e., binding) variable regions composed of half of a light chain and one quarter of a heavy chain. Further, all antibodies of a certain class and their Fab fragments (i.e., fragments composed of VL,CL, VH, and CH1) whose structures have been determined by x-ray crystallography show similar variable region structures despite large differences in the sequence of hypervariable segments even when from different animal species. The immunoglobulin variable region seems to be tolerant towards mutations in the antigen-binding loops. Therefore, other than in the hypervariable regions, most of the so-called "variable" regions of antibodies, which are defined by both heavy and light chains, are, in fact, quite constant in thier three dimensional arrangement. See for example, Huber, R„ Science 233:702-703 (1986), incorporated by reference herein. Natural antibodies are typically heterogeneous, binding to many different epitopes, or pails of a foreign antigen. In contrast, monoclonal antibodies ("MAbs") are antibodies that are homogenous in thier binding affinity. MAbs have been shown to be useful both as diagnostic and therapeutic agents. MAbs are produced routinely by established procedures, e.g., from hybridomas generated by fusion of mouse lymphoid cells with an appropriate mouse myeloma cell line, as well as by more advanced recombinant techniques. Even smaller antibody-like proteins or polypeptides are formed of antigen binding sites with minimal additional structure. These are art-known as single-chain antigen-binding proteins or polypeptides ("SCAs") or single-chain variable fragments of antibodies ("sFv"). These may incorporate a linker polypeptide to 3 bridge individual variable regions, VL and VH, into a single polypeptide chain. A description of the theory and production of single-chain antigen-binding proteins is found in Ladner et al, U.S. Pat. Nos. 4,946,778, 5,260,203, 5,455,030 and 5,518,889, and in Huston et al, U.S. Pat. No. 5,091,513 ("biosynthetic antibody binding sites" (BABS)), which disclosures are all incorporated herein by reference. The single-chain antigen-binding proteins produced under the process recited in the above patents have binding specificity and affinity substantially similar to that of the corresponding Fab fragment. Broadly, pairs of suitable light and heavy chains can be associated to form antigen binding sites. Each individual light and heavy chain folds into regions of approximately 110 amino acids, assuming a conserved three-dimensional conformation. The light chain comprises one variable region (VL) and one constant region (CL), while the heavy chain comprises one variable region (VH) and three constant regions (CH1, CH2 and CH3)- Pairs of regions associate to form discrete structures. In particular, the light and heavy chain variable regions associate to form an "Fv" area which contains the antigen-binding site. The constant regions are not necessary for antigen binding and in some cases can be separated from the antibody molecule by proteolysis, yielding biologically active (i.e., binding) variable regions composed of half of a light chain and one quarter of a heavy chain. Further, x-ray crystallography has confirmed that all antibodies of a particular class, and their Fab fragments (i.e., fragments composed of VL, CL, VH, and CH1) show similar variable region structure, but large differences in the sequences of their respective hypervariable segments. This is also observed in comparisons of antibodies derived from different respective animal species. The immunoglobulin variable region seems to be tolerant of mutations in the antigen-binding loops. Therefore, other than in the hypervariable regions, most of the so-called "variable" regions of antibodies, which are defined by both heavy and light chains, are, in fact, quite constant in their three dimensional arrangement. See for example, Huber, &, Science 233.:702-703 (1986), incorporated by reference 4 herein. The in vivo properties of SCA polypeptides are different from those of MAbs and larger, more conventional antibody fragments. Their small size allows SCAs to be cleared more rapidly from tire blood, and to penetrate more rapidly into tissues (Milenic, D. E. etal. Cancer Research 51:6363-6371(1991): Colcher et al, J. Natl. Cancer Inst. 82:1191 (1990); Yokota et al, Cancer Research 52:3402 (1992)). In addition, SCA polypeptides are not retained in tissues such as the liver and kidneys due to the absence of a constant region normally present in antibody molecules. Thus, SCA polypeptides have applications in cancer diagnosis and therapy, where rapid tissue penetration and clearance are advantageous. Synthetic antigen binding proteins are also described by Huston et al. in U.S. Pat. No. 5,091,513, incorporated by reference herein. The described proteins are characterized by one or more sequences of amino acids constituting a region that behaves as a biosynthetic antibody binding site (BABS). The sites comprise (1) noncovalently associated or disulfide bonded synthetic VH and VL regions, (2) VH—VL or VL-VH single chains wherein the VH and VL are attached to a polypeptide linker, or (3) individual VH or VL domains. The binding domains comprises complementarity determining regions (CDRs) linked to framework regions (FRs), which may be derived from separate immunoglobulins. It should be noted that the Huston et al proteins include one characterized by having an initial heavy chain, i.e., the VH - peptide linker - VL domain. Multivalent antigen-binding proteins are known. As described herein, a multivalent antigen-binding protein includes two or more single-chain protein molecules. These can be associated or linked by covalent or noncovalent bonding. Enhanced antigen binding activity, di- and multi-specific binding, and other novel uses of multivalent antigen-binding proteins have been demonstrated. See, e.g., Whitlow, M., et al, Protein Engng. 7:1017-1026 (1994); Hoogenboom, H. R., Nature Biotech. 15:125-126(1997); and WO 93/11161, and co-owned U.S. Patent Nos. 5,869,620, 6,025,165, 6,027,725, 6,103,889, 6,121,424 and 6,515,110, all incorporated by reference herein. Although peptides, such as the single-chain polypeptides described above, 5 and fusion proteins thereof, have not been associated with significant antigenicity in mammals, it has been desirable to prolong the circulating life and even further reduce the possibility of an antigenic response. One way to enhance the circulating life and reduce the antigenicity of proteins and polypeptides has been to conjugate them to polymers, such as polyalkylene oxides. However, the relatively small size of the polypeptides and their delicate structure/activity relationship, have made polyethylene glycol modification difficult and unpredictable. To effect covalent attachment of polyalkylene oxides to a protein, the hydroxyl end groups of the polymer must first be converted into reactive functional groups. This process is frequently referred to as "activation" and the product is called "activated PEG" or activated polyalkylene oxide. For example, methoxy poly(ethylene glycol) (mPEG), capped on one end with a functional group, reactive towards amines on a protein molecule, is used in most cases. A number of activated polymers, such as succinimidyl succinate derivatives of PEG ("SS-PEG"), have been introduced (Abuchowski et al, Cancer Biochem. Biophys. 7:175-186 (1984)). SS-PEG reacts quickly with proteins (30 minutes) under mild conditions yielding active yet extensively modified conjugates. Zalipsky, in U.S. Pat. No.5,122,614, discloses polyethylene glycol)-N-succinimide carbonate and its preparation. This form of the polymer is said to react readily with the amino groups of proteins, as well as low molecular weight peptides and other materials that contain free amino groups. Other linkages between the amino groups of the protein, and the PEG are also art known such as urethane linkages (Veronese et al, Appl. Biochem. Biotechnol. 11:141-152 (1985)), carbamate linkages (Beauchamp etal, Analvt. Biochem. 131:25-33 (1983)), and others. However, despite these and other methods, it has often been found that the resulting conjugates lack sufficient retained activity. For example, Benhar et al (Bioconiugate Chem. 5:321-326 (1994)) observed that PEGylation of a recombinant single-chain immunotoxin resulted in the loss of specific target immunoreactivity of the immunotoxin. The loss of activity of the immunotoxin 6 was the result of PEG conjugation at two lysine residues within the antibody-combining region of the immunotoxin. To overcome this problem, Benhar et al. replaced these two lysine residues with arginine residues and were able to obtain an active immunotoxin that was 3-fold more resistant to inactivation by derivatization. Another suggestion for overcoming these problems discussed above is to use longer, higher molecular weight polymers. These materials, however, are difficult to prepare and expensive to use. Further, they provide little improvement over more readily available polymers. Another alternative suggested is to attach two strands of polymer via a triazine ring to amino groups of a protein. See, for example, Enzyme 26:49-53 (1981) and Proc. Soc. Exper. Biol. Med., 188:364-369 (19SS). However, triazine is a toxic substance that is difficult to reduce to acceptable levels after conjugation. An examination of the three-dimensional structure of an SCA protein reveals that the C-terminus and the linker region are farthest removed from the antigen-binding site and therefore might be sites for polymer conjugation wherein tire attached polymer does not sterically block or disrupt the conformation of the antigen-binding site or the surrounding Fv architecture (Wang M., et al, 1998 Protein Engng 11: 1277-1283) in the context of positioning sites for polymer linkage to inserted residues that are glycosylated, in vivo, during production of those proteins. Efforts to position amino acid residues within SCA structure for more effective polymer conjugation have been described by the following co-owned parents of the present patent application, all of which are incorporated by reference herein: U.S. Ser. Nos. 09/791,578 and 09/791,540 both filed on February 26, 2001, describing selectively positioned Cys and oligo Lys residues. Co-owned U.S. Ser. Nos. 09/956,087 and 09/956,086, both September 20, 2001 describe tandem and triplet ASN, and related sites in an SCA for selectively positioned glycosylation to which polymers are selectively conjugated. However, there remains a need in the art for further options and improvements in positional conjugation of polymers to SCA proteins, as well as further options and 7 improvements in conjugation chemistry, that allows for the binding activity and specificity of the polypeptide to be retained, along with all of die benefits of polymer conjugations. SUMMARY OF THE INVENTION In order to address these longstanding needs, the invention provides for a TNFa - binding, single-chain antigen-binding polypeptide ("SCA") capable of site-specific conjugation to a polyalkylene oxide polymer, that comprises, a first polypeptide comprising an antigen-binding portion of a variable region of an antibody heavy or light chain; a second polypeptide comprising an antigen-binding portion of a variable region of an antibody heavy or light chain; and a peptide linker linking the first and second polypeptides, wherein the single-chain antigen-binding polypeptide has at least one Cys residue which is capable of being conjugated to a polyalkylene oxide polymer, and has at least one antigen binding site. The Cys residue is preferably located at one or more of the following positions.: a C-terminus of the heavy chain or light chain variable region; an N-terminus of the heavy chain or light chain variable region; any amino acid position of the peptide linker; both the N-terminus and C-terminus; position 2 of the linker; position 5 of the linker; both position 2 of the linker and the C-terminus; and combinations thereof. Preferably, the TNFa-binding SCA selectively binds to TNFa. More preferred Cys positions include, e.g., position 2 of the linker, the C-terminus and combinations thereof. The C-terminus is preferably a naturally occurring C-terminus, but can also include any art known rnodifi3 5 cations thereof 8 The SCA of the invention is optionally formed of variable regions from light and/or heavy chains of an antibody of interest, e.g., preferably an anti-TNFa antibody. The invention also provides conjugates comprising the inventive single-chain antigen-binding polypeptides or proteins, wherein the conjugates include a substantially non-antigenic polymers, e.g., a polyalkylene oxide polymer. The polyalkylene oxide is preferably a polyethylene glycol or "PEG" polymer. The polyalkylene oxide is any suitable size range, but preferably ranges in size from about 5,000 to about 40,000 Daltons. Preferably the polyalkylene oxide polymer is covalently linked to the single-chain antigen-binding polypeptide at a Cys residue. Preferably, the polyalkylene oxide is linked to the single-chain antigen-binding polypeptide at a Cys residue via a linker, such as, for instance, a maleimide, vinylsulfone, thiol, orthopyridyl disulfide and/or a iodoactemide linker. The maleimide linker is most preferred. In the polymer-conjugated embodiments of the invention, the polyalkylene oxide is optionally conjugated to at least two single-chain antigen-binding polypeptides, wherein each single-chain antigen-binding polypeptide is the same, or different. Optionally, the conjugate, e.g. either the PAO or the SCA, or both, is further linked or conjugated to an additional functional moiety, e.g., a detectable label or tag. The invention also provides for polynucleotides encoding the single-chain antigen-binding polypeptides, replicable expression vectors comprising the polynucleotides, and suitable host cells for expressing the same. The inventive SCA proteins are produced by any suitable, art-known process or method, but are preferably produced, as exemplified herein, by culturing a host cell comprising an SCA encoding expression vector and collecting the single-chain antigen-binding polypeptide expressed by the host cell. The invention further provides for a protein comprising two or more single-chain antigen-binding polypeptides capable of site-specific conjugation as a 9 multivalent antigen-binding protein in the form of toners, trailers, tetramers, and the like. The inventive multivalent protein is prepared by art-known methods wherein each SCA is linked by covalent or noncovalent linkers, e.g., peptide linkers, disulfide linkers, and the like. In an alternative option, the protein is assembled with noncovalent linkers by reducing and refolding the constituent SCA polypeptides. In the later option, it is particularly preferred that the peptide linker of the constituent single-chain antigen-binding proteins or polypeptides range in size from 2 to 18 residues. The invention further provides for a multivalent protein, having the particular Cys residues in one or more of the constituent SCA polypeptides, that is encoded as a single, multivalent protein. A polynucleotide encoding such a single chain multivalent protein is also contemplated as part of the present invention. Methods for using die inventive SCAs and polymer conjugates are also provided. Simply by way of example, one such method includes the steps of: contacting a sample suspected of containing TNFa with a reagent comprising a single-chain antigen-binding polypeptide or a multivalent protein according to the invention, and detecting whether the single-chain antigen-binding polypeptide or multivalent protein according to the invention has bound to the TNFa. Advantageously, the polypeptide or multivalent protein according to the invention is conjugated to a polyalkylene oxide polymer. For all of the above methods, the conjugate, either the SCA or die polymer, is optionally anchored to a solid substrate. Also provided are methods of treating or diagnosing a disease or disorder in a mammal, e.g., a human, comprising administering an effective amount of the TNFa - binding single-chain antigen-binding polypeptide of the invention, wherein the single-chain antigen-binding polypeptide binds to TNFa and is administered in an amount effective to inhibit TNFa related toxicity. The single-chain antigen-binding polypeptide of the invention and/or polymer conjugates thereof, is administered in amounts ranging from about 10m.g/kg to about 4,000mg/kg, and more preferably in amounts ranging from about 20mg/kg to about S00mg/kg} and 10 even more preferably from about 20mg/kg to about 400mg/kg, by any art-known systemic route, wherein the dose is repeated as needed for effecting a clinical response. Administration by perfusion into body cavities, by inhalation or intranasal routes, along with topical administration, is also contemplated in order to treat systemic, as well as more localized conditions benefiting from the inventive anti-TNF alpha polypeptides, proteins and polymer conjugated compounds. Such conditions include, e.g., toxic shock syndromes, and any other art-known inflammatory processes responsive to anti-TNF alpha treatment. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1A illustrates the sequence of the DNA molecule encoding SCA 2-7-SC-l (SEQ ID NO: 1) having the construction VL-218-VH-his5 and no Cys mutein, and the expressed protein (SEQ ID NO: 10). FIG. 1B illustrates the sequence of the DNA molecule encoding 2-7-SC-2 (SEQ ID NO: 2) having the construction VL-21 S-VH-his6 and that encodes an SCA with a C-terminus Cys, and the expressed protein (SEQ ID NO: 11). FIG. 1C illustrates the sequence of the DNA molecule encoding 2-7-SC-3 (SEQ ID NO: 3) having the construction VH-(GGGGS)3-VL-1US6 and that encodes an SCA with a C-terminus Cys, and the expressed protein (SEQ ED NO: 12). FIG. ID illustrates the sequence of the DNA molecule encoding 2-7-SC-4 (SEQ ID NO: 4) having the construction VL-21 8-VH and that encodes an SCA with a C- terminus Cys, and the expressed protein (SEQ ED NO: 13). FIG. IE illustrates the sequence of the DNA molecule encoding 2-7-SC-5 (SEQ ED NO: 5) having the construction VL-218-VH-his a Cys at linker position 2, and the expressed protein (SEQ ID NO: 14). FIG. IF illustrates the sequence of the DNA molecule encoding 2-7-SC-6 (SEQ ID NO: 6) having the construction VL-218-VH-his6 and that encodes an SCA with a Cys at linker position 2 and a Cys at the C terminus, and the expressed protein (SEQ ID NO:.15). 11 FIG. 1G illustrates the sequence of the DNA molecule encoding 2-7-SC-7 (SEQ ID NO: 7) having the construction VH-(GGGGS)3-VL-hisg and that encodes an SCA with a Cys at linker position 5 and the expressed protein (SEQ ID NO: 16). FIG. 1H illustrates the sequence of the DNA molecule encoding 2-7-SC-8 (SEQ ID NO: 8) having the construction VL-218-VH-his6 and that encodes an SCA with a Cys at both the N-terminus and C-terminus, and the expressed protein (SEQ ID NO: 17). FIG. 1-1 illustrates the sequence of the DNA molecule encoding 2-7-SC-9 (SEQ ID NO: 9) having the construction VL-GGGGS-VH-hisg and that encodes an SCA with no free Cys, and the expressed protein (SEQ ID NO: 18). FIG 2 A. illustrates clone 2-7-SC-2 SCA expression. Expression of the SCA protein is induced by 1 % methanol or MeOH in Pichia culture. 27 kDa is marked by the arrow (" à" ). FIG 2B illustrates expression and purification data for clone 2-7-SC-2 , including the SDS-PAGE gel analysis by Coomassie Blue staining of the fractions, and the yield at each step. A small amount of ~54 kDa disulfide-linked dimer is visible in the stained gel. Legend: STD, Markl2 protein molecular weight standards; SUP, fermentation harvest supernatant; DIA, diafiltered supernatant; DEAE, first DEAE chromatography flow-through; Ni"++", eluted sample after nickel affinity chromatography; DEAE, second DEAE chromatography. Peaks are visible at about 27 kDa, as identified by the carrot ">". FIG 3A illustrates the structure of mPEG-MAL. FIG 3B illustrates the structure of mPEG2(MAL). FIG 3C illustrates the structure of mPEG(MAL)2. FIG 3D illustrates the structure of mPEG2(MAL)2. FIG 3E illustrates reaction of activated PEG-MAL with a thiol-SCA. FIG 3F illustrates a vinylsulfone active PEG. FIG 4 is a spectrograph plot of absorbance verses wavelength between 200 and 400 nm. Curve A is cysteine, 3mM; curve B is PEG-MAL (1 mM) + cysteine 12 (3mM) post-reaction; and curve C is PEG-MAL 1mM. FIG. 5A illustrates an SDS-PAGE analysis of 2-7-SC-5 and 2-7-SC-5 conjugates with visualization by Brilliant Blue Stain. Lane 1 provides MARIC12 (Invitrogen) protein size standards, lane 2 is non-conjugated 2-7-SC-5 SCA, lane 3 is PEG(20K)2-7-SC-5 SCA and lane4 is PEG(40K)2-7-SC-5 SCA. FIG. 5B illustrates an SDS-PAGE analysis of 2-7-SC-5 and 2-7-SC-5 conjugates with visualization by iodine staining. Lane 1 provides MARK.12 protein size standards, lane 2 is non-conjugated 2-7-SC-5 SCA, lane 3 is PEG(20K)2-7-SC-5 SCA and lane4 is PEG(40K)2-7-SC-5 SCA. FIG. 6A illustrates flow cytometry analysis of the binding of biotinylated TNFa to cell receptor in the presence of 2-7-SC-2 SCA. Curve 1 represents the cell population without fluorescence labeling, curve 2 represents the cell population after binding to biotin-TNFa and then to streptavidin-PE, curve 3 represents the cell population preincubated with SCA, biotin-TNFa, and then streptavidin-PE. FIG. 6B illustrates flow cytometry analysis of the binding of biotinylated TNFa to cell receptor in the presence of 2-7-SC-2 PEG(20K) SCA. Curve 1 represents the cell population without fluorescence labeling, curve 2 represents the cell population after binding to biotin-TNFa and then to streptavidin-PE, curve 3 represents the cell population preincubated with PEG-SCA, biotin-TNFa and then to streptavidin-PE. FIG. 6C illustrates flow cytometry analysis of the binding of biotinylated TNFa to cell receptor in the presence of 2-7-SC-2 PEG(40K) SCA. Curve 1 represents the cell population without fluorescence labeling, curve 2 represents the cell population after binding to biotin-TNFa and then to streptavidin-PE, curve 3 represents the cell population preincubated with PEG-SCA, TNFa and then to streptavidin-PE. FIG. 7 shows a Western blot analysis of D2E7 2-7-SC-2 SCA protein and PEG-SCA derivatives. The primary detection antibody was anti-2-7-SC-l SCA rabbit antiserum prepare from rabbits immunized with the purified recombinant SCA protein. Lane 1 and 7, molecular weight markers (250, 14S, 98, 64, 50, 36, 22, 16, 6 and 4 kDa); lane 2,2-7-SC-2 SCA protein; lane 3, ethyl-2-7-SC-2; lane 4, PEG 13 (5 kDa)-2-7-SC-2; lane 5, PEG (20 kDa)-2-7-SC-2; lane 6, PEG (40 KDa)-2-7- SC-2. FIG. 8 shows the scanned image intensity of the bands of D2E7 2-7-SC-2 and PEGylated forms confirming reactivity of this anti-D2E7 antiserum with the recombinant SCA proteins and PEG-SCA conjugates. Band A is 2-7-SC-2, Band B is 2-7-SC-5, Band C is PEG(20k)-2-7-SC-2, Band D is PEG(20k)-2-7-SC-5, Band E is PEG(40k)-2-7-SC-2, Band F is PEG(40k)-2-7-SC-5. FIG. 9 shows the SDS PAGE analysis of a representative set of samples for the pharmacokinetic studies. 2-7-SC-2 SCA proteins and 2-7-SC-2 PEG-SCA conjugates were examined on Coomassie Blue stained gels. On the left gel, the loaded samples were non-reduced. On the right gel, the samples were reduced with 3 mM beta-mercaptoethanol and heated to 85 C for 2 minutes prior to loading. Approximately ten micrograms of protein was loaded for each lane. Legend: MM -molecular weight standards; lane 1,2-7-SC-2 SCA; lane 2,2-7-SC-2 SCA modified with N-ethylmaleimide; lane 3,2-7-SC-2 SCA-PEG(40 kDa); lane 4, 2-7-SC-2 SCA-PEG(20 kDa). DETAILED DESCRIPTION OF THE INVENTION Accordingly, the present invention provides improved anti-TNF-a single-single chain antigen-binding polypeptides and/or multivalent proteins comprised of such polypeptides, with engineered functional groups selected to facilitate site-directed conjugation to polymers, e.g., substantially non-antigenic polymers. Conjugates of the inventive polypeptides with polymers, as well as methods of making and using the same, are also provided. The invention broadly relates to the discovery mat single-chain antigen-binding proteins ("SCA") or single-chain variable fragments of antibodies ("sFv"), have enhanced properties when conjugated to suitable polyalkylene oxide polymers at specific locations on the SCA polypeptide. The SCAs of the invention are engineered to include functional groups for selective polymer conjugation at such specific locations. The benefits of polymer conjugation broadly include substantially reduced antigenicity in vivo, and increased circulating half-life after 14 administration to an animal or human patient. Without meaning to be bound by any theory or hypothesis as to how the inventive SCAs provide conjugates with desirable properties, it is believed that, by engineering the binding sites at selected locations on the polypeptide chain or chains, interference with antigen binding function and chain tertiary structure by the presence of the conjugated polymer(s) is avoided or minimized. In order to better appreciate the scope of the invention, the following terms are defined. The terms "single-chain antigen-binding molecule" ("SCA") or "single-chain Fv" (sFv) are used interchangeably herein unless otherwise specified. The terms, "protein" and "polypeptide" are also used interchangeably unless otherwise specified. Broadly, an SCA is structurally defined as comprising the binding portion of a first polypeptide from the variable region of an antibody VL (or VH), associated with the binding portion of a second polypeptide from the variable region of an antibody VH (or VH, the two polypeptides being joined by a peptide linker linking the first and second polypeptides into a single polypeptide chain, such that the first polypeptide is N-terminal to the linker and second polypeptide is C-terminal to the first polypeptide and linker. The SCA thus comprises a pair of variable regions connected by a polypeptide linker. The regions may associate to form a functional antigen-binding site, as in the case wherein the regions comprise a light-chain and a heavy-chain variable region pair with appropriately paired complementarity determining regions (CDRs). In this case, the single-chain protein is broadly referred to as a "single-chain antigen-binding protein" or "single-chain antigen-binding molecule" or "single-chain antigen-binding polypeptide." As defined above, the SCAs are optionally "monovalent" or "multivalent." Monovalent SCAs are engineered to include only a single antigen binding site, i.e., a single pair of variable regions connected by a polypeptide linker associating to form the antigen binding site. Multivalent SCAs are antigen binding proteins engineered to include two or more antigen binding sites, ie., two or more pairs of variable regions connected by a polypeptide linker, including SCAs mat include two or more single-chain antigen-binding polypeptides as described above. The constituent SCA moieties are 15 associated by any art-known method. In one embodiment, multivalent binding proteins according to the invention include two or more SCAs feat are noncovalently associated so as to remain fully functional as antigen binding proteins. In another embodiment, multivalent binding proteins include two or more SCAs that are associated by covalent linkage, e.g., via one of several art-known peptide or non-peptide linker chemistries. Further, multivalent binding proteins, e.g., formed of plural SCAs, can be expressed or synthetically constructed as a single peptide chain, analogously to a monovalent SCA, but with two or more repeated SCA domains, that are the same or different. SCAs are constructed so that the VL is the N-terminal domain followed by the linker and VH (a VL-Linker-VH construction). In an alternative embodiment, SCAs are constructed so that VH is the N-terminal domain followed by the linker and VL (VH-Linker-VL construction). The preferred embodiment contains VL in the N-terminal domain (see, Anand, N. N., et al, J. Biol. Chem. 266:21874-21879 (1991)). Optionally, multiple linkers are employed. A description of the theory and production of single-chain antigen-binding proteins is found in Ladner et al, U.S. Pat Nos. 4,946,778, 5,260,203, 5,455,030 and 5,518,889, and in Huston et al., U.S. Pat No. 5,091,513 ("biosynthetic antibody binding sites" (BABS)), all incorporated herein by reference. The SCAs produced according to the above patents have binding specificity and affinity substantially similar to that of the corresponding Fab fragment. Variable Domains (Fv) The SCAs of the invention are constructed with variable domains ("Fv") that are selected, derived or modeled from any desirable natural or artificial antibody. In another preferred embodiment, Fv for use in the invention are obtained from libraries of Fvs configured as permutation libraries, screened against a desired binding target(s). Simply by way of example, large numbers of MAbs have been employed by the art to obtain Fv domains and it is contemplated that Fv domains can be obtained, and employed in the SCAs of the invention, from any of these. Simply by way of example, and without limitation, the following MAbs are 16 employed to provide Fv domains: 26-10, MOPC 315, 741F8, 520C9, McPC 603, D1.3, murine phOx, human phOx, RFL3.S sTCR, 1A6, Sel55-4, 18-2-3, 4-4-20, 7A4-1, B6.2, CC49, 3C2,2c, MA-\5C5/KUGQ, OX, etc. (See, Huston, J. S. et al, Proc. Natl. Acad. Sci. (USA) 85:5879-5883 (1988); Huston, J. S. et al., SIM News 38f4) (Supp.).11(1988); McCartney, J. et al., ICSU Short Reports 10:114 (1990); McCartney, J. E. et al, unpublished results (1990); Nedelman, M. A. et al, J. Nuclear Med. 32 (Supp.):1005 (1991); Huston, J. S. etal, In: Molecular Design and Modeling: Concepts and Applications. Part B, edited by J. J. Langone, Methods in Enzvmology 203:46-88 (1991); Huston, J. S. et al, In: Advances in the Applications of Monoclonal Antibodies in Clinical Oncology. Epenetos, A. A. (Ed.), London, Chapman & Hall (1993); Bird, R. E. et al, Science 242:423-426 (1988); Bedzyk, W. D. etal, J. Biol. Chem. 265:18615-18620 (1990); Colcher, D. etal. J. Nat. Cancer Inst 82:1191-1197 (1990); Gibbs, R. A. etal, Proc. Natl. Acad. Sci. (USA) 88:4001-4004 (1991); Milenic, D. E. et al, Cancer Research 51:6363-6371 f!991): Pantoliano. M. W. etal. Biochemistry 30:10117-10125 (1991); Chaudhary, V. K. etal, Nature339:394-397 (1989); Chaudhary, V. K. et al, Proc. Natl. Acad. Sci. (USA) S7:1066-1070 (1990); Batra, J. K. et al, Biochem. Biophvs. Res. Comm. 121:1-6 (1990); Batra, J. K. et al. J. Biol. Chem. 265:15198-15202 (1990); Chaudhary, V. K. et al, Proc. Natl. Acad. Sci. (USA) 87:9491-9494 (1990); Batra, J. K. et al. Mol. Cell. Biol. 11:2200-2205 (1991); Brinkmann, U. etal., Proc. Natl. Acad. Sci. (USA) 88:8616-8620 (1991); Seetharam, S. etal, J. Biol. Chem. 266:17376-17381 (1991); Brinkmann, U. et al, Proc. Natl. Acad. Sci. (USA) S9:3075-3079 (1992); Glockshuber, R. et al, Biochemistry 29:1362-1367 (1990); Slcerra, A. etal, Bio/Technol. 9:273-278 (1991); Pack, P. etal. Biochemistry31:1579-1534 (1992); Clackson, T. etal, Nature 352:624-628 (1991); Marks, J. D. etal. J. Mol. Biol. 222:581-597 (1991); Iverson, B. L. etal, Science 249:659-662 (1990); Roberts, V. A. et al, Proc. Natl. Acad. Sci. (USA) 87:6654-6658 (1990); Condra, J. H. et al, J. Biol. Chem. 265:2292-2295 (1990); Laroche, Y. et al, J. Biol. Chem. 266:16343-16349 (1991); Holvoet, P. et al, J. Biol. Chem. 266:19717-19724 (1991); Anand, N. N. etal, I 17 Biol. Chem. 266:21874-21879 (1991); Fuchs, P. et d, Bio/Technol. 9:1369-1312 (1991); Breitling, F. et al. Gene 104:104-153 (1991); Seehaus, T. etal. Gene 114:235-237 (1992); Talddnen, K. et al, Protein Engng. 4:837-841 (1991); Dreher, M. L. et al. J. Immunol. Methods 139:197-205 (1991); Mottez, E. et al, Eur. J. Immunol. 21:467-471 (1991); Traunecker, A. et al, Fioc. Natl. Acad. Sci. (USA) 88:8646-8650 (1991); Traunecker, A. etal, EMBOJ. 10:3655-3659 (1991); Hoo, W. F. S. et al, Proc. Natl. Acad. Sci. (USA) 89:4759-4763 (1993)). All of the foregoing citations are incorporated by reference herein. In particular, the anti-TNFa MAb described as D2E7 by US patent No. 6,258,562, and the anti-erbB-2 MAb (HERCEPTTN™) described by Carter P et al, 1992, Proc Natl Acad Sci (USA) 89: 4285-4289 served as exemplary models for the engineering of SCAs and SCA-polyalkylene oxide conjugates, according to the invention. D2E7 is commercially available as Humira® (Abbott Immunology, Abbott Park, Illinois). In addition, the CC49 MAb was developed by Dr. Jeffrey Schlom's group, Laboratory of Tumor Immunology and Biology, National Cancer Institute. It binds specifically to the pan-carcinoma tumor antigen TAG-72. See Muraro, R. et al, Cancer Research 4S: 4588-4596 (198S). The anti-TAG-72 CC-49 SCA described by Filpula et al. 1996 (Antibody Engineering: A Practical Approach,, Oxford University Press, pp 253-268), was also prepared as a Cys-modified SCA and as an exemplary conjugate according to the invention. All of the foregoing citations are incorporated by reference herein. Peptide Linkers SCAs according to the invention include peptide linkers designed to span the C-terminus of VL, or neighboring site thereof, and the N-terminus of VH, or neighboring site thereof, or to link die C-terminus of VH and the N-terminus of The artisan will appreciate that linker length depends upon the nature of the polypeptides to be linked and the desired activity of the linked fusion polypeptide resulting from fee linkage. Generally, the linker should be long enough to allow the resulting linked fusion polypeptide to properly fold into a conformation 18 providing the desired biological activity, i.e., antigen-binding. In each particular case, the preferred length will depend upon the nature of the polypeptides to be linked and the desired activity of the linked fusion polypeptide resulting from the linkage. Where conformational information is available, as is the case with the SCA polypeptides discussed below, the appropriate linker length may be estimated by consideration of the 3-dimensional conformation of the substituent polypeptides and the desired conformation of the resulting linked fusion polypeptide. Where such information is not available, the appropriate linker length may be empirically determined by testing a series of linked fusion polypeptides with linkers of varying lengths for the desired biological activity. Such linkers are described in detail in WO 94/12520, incorporated herein by reference. Peptide linkers used to construct SCA polypeptides generally range in size from about 2 to about 50 amino acid residues in length, and preferably, from about to 2 to about 10 residues. In certain other embodiments, the linkers range in size from about 10 to about 30 residues. In certain more preferred embodiment, particularly for embodiments related to multivalent binders comprising two or more noncovalently associated SCA polypeptides, it is preferred that the linker range in size from about 2 to about 20 amino acid residues. More preferably, such linkers are serine rich or glycine rich. The linkers are designed to be flexible, and it is recommended that an underlying sequence of alternating Gly and Ser residues be used. To enhance the solubility of the linker and the single chain Fv protein associated therewith, three charged residues may be included, two positively charged lysine residues (K) and one negatively charged glutamic acid residue (E). Preferably, one of the lysine residues is placed close to the N-terminus of VH, to replace the positive charge lost when forming the peptide bond of the linker and the Vy. Such linkers are described in detail by co-owned U.S. Patent No. 5,S56,456, incorporated by reference herein. See also, Whitlow, M., et al, Protein Engng. 7:1017-1026 (1994), incorporated by reference herein. For multivalent antigen binding proteins according to the invention, the 19 covalent or noncovalent association of two or more SCA polypeptides is preferred for their formation. Although, multivalent SCAs can be produced from SCA with linkers as long as 25 residues, they tend to be unstable. Holliger, P., et al, Proc. Natl. Acad. Sci. (USA) 90:6444-644S (1993), have recently demonstrated that linkers 0 to 15 residues in length facilitate the formation of divalent Fvs. See, Whitlow, M., et al. Protein Engng 7:1017-1026 (1994); Hoogenboom, H. R., Nature Biotech. 15:125-126 (1997); and WO 93/11161, incorporated by reference herein. Identification and Synthesis of Site-specific PEGylation Sequences The invention provides for thiol functional moieties, e.g., a thiol-containing amino acid residue located at specific sites in the VL and VH regions, adjacent to the C-terminus of the polypeptide (VL, VH or a neighboring site thereof), the N-terminus of the polypeptide (VL VH or neighboring site thereof), the linlcer region between the first and second polypeptide regions, or in a combination of these regions. In the present invention, it is preferred that specific sites for polymer conjugation be located in the polypeptide linker, the C-terminus or adjacent to the C-terminus of the SCA, and preferably, at the second residue of the linker. The thiol-containing functional group can be any known to art, including natural amino acid residues, and/or non-naturally-occurring amino acid residues, as well has thiol-fictionalized derivatives of the same. In a preferred embodiment, the thiol functional moiety is a cysteine residue. This is preferred because SCA proteins normally have two buried disulfide bonds (Padlan EA, 1994, Antibody-Antigen Complexes. R.G. Landes Company, Austin), but no free cysteines. Thus, only the engineered Cys thiols are available for conjugation with activated polymers selective for reaction with thiols. The particular nucleotide sequence which is used to introduce a Cys site into the various positions will depend upon the naturally-occurring nucleotide sequence. The most preferred sites are those in which it takes a minimum number of changes to create the Cys insertion while meeting the above-described steric requirements, as well. Of course, based on the redundancy of the genetic code, a 20 particular amino acid may be encoded by multiple nucleotide sequences. Any suitable art-known method for site-directed mutagenesis is used to change the native protein sequence to one that incorporates the Cys residue. The mutant protein gene is placed in an expression system, such as bacterial cells, yeast OT other fungal cells, insect cells or mammalian cells. The mutant protein is then purified by standard methods for recovery of proteins. Preferably, nucleic acid molecules expressing SCA muteins are produced by oligonucleotide-directed mutagenesis. Such methods for generating the site-specific Cys muteins, and related techniques for mutagenesis of cloned DNA, are well known in fee art. See, Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (19S9); Ausubel et al (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY. John Wiley and Sons (1987), both incorporated herein by reference. Hosts and Vectors After mutating the nucleotide sequence of an SCA of interest to provide for a Cys residue at the desired location, the mutated nucleic acid is preferably inserted into a suitable cloning vector, where the nucleotide encoding the SCA is operably linked to regulatory sequences controlling transcriptional expression. These are preferably selected by art-known techniques in order to optimize SCA production from a desired host cell system. SCAs are known to be expressed and produced by prokaryotic or eukaryotic host cells, although for many purposes eukaryotic host cells are preferred. Preferred prokaryotic hosts include, but are not limited to, bacteria such as Bacillus, Streptomyces, Streptococci, and/or Escherichia coli. Preferred eukaryotic host cells include yeast or other fungal cells, insect cells and/or mammalian cells. Preferably, these include human or primate cells, present either in vivo, or in tissue culture. More preferably, the inventive SCAs are produced by transformed yeast, such as Pichiapastoris. Expression vectors are optionally selected to provide transient expression in a host cell, or to integrate into the host 21 cell genome to create a transformed cell line. Standard protein purification methods are used to purify these mutant proteins. Only minor modification to the native protein purification scheme may be required. For example, selection of vectors, hosts, methods of production, isolation and purification of monovalent, multivalent and fusion forms of proteins, especially SCA polypeptides, are thoroughly described by e.g., co-owned U.S. Pat. Nos. 4,946,778 and 6,323,322 incorporated by reference herein. In one preferred embodiment, a nucleic acid molecule encoding an SCA of interest and a selection marker is integrated into a host cell chromosome, either as a single vector or as co-introduced vectors. The marker may complement an auxotrophy in the host (such as his4, leu2, or ura3, which are common yeast auxotrophic markers), biocide resistance, e.g., antibiotics, or resistance to heavy metals, such as copper, or the like. The selectable marker gene can either be directly linked to the SCA DNA sequence to be expressed, or introduced into the same cell by co-transfection. Cells which have stably integrated the introduced nucleic acid are selected by survival or other effects of the marker in a given system. In another embodiment, me SCA of interest is encoded by a suitable plasmid vector capable of autonomous replication in the recipient host eel). Any of a wide variety of art-known vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species. Any of a series of yeast vector systems can be utilized. Examples of such expression vectors include the yeast 2-micron circle, the expression plasmids YEP13, YCP and YRP, etc., or their derivatives. Such plasmids are well known in the art (Botstein et al, Miami Wntr. Svmp. 19:265-274 (1982); Broach, J. R., In: The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., p. 445-470 (1981); 22 Broach, J. R, Cell 28:203-204 (1982)). 115 For a mammalian host, several art-known vector systems are available. One class of vectors utilize DNA elements which provide autonomously replicating extra-chromosomal plasmids, derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, or SV40 virus. A second class of vectors relies upon the integration of the desired gene sequences into the host chromosome. Cells which have stably integrated the introduced DNA into their chromosomes are marker selected as discussed supra. Additional elements may also be needed for optimal synthesis of mRNA. These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals. The cDNA expression vectors incorporating such elements include those described by Okayama, H., Mol. Cell. Biol. 3:280 (1983), and others well known to the art. Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNHSA, pNH16a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Preferred vectors for expression in Pichia are pHIL-S 1 (Invitrogen Corp.) and pPIC9 (Invitrogen Corp.). Other suitable vectors will be readily apparent to the skilled artisan. Once the vector or DNA sequence containing the constructs has been prepared for expression, the DNA constructs may be introduced or transformed into an appropriate host. Various techniques may be employed, such as transformation, transfection, protoplast fusion, calcium phosphate precipitation, electroporation, or other conventional techniques. After the cells have been transformed wife the recombinant DNA (or RNA) molecule, the cells are grown in media and screened for appropriate activities. Expression of the sequence results in the production of fee mutant SCA for PEG conjugation of the present invention. 23 production and Purification of SCA Proteins The monovalent or multivalent antigen-binding proteins of the invention can be produced by any suitable art-known methods. Broadly, the method includes preparing a suitable expression vector, expressing the vector in a compatible host cell, culturing the host cells and recovering the desired protein. For expression in prokaryiotic cells or other cultured cells not capable of secreting the recombinant protein into the culture medium, the recovery is from the harvested cells. The harvested cellular material is subjected to cell lysis and washing, solubilization of the formed inclusion bodies in a compatible denaturing solvent, refolding by dilution under conditions effective to provide refolding into a function binding protein, and two ion-exchange HPLC chromatography steps. Preferred prolcaryotic expression systems include, e.g., Escherichia coli ("E. coli") See, for example, U.S. Patent Nos. 4,946,778, 5,260,203, 5,455,030, 5,518,889, AND 5,534,621, as well as Bird era/., Science242:423 (1988), also incorporated by reference herein. Initial work on expression of the exemplified SCA proteins employed the E. coli expression system obtained from Xoma Corporation (araB promoter and pelB signal). The SCA protein was successfully expressed. However, the proteins expressed by the Xoma Corp. system remained cell associated in the periplasm, and would have required additional purification steps. A more preferred expression system employs eukaiyotic host cells and an expression vector with a secretion signal sequence. This preferred embodiment avoids the need to recover Hie SCA expressed as insoluble inclusion bodies from E. coli host cells. glycosylation, where needed. A number of recombinant DNA strategies exist which utilize strong promoter sequences and high copy number of plasmids which can be utilized for production of the desired proteins in yeast. Yeast recognizes leader sequences on cloned mammalian gene products, and secretes peptides bearing leader sequences (i.e., pre-peptides). For this reason, the SCA proteins exemplified herein were all expressed by secretion from the yeast Pichia pastoris and recovered from solution. 24 SCA Proteins with D2E7 MAb Variable Domains In a particularly preferred embodiment, SCAs according to the invention were developed employing variable domains of the D2E7 MAb. The D2E7 MAb was developed by Cambridge Antibody Technology and BASF Corporation. It binds specifically to a human cytokine, tumor necrosis factor alpha (TNF-a), and the MAb is described in detail by US patent Nos. 6,09,03S2, 6,258,562, incorporated by reference herein.. Selected domains of this antibody served as models to prepare a number of exemplar)' SCA molecules having one or more Cys residues incorporated into their respective polypeptide sequences at specific locations. In brief, a wholly synthetic gene was constructed by polymerase chain reaction (PCR) using 14 long overlapping synthetic oligonucleotides, ranging from 20 bases to 102 bases in length,. Oligonucleotide-directed mutagenesis was further employed to construct other Variants of the original sequence. The SCAs encoded by the resulting vectors contain the complete variable light (VH and variable heavy (VH) segments of the D2E7 MAb, connected by a peptide linker. The exemplified linkers were an eighteen residue linker designated as the "218-linker," and a 15 residue linker. The eighteen amino acid "218-Iinker" has been described by Filpula et al, '1996, Antibody Engineering: A Practical Approach. 1996, Oxford University Press, pp 253-268). The 15 amino acid long (GGGGS)3 linker (SEQ ID NO: 42) has been described by Huston JS et al, 19SS, Proc Natl Acad Sci (USA) 85: 5879-5883. In some cases, a six-histidine tag (his6) (SEQ ID NO: 43) at the C-terminus was included to simplify purification via metal immobilized metal ion- affinity chromatography (IMAC). The completed genes were cloned into an E. coli plasmid for DNA sequence confirmation on an ABI PRISM® 310 Genetic Analyzer from Applied Biosystems (Foster City, California) (formerly produced by ABI/Perkin-Elmer). The domain orientations, linkers, and placement of the free cysteine are summarized in Table 1, below. 25 TABLE 1: SCA CLONES WITH D2E7 Fv SCA FreeCys at Clone SEQ ID NOs DESIGN Posirion(s) FIGS. Nos. 2-7-SC-l SEQIDNO:l VL-21S-VH-his6 None 1A 2-7-SC-2 SEQIDNO:2 VL-218-VH-his6 C-terminus IB 2-7-SC-3 SEQ ID NO:3 VH-(GGGGS)3-VL-his6 C-terminus IC 2-7-SC-4 SEQJDNO:4 VL-21S-VH C-terminus ID 2-7-SC-5 SEQIDNO:5 VL-21S-VH-his6 Linker position2 IE 2-7-SC-6 SEQ ID NO :6 VL-218-VH-his6 Linker position 2 and C-terminus IF 2-7-SC-7 SEQ ID NO:7 VH-(GGGGS)3-VL-his6 Linker position IG 2-7-SC-8 SEQ ID NO:8 VL-218-VH-his6 Both N- andC-terminus IH 2-7-SC-9 SEQIDNO:9 VL-GGGGS-VH-his6 None l-I As summarized by Table 1, above, FIGS. 1A, IB, IC, ID, IE, IF, IG, IH and l-I present the DNA and encoded polypeptide sequences of the above nine genes. Recombinant expression and purification of SCA proteins. As noted above, Pichia pastoris was employed for production of the SCA variant proteins described above. The signal sequence from the yeast alpha mating factor was inserted directly in front of the mature coding sequence for each of these SCA proteins. The amino acid sequence of this signal peptide is Met Arg Phe Pro Ser lie Phe Thr Ala Val Leu Phe Ala Ala Ser Ser Ala Leu Ala A Ala (SEQ ID NO: 36) where the "A" indicates the cleavage site. A 20th amino acid of the signal (the alanine after the A ) was also included in these constructs. Therefore, the amino terminus of the mature SCA protein contains this alanine, followed, in each exemplified SCA, by the complete amino acid sequences illustrated by FIGS. 2A- 2H (SEQ ID NOS. 1-9), respectively; as enumerated by Table 1). N-terminal protein sequence analysis confirmed that these sequences were correctly processed. Tire mutant genes expressing fee D2E7 SCAs were individually ligated at the EcoRI site into the Pichia transfer plasmid pHIL-D2 26 (Invitrogen Corp.) and transformed into the yeast Pichia pastoris host GS-115. Detailed protocols for these procedures are presented in the Pichia Expression Kit Instruction Manual Cat. No. XI710-01 (1994) from Invitrogen Corporation, incorporated by reference herein. Initial evaluation of expression was done by Coomassie Blue staining of SDS-PAGE gels. The clone numbers for the Pichia expression strains for each SCA protein correspond to the 2-7-SC numbers in Table 1, supra. The SCA proteins (-27 kDa) were expressed and secreted at high levels in recombinant Pichia (about 20 — 100 mg/L). Analysis on SDS-PAGE gels in the absence of reductant demonstrated the expected presence of both monomers and dimers formed by a single disulfide cross-link of two monomers. Rabbit antiserum versus the purified 2-7-SC-l SCA protein was prepared. Western analysis with this reagent verified the identity of the expressed SCA proteins. For example, FIG. 8 shows a representative Western blot analysis of D2E7 2-7-SC-2 and PEGylated forms confirming reactivity of this anti-D2E7 antiserum with the recombinant SCA proteins and PEG-SCA conjugates. Anti-218-linlcer antibody was employed. 1 µg of each sarnie was analyszed on 4-20% non-reducing SDS-PAGE gel. The primary and secondary antibodies are anti 18-linlcer antibody raised in rabbit and goat anti rabbit antibody conjugatd horserasish peroxidase, respectively. The enzyme substrate was TMBM peroxidase substrate from Moss, In. D2E7 2-7-SC-2 has PEG at c-terminal and 2-7-SC-5 has PEG at 218 linker. Band A is 2-7-SC-2, Band B is 2-7-SC-5, Band C is PEG(20k)-2-7-SC-2, Band D is PEG(20k)-2-7-SC-5, Band E is PEG(40k)-2-7-SC-2, Band F is PEG(40k)-2-7-SC-5. The SCA proteins were purified from Pichia pastoris supematants to greater man 95% purity by simple two or three column chromatography protocols. For the SCA proteins bearing a hisg tag (SEQ ID NO: 43), the dialyzed fermentation medium was diafiltered and passed through a DEAE column, then bound to an IMAC nickel affinity column, (QIAGEN). The bound SCA protein was eluted with imidazole; then flowed through a second DEAE anion exchange column. The flow-through was diafiltered for concentration of the SCA protein 27 and further characterized. For SCA proteins lacking the hisg tag (SEQ ID NO: 43), the SCA protein was either purified on a protein L-agarose column with low pH elution, obtained from Pierce Biotechnology, Inc (Rockford, Illinois), or captured on HS cation exchange chromatography, obtained from Amersham Pharmacia (Piscataway, NJ), followed by salt gradient elution and diafiltration. HS chromatography was the preferred method. FIGS. 2A and 2B show representative expression and purification data for clone 2-7-SC-2 , including the SDS-PAGE gel analysis by Coomassie Blue staining of the fractions, and the yield at each step. A small amount of -54 kDa disulfide-linked dimer is visible in the stained gel. Thiol-Specific Activated Polymers Preferably, the inventive SCAs are linked to thiol-specific activated polymers. Specifically, the activated polymers preferably employed in the present invention are those which have a sulfhydryl- or thiol- selective terminal linking group on at least one terminal thereof. Several art-known activated polymers, e.g., polyalkylene oxide (PAO) polymers that are reactive with free thiols, are readily employed in the practice of the invention. Examples of reactive groups include maleimide, vinylsulfone, thiol, orthopyridyl disulfide, and iodoactemide, with maleimide activated polyethylene glycols (PEG-mal's) being more preferred, in view of the maleimide group being highly specific for thiols and the conjugation reaction taking place under mild conditions. See also, for example, co-owned U.S. Patent No.5,730,990, incorporated by reference herein. Additional sulfhydral selective activated PEG-polymers are also available from Nektar Therapeutics (formerly Shearwater Corporation) as illustrated by the 2001 Shearwater Corporation Catalog, incorporated by reference herein. See also Goodson, RJ. & Katre, N.V. 1990, Bio/Technology 8:343: Kogan, T. P. 1992, Synthetic Coram. 22, 2417, incorporated by reference herein. For example, the linear polymers mPEG-MAL (5 kDa) {e.g., Shearwater Cat. No. 2D3X0T01) and mPEG-MAL (20 kDa), as well as branched polymer mPEG2-MAL (40 kDa) (e.g., Shearwater Cat. No. 2D2M0H01) conjugated to 28 inventive SCAs, are exemplified herein. Structures of these maleimide-PEG polymers and the conjugation chemistry are shown for convenience by FIGS 3A-3E. FIG. 3F illustrates rnPEG-vinylsulfone. The various maleimide- activated polymers readily react with free thiols, as illustrated by FIG. 3E. In FIG. 3E, "SCA" is a protein according to the invention having at least one free thiol (S-H). See Table 2, below. TABLE 2 FIG Nos. Description Nektar/Shearwat er Cat. Nos. FIG3A mPEG-MAL 2D2M0H01, 2D2M0P01 FIG3B mPEG2(MAL) 2D3X0T01 FIG3C mPEG(MAL)-> 2D2D0H0F, 2D2D0P0F FIG 3D mPEG2(MAL)2 Catalog, page 10 FIG 3F mPEG Vinylsulfone Additional polymeric platforms which can include the sulfhydryl-specific linkers include those disclosed in commonly-assigned US Patent Nos. 5,643,575, 5,919,455, 6,113,906, (U-PEG's), 6,153,655 and 6,395,266 (terminally branched PEG's), 6,251,382 (polyPEG's) andUSSN 10/218,167 (bicines), etc. See also Shearwater Polymers, Inc. catalog "Polyethylene Glycol and Derivatives 2001". The disclosure of each of the foregoing is incorporated herein by reference. As mentioned above, the polymer portion of the conjugate is preferably a polyalkylene oxide. More preferably, the polymer portion is a polyethylene glycol which is substantially non-antigenic. Although PAO's and PEG's can vary substantially in weight average molecular weight, those included in the compositions of the present invention independently have a weight average molecular weight of from about 2,000 Da to about 136,000 Da in most aspects of tire invention. More preferably, the polymer has a weight average molecular weight of from about 3,000 Da to about 100,000 Da. Most preferably, the polymer 29 portion has a weight average molecular weight of from about 5,000 Da to about 40,000 Da. The polymeric substances included herein are preferably water-soluble at room temperature. A non-limiting list of such polymers include polyalkylene oxide homopolymers such as polyethylene glycol (PEG) or polypropylene glycols, polyoxyethylenated polyols, copolymers thereof and block copolymers thereof, provided that the water solubility of the block copolymers is maintained. Confirmation of the specific reactivity of the maleimide polymers with free cysteine, but not with lysine or histidine, was accomplished by reaction of the maleimides with these respective free amino acids. FIG. 4 confirms the reactivity of cysteine with activated PEG-MAL. The absorbance for cysteine, as a 3mM solution, is shown as curve A. The absorbance curve for activated PEG-MAL, at a concentration of 1 mM, is shown as curve C and is characterized by a wide absorbance peak centered on 300 nm. Absorbance curve B was taken of a solution combining cysteine and activated PEG-MAL in a 1:3 ratio (1 mM PEG-MAL and 3 mM cysteine, 100 mM sodium phosphate, pH 6.0, 1 mM EDTA, 25 °C). The B curve tracks the A curve, with a shift to the right, but the characteristic 300 nM broad peak of PEG-MAL, is not present, confirming the reactivity of cysteine with activated PEG-MAL. Analogous absorbance curves for histidine or lysine (not shown), confirm that these residues are not highly reactive under the employed conditions. Labeled or Tagged Conjugates Upon production of a polyalkylene oxide conjugated SCAs according to the invention, the conjugates are optionally further modified by linking or conjugating a diagnostic or therapeutic agent to the SCA-polymer conjugate. The general method of preparing an antibody conjugate according to the invention is described in Shih, L. B., et a!., Cancer Res. 51:4192 (1991); Shih, L. B., and D. M. Goldenberg, Cancer Immunol. Immunother. 31:197 (1990); Shih, L. B., et al, Intl. J. Cancer 46:1101 (1990); Shih. L. B., et al, Intl. J. Cancer 41:832 (1988). all incorporated herein by reference. The indirect method involves reacting an 30 antibody (or SCA), whose polyalkylene oxide has a functional group, with a carrier polymer loaded with one or plurality of bioactive molecules, such as, peptides, lipids, nucleic acids (i.e., phosphate-lysine complexes), drug, toxin, chelator, boron addend or detectable label molecule(s). In certain alternative embodiments, the polyalkylene oxide conjugated SCA is directly conjugated or linked to a diagnostic or therapeutic agent. Hie general procedure is analogous to the indirect method of conjugation except that a diagnostic or therapeutic agent is directly attached to an oxidized sFv component. See Hansen et al., U.S. Pat No. 5,443,953, incorporated herein by reference. Pharmaceutical Compositions and Administering the SCA and/or SCA-Polymer Conjugates The pharmaceutical compositions of the invention may include a "therapeutically effective amount" or a "prophylactically effective amount" of an SCA and/or SCA-polymer conjugate of the invention. A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount of the SCA and/or SCA-polymer conjugate may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the antibody or antibody portion to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody or antibody portion are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount. Dosage regimens may be adjusted to provide the optimum desired response (e g., a therapeutic or prophylactic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the 31 therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals. An exemplary, non-limiting range for a therapeutically or prophylactically effective amount of an SCA and/or SCA-polymer conjugate of the invention is 0.1-20 mg/kg, more preferably 1 -10 mg/kg. It is to be noted that dosage values may vary wife the type and severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to fee individual need and the professional judgment of the person administering or supervising the administration of the compositions, and feat dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of fee claimed composition. Pharmaceutical Compositions In a further preferred embodiment, the SCAs of the invention are employed for treating and/or diagnosing conditions related to the binding specificity of a particular SCA protein of interest. Thus, an SCA and/or SCA-polymer conjugate is administered by art-known methods, to an animal or person having a disease or disorder for which the binding properties of the administered SCA are useful in treating or diagnosing such disease or disorder. Preferably, the SCA is polymer-conjugated according to fee invention. The SCAs and conjugated SCAs of the invention can be incorporated into pharmaceutical compositions suitable for administration to a subject, e.g., an 32 animal or person in need of such administration. Typically, the pharmaceutical composition comprises an SCA polypeptide having at least one type of binding specificity, and a pharmaceutically acceptable carrier. The term, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antimicorbial, e.g., antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are physiologically compatible. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextiose, glycerol, ethanol and the like, as well as combinations thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the antibody or antibody portion. The inventive compositions are optionally prepared in a variety of fonns. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories. The preferred form depends on the intended mode of administration and therapeutic application. Typical preferred compositions are in the form of injectable or infusible solutions, such as compositions similar to those used for passive immunization of humans with other antibodies. The preferred mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular). In a preferred embodiment, the SCA and/or SCA-polymer conjugate is administered by intravenous infusion or injection. In another preferred embodiment, the antibody is administered by intramuscular or subcutaneous injection. Adminisn-ation via inhalation, as a spray, aerosol or mist is also contemplated where that route is advantageous, e.g., for systemic absorption and/or local action within the respiratory system. Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a 33 solution, microemulsion, dispersion, liposome, or other ordered structure suitable to high drug concentration. Sterile injectable solutions can be prepared by incorporating the active compound (i.e., antibody or antibody portion) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin. The SCAs and/or SCA-polymer conjugates of the present invention can be administered by a variety of methods known in the art, although for many therapeutic applications, the preferred route/mode of administration is intravenous injection or infusion. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results. In certain embodiments, the SCAs and/or SCA-polymer conjugates of the invention may be orally administered, for example, with an inert diluent or an assimilable edible carrier. The SCAs and/or SCA-polymer conjugates (and other ingredients, if desired) are optionally enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly mto the subject's diet. For oral therapeutic administration, the compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. To administer the SCAs and/or SCA-polymer conjugates of the invention by other than parenteral administration, it may be necessary to coat the compound with, or co-administer 34 the compound with, a material to prevent its inactivation. Supplementary active compounds can also be incorporated into the pharmaceutical compositions. In certain embodiments, an SCAs and/or SCA-polymer conjugate of the invention is co-formulated with and/or co-administered with one or more additional therapeutic agents that will provide additive, synergistic or supplementary therapeutic or diagnostic activity for a disease or disorder. Administering Anti-hTNF-a SCAs and/or SCA-Polymer Conjugates For example, anti-hTNFa SCAs and/or SCA-polymer conjugates of the invention may be co-formulated and/or co-administered with one or more additional antibodies or SCAs that bind other targets (e.g., that bind other cytokines or that bind cell surface molecules), one or more cytokines, soluble hTNFa receptors (see e.g., PCT Publication No. WO 94/06476) and/or one or more chemical agents that inhibit hTNF-a production or activity (such as cyclohexane-ylidene derivatives as described in PCT Publication No. WO 93119751). Furthermore, one or more SCAs and/or SCA-polymer conjugates of the invention may be used in combination with two or more of the foregoing therapeutic agents. Such combination therapies may advantageously utilize lower dosages of the individual administered therapeutic agents. Indications for Anti-TNF a-SCAs and Preferred Co-Administered Agents Simply by way of a example, U.S. Patent Nos. 6,258,562 and 6,090,382, incorporated by reference herein, provide an exhaustive list of diseases and disorders for which TNF a is a mediator or co-mediator of primary or other aspects of disease processes. Art-known agents for treating or palliating such diseases or disorders are contemplated to be co-formulated or co-administered with the anri-TNFcc embodiments of the inventive SCAs and/or polymer conjugated SCAs. In brief, the list of diseases and disorders mediated by or related to the actions of TNFa, and therefore rationally treated by a TNFa binder, optionally in combination with oilier art-known therapeutics, is stated by U.S. Patent No. 35 6,258,562 to include, e.g., sepsis, autoimmune diseases, infectious diseases, transplantation/rejection, malignancy, pulmonary and intestinal disorders. These indications and, where applicable, agents that are optionally co-fomiulated in treating such indications with anti-TNFa SCAs, are as follows. Sepsis. Treatable conditions associated with sepsis include TNFa - mediated septic shock syndrome and associated hypotension, myocardial suppression, vascular leakage syndrome, organ necrosis, stimulation of the release of toxic secondary mediators and activation of the clotting cascade, endotoxic shock, gram negative sepsis and toxic shock syndrome. Autoimmune diseases. Treatable conditions associated with auto immune diseases include, tissue inflammation and joint destruction in rheumatoid arthritis, death of islet cells and the insulin resistance in diabetes, cytotoxicity to oligodendrocytes and induction of inflammatory plaques in multiple sclerosis. Agents contemplated to be co-formulated or co-administered with the inventive anti-TNFa SCAs and/or polymer conjugated SCAs include any art-lcnown agents available to treat such autoimmune disorders including, e.g., glucocorticosteroids, non-steroidal anti-inflamniatory drug(s) (NSAEDs); cytokine suppressive antiinflammatory drug(s) (CSAIDs); CDP-57111BAY-10-3356 (humanized anti-TNFa antibody; Celltech/Bayer); cA2 (chimeric anti-TNFa antibody; Centocor); 75 kdTNFR-IgG (75 kD TNF receptor-IgG fusion protein; Immunex; see e.g., Arthritis & Rheumatism (1994) Vol. 37. S295; J. Invest Med. (1996) Vol. 44 235A); 55 kdTNFR-IgG (55 lcD TNF receptor-IgG fusion protein; Hoffmann-LaRoche); IDEC-CE9.I/SB 210396 (non-depleting primatized anri-CD4 antibody; IDEC/SmithKline, to name but a few. Infectious diseases. Treatable conditions associated with infectious diseases include TNFa -mediated brain inflammation, capillary thrombosis and infarction in malaria, venous infarction in meningitis, cachexia secondary to invention, e.g., HTV virus invention, stimulation of viral proliferation and central nervous system injury in HIV infection, fever and myalgias due to infections such as influenza). Agents 36 contemplated to be co-formulated or co-administered with the inventive anti-TNFoc SCAs and/or polymer conjugated SCAs include any art-known anti-infective agents, e.g., antibiotics, anti-bacterials, antivirals, and the like, as well as nonsteroidal anti-inflammatory drug(s) ("NSAIDs") and/or antibodies or SCAs that bind to the infective agent and/or its toxins or essentia] components. Transplantation Treatable conditions associated with transplantion medicine, rejection of transplants or side effects of the required immunosuppression agents include TNFa - mediated allograft rejection and graft versus host disease (GVHD), to name but a few transplantation-related effects. Agents contemplated to be co-formulated or co-administered with the inventive anti-TNFa SCAs and/or polymer conjugated SCAs include, e.g., glucocorricosteriods, cyclosporin A, FK.506, and/or OKT3, to inhibit OKT3-induced reactions, as well as in combination with binders directed to immune cell receptors such as antibodies or SCAs binding to CD25 (IL-2 receptor-a),CDl la (LFA-1), CD54 (ICAM-1), CD4, CD45, CD2S/CTLA4, CD80 (B7-1) and/or CD86 (B7-2). Malignancy. Treatable conditions associated with malignancy include TNFa -mediated cachexia, tumor growth, metastatic potential and cytotoxicity in malignancies. Agents contemplated to be co-formulated or co-administered with the inventive anti-TNFa SCAs and/or polymer conjugated SCAs include any art-known anti-tumor or anti-cancer agents. Pulmonary Disorders. Treatable conditions associated with pulmonary disorders include adult respiratory distress syndrome, shock lung, chronic pulmonary inflammatory disease, pulmonary sarcoidosis, pulmonary fibrosis and silicosis. For pulmonary disorders, the inventive anti-TNFa SCAs and/or polymer conjugated SCAs are optionally administered by oral or nasal spray, or formulated for administration as an aerosol, via any standard inhalation system. Such formulations can be coadministered or administered at alternate times with other agents suitable for treating such pulmonary disease or disorder, or an agent that facilitates bronchial access for the SCA formulation. 37 Intestinal Disorders. Treatable conditions associated with intestinal disorders include the range of inflammatory bowel disorders, e.g., Crohn's disease and/or ulcerative colitis. Agents contemplated to be co-formulated or co-administered with the inventive anti-TNFa SCAs and/or polymer conjugated SCAs include, budenoside; epidermal growth factor; corticosteroids; cyclo ;porin, sulfasalazine; aminosalicylates; 6-mercaptopurine; azathioprine; metronidazole; lipoxygenase inhibitors; mesalamine; olsalazine; balsalazide; antioxidants; thromboxane inhibitors; IL-1 receptor antagonists; anti-EL-ip MAbs; anti-IL-6 MAbs; growth factors; elastase inhibitors; pyridinyl-imidazole compounds; CDP-571/BAY-10-3356 (humanized anti-TNFa antibody; Celltech/Bayer); cA2 (chimeric anti-TNFa antibody; Centocor); 75 kdTNFR-IgG (75 kD TNF receptorlgG fusion protein; Immunex; 55 kdTNFR-IgG (55 kD TNF receptor-IgG fusion protein; Hoffmann-LaRoobe); interleukin-10 (SCH 52000; Schering Plough); IL4; IL-10 and/or IL4 agonists (e.g., agonist antibodies); interleukin-11; glucuronide- or dextran-conjugated prodrugs of prednisolone, dexamethasone or budesonide; ICAM-1 antisense phosphorothioate oligodeoxynucleotides (ISIS 2302; Isis Pharmaceuticals, Inc.); soluble complement receptor 1 (TP10; T Cell Sciences, Inc.); slow-release mesalazine; methotrexate; antagonists of Platelet Activating Factor (PAF); ciprofloxacin; and lignocaine. Diagnostic and Assay Methods: Anti-TNFa SCA or SCA-Conjugates The anti-hTNFa SCAs and/or SCA-polymer conjugates of the invention can be used to detect hTNFa in samples of interest, such as in a biological sample, including serum or plasma or other clinical specimens, using a conventional immunoassay. These include enzyme linked immunosorbent assays (ELISA), radioimmunoassay (RIA) or tissue immunohistochemistry. The invention provides a method for detecting hTNFa in a biological sample comprising contacting a biological sample with an antibody, or antibody portion, of the invention and detecting either the antibody (or antibody portion) bound to hTNFa or unbound SCA and/or SCA-polymer conjugates, to thereby 38 detect hTNFa in the biological sample. The SCA is directly or indirectly labeled with a detectable substance to facilitate detection of tire bound or unbound antibody. Suitable detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, |3-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoeiythiin; an example of a luminescent material includes luminol; and examples of suitable radioactive material include 125I, 131*, 35S or 3H. In an optional embodiment, the inventive SCAs are not labelled, but hTNFa is assayed in biological fluids by a competition immunoassay whwein rhTNFa standards are labeled with a detectable substance, and an unlabeled anti-hTNFa! SCA and/or SCA-polymer conjugate. In this assay, the biological sample, the labeled rhTNFa standards and the anti-hTNFa SCA and/or SCA-polymer conjugate are combined and the amount of labeled rhTNFa standard bound to the unlabeled SCA and/or SCA-polymer conjugate is determined. The amount of hTNFa in the biological sample is inversely proportional to the amount of labeled rhTNFa standard bound to the anti-hTNFa SCA and/or SCA-polymer conjugate. U.S. Patent Nos. 6,25S,562 and 6,090,382 indicate that tire D2E7 MAb can also be used to detect TNFas from species other than humans, in particular TNFas from primates (e.g., chimpanzee, baboon, mannoset, cynomolgus and rhesus), pig and mouse, it is contemplated that the anti-TNFa SCA and/or SCA-polymer conjugates of the invention are readily employed for that purpose, as well. EXAMPLES The following examples serve to provide further appreciation of the invention but are not meant in any way to restrict the effective scope of tire invention. 39 EXAMPLE 1 DESIGN OF SCA PROTEINS WITH AT LEAST ONE FREE THIOL. Nine SCA polypeptides were designed based on the variable domains of the D2E7 MAb. The use of me term, "D2E7 SCA" herein refers to any of the SCA produced with the D2E7 variable domains as exemplified herein, unless otherwise indicated. Each was constructed as follows. As noted supra a wholly synthetic gene was constructed by polymerase chain reaction (PCR) using 14 long overlapping synthetic oligonucleotides, ranging from 20 bases to 102 bases in length, ). Oligonucleotide-directed mutagenesis was further employed to construct other variants of the original sequence. The expressed SCA proteins contain the complete variable light (VH and variable heavy (VH) segments of the D2E7 MAb, connected by a peptide linker. Two linkers were employed. Linker "21S" is an eighteen amino acid residue 218-linker described by Filpula et al, 1996 ("Antibody Eneineering: A Practical Approach., Oxford University Press, pp 253-268). The "(GGGGS)3 linker" (SEQ ID NO: 42) is a 15 amino acid residue linlcer described by Huston JS et al, 1988, Proc Natl Acad Sci (USA) 85: 5879-5883. In some cases, as noted by Table 1, supra, a six-histidine tag (his6) (SEQ ID NO: 43) at the C-terminus was included to simplify purification via metal immobilized metal ion- affinity chromatography ("IMAC"). The completed genes were cloned into an E. coli plasmid for DNA sequence confirmation on an ABI PRISM® 310 Genetic Analyzer from Applied Biosystems (Foster City, California) (formerly produced by ABI/Perkin-Elmer). The domain orientations, linkers, and placement of the free cysteine in each respective SCA modeled on the D2E7 MAb, are summarized in Table 1, supra 'clone numbers 2-7-SC-l through -9). The nucleic acid chains expressing each of clone numbers 2-7-SC-l through -9 were prepared as follows. 40 Method of Cloning and Expression of D2E7 SCA The Synthetic VL-VH version of D2E7 SCA gene was constructed by two rounds of PCR using six overlapping oligonucleotides as templates for the VL chain and six overlapping oligonucleotides as templates for VH chain. The VL chain and V^ chain of D2E7 SCA gene were linked with a 21S linker. The C-terminus of the encoded protein was followed by 6 tandem histidines for IMAC purification purposes. Six oligonucleotides from 5' to 3' end for VL were designed as follows: VL1: GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGGG AC(SEQIDNO: 19) VL2:GCATCTGTAGGGGACAGAGTCACCATCACTTGTCGGGCAAGTCAG GGCATCAGAAATTACTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCC CCT(S2QIDNO:20) VL3: CCCTGATTGCAAAGTGGATGCAGCATAGATCAGGAGCTTAGGGGCTTT CCCTGG (SEQ ID NO: 45) VL4:TCCACTTTGCAATCAGGGGTCCCATCTCGGTTCAGTGGCAGTGGAT' CTGGGACAGATTTC (SEQ ID NO: 21) VL5:TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTACAGCCTGAAG ATGTTGCAACTTATTACTGTCAAAGGTATAACCGTGCACCGTATACTTT TGGCCAG (SEQ ID NO: 22) VL6:ACCACTCCCGGGTTTGCCGCTACCACTAGTAGAGCCTTTGATTTCC ACCTTGGTCCCCTGGCCAAAAGTATA (SEQ ID NO: 23). Among them, VL1, 2, 4 and 5 were forward (sense) oligonucleotides, and VL3 and 6 were reverse oligonucleotides. Six oligonucleotides from 5' to 3' end for VH were designed as follows: VH1 :GGCAAACCCGGGAGTGGTGAAGGTAGCACTAAAGGTGAGGTGCA GCTGGTGGAGTCTGGGGGA (SEQ ID NO: 24). 41 VH2:GTGGAGTCTGGGGGAGGCTTGGTACAGCCCGGCAGGTCCCTGAGA CTCTCCTGTGCGGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTG GGTCCGG (SEQ ID NO: 25) VH3:CCAAGTGATAGCTGAGACCCATTCCAGGCCCTTCCCTGGAGCTTGC CGGACCCAGTGCAT (SEQ ID NO: 26) VH4:TCAGCTATCACT"GGAATAGTGGTCACATAGACTATGCGGACTCTG TGGAGGGCCGATTC (SEQ ID NO: 27) VH5:GTGGAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCC CTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGATACGGCCGTATAT TACTGTGCG (SEQ ID NO: 28) VH6:AGACGAGACGGTGACCAGGGTACCTTGGCCCCAATAGTCAAGGGA GGAGGCGGTGCTAAGGTACGAGACTTTCGCACAGTAATATAC (SEQ ID NO: 29) Among them, VH1, 2, 4 and 5 were forward oligonucleotides and VH3 and 6 were reverse oligonucleotides. All oligonucleotide designed for the synthetic VL and VH of D2E7 SCA were synthesized by MWG Biotech, Inc. The VL of the D2E7 SCA gene was assembled in a first round PCR, using 2mM Tris (pH8.4), 5mM KC1, 7.5raM MgCl2, 1.5mM dNTP, 2 units of Platinum Tag polymerase (Invitrogen), oligonucleotides VL 1, 2, 3, 4, 5 and 6 (lpmol each) ' as templates, 5' TGGCGAGCTCTGACATCCAGATGACCCAGTCT (SEQ ID NO: 30) (50pmol) as forward primer and 5'ACCACTCCCGGGTTTGCCGCTACCACTAGTAGA (SEQ ID NO: 31) (50pmol) as reverse primer. The PCR was performed for 30 cycles of 94°C for 30 seconds, 56°C for 30 seconds and 72°C for 60 seconds, followed by 72°C for 10 minutes. The VH of the D2E7 SCA gene was assembled in a first round PCR, using 2mM Tris (pH8.4), 5mM KC1, 7.5mM MgCl2, 1.5mM dNTP, 2 units of Platinum Tag polymerase (Invitrogen), oligonucleotides VH1,2, 3, 4, 5 and 6 (lpmol each) as templates, 5' GGCAAACCCGGGAGTGGTGA (SEQ ID NO: 32) (50pmol) as forward primer and 42 5'GCCACTCGAGCTATTAGTGATGGTGATGGTGGTGAGACGAGACGGTG ACCAG (SEQ ID NO: 33) as reverse primer (50pmol). The PCR was performed for 30 cycles of 94°C for 3.0 seconds, 56°C for 30 seconds and 72°C for 60 seconds, followed by 72°C for 10 minutes. Genetic construction of the variant D2E7 SCA genes encoding the variant SCA proteins of Table 1 was accomplished by site directed mutagenesis. For example, 2-7-SC-5 is a mutant of D2E7 SCA (2-7-SC-l) with an amino acid change from serine to cysteine at the residue 109 in the 218 linker. This gene was created by two rounds of PCR using 2-7-SC-l DNA as a template and four oligonucleotides as primers. The primers for construction of clone 2-7-SC-8 were designed as follows: Forward primer 1: CTCGAATTCACCATGAGATTTCCTTC (SEQ ID NO: 37) Forward primer 2: AAGGTGGAAATCAAAGGCTGTACTAGTGGTAGCGGCAAACCC (SEQ ID NO: 38) Reverse primer 1: GGGTTTGCCGCTACCACTAGTACAGCCTTTGATTTCCACCTT (SEQ LD NO: 39) Reverse primer 2: CGAGAATTCTCATTAATTGCGC AGGTAGCC (SEQ LD NO: 40) Two fragments were amplified separately in the first round of PCR by two primer combinations (forward primer 1 and reverse primer 1, and forward primer 2 and reverse primer 2, SOpmol each), using 2mM Tris (pH8.4), 5mM KC1, 7.5mM MgCl2, 1.5mM dNTP, 2 units of Platinum Tag polymerase (Invitrogen), and 2-7-SC-8 DNA (10µg) as template. Tire D2E7 SCA gene variant for 2-7-SC-8 was completed by hybrid extension in the second round of PCR, using forward primer 1 and reverse primer 2 (50pmol each), 2mM Tris (pH8.4), 5mM KC1, 7.5mM MgCh, 1.5mM dNTP, 2 units of Platinum Tag polymerase (Invitrogen), and the two fragments (10µg each) from the first round of PCR as templates, The complete PCR product of the 2-7-SC-S SCA gene, with cysteine at the 43 residue 109, was cloned into vector pHilD2 and used to transform Pichia GS115 strain, as described below. The remaining genes of Table 1 were generated by similar site directed mutagenesis steps. For the 2-7-SC-2 gene (SEQ ID NO:2), the PCR reverse oligonucleotide primer encoded the cysteine codon TGC after the six C-terminal histidine codons. For the 2-7-SC-3 gene (SEQ ID NO:3), the PCR reverse oligonucleotide primer encoded the cysteine codon TGC after the six C-terminal histidine codons. For the 2-7-SC-4 gene (SEQ ID NO:4), the PCR reverse oligonucleotide primer encoded the cysteine codon TGC directly after the C-terminal VH serine codon. For the 2-7-SC-6 gene (SEQ ID NO:6), the central oligonucleotide primer encoded the cysteine codon TGC at position 2 of the 218 linker, and the C-terminal reverse primer encoded the cysteine codon TGC after the six C-terminal histidine codons. For the 2-7-SC-7 gene (SEQ ID NO:'/), the central oligonucleotide primer encoded the cysteine codon TGC at nucleotides 376- 378 (FIG. 1G), corresponding to residue position 5 of the (GGGGS)3 linker (SEQ ED NO: 42). For the 2-7-SC-8 gene (SEQ ID NO: 8), tire PCR forward oligonucleotide primer encoded the cysteine codon TGC before the N-terminal VL amino acid Asp, and the PCR reverse oligonucleotide primer encoded the cysteine codon TGC after the six C-terminal histidine codons. For the 2-7-SC-9 gene (SEQ ID NO:9), a 5 -codon linker encoding GGGGS (SEQ LD NO: 44) replaced the IS codon 218-linker. For assembling the complete D2E7SCA gene and expression of D2E7SCA in Pichia, a signal sequence was added at tire 5' end of D2E7SCA gene in a second round of PCR, using 2mM Tris (pHS.4), 5mM KCl, 7.5mM MgCl2, 1.5mM dNTP, 2 units of Platinum Tag polymerase (Invitrogen), first round of PCR products of VL and VH of D2E7SCA gene (lng each) as templates, 5'CCTCGGAATTCACCATGAGATTTCCTTCAATTTTTACTGCTGrrTTATT CGCAGCATCCTCCGCATTAGCTGCTGACATCCAGATGACCCAG (SEQ ID NO: 34) (50pmol) as forward primer and 5'CGCGGAATTCTATTAGTGATGGAGATGGAGGAGAGACGAGACGGTG 44 ACCAG (SEQ ID NO: 35) (50 pmoi) as reverse primer. The PCR was performed for 30 cycles of94°C for 30 seconds, 56°C for 30 seconds and 72°C for 60 seconds, followed by 72°C for 10 minutes. The gene product of tire second round of PCR-assembled D2E7 SCA with 5' end signal sequence was purified by 1% agarose gel, digested by EcoRl at 37°C for 60 minutes and ligated at EcoRl site of vector pHilD2 (Invitrogen) using T4 DNA ligase at 12°C for 60 minutes. lOOul of DH5oc competent cells (Invitrogen) were transformed by the ligation reaction product and incubated on ice for 30 minutes and at 42°C for 45 seconds, then lml of S.O.C media was added and incubated at 37°C for 50 minutes with shaking at 250 rpm. 0.1ml of the transformation mixture was spread onto LB Ampicillin (lOmg/L) plates and incubated at 37°C for 16 hours. Several pHilD2-D2E7SCA plasmid-transformed DH5a clones on the LB Ampicillin (10mg/L) plates were grown in 2ml of LB media at 37°C for 16 hours. The plasmid mini-preparations of D2E7SCA from each clone were prepared. DNA sequence of pHilD2-D2E7SCA plasmid was confirmed using Big Dye terminator cycle DNA sequencing kit (Applied Biosystem) by ABI Prism 310 Genetic Analyzer. Each of the variant SCA clones listed in Table 1 was generated by the following procedures. For Pichia transformation, pHilD2-D2E7SCA plasmid was digested with Sail at 37°C for 60 minutes and re-suspended in lOu.1 distilled water after phenol extraction and ethanol precipitation. Pichia GS115 cells were grown in 50ml of YPD media at 30°C for 16 hours with shalcing at 250 rpm (OD600=1.2), washed in ice-cold distilled water three times and in 1M Sorbitol one time, and finally re-suspended in 0.1ml of 1M sorbitol. The prepared Pichia GS115 cells were mixed with Sail-digested 10|j.g of pHilD2-D2E7SCA plasmid in an ice-cold 0.1cm electorporation cuvette and pulsed under the conditions of 800V, 10uF and 129 by electro cell manipulator (BIX). After pulsing, l ml of ice-cold 1M sorbitol was added into the electroporation cuvette. 45 WO 20(14/096989 PCT/US2004/0J2458 The whole content was transferred into a 15ml tube and incubated at 30°C for 1 hour. 0.2ml of the transformation mixture was spread onto RDB media plates and incubated at 30°C for four days. Several pHilD2-D2E7SCA plasmid-transformed Pichia clones from RDB plates were inoculated into 25ml of BMGY media in 500ml flasks and incubated at 30°C with shaking at 250 rpm for two days. The cells were harvested by centrifugation at 3,000 rpm at room temperature, re-suspended into 5m] of BMMY of media in 50ml flasks to induce expression and incubated at 30°C with shaking for another two days. l ml sample from each culture was transferred into micro-centrifuge tubes and centrifuged at 14,000 rpm for 2 minute at room temperature. 40pi sample from supernatant of each culture was analyzed by Coomassie Blue-stained SDS-PAGE and Western blot. EXAMPLE 2 RECOMBINANT EXPRESSION AND PURIFICATION OF SCA PROTEINS. The SCA proteins described in Example 1 (Clone numbers 2-7-SC-l through -9). were all produced by expression and secretion from the yeast Pichia pastoris. The secretion signal sequence from the yeast alpha mating factor was inserted directly in front of the mature coding sequence for each of these SCA proteins. The amino acid sequence of this signal peptide is Met Arg Phe Pro Ser He Phe Thr Ala Val Leu Phe Ala Ala Ser Ser Ala Leu Ala A Ala (SEQ ID NO: 36) 25 where the A indicates the cleavage site. We also included this 20th amino acid of the signal (the alanine after the A) in our constructions. Therefore, the amino terminus of each respective mature SCA protein contains this alanine followed by the complete amino acid sequences recorded in FIGS 1 A-IF. N-terminal protein sequence analysis confirmed these correctly processed sequences. These mutant 30 SCA genes were individually ligated at the EcoRI site into the Pichia transfer plasmid pHIL-D2 (Invitrogen Corp.) and transformed into the yeast Pichia pastoris host GS-115. Detailed protocols for these procedures are presented in the Pichia 46 Expression Kit Instruction Manual Cat. No. XI710-01 (1994) from Invitrogen Corporation, incorporated by reference herein. Initial evaluation of expression was done by Coomassie Blue staining of SDS-PAGE gels. Pichia Fermentation of D2E7 SCA clones All expression clones of anti-TNFa SCA D2E7, including clones 2-7-SC-2, 2-7-SC-3,2-7-SC-4, 2-7-SC-5 and 2-7-SC-7, were generated in Pichia pastoris, a methylotrophic yeast, and proteins were secreted into growth medium. The high density fermentation of D2E7 SCA variants were performed in BMGY medium, the basal medium supplemented with YNB and Biotin (see Medium Composition) using automatic feed control fermenters (Models: BioFlow 3000 and BioFlow IV; New Brunswick Scientific, Co, Edison, NJ, USA). in BMGY for 16-20 h, (c) growth phase in glycerol (50%) for 4 h, and (d) induction of D2E7 variants with methanol for 45 h. Feeding of each component was optimized with respect to dissolved oxygen level which Avas set at 30%. The growth temperature was set at 29°C and pH was maintained at 6.0 using ammonium hydroxide and phosphoric acid during the run. Different parameters monitored over a 68 h fermentation period where OD600 values of the growing culture reached from 0.5 to 125 at the end of phase (b), from 125 to 200 at the end , of glycerol-feeding phase (phase c) and finally, from 200 to 300 at the end of induction phase (phase d). On an average, the expression of D2E7 variants in the fermentation supematants was between 50 and 100 mg/L. 2-7-SC-2 , the VL-VH variant with a free cysteine engineered at the carboxyl terminal followed by a histidine tail, was found to be the most robust clone that performed well with excellent reproducibility during fermentation. Description of supplies BMGY (per L) Yeast Extract: Peptone: Glycerol: 47 Phosphate Buffer; (!M,pH6.0) YNB: Biotin: FMT30 (Breox): Inducer Methanol Oxygen Compressed oxygen The SCA proteins of Example 1 were purified from Pichia pastoris supematants to greater than 95% purity by simple two or three column chromatography protocols. Purification of Proteins from Clones 2-7-SC-2, 2-7-SC-3, 2-7-SC-5, 2-7-SC-7 D2E7 SCAs with Histidine tag The D2E7 variants, 2-7-SC-2, SCA2-7-SC-3, SCA2-7-SC-4, SCA2-7-SC-5, and 2-7-SC-7 were purified from fermentation supernatant using a combination of ion-exchange and affinity column chromatography. The supernatant was diafiltered extensively to concentrate the sample while exchanging the spent medium with Buffer C containing Tris, 20 mM at pH 7.4 and 50 mM NaCl. The buffer exchanged sample was men subjected to DEAE column chromatography (Cat# 17-0709-01; Amersham BioSciences, Piscataway, NX). D2E7 SCAs did not bind to DEAE column under the specified conditions. The flow through from the DEAE column was dialyzed against buffer A containing Tris, 50 mM at pH 8.0 and 0.3 M NaCl and applied to Ni-NTA resin (Qiagen, Inc., Valencia, CA) previously equilibrated with the same buffer. Non-specific binding was disrupted using a stringent wash with buffer B containing 10% glycerol in buffer A followed by the removal of glycerol by buffer A. Further low-affinity interactions were washed-off by passing 3 column volumes of 60-100mM imidazole (100 mM only for 2-7-SC-2). Finally, the bound SCA was eluted from the Ni-NTA column with 3-5 column volume of 250 mM imidazole. For both washing and elation, imidazole was prepared in buffer A. The peak fractions were pooled and dialyzed extensively against buffer C, 48 the DEAE-buffer. The dialyzed sample was clarified by high speed centrifugation and passed through DEAE column as the final step of purification. Protein concentration of the purified sample was then determined by UV2so and by BCA method before storing at -20°C for future use. Purification of Proteins 2-7-SC-4 D2E7 SCA without Histidine tag Protein L strongly binds :o VL domains of many different species. The binding is extremely species specific, and also sub-type specific. The VL domain of 2-7-SC-4 could be recognized by protein L and taking advantage of this specificity of interaction, we purified 2-7-SC-4 in single step, directly from the diafiltered samples. Low pH elution of 2-7-SC-4 from protein L column (Cat# CLBL 201-5, CBD Teclmologies Ltd, Buffalo, NY) did not affect the structural or functional integrity of the SCA. In brief, fermentation supernatant was diafiltered and exchanged with PBS for loading the sample onto the column. Non-specifically bound proteins were washed away .with a large volume of PBS after loading. The SCA protein was eluted from the column with Glycine buffer (10 mM) at pH 2.0 and collected immediately on 3M Tris to neutralize the solution. Fractions were analyzed on SDS-PAGE, positive fractions were pooled together and dialyzed against PBS. The SCA protein was clarified by high speed centrifugation after dialysis, protein concentration was determined and stored at -20°C for future use. Alternate, less preferred methods, like HS (POROS 50 HS, code: 1-3359-07; Applied BioSciences, Foster City, CA) or Q-sepharose FF (cat# 17-0510-01, Amersham BioSciences, Piscataway, NJ) were also used effectively in SCA purification. The following table shows purification of 2-7-SC-2 D2E7 variants by various columns, percentage yields after each step of purification and quality of purification for each variant. 49 TABLE 3 2- 7-SC-2 (VL-VH, 218-LINKER, C-CYS, HIS-TAG) Sample Concentration of SCA (mg/ml) Total SCA (mg) Yield (%) Fermentation Supernatant 0.07 250 100 Diafiltered Sample 0.38 230 92 DEAE-Flow Through 0.13 210 84 Ni-Column-Purified 5.0 200 80 DEAE-Purified 2.13 190 76 Buffer Exchanged 2.7 186 74 FIGs. 2 A and 2B presents representative SDS PAGE analysis of samples from each purification step of 2-7-SC-2 SCA protein. The gel was stained with Coomassie Blue. Purity of the final sample was estimated at 95% from gel densitometry scanning. A small amount of 54 kDa disulfide-linked dimer was visible in the stained gel. EXAMPLE 3 STABILITY AND REACTIVITY OF MALEIMIDE DEPIVATTVES OF POLYETHYLENE GLYCOL Maleimide Reactivity With Amino Acid Residues Confirmation of the specific reactivity of the maleimide polymers with free cysteine, but not with lysine or histidine, was accomplished by reaction of these compounds with these respective free amino acids. As shown in FIGs 4A-4C, cysteine, but not histidine or lysine (not shown), is highly reactive with the PEG-maleimides under the standard reaction conditions employed. Analysis and Stability of Active Maleimide Group Functional group analysis was conducted in two steps, as follows. 50 reaction of MAL-PEG with cysteine and determination of remaining nnreacted cysteine after the reaction by titration with 5,5'-dithio-£is(2-nitrobenzoic acid) ("DTNB"). Determination of active MAL-PEG was conducted at a reaction molar ratio of 1:3 (MAL-PEG:Cysteine) in 50 mM sodium phosphate, pH 6 and 1 mM EDTA. The reaction was conducted as follows. A 1/40 volume of cysteine in H2O was added to a 1 mM PEG solution to a final concentration of 3 mM. The mixture was incubated at 25 °C in the dark for 10 min, followed by DTNB titration. In DTNB titration, a 1/50 volume of the reaction mixture containing the cysteine and Cys-MAL-PEG mixture was added to 0.2-0.3 mM DTNB in 100 mM sodium phosphate, pH 7.3 and 1 mM EDTA,. The final concentration of remaining cysteine was between 0.04-0.06 mM. Absorbance at 412 ran was recorded after 5 min of equilibrium at 25 °C using 13,300 M" .cm" as an extinction coefficient of DTNB. The reaction of MAL-PEG with Beta-mercaptoethylamine was also investigated. This reaction is not quantitative because beta-mercaptoethylamine is air-sensitive and hygroscopic. The stability of MAL-PEG was monitored by a UV scan between 240 and 400 nm. MAL-PEG had a maximum absorbance at 300 nm. The peak disappeared after reacting with cysteine or hydrolyzmg in the presence of 0.1 N NaOH at 37 °C for 2 hrs. Stability of MAL-PEG The stability of MAL-PEG is dependent on pH, temperature, and incubation time. It was considered stable if there was less man 10% decrease in absorbance at 300 nm. 1 mM MAL-PEG is stable at 4 °C for at least 24 hrs in all buffers tested (pH 5, pH 6, and pH 7 phosphate buffers). At 25 °C and pH 5.0, MAL-PEG is stable for 33 hours. Therefore, the preferred PEGylation conditions are pH 5 or pH 6, 25 °C for 2 hrs; or 4 °C for 24 hrs; or pH 5,25 °C for 24 hours. 51 Specificity of Mal-PEG Reaction with Cysteine The reaction with Cysteine was completed in less than 2 min regardless of reaction pH (5, 6, or 7) and temperature (4 °C or 25 °C). The reaction with lysine (Lys:MAL-PEG = 15:1) was not observed in pH 5 and pH 6 buffers during 24 Ins incubation at 4 °C or 25 °C. However, at pH 7, 25 °C, greater than 10% MAL-PEG reacted with lysine during 24 hours of incubation. There was no reaction with histidine at a molar ratio of 15:1 (Histidine:MAL-PEG) pH 5, 6, and 7 during 24 hours incubation at 4 °C or 25 °C. EXAMPLE 4 PEGYLATION OF SCA PROTEINS 4A. Materials and Methods HiPrep® 26/10 and G-25 PD-10 desalting columns (Pharmacia Biotech, 17-1408-01, New Jersey) and Poros 50 Micron HS media (Applied Biosystems) were used. mPEG-maleimide compounds were purchased from Nektar Therapeutics (San Carlos, California; fonnerly Shearwater Corp.) or synthesized at Enzon Pharmaceuticals, Inc. PEG-MAL polymers employed in this study included the 40 kDa branched PEG2,20 kDa linear PEG, 5 kDa linear PEG, 20 kDa bis-MAL bifunctional PEG, -and 40 kDa branched U-PEG. N-ethylmaleimide and 6-(Biotinamidocaproylamido) caproic acid N-Hydroxysuccinimide ester were purchased from Sigma. rProtein A Sepharose Fast Flow was obtained from Amersham Biosciences Corp. (Piscataway, New Jersey). Ultralink Iodoacetyl® was obtained from Pierce Biotechnology, Inc (Rockford, Illinois). DMSO, (Minneapolis, Minnissota). Streptavidin-Phycoerytlirin was obtained from BD Sciences (San Jose, California). The 96 well microtiter plates were purchased from Midwest Scientific (St. Louis, Missouri). Streptavidin-peroxidase was from Sigma and TMB peroxidase substrate was from Moss, Inc. (Pasadena, Maryland). TNFa was purchased from Cheniicon (Temecula, California). Titrisol® iodine solution was obtained from EM Science 52 (Gibbstown, New Jersey) 4B. Reduction of D2E7 SCAs The free cysteine residue at the C-terminus or linker of the SCAs isolated by Example 3 was reduced before reaction with MAL-PEG. The reduction solution contained 3 mg/ml D2E7 SCA, 2 mM dithiotlireitol (DTT), 2 mM EDTA, and 100 mM sodium phosphate, pH 7.8. The reduction was conducted at 37 °C for 2 hrs. Free DTT was removed on HiPrep® desalting column for 15-ml samples, or PD-10 for a 4-ml sample. The column was equilibrated with 100 mM sodium phosphate pH 6.0, 2 mM EDTA. The recovery of D2E7 SCA after reduction and desalting was 85%. Other reductants, including beta-mercaptoethylamine and beta-mercaptoethanol, were also successfully used hi modified procedures. Sulfhydryl group quantitation was performed as described by Grassetti DR et al, 1967, Archives Biochem Biophvs 119: 41-49, and Riddles PW et al, 1979, Anal Biochem 94: 75-81, incorporated by i-eference herein. Near quantitative reduction of one thiol per SCA was achieved. 4C. PEGylation and Purification of SCA Methods The SCA proteins isolated by Example 3 were PEGylated through cysteine-' specific reactions with PEG maleimide compounds. 2-7-SC-2 and 2-7-SC-5 were chosen for extensive studies of PEG-SCA characterization. For these SCA proteins, maleimide-PEG conjugates with 5 kDa, 20 kDa, 40 kDa (branched) and bis-maleimide compounds were examined. Reaction of the SCA proteins withN-ethylmalemide provided a control conjugation reaction which blocks the free thiol but adds minimal molecular mass. Other D2E7 SCA proteins were modified with selected PEG-maleimide polymers as listed hi the section on BIAcore analysis. The reaction buffer contained 1 mg/ml reduced SCA, 100 mM sodium phosphate pH 6.0, 2 mM EDTA, and PEG maleimide compound at a reaction molar ratio of 10:1 (PEG:D2E7). The reaction was conducted at 25 °C under Nitrogen for 2 hrs. 53 The typical yield of the conjugation analyzed on SDS-PAGE was 80%. Ai HS column was used for purification of PEG-SCA from native SCA, high moiecular weight impurities, free PEG, side reaction products, and endotoxin. In less preferred methods, S and SP columns were also successfully utilized. The column equilibration buffer contained 10 mM sodium phosphate, pH 5.0, and elution buffer was made of 1 M NaCI in 10 mM sodium phosphate, pH 5.0. Free PEG was in the flow through. PEG-D2E7 SCA conjugates were eluted sequentially with conjugates with higher numbers of attached PEG elunting first, followed by conjugates with a single polymer attached, and finally, native D2E7 SCA. PEG-D2E7 conjugates of different sizes were therefore eluted at different concentrations of NaCl. 4D. Reduction of D2E7 SCA - Results Summary D2E7 SCA produced in Pichiapastoris and purified as described has to be reduced prior to a reaction with MAL-PEG. DTT at the concentrations from 0.5 mM to 50 mM was tested. It was shown that 0.5 mM was sufficient to reduce monomer to diner. DTT at a concentration higher than 10 mM generated some precipitate. The higher the concentration of DTT used, the higher amount of D2E7 SCA precipitated. The^ precipitate might be denatured D2E7 SCA. 2-mM DTT was chosen for standard PEGylarion protocols. Beta-mercaptoethyJamine, glutathione, and cysteine from 2 mM to 10 mM were also investigated. It was shown that a concentration higher than 10 mM was required to reduce the dimer to monomer. DTT at 0.5 mM was as efficient, as the other reducing reagents at 10 mM, in reduction of the 2-7-SC-2 dimer to monomer. The yields of conjugates after reduction were about S0% of the starting reduced SCA protein. 54 4E. PEGylation - Results Summary The reaction ratios ranging from 1:1 to 10:1 (MAL-PEG;D2E7 SCA) were investigated for PEGylation yield at pH 6.0. A ratio of 1:4 was the minimum required to give a high yield of the conjugate. Reaction times from 10 min to 24 hrs at 25 °C, and 1S his at 4 °C were studied. It was shown that the reaction was completed in 10 min at 25 °C (the shortest time tested). A high concentration of protein (e.g., >1 mg/ml) is not desirable for a reaction of the free cysteine residue of D2E7 SCA with MAL-PEG since yields are reduced. This contrasts with the optimal approach for a non-specific multi-PEGylation. Protein concentrations of 0.5, 1.5, 2.0, 2.5, and 3 mg/ml were tested. D2E7 SCA protein of 0.2-1 mg/ml was used as the preferred concentration for constructing the conjugates. The reaction pH from 5-8 was investigated. For PEGylation, pH 6.0 was used. Unconjugated D2E7 SCA could be recycled for re-conjugation. The yield from the second conjugation reaction was similar to that obtained for the imtial D2E7 SCA PEGylation. The best conjugation yield was 85%. Overall, the results demonstrate that monoPEGylated SCA proteins may be generated in good yield via robust conjugation methods using the designed single free-thiol variant SCA proteins. 4F. Purification Results Summary Ultrafiltration with polyethersulfone membranes cannot be used for concentration and changing buffers of the 2-7-SC-2 SCA protein and its conjugates, since most of the protein was lost to the membrane. There was 100% recovery of the protein on Millipore regenerated cellulose membranes such as Centriplus, Centricon, and Amicon There was 10% loss of the protein on a 0.2-µm low protein binding sterile filter. The total yield after two steps of purification, two steps of concentration, and one step of filtration was 30-40%. 55 The purified PEG-SCA proteins were subjected to SDS PAGE analysis and visualized with Coomassie Blue stain (data not shown). The analysis indicated that trace amounts (-1%) of unreacted SCA protein remained in the purified 40 kDa MAL-PEG and 20 kDa MAL-PEG reactions. Iodine stain of SDS PAGE gel, which highlights the polyethylene glycol containing compounds, also revealed trace amounts ( The 40 kDa MAL-PEG reactions sometimes also displayed a trace (~1%) of very high molecular weight PEG impurities. Polymers in the very high mass range were also detectable in the starting unreacted 40 kDa MAL-PEG polymers. N-ethylmaleimide reduction totally blocks the formation of dimers in the SCA proteins having a single free cysteine. 4G. Removal of Endotoxin by Ion Exchange Chromatography Endotoxin present in protein samples was removed by DEAE or HS columns. At pH 7-8, endotoxin was bound to a DEAE column while the D2E7 SCA was present in the flow through fraction, whereas at pH 5.0, endotoxin was present in the flow through fraction and D2E7 SCA was bound to HS column. An HS column was used to remove endotoxin from D2E7 SCA protein. The column equilibration buffer contained 10 mM sodium phosphate, pH 5.0 and elution buffer contained 1 M NaCl and 10 mM sodium phosphate, pH 5.0. Typical endotoxin values in the purified samples were below 1 EU/ml. EXAMPLE 5 ANALYTICAL CHARACTERIZATION OF SCA AND PEG-SCA. 5A. Determination of Protein Concentration Protein concentrations were determined by UV at 280 ran. The extinction coefficient of the SCAs obtained in Example 3 were 1.24 ml/mg.cm. The concentration was also confirmed by the bicinchoninic acid assay ("BCA"), obtained as a Micro BCA Protein Assay Reagent kit from Pierce Biotechnology, Inc (Rockford, Illinois) using lysozynie or a Fab as standards. The BCA assay was 56 conducted as recommended by the manufacturer and essentially according to the method of Smith, P.K., et al. 1985, Anal. Biochem. 150, 76-S5, incorporated by reference herein. Protein Concentration Determination Results UV at 280 nm (dz ta not shown) and BCA, as discussed supra, using lysozyme and a human Fab as standards, gave similar results in protein concentration determinations. For the BCA analysis, EDTA should be removed along with DTT after reduction, since these reagents interfere with the assay. All samples for animal studies were analyzed for protein content by UV and confirmed by BCA using lysozyrne as a standard. 5B. Anti-D2E7 SCA Polyclonal Antibody and Biotinylated Anti-D2E7 SCA Antibody Purification qfAntiD2E7SCA Antibody. Anti-2-7-SC-l SCA antibodies were raised in rabbits and purified by Protein A chromatography and D2E7 SCA-conjugated affinity column chromatography. For a Protein A column purification, the antibody was diluted with two volumes of Tris buffer to make a final concentration of 0.1 M Tris-HCl, pH 8.0, 0.02% NaN3. The diluted samples were loaded on a 2-ml Protein A Sepharose column which was equilibrated witii 0.1 M Tris-HCl, pH 8.0, 0.02% NaN3 at an equal volume of antiserum to protein A resin. Anti-2-7-SC-2 SCA was eluted out with 50 mM glycine, pH 3.0 to a 1/10 volume of 1 M Tris-HCl, pH 8.0. The antibody concentration was determined at 280 nm using an extinction coefficient of 0.8 ml/mg.cm. A D2E7 SCA-conjugated affinity column was prepared by a coupling reaction of Ultralinlc lodoacetyl with the free cysteine residue of 2-7-SC-2 SCA protein. Specifically, ~ 7 ml of Ultralink lodoacetyl resin rinsed with 2 volumes of 50 mM phosphate, 5 mM EDTA, pH 7.8, were mixed with ~ 6.5 ml of 1.45 mg/ml 2-7-SC-2 SCA at 25 °C for 15 min. The coupling reaction was monitored by measuring absorbance of the supernatant at 57 2S0 nm. The protein concentration in the supernatant was decreased by 80%. The resin was washed with 3 volumes of 50 mM phosphate, pH 7.8,5 mM EDTA and then treated with 50 mM cysteine for 40 min. The sample was then transferred to the column and washed with 1 M NaCl, 50 mM glycine, pH 3.0, and then with PBS. The anti-2-7-SC-2 SCA antibody purified from the Protein A column was passed through the D2E7 SCA-conjugated column which was equilibrated with standard PBS. The column was chased to baseline with PBS and the antibody was eluted out with 50 mM glycine, pH 3.0 to a 1/10 volume of 1 M Tris-HCl, pH 8.0. Biotinylated Anti-D2E7 SCA Antibody. Glycine and Tris components in the samples were removed by a PD-10 desalting column, which was equilibrated with 50 mM phosphate, pH 7.6, 100 mM NaCl. To the antibody solution was added 1/10 volume of activated Biofiii in DMSO at a reaction molar ratio of 40:1 (biotin:antibody). After 1 hr at 25 °C, the biotinylated antibody was purified on a PD-10 desalting column which was equilibrated with PBS (10 mM sodium phosphate, 138 mM NaCl, 2.7 mM KCl, pH 7.4). 5C. Western Blot Anti D2E7 SCA rabbit antiserum was used as a primary antibody and goat anti rabbit HRP was used as a secondary antibody. Binding was measured with a TMBM peroxidase substrate. Rabbit antiserum was also previously prepared from against the synthetic 18 residue 218-linker peptide. Reactivity with SCA proteins containing this linker was also established. Western Blot Results All bands shown on the gels from purified preparations were Western Blot positive. FIG. 7 shows an example of a Western analysis of D2E7 SCA and PEG-SCA compounds detected with anti-2-7-SC-l antiserum. The primary detection antibody was anti-2-7-SC-l SCA rabbit antiserum prepare from rabbits immunized with the purified recombinant SCA protein. Lane 1 and 7, molecular 58 weight markers (250,148, 98, 64, 50, 36,22, 16,6 and 4 kDa); lane 2,2-7-SC-2 SCA protein; lane 3, ethyl-2-7-SC-2; lane 4, PEG (5 lcDa)-2-7-SC-2 ; lane 5, PEG (20 kDa)-2-7-SC-2 ; lane 6, PEG (40 kDa)-2-7-SC-2 . It was not established what proportion of the 2-7-SC-2 SCA protein existed as monomer and dimer in the animal studies because of the low concentration in plasma. However, the slightly more rapid clearance of the 2-7-SC-2 protein modified with N-ethylmaleimide could suggest that some of the starting SCA protein was dimer and exhibited slower clearance due to a larger mass or avidity. 5D. Purity Analysis The dimer form is generated by cross linking of the free cysteine residues since the 2-7-SC-2 SCA modified with N-ethyl-maleimide did not show any dimer on a non-reducing SDS-PAGE. The purified PEG-SCA conjugates typically contained essentially no free PEG as detected by Iodine stain, less than 1% of unmodified SCA, and less man 1 % high molecular weight molecules as detected on SDS-PAGE. 5E. Iodine stain SDS PAGE gels were rinsed with dl^O and placed in 5% barium chloride solution. After 10 min of gentle mixing, the gel was rinsed with H2O and then placed in 0.1 M Titrisol® iodine solution for color development. 5F. Mass Determination The exact mass values of SCA and PEG- SCA conjugates were determined by matrix assisted laser desorption ionization mass spectrometry ("MALDI-TOF"; Bruker Daltronics OmniFIex NT) using an internal standard with similar molecular weight on the oc-cyano-4-hydroxy cinamic acid (CHCA) matrix. Apparent molecular weights (Stoke radius) of the SCA proteins were estimated using Superdex 200 HR 10/30 Gel Filtration column chromatography [Amersham Biosciences, by the method of the manufacturer] which was equilibrated in 50 mM 59 sodium phosphate, pH 6.5 and 150 mM NaCl,. Additionally, analysis of molecular masses on 4-20% SDS-PAGE gels was performed using appropriate protein and PEG-protein standards. The apparent molecular weight of the PEG-40k- SCA, as determined by size exclusion chromatography, was 670 kDa, or about 10-fold more than its molecular mass. Molecular Weight Determination Results for 2-7-SC-2 : The molecular weight determination results are shown in Table 4. TABLE 4 Compound MALDI-TOF SECxlO3 SDS-PAGE x 10J D2E7 SCA 27,394±295 20 30 Ethyl-D2E7 SCA 27,858 20 30 PEG-5k-D2E7 SCA 33,715 36 PEG-20k-D2E7 SCA 49,874 340 56 PEG-40k-D2E7 SCA 73,123 670 170 The correlation of PEG size over protein size on 4-20% SDS gel was Y = 0.00156X Other D2E7 SCA variants and PEG-SCA compounds displayed comparable mass values that conformed to their molecular weight and polymer size. 5G. N-terminal Sequencing and Peptide Mapping: N-terminal sequencing of 2-7-SC-2 and2-7-SC-5 confirmed the expected processing of signal sequence, such that the N-terminal amino acid of the secreted SCA proteins is alanine followed by the first residue of VL- Peptide Mapping on 2-7-SC-5 - 40 kDa PEG The protein (0.2 mg total) was denatured and reduced in 6 M Guanidine HC1 containing 1 rnM EDTA and 5 mM DTT. The solution was allowed to incubate at 37°C for 1 h. Alkylating agent, iodoacetamide, was added to the final concentration of 15 mM and the reaction was performed at room temperature for 1 h. After alkylation, the excessive iodoacetamide was inactivated by adding p- 60 mercaptoethanol to 45 rnM (final concentration) and the solution was subjected to PD10 desalting column. The alkylated PEG-2-7-SC-5 was concentrated with Centricom 10 and then hydrolyzed by TPCK-treated trypsin with errzyme to protein ratio of 1:20 (w/w). The hydrolysis was allowed for 6-8 h at 37°C and then added same amount of fresh trypsin for overnight reaction. The hydrolyzed protein solution was brought to dryness b> Speedvac and reconstituted in HPLC-grade water. The resultant peptide mixture was fractionated by HPLC size exclusion chromatography (Superdex 75) with HPLC-grade water. The factions were manually collected and analyzed by Tricine SDS-PAGE stained with iodine solution (20 mM in 5% BaCl). The positively stained fractions were further resolved by reversed-phase HPLC (Jupiter CI 8,2 x 250 mm) with the gradient of acetonitrile (containing 0.05% TFA) from 5-70% in 60 min. The peaks were collected manually and dried in Speedvac. The peaks were reconstituted with 10 pi water and 5 pi was taken for Tricine SDS-PAGE analysis. The positively iodine-stained fraction (only one, -40 min of retention time) was subjected to amino acid sequencer analysis (Applied Biosystems). The sequence obtained from the analysis was GO TSGSGKPG (SEQ ID NO: 41), where the blank square represents the modified amino acid, indicating that maleimide - PEG 40K is accurately attached to cysteine (position 110 from N-terminal Ala 1). 5H. Stability of D2E7 and PEG-D2E7 - Results D2E7 SCA and PEG-D2E7 SCA conjugates were shown to be stable after 10 cycles of freeze-thaw. Aliquots of native 2-7-SC-2 SCA (concentration 1.1 mg/ml in 50 mM Tris/Glycine buffer at pH 7.0) were subjected to freezing at -S0°C for 15 minutes followed by thawing at 37°C for 10 minutes. The freeze-thaw maneuver was performed for 3, 5, and 10 cycles and the integrity of the native SCA was analyzed by SDS-PAGE and by established TNF-sensitive cell rescue assay. The SCA was found be to very stable and could physically withstand at least 10 freeze-thaw cycles without showing any degradation as determined by Coomassie blue staining of polyacrylamide gel (data not shown). There was no 61 change in biological activity of 2-7-SC-2 (IC50: 224.6 nM) upon 5 cycles of freeze-tliaw. All D2E7 PEG-SCA proteins in this study were found to be stable for 30 days at 4 °C in 20 mM sodium phosphate, pH 6.5,150 mM NaCl. 2-7-SC-2 SCA protein was stable at a pH 3-10,25 °C, IS hrs incubation. NaCl at a concentration up to 1.2 M had no effect on activity or solubility of 2-7-SC-2 , in 20 mM sodium phosphate, pH 7.4, at 25°C. 51. Antigenicity PEGylated D2E7 SCA proteins display a marked decrease in binding efficiency to anti-D2E7 SCA polyclonal antibodies. PEG-SCA 2-7-SC-5 is marginally reactive with anti-218 peptide rabbit serum as analyzed by Western blots using anti-218 antiserum. EXAMPLE 6 FLOW CYTOMETRY ANALYSIS OF SCA AND PEG-SCA PROTEINS Cell Surface Receptor Binding Assay for 2-7-SC-2,2-7-SC-3,2-7-SC-4,2-7-SC-5 The WEHI-13VAR cell line was used to analyze TNF-alpha binding to the cell receptor in the presence of D2E7 SCA or PEG-D2E7 SCA. The Biotin TNF-alpha (0.04 fig) was preincubated with D2E7 SCA or PEG-D2E7 SCA (1-4 fig) in 50 pJ of FACS buffer (1% FBS and 0.05% NaN3 in PBS) at 25 °C for 30 min and then at 4 °C for 15 min with shaking. At the same time, the controls, such as biotinylated soybean trypsin inhibitor (0.05 /ig), polyclonal goatIgG anti-human TNF-alpha antibody (20 p.g), and CC49 SCA (4 (j.g), were also pre-incubated with biotin-TNF-alpha (0.04 p.g) in 50 pi FACS buffer. WEHI-13VAR cells were detached from flask using ice cold 20 mM EDTA in PBS, 37 °C for 2-3 min. The cells were resuspended in RPMI1640 Medium and span down at 2000 rpm for 5min. The cells were then washed once with medium and twice with FACS wash buffer and counted using a hemacytometer. 62 The cells were suspended in FACS buffer to a final concentration of 2x106 cells/ml. All amber eppendprf tubes used for cells were blocked with FACS buffer for at least 1 hr at 4 °C. For the effect of Actinomycin D and Fc block reagent (BD Biosciences)on TNF-alpha binding to cell receptor, the cells (105) were pre-incubated with 0.05 pg Actinomycin D/lxl 06 cells or 1 ug Fc blocking/1 xlO6 cells in 50 H.1 FACS buffer for 15-30min at 4°C. To 50-fJ mixture of TNF-alpha and PEG-D2E7 SCA was added 50 pi of 1x10s WEHI-13VAR cells. After 60 min incubation at 4 °C in the dark, the cells were span down and resuspended in 80 ul cold FACS buffer. 10-/ilofStreptavidin-Phycoerythrin was added. The mixture was incubated in the dark at 4 °C for 30 min. The cells were then washed twice with cold 1 ml of FACS buffer and resuspended in 0.3 nil FACS wash buffer for analysis. Flow cytometry analysis - Results Biotinylated soybean trypsin inhibitor, polyclonal goat anti-human interferon-alpha IgG, and CC49 SCA (Enzon) exhibited no binding and served as negative controls. Preincubation with Fc block reagents (BD Biosciences) and Actinomycin D to the cells had no effect on TNF-alpha Binding. PEG-D2E7 2-7-SC-2 SCA conjugates (ethyl-, 5k, 20k or 40k PEG) completely ehminated TNF-alpha binding to the cells at a molar ratio higher than 16:1 (D2E7 SCA:TNF-alpha). At the same molar ratios of D2E7 SCA to TNF-alpha, native D2E7 SCA also reduced TNF-alpha binding to the cells, but not fully. Therefore, in mis analysis, the PEG-SCA versions of the D2E7 were more potent than the native SCA proteins. FIGs. 6A, 6B and 6C shows representative data of 2-7-SC-2 SCA and PEG-SCA compounds in flow cytometry analysis of the capacity of these compounds to prevent biotin labeled TNF-a from binding to its receptor on WEHI-13VAR cells. These data show that the anti-TNF-a PEG-SCA compounds are highly active in blocking the binding of this cytokine to its receptor in a cell based system. Flow Cytometry Analysis of TNFot Binding to Cell Receptor in the . Presence of 2-7-SC-2 or PEG-2-7-SC-2.1, cell population without fluorescence 63 labeling; 2, cell population after binding to biotin-TNFa and then to streptavidin- phycoerythrin; and 3, effect'of 2-7-SC-2 (FIG. 6A), PEG(20k)-2-7-SC-2 (FIG. 6B), and PEG(40k)-2-7-SC-2 (FIG. 6C) on TNFa binding to cell receptor. The molar ratio of 2-7-SC-2 or PEG-2-7-SC-2 to TNFa is 16:1. The shift towards low fluorescence intensity indicates reduced binding of TNFa to the cells. EXAMPLE 7 BIACORE ANALYSIS Kinetic Analysis of the interaction of recombinant hTNF-alpba with D2E7 SCA and PEG-SCA The interaction between TNF-a and D2E7 SCA variants and their PEGylated forms was analyzed by surface plasmon resonance (SPR) techniques using a BiaCore X instrument (BiaCore, Inc.; Piscataway, New Jersey). Recombinant human TNF-a of >97% purity (Pierce; Rockford, IL) was immobilized on a CM5 chip (BiaCore, Cat # BR-1000-14) as a 10 ug/ml solution atpH 5.0 (acetate buffer, BiaCore, Catt#BR-1003-51). The immobilized surface was washed three times with acetate buffer, pH 4.5 (BiaCore, Cat # BR-1003-50) and subjected to ligand stability analysis for 6 cycles with 500 nM native SCA. D2E7 SCA served as analyte with acetate at pH 4.5 as the regeneration buffer. Over the stable TNF-a-bound surface, different concentrations of SCAs or PEG-SCAs were examined for association (3 minutes) and dissociation (2 minutes or 5 minutes) and the data were analyzed for kinetic parameters {e.g., kon, koff, KA, and Krj> values) using BiaEvaluation software (version 3.0). HBS-N (BiaCore, Cat t# BR-1003-69) was used as the running buffer in this protocol. Kinetic Analysis of Interaction between immobilized rhTNF-a with D2E7 SCA or PEG-SCA Methods TNF-alpha Source: Pierce, recombinant form, cat# RTNFA50 64 MW: 17.4 k D, 157 aa Purity: >97% Reconstitution: In distilled water "DW" to a concentration of 100 ug/ml. No additives are present in the preparation Storage: Stored at -70 degrees C D2E7 SCA: Clone 2-7-SC-2 Source: Eiizon Pharmaceuticals, Inc., recombinant form, expressed in Pichia MW: 27 kD, with 218 linker Purity: >90% Reconstitution: In 10 mM phosphate buffer, pH 7.0, with 150 mM NaCl Storage: Stored at 4.0 degrees C Immobilization: Using New CM5 Chip TNF cone: 10 µg/ml, diluted directly from the stock in acetate buffer at pH 5.0 Flow rate: 5.0 µl/min Channels: FC1-2,3.0 min activation with 1:1 NHS/EDC mixture Channel: FC2, manual injection of 15 µl of TNF, 10 µg/ml (Less volume to be injected to achieve lower RUs) Channels: FC1-2, 3 minutes inactivation with 1 M Ethanolamine, pH S.5 Channel: FC1-2, manual injection of 25 µl of BSA, 1 ug/ml in HBS-N buffer Channels: FC1-2, 1 min injection of 10 mM acetate, pH 4.5, 100 µl/min, to clean the injection port Final RU (response unit) was 199. The CM5 Chip was washed with HBSN buffer and tested for at least 6 cycles of stability with 500nM 2-7-SC-2 . The CM5 Chip was then used for kinetic analysis. 65 Kinetic Analysis of D2E7 2-7-SC-2 Concentration of 2-7-SC-2 : diluted in HBS-N immediately before injection 2.98 µg/ml (1080 nM) 1.49 µg/ml (540 nM) 0.745 µg/ml (270 nM) 0.3725 µg/ml (135 nM) 0.186 µg/ml (67.5 nM) 93 µg/ml (33.75 nM) 46.5 µg/ml (16.875 nM) 23.28 µg/ml (8.4375 nM) 0 µg/ml (0 nM) Flow Rate: 25 µl/min (Note: 30 µl/min resulted in similar binding as that of 20 and 25 µl/min) Duration of association: 3 minutes Duration of dissociation: 2 minutes and 5 minutes Regeneration Buffer: 10 mM Acetate, pH 4.5 Regeneration was performed in two steps, 100µl wash at 100µl/min as the 1st wash and40 80 µl at 100µl/min as 2nd wash, depending on the RU left on the chip after the 1st wash Data Analysis The association and dissociation kinetic curves for the bimolecular binding reaction were analyzed using 1:1 binding fit with and without mass transfer limitations. No significant improvement in kinetics was achieved by including mass transfer parameters, showing mat mass transfer phenomenon was not prevalent in the experiments. 2-7-SC-4 and PEG-40k-2-7-SC-4 were prepared for this purpose FACS results independently showed that there was no difference between D2E7/PEG-D2E7 SCA binding to TNF-alpha, with and without the SCA his-tag 66 segment. The results from Biacore and cell rescue studies have also confirmed that the his-tag segment is not responsible for binding events of the antigen and SCA. Direct binding kinetics were determined by immobilizing TNF-alpha on CMS Chip and allowing different concentrations of native and PEG-versions of 2-7-SC-2 to flow over the bound ligand. Table 5, below, provides the ka (kon), kd (k0ff), KA, and KD values of different forms of 2-7-SC-2 SCAs. Kinetic Parameters of 2-7-SC-2 SCA compounds TABLE 5 2-7-SC-2 Versions ka (M-Vl) kd(s-l) KACM-1) KD(M) 2-7-SC-2 -native 3.28e5 3.92e-4 8.36e8 1.2e~9 2-7-SC-2 -NE-mal 1.47e5 7.87e-5 1.86e9 5.37e"10 2-7-SC-2 -5K-PEG 4.96e4 3.01e-4 1.65e8 6.06e-9 2-7-SC-2 -20K-PEG 1.6e3 4.18e"4 3.83e6 2.61e-7 2-7-SC-2 -40K-PEG 4.47e3 6.78e"4 6.59e6 1.52e"7 Table 5, above, confirms that the PEGylated SCA proteins maintain high affinity for their ligand. However, different PEG-SCA designed molecules show differences in on-rates and off-rates. In particular, the 40 kDa PEG version of 2-7-SC-2 has significantly diminished on-rates, but retained off-rates, when compared to the parent SCA. This could reflect a steric hindrance effect in this artificial binding environment on the BIACore chip by the large and flexible PEG polymers. In contrast, the cell based assays described elsewhere in this study show a similar binding potency for the native and 40 kDa PEGylated SCA proteins. The specific trends in on-rate and off-rate perturbations by PEGylation could reveal a compound-specific conformation or arrangement of the polymer witli respect to the conjugated protein. The further studies on additional PEG-SCA compounds described below highlight this possibility. 2-7-SC-4 - 40 kDa-PEG 67 data indicate that placement of the PEG polymer directly at C-terminus substantially improved off-rates. The strategy of using the defined parameters of SCA cysteine placement and PEG polymer mass as disclosed in tins study may allow the optimization of binding and activity properties for any individual PEG-SCA protein conjugate. Binding Kinetics of 2-7-SC-5 and2-7-SC-7 to rhTNF Direct binding kinetics were determined by immobilizing TNF-alpha on CM5 Chip and allowing different concentrations of native and PEG-versions of 2-7-SC-5 and 2-7-SC-7 / to flow over the bound ligand. Tables below provide the ka, kd, KA, and KD values of different forms of 2-7-SC-5 and 2-7-SC-7 . TABLE 6 KINETIC PARAMETERS OF 2-7-SC-5 SCA COMPOUNDS 2-7-SC-5 Versions Ka (M-V1) kd(s-i) KA(M-!) KD(M) 2-7-SC-5 -native 1.73e5 1.12e-5 1.55el0 6.44e-ll 2-7-SC-5-40K-PEG 2.04e3 2.23e-6 9.18e8 1.09e-9 TABLE 7A KINETIC PARAMETERS OF 2-7-SC-7 Version KaCM-V1) kd(s-l) KAfMr1) KD(M) 2-7-SC-7 -native 3.51e4 2.96e-6 1.19el0 8.43e-ll TABLE 7B KINETIC PARAMETERS OF 2-7-SC-7 2-7-SC-7 Version ka(M-1s-1) kdCs-1) (KA(M-1) KD (M) 2-7-SC-7-20K-PEG 4.37e4 2.89e-4 1.51e8 6.61e-9 68 Direct binding kinetics were determined by immobilizing TNF a on CM5 Chip and allowing different concentrations of native and PEG-versions of 2-7-SC-3 /2-7-SC-7 to flow over the bound ligand. Tables below provide the ka, led, KA, and KD values of different forms of 2-7-SC-3 and 2-7-SC-7 TABLE 8A Kinetic Parameters of 2-7-SC-3 SCAs and Conjugates 2-7-SC-3 Versions ka (M-ls-1) kd(s-1) KA (Mr1) I 2-7-SC-3 -20K-PEG 1.02e4 2.5e-4 4.07e? 2.45e"8 2-7-SC-3 40K-PEG 4. He3 4.04e-4 1.03e7 9.74e-8 TABLE 8B Kinetic Parameters of 2-7-SC-4 SCAs and Conjugates Ko„(lMs) Koff(l/s) KA KB(M) (1/M) 2-7-SC-4 native 2.72e5 4.95e-4 5.49e8 1.82e"9 2-7-SC-4 40K-PEG 1.12e4 4.04e"6 2.78e9 3.6e-10 EXAMPLES ASSAY FOR NEUTRALIZATION OF TNF a CELLULAR CYTOTOXICITY A cell-based assay for neutralization of TNF-a cellular cytotoxicity was conducted as follows. WEHI-13VAR cells (obtained from the American Type Culture collection, ATCC No. CRL-2148) are more sensitive to TNF-a in the presence of Actinomycin D, and were employed in the assay. WEHI-13VAR cells were seeded in a 96-well plate, 10,000 cells per well and incubated overnight at 37°C in a humidified incubator with 5% C02. A range of concentrations of D2E7 SCA proteins and their PEGylated forms were added to the seeded cells in the 96-well plates in serial dilutions from lOug/ml to 2. 5ng/ml diluted in culture medium. 69 Immediately following the addition of D2E7 SCA compounds, rhTNF- alpha (Pierce) was added to each well at a concentration of 1.0 ng/ml. The cells were then allowed to grow for 24 h and cell viability was determined by addition of 15 ul MTT dye reagent (Cat # G4000, Promega Corporation [Madison, Wisconsin]) (3-(4,5,dimemylthiazol2yl)2,5-diphenyl tetrazolium bromide) following the manufacturer's instruction. The analysis of cell rescue was performed by comparing the viability of D2E7-treated cells with untreated cells in the presence of TNF-a. Control wells consisted of untreated cells, and cells treated with TNF-a alone. The cells in the control wells exhibited a complete loss of viability. The percentage of viable cells (or rescued cells) in experimental wells was plotted against the log of D2E7 concentrations and IC50 values were determined for each data set. Each value was derived from a triplicate experimental set. Cell Rescue by D2E7 SCA Proteins from TNF-Alpha Lethality The ability of the ami-TNFa SCA proteins, such as those listed by Tables 9A, 9B and 9C, infra, to protect cells from negative effects of TNFa was confirmed by employing a TNFa - sensitive cell-line, "and contacting the cells with TNFa, with and without SCA protein 2-7-SC-2. Results are were consistent with additional tests conducted with other SCA proteins prepared by Example 1. Materials and Methods Cell line: WEHI-13VAR cells; ATCC# CRL-2148, mouse cell line Propagation: RPMI1640 medium with 2 mM G-glutamine, 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate, and 10%FBS Freeze Medium: Culture medium, 95% and DMSO, 5% Assay Method WEHI-13VAR cells were trypsinized and seeded in 96-well plate, 10,000 cells/well in complete RPMI-1640 medium and allowed to establish for 12 h in a 70 humidified incubator at 37°C with 5% CO2 Cells were washed with PBS and fresh medium was added to each well Different D2E7 SCA variants and their PEGylated forms were added to wells, including those listed by Tables 9A, 9B and 9C, infra. The SCAs were serially diluted from 10u.g/ml to 2.5ng/ml (diluted in complete RPMI medium). No D2E7 was added to the control cells. Immediately following the addition of the D2E7 compound, recombinant hTNF-alpha (1.0 ng/ml diluted in RPMI medium, not complete medium) was added to each well. No TNF-alpha was added to the untreated control cells. Cells were incubated for 24h in humidified incubator at 37°C with 5% CO2 At the end of incubation period, 15ul MTT dye reagent (Cat# G4000, Promega Corporation) was added to each well and the plate was incubated for 4h at 37°C before stop solution was added to each well. The content of each well was mixed thoroughly and crystals were allowed to solubilize overnight at room temperature. The plate was read at 570nm and 630nm in a 96-well plate reader (Molecular Devices) and the difference (measure of cell viability) in absorbance units was plotted against the concentration of D2E7 compound used to rescue the cells against TNF-alpha cytotoxicity. The concentration of D2E7 SCA protein at which 50% cells were rescued was determined for each set of experiment from the viability graph using log[D2E7] as X-axis and % Rescued as Y-axis parameters. The stability of Mal-PEG (20 kDa) polymer at 25 °C, 50 mM sodium phosphate pH 7.0, 1 mM EDTA was investigated by UV absorbance scanning from 220 ran to 400 nm for 0, 2,4,22, and 33 hours. After 33 hours at 25 °C, 3 mM cysteine was added and the mixture was scanned after 5 minutes incubation. The time dependent conversion of the distinctive peak at 300 nm was quantitated. Note: WEHI-13VAR cells are more sensitive to TNF-alpha and lymphotoxin than L929 (ATCC CCL-1). In the absence of Actinomycin D these cells lose sensitivity to TNF within 30 days. Also, addition of Actinomycin D was found to be detrimental for the rescue of cells by D2E7 compounds. 71 The native 2-7-SC-2,2-7-SC-2 -NE-maleimide, 5K, 20K, and 40K PEGylated 2-7-SC-2 s were analyzed for their potency to rescue cells from TNF-raediated killing. Table 9A provides the IC50 values (to rescue 50% WEHI-13VAR cells from killing by 1.0 ng/ml TNF) for each version of 2-7-SC-2 . Table 9A: Cell rescue by 2-7-SC-2 SCA compounds: 2-7-SC-2 Versions IC50 values 2-7-SC-2 native 3.05X10-9 M 2-7-SC-2 -NE-maleimide 3.71X10-9 M 2-7-SC-2 -5K-PEG 4.27X10-9 M 2-7-SC-2 -20K-PEG 3.52X10-9 M 2-7-SC-2 -40K-PEG 11.09X10-9 M Table 9B: Cell rescue by 2-7-SC-4 SCA compounds 2-7-SC-4 Versions IC50 Values 2-7-SC-4 native 7.18X10-9 M 2-7-SC-4 -40K-PEG 4.64X10-9 M Table 9C: Cell rescue by 2-7-SC-5 SCA compounds 2-7-SC-5 Versions IC50 Values 2-7-SC-5 native 4.18X10-9 M 2-7-SC-5 -40K-PEG 6.91X10-9 M These data confirm that the designed PEGylated versions of D2E7 SCA display similar bioactivity in binding and neutralization of the cytokine TNF-alpha in this cell-based assay. The PEG-SCA compounds therefore are able to effectively neutralize tins cytokine and prevent its binding to the TNF-alpha receptors on these cells. 72 EXAMPLE 9 PHARMACOKINETICS OF D2E7 SCA AND PEG-SCAs STUDY PROTOCOL: Pharmacokinetics of SCA and PEG-SCA Conjugates in ICR Mice Purpose of Study This study was designed to examine the plasma pharmacokinetics of SCA D2E7 (2-7-SC-2 and 2-7-SC-5 ) and the PEGylated forms including PEG (5kd), PEG(20kd) and PEG(43kd) conjugates in ICR mice. Test Articles (Stored at -20°C prior to administration) D2E7(2-7-SC-2 ,2-7-SC-5 ) (100% active w/w) PEG(20kd)-D2E7(2-7-SC-2 ,2-7-SC-5) (57.4% active w/w) PEG(43kd)-D2E7(2-7-SC-2,2-7-SC-5 ) (38.6% active w/w) Test System Species: ICR (Sprague Dawley Harlan) mice Age: 7-8 week Gender: Female Weight: Weight range at initiation: approximately 25g Animal Husbandry: Mice were housed 5 per cage in breeder boxes at the University of Medicine and Dentistry of New Jersey ("UMDNJ") vivarium. Cages were sized in accordance with the "Guide for the Care and Use of Laboratory Animals of the Institute of Laboratory Animal Resource", National Research Council. Waste material was removed at a minimum of two times per week. The cages were clearly labeled with a cage card indicating study, test aiticle, animal number, sex, and dose level. Animals were acclimated for one week prior to study initiation 73 Diet The mice had access to tap water and fed commercially available lab chow ad libitum. Sample Preparation D2E7(2-7-SC-2 ,2-7-SC-5) were diluted with PBS to 0.556 mg/mL D2E7 PEG(20kd)-D2E7(2-7-SC-2 ,2-7-SC-5) were diluted with PBS to 0.503 mg/mL D2E7 equivalents PEG(43kd)-D2E7(2-7-SC-2 , 2-7-SC-5 ) were diluted with PBS to 0.541 mg/mL D2E7 equivalents Phosphate Buffered Saline; 10 mM sodium phosphate, pH 6.5 containing 140mM NaCl Administration Site D2E7(2-7-SC-2 ,2-7-SC-5), PEG(20kd)-D2E7(2-7-SC-2 ,2-7-SC-5 ), and PEG(43kd)-D2E7(2-7-SC-2 ,2-7-SC-5 ) conjugates were administered as a single dose (Day 1) i.v. via the tail vein. Experimental Design Fifty-four (54) mice were assigned, dosed and bled according to the scheme of Table 10, below. 74 | TABLE 10 Group Treatment N Dose (mg/ kg) D2E7Dose*(mg/kg) Inj Time Points Bled (k) 1 Vol5 Oil) 1 20kdPEG-2-7-SC-5 3 7.0 4 IV 0.03 24 100/1000 2 20kdPEG-2-7-SC-5 3 7.0 4 iv 0.25 48 100/1000 3 20kdPEG-2-7-SC-5 3 7.0 4 iv 0.5 72 100/1000 4 20kdPEG-2-7-SC-5 3 7.0 4 iv 1 96 100/1000 5 20kdPEG-2-7-SC-5 3 7.0 L 4 iv 3 1000 6 20kdPEG-2-7-SC-5 3 7.0 L 4 iv 6 1000 7 2-7-SC-5 3 4.0 4 IV 0.03 24 100/1000 8 2-7-SC-5 3 4.0 4 iv 0.25 48 100/1000 9 2-7-SC-5 3 4.0 4 iv 0.5 72 100/1000 10 2-7-SC-5 3 4.0 4 iv 1 96 100/1000 11 2-7-SC-5 3 4.0 4 IV 3 1000 12 2-7-SC-5 3 4.0 4 iv 6 1000 7 43kd PEG-2-7-SC-5 3 10.4 4 iv 0.03 24 100/1000 8 43kd PEG-2-7-SC-5 3 10.4 4 iv 0.25 48 100/1000 9 43kd PEG-2-7-SC-5 3 10.4 4 I iv 0.5 72 100/1000 10 43kd PEG-2-7-SC-5 3 10.4 4 | iv 96 100/1000 11 43kd PEG-2-7-SC-5 3 10.4 | 4 | iv i 3 10OO 12 43kd PEG-2-7-SC-5 3 10.4 4 , iv 6 10OO *D2E7 equivalent §Repeat bleeding was ~1000 \.(L 75 Two (2) untreated mice were bled via cardiac puncture into EDTA containing tubes for the collection of untreated control plasma. Mice were injected intravenously with 200 µL per mouse with D2E7(2-7-SC-5 ), 180 µL per mouse PEG(20kd)-D2E7(2-7-SC-5 ), and 190 µL per mouse PEG(43kd)-D2E7(2-7-SC-5) conjugates. Following sedation with 0.09% avortin, mice were bled via the retro-orbital sinus into EDTA containing vials. At 2 min, 15 min, 30 min and 1 hour mice were bled 100 µL and at 3h, 6h, 24h, 48h, 72h and 96h mice were terminally bled ~1000 µL by cardiac puncture. The plasma was collected following centrifugation of the blood and immediately frozen at-80°C on dry ice. The plasma samples were thawed and me concentration of D2E7 compounds determined by ELISA. The data were modeled using WinNonlin software to determine D2E7(2-7-SC-2 , 2-7-SC-5 ), PEG(20kd)-D2E7(2-7-SC-2 , 2-7-SC-S ), and PEG(42kd)-D2E7(2-7-SC-2 ,2-7-SC-5) pharmacokinetic parameters. Clinical Examinations: The mice were examined visually on arrival. A detailed physical examination for signs of clinical abnormality was performed only when necessary according to visual assessment, in order to avoid excessive handling. The mice were examined visually once daily following infusion of the test article, for mortality and signs of reaction to treatment. Any death and clinical signs were recorded. More frequent examinations were performed if circumstances dictate. Animal Care Provision: This study was conducted in accordance with the current guidelines for animal welfare (NIH Publication 86-23, 1985). Pharmacokinetics of D2E7 SCA and PEG-D2E7 SCA Conjugates in Mice: Enzyme-Linked Immunosorbent Assay (ELISA) of D2E7 SCA and PEG-SCA Sample Preparation. The linear range of SCA tested was between 0.2 µg/ml and 30 µg/ml. µg/ml protein concentrations and an optical reading within the linear range was used for analysis. The standard SCA or PEG-SCA was diluted in plasma to a similar dilution factor to the plasma samples analyzed or directly diluted in dilution buffer (0.1 % 76 BSA and 0.05% Tween-20 in PBS, pH 7.4). To simplify the procedure, the standard was diluted in dilution buffer for plasma sample analysis. The dosage by i.v. or s.c. administration was 4.5 mg/kg. The dilution factors for plasma samples by i.v. administration were 500 for 0.03-3 hr samples and 10 for 6-96 hr samples of SCA, 500 for 0.03-24 hrs samples and 10 for 4-96 hrs samples of PEG-5k-SCA, 800 for 0.033-6 hr samples and 100 for 24-96 hr samples of PEG-20k-SCA, and 800 for ail samples of PEG-40k-SCA. The dilution factors of the plasma samples by s.c. administration were 200 for all samples of SCA and 300 for all samples of PEG(20k)-SCA. ELISA Procedure. A sandwich ELISA was used to determine plasma concentrations of SCA and PEG-SCA conjugates. The samples were measured in terms of defined compositions as detected by the antibody. The capture antibody was polyclonal anti D2E7 antibody which was purified by protein A and D2E7-conjugated affinity columns. For the binding to TNFot, the plate was coated with TNFcc. The primary and secondary antibodies were biotinylafed anti D2E7 antibody and Streptavidin-peroxidase respectively. The Maxisorp plates were coated with 400 ng/well anti D2E7 antibody or TNFoc in 50 µl of 50 mM sodium bicarbonate at 25 °C for overnight At the same time, for samples dilution, the Nunc microwell plates or any regular 96-well plates that have a minimal absorption of protein were blocked with blocking buffer (1% BSA, 5% Sucrose, and 0.05% NaN3 in PBS, pH 7.4) at 4 °C for overnight. On the next day, the coating solution and blocking solution were removed from both ELISA and Nunc plates with aspirator. The ELISA plates were blocked with blocking solution (250ul/well) for at least 1 hr at 25 °C and the Nunc plates were washed three times with wash buffer (PBS with 0.05% Tween-20, pH 7.4) or were allowed to air dry at 25 °C and stored at 4 °C for further analysis. The ELISA plates after removing blocking solution were washed with wash buffer three times or allowed to air dry at 25 °C and stored sealed at 4 °C until further use. The plasma samples were diluted 1:2 m a consecutive manner from the top of the Nunc plate to the bottom with 120 u.1 left in each well. After the pre-dilution with dilution buffer, 100 µl of 77 die samples was transferred to ELISA plates and incubated at 4 °C overnight. After die sample solutions were removed and the plates were washed three times with wash buffer, 20-ng biotin anti D2E7 antibody in 50 ul dilution buffer was added to each well. The samples were incubated at 25 °C for 2 hrs. 100-ul streptavidin-peroxidase was added at 1:16,000 dilution after the primary antibody was removed and die plates were washed with wash buffer for four times. The plates were incubated at 25 °C for 1 hr. The solution was removed and the plates were washed three times with wash buffer. The color was developed 10-20 min after adding 100 pi of TMBE substrate and stopped by adding 50 fil 1 M H2S04. Absorbance at 450 nm was recorded. Data Acquisition and Analysis. Data were acquired and analyzed on a Molecular Devices microplate reader. The standard curve was obtained by plotting, of optical density of the endpoints at 450 nm versus the concentrations of the standard and by drawing the best fitting curve that has a correlation coefficient of 0.99 or better. All unknown sample concentrations were calculated from the standard curve after the dilution factor has been incorporated. The closest numbers of ail data points that have an appropriate optical density have been averaged for the results. Pharmacokinetics of D2E7 SCA and PEG-D2E7 SCA Conjugates in Mice PK parameters for all 2-7-SC-2 series (2-7-SC-2, ethyl-2-7-SC-2 , PEG-5k-2-7-SC-2, PEG-20k-2-7-SC-2 , PEG-40k-2~7-SC-2 ) were determined. PK parameters for 2-7-SC-5 , PEG-20k-2-7-SC-5 , and PEG-40k-2-7-SO5 were determined. PK parameters for 2-7-SC-2 and PEG-20k-2-7-SC-2 by s.c. mjection were also determined. From the pilot experiments, a lower detection sensitivity of 2-7-SC-2 (50 ng/ml) using anti 218 linker was observed. An approximately 100-fold extension of circulating half-life in mice was observed in the 40 kDa PEG-SCA compounds (2-7-SC-2 , 2-7-SC-5 ) when compared to the unmodified SCA protein. Table 11, below, displays the determined pharmacokinetic parameters for 2-7-SC-2, PEG-2-7-SC-2 ,2-7-SC-5 , PEG-2-7-SC-5 administered via intravenous injection (IV) or subcutaneous (SC) injection. 78 TABLE 11 Pharmacokinetic Parameters of D2E7 SCA and PEG-SCA in Mice1 SCA/PEG Rte t\n (hi) ha (hr) MRT (hr) AUC hr.u.g/ml CL ml/hr/kg Vss ml/kg Cmaxµg/ml 2-7-SC2 Ethyl-2-7-SC2 PEG(5k)-2-7-SC2 2PEG(20k)2-7-SC2 3 PEG(40k)2-7-SC2 i.v. i.v. i.v.i.v.i.v. 0.15±0.03 0.08±0.00 2.57±0.874.38±1.7621.62±2.64 0.70±0.200.7±006.74±5.1927.2±49.028.3±4.1 0.37±0.23 0r44±0.02 8.21±6.23 19.9±34.1 40.6±5.8 11.3±1.44.2±0.1338±80347±1383463±387 387±491035±1210.5±2.612.6±5.01.26±0.14 280±57450±2084.1±33.7250±34651.3±3.2 53.8±3.836.5±0.1104±654.9±1.4111±5 19.1±1.0 203±10 449.5±115.1 8.91±1.46 2624±466 1.36±0.24 0.23=0.01 3.57±0.97 20.7±3.8 1.34±0.13 7.00±2.64 30.7±14.0 1.51±0.16 9.79±3.66 41.2±15.3 57.8±0.9 88.2±10.8 88.0±3.6 4.11±0.44 39.0±1.8 308±18 81.0± 10.3 56.0± 13.5 2-7-SC-5 i.v. PEG(20k) 2-7-SC-52 i.v. PEG(40k)-2-7-SC5 i.v. 22.4±5.0 1925±115 178±39 2.08±0.12 s.c. s.c. 1.4±30.2 26.0±3.0 2-7-SC2 PEG(20k)2-7-SC2 1Pharmacokinetic parameters for intravenous ("i.v.") were determined by using a two compartment, i.v. bolus, no lag time, 1st or elimination model. Pharmacokinetic parameters for sc were determined by using a one compartment, 1st order input, 1st order elimination model. 2The data are an average of two analyses of computer modeling and the highest standard deviation was taken. 3High numbers of standard deviation. 79 WO 2004/096989 These results demonstrate that the circulating lives of PEGylated SCA proteins can designed to cover the range of therapeutically useful pharmacokinetics. The two-log extension of serum half-life in the 40 kDa PEG conjugated SCA places these compounds in the pharmacokinetic range of intact monoclonal antibodies. The site-specific attachment of the PEG polymer at a unique site distant from the antigen-binding site illows the manufacture of not only active antigen-binding proteins, but also production of a product that is relatively homogeneous in its composition, in contrast to the substantial heterogeneity of SCA proteins PEGylated using random amine chemistries. The large difference in circulating lives of the 40 kDa PEGylated SCA proteins of this study when compared to the 20 kDa PEGylated SCA proteins was somewhat surprising. We did not predict mis based on our results of randomly PEGylated (CC49) SCA proteins, where there was evidence of a pharmacokinetic plateau at about 20 kDa PEG, since the 12 kDa PEG displayed comparable circulating lives. "While not being bound by any theory or hypothesis as to how the invention may operate, it is believed that it is the branched chain structure that also contributes to vastly prolonged circulating lives of the 40 kDa PEG-SCA compounds. Of special interest is the success in using the PEG-SCA (20 kDa PEG) in subcutaneous injections. This route of administration provided markedly better AUC values than intravenous administration. The subcutaneous route may ultimately be preferred for the formulation of PEG-SCA therapeutics. The linker attachment of PEG to the SCA proved successful and compared well in animal studies with the C-terminal PEG attachment. Possibly, the linker attachment of PEG could also contribute to promotion of SCA stability and diminished antigenicity and/or proteolysis. EXAMPLE 10. DIMERIC D2E7 PEG-SCA PROTEINS VIA BIS-MALEIMTDE-PEG In order to generate bivalent PEG-SCA compounds having two SCA proteins per one polymer, 6is-maleimide-PEG polymers were employed. These have the activated maleimide group at both termini of the polymer. SDS PAGE 80 analysis demonstrated that the SCA-PEG-SCA compounds could be synthesized using the methods of this disclosure. The effects of reaction pH and the reaction molar ratio are shown in Table 12 and Table 13, respectively. Effect of Reaction Molar Ratio on Formation of Bis- and Mono-D2E7 SCA- TABLE12 bis-mal-PEG:D2E7-2-7-SC-2 0.165:1 0.335:1 1:1 bis-D2E7 SCA-PEG conjugate (%) 20.7 21.5 17.6 mono-D2E7 SCA-PEG conjugate (%) 9.4 21.3 26.0 bis- and mono-D2E7-SCA-PEG conjugates (%) 30.1 42.8 43.6 The data were obtained by gel image analysis on 4-20% SDS-PAGE gel. Bis-mal-PEG (20k) was dissolved in 100 mM sodium phosphate, pH 6 to a concentration of 3.7 mg/ml. It was men slowly added to 1 mg/ml D2E7 2-7-SC-2 in 100 mM sodium phosphate, pH 6 and .1 mM EDTA at 1/30 to 1/10 volume of D2E7 2-7-SC-2 and the reaction molar ratio indicated. The reaction was conducted at 25 °C under Nitrogen for 1.5 hrs. Effect of Reaction pH on Formation of Bis- and Mono-D2E7 SCA-PEG (20k) TABLE 13 PH 5.0 5.5 6.0 6.5 7.0 7.5 bis-D2E7 2-7-SC-2-PEG (%) 17.6 19.0 28.2 34.0. 37.7 38.4 mono-D2E7 2-7-SC-2-PEG (%) 21.4 23.9 13.7 18.2 14.5 16.4 bis- and mon-D2E7 2-7-SC-2-PEG (%) 39.0 42.9 41.9 52.1 52.1 54.9 The reaction contained 1 mg/ml D2E7 2-7-SC-2 and 0.12 mg/ml bis-mal-PEG compound at a reaction molar Tatio of 0.165:1 (bis-mal-PEG:2-7-SC-2) in 100 mM sodium phosphate, at the pH indicated. The reaction was conducted at 25 °C, under Nitrogen for 2 hrs. The samples were analyzed on 4-20% SDS-PAGE gel and the corresponding band of each compound were quantitated. High molecular weight impurities were less than 1% and the dimer of 2-7-SC-2 was less man 5%. 81 EXAMPLE 11 CONFIRMATION OF ANTI-TNP ALPHA ACTIVITY IN MICE This example confirms the efficacy of PEGylated anti-tumor necrosis factor-alpha single chain antibody (Peg-anti-TNF-a SCA), native anti-TNF-a SCA, and Humira® (intact D2E7) anti-TNF-a antibody in neutralizing the inflammation cascade (prophylaxis) prompted by TNF-a in a standard animal model based on TNF-a challenge, as described by Galanos el al. 1979, Proc. Nat'l Acad Sci (USA) 76: 5939-5943, incorporated by reference herein. In brief, endotoxemia was induced in C57/BL6 mice by injecting TNF-a into D-galactosamine (NGal) sensitized mice via the intraperitoneal route (i.p.). In brief, C57/BL6 mice were injected i.p. with different doses of native SCA, PEG-SCA, and Humira®, 30 minutes prior to challenging the mice with a combination of recombinant human TNF-a (1.0 fig/animal) and N-galactosamine (20mg/animal). Surviving mice were euthanized after 24h. Injection of NGal and TNF together caused lethality in nearly all animals within 24 hrs. Thirty minutes before intraperitoneal ("IP") administration of 1 microgram of TNF and 20 mg of NGal, various doses of D2E7 MAb (Humira®) TNF-neutralizing MAb or the 20 or 40 kDa PEG-SCA compounds were administered. The mice treated with both the E2E7 MAb and PEG-SCA compounds exhibited comparably high survival rates at comparable doses. Materials and Methods Test animals were female C57B1/6 (Sprague Dawley Harlan) mice aged 7-8 weeks, weighing approximately 25g at initiation. The mice were maintained with tap water and commercially available lab chow ad libitum. The agents tested for protective properties against challenge by TNF-a were 2-7-SC-5 native SCA; 2-7-SC-5-20K-PEG-SCA; 2-7-SC-5-43K-PEG-SCA, prepared as described above, and intact d2E7 MAb (Humira® from Abbott Immunology, Abbott Park, Illinois). Control was phosphate buffer solution ("PBS"). The agents were administered via a single intraperitoneal ("IP") injection. 82 One hundred twenty-six (126) mice were assigned according to the following protocol: TABLE 14: Part 1 Group Treatment Stimulant N Doseµg/mouse in 100µLPBS) 1 PBS TNF-a 7 * 2 PBS TNF-a and D-galactosamine 7 * 3 SCA-1.7 TNF-a and D-galactosamine 7 1.7 4 SCA-0.85 TNF-a and D-galactosamine 7 0.85 5 SCA-0.42 TNF-a and D-galactosamine n 0.42 6 SCA-0.21 TNF-a and D-galactosamine 1 0.21 7 Humira-5 TNF-a and D-galactosamine 7 5 8 Humira-2.5 TNF-a and D-galactosamine 7 2.51.25 9 Humira-1.25 TNF-a and D-galactosamine v 10 Humira-0.625 TNF-a and D-galactosamine 7 | 0.625 Mice recei ving PBS treatment will be dosed at a volume oi riooui, ip. TABLE 14: Part 2 Grou P Treatment Stimulant N Dose(^g/mouse in 100nl PBS) 11 20kPeg-SCA-1.7 TNF-a and D-galactosamine 7 1.7 12 20k Peg-SCA-0.S5 TNF-a and D-galactosamine 7 0.85 13 20kPeg-SCA-0.42 TNF-a and D-galactosamine 7 0.42 14 20kPeg-SCA-0.21 TNF-a and D-galactosamine 7 0.21 15 43kPeg-SCA-1.7 TNF-a and D-galactosamine 7 L 1-7 16 43kPeg-SCA-0.85 TNF-a and D-galactosamine 7 0.85 17 43kPeg-SCA-0.42 TNF-a and D-galactosamine 7 0.42 18 43k Peg-SCA-0.21 TNF-a and D-galactosamine 7 0.21 Following at least one week of acclimation, mice were injected i.p. with the specified treatment indicated above. Thirty minutes following this injection (t = 0), mice were challenged i.p. with stimulants as indicated. (Mice received 1.0µg/mouse of recombinant TNF-a in 50p.l PBS and/or 20mg/mouse D-galactosamine in 200^1 PBS.) The above experiment was then repeated, using die same procedures, but with higher doses of the test compounds: 0.125µg 0.625jxg 2.5µg and 10.µg per 83 mouse for each of 2-7-SC-5-20K-PEG-SCA and 2-7-SC-5-40K-PEG-SCA, respectively. Non-conjugated 2-7-SC-5 SCA was tested at 20ug and intact D2E5 (Humira) was tested at 0.625µg/mouse. 5 Results The % survival data was plotted against dose of compound (data not shown). The dose of compound offering at least 70% protection to TNF-challenged mice was considered to be the baseline for efficacy comparison. 10 Identical doses (0.625 µg/animal) of Humira® and PEG-SCAs, both 20k- and 40kDa-PEG-SCAs) protected mice from TNF-induced lethality. However, a higher dose of native, non-conjugated SCA (20 ^g/animal or about 800(j.g/kg) was required to achieve a similar level of protection in these mice. On molar basis, the derived data demonstrated that approximately 3-fold excess of 20- or 40 kDa-PEG- 15 SCA was necessary to achieve survival equivalence similar to the full length antibody. On the other hand, 100-fold molar excess of native SCA was required to attain similar protection against TNF-induced lethality. These data suggest that modification of D2E7 SCA by PEG offers distinct advantages over the native protein by increasing the circulating half life of the protein in plasma. 20 Since the test animals averaged about 25 grams, 0.625 jag/animal corresponds to a dose of about 25fj.g/kg and 10µg/animal corresponds to about 400µg/kg. 84 WE CLAIM: 1. A single-chain antigen-binding polypeptide capable of site-specific conjugation to a polyalkylene oxide polymer, that comprises, (a) a first polypeptide comprising an antigen-binding portion of a variable region of an antibody heavy or light chain; (b) a second polypeptide comprising an antigen-binding portion of a variable region of an antibody heavy or light chain; and (c) a peptide linker linking the first and second polypeptides, wherein the single-chain antigen-binding polypeptide has at least one Cys residue which is capable of being conjugated to a polyalkylene oxide polymer, and has at least one antigen binding site, and wherein the Cys residue is located at a position selected from the group consisting of: (i) a C-terminus of the heavy chain or light chain variable region; (ii) an N-terminus of the heavy chain or light chain variable region; (iii) any amino acid position of the peptide linker; (iv) both the N-terminus and C-terminus; (v) position 2 of the linker, (vi) both position 2 of the linker and the C-terminus; and (iv) combinations thereof; and wherein the single-chain antigen-binding polypeptide binds to TNF-a. 2. The single-chain antigen-binding polypeptide of claim 1 wherein tlif Cys residue is located at a position selected from the group consisting of position 2 of the linker, the C-terminus and combinations thereof. 3. The single-chain antigen-binding polypeptide of claim 1 wherein the first polypeptide comprises a variable region of an antibody light chain and the second polypeptide comprises a variable region of an antibody heavy chain. 85 4. Hie single-chain antigen-binding polypeptide of claim 1, wherein the C- terminus of the second polypeptide is the native C-terminus. 5. The single-chain antigen-binding polypeptide of claim 1 wherein the peptide linker ranges in size from 2 to 18 residues 6. A conjugate comprising the single-chain antigen-binding polypeptide of claim 1, and comprising a polyalkylene oxide polymer, wherein the polyalkylene oxide polymer is covalently linked to the single-chain antigen-binding polypeptide at a Cys residue. 7. The conjugate of claim 6 wherein the polyalkylene oxide is linked to the single-chain antigen-binding polypeptide at a Cys residue via a linker selected from the group consisting of a maleimide, vinylsulfone, thiol, orthopyridyl disulfide and a iodoactemide linker. 8. The conjugate of claim 6 wherein the polyalkylene oxide is linked to the single-chain antigen-binding polypeptide at a Cys residue via a maleimide linker. 9. The conjugate of claim 6 wherein the polyalkylene oxide ranges in size from about 5,000 to about 40,000 Daltons. 10. The conjugate of claim 6 wherein the polyalkylene oxide is a polyethylene oxide. 11. The conjugate of claim 6, wherein the polyalkylene oxide is conjugated to at least two single-chain antigen-binding polypeptides, and each single-chain antigen-binding polypeptide is the same, or different. 12. The conjugate of claim 11 wherein the single-chain antigen-binding polypeptide is further conjugated to an additional functional moiety. 86 13. The conjugate of claim 12 wherein the additional functional moiety is a detectable label or tag. 14. A polynucleotide encoding the single-chain antigen-binding polypeptide of claim 1. 15. A replicable expression vector comprising the polyucleotide of claim 14. 16. A method of producing the single-chain antigen-binding polypeptide, comprising the steps of: (a) culturing a host cell comprising the expression vector of claim 12, and (b) collecting the single-chain antigen-binding polypeptide expressed by the host cell. 17. A method of detecting TNF-a suspected of being in a sample, comprising: (a) contacting the sample with a reagent comprising the single-chain antigen-binding polypeptide of claim 1, and (b) detecting whether the single-chain antigen-binding polypeptide has bound to the TNF-a. 18. The method of claim 17 wherein the single-chain antigen-binding polypeptide is covalently conjugated to at least one polyalkylene oxide polymer via a Cys residue of the single-chain antigen-binding polypeptide. 19. The method of claim 18 wherein the conjugate is anchored to a solid substrate. 20. A method of treating or preventing TNF-a related toxicity in a mammal, comprising administering the single-chain antigen-binding polypeptide 87 of claim 1 to the mammal, wherein the single-chain antigen-binding polypeptide is administered in an amount effective to inhibit TNF-a activity in the mammal. 21. The method of claim 20 wherein the administered single-chain antigen-binding polypeptide is covalently conjugated to at least one polyalkylene oxide polymer via at least one of the Cys residues. 22. The method of claim 20 wherein the single-chain antigen-binding polypeptide is administered in an amount ranging from about 10jig/kg to about 4,000ng/kg. 23. The method of claim 20 wherein the single-chain antigen-binding polypeptide is administered in an amount ranging from about 20|ig/kg to about 400p.µ/kg. 24. A protein comprising two or more of the single-chain antigen-binding polypeptides of claim 1, wherein each single-chain antigen-binding polypeptide is the same or different 25. The protein of claim 24 that is bivalent, trivalent or tetravalent. 26. The protein of claim 24 wherein the constituent single-chain antigen-binding polypeptides are noncovalently associated. 27. The protein of claim 26 herein the peptide linker of the constituent single-chain antigen-binding polypeptides range in size from 2 to 18 residues. 28. The protein of claim 24 wherein the constituent single-chain antigen-binding polypeptides are covalently linked. 29. The protein of claim 24 that is encoded as a single, multivalent protein. 88 ABSTRACT The present invention relates to monovalent and multivalent single-chain antigen-binding polypeptides with site-specific modifications. The provided polypeptides are capable of being covalently linked or conjugated to polyalkylene oxides at the modified sites. The resulting conjugates retain antigen binding properties and exhibit prolonged circulating time and reduced antigenicity relative unconjugated single chain antigen binding polypeptides. Methods and compositions for making and using the single chain antigen-binding polypeptides with site-specific modifications are also provided. |
---|
01091-mumnp-2005-abstract(29-1-2008).doc
01091-mumnp-2005-cancelled pages(7-12-2005).tif
01091-mumnp-2005-claims(granted)-(29-1-2008).doc
01091-mumnp-2005-claims(granted)-(29-1-2008).tif
01091-mumnp-2005-correspondence(29-1-2008).tif
01091-mumnp-2005-correspondence-ipo-(21-1-2008).tif
01091-mumnp-2005-form 1(5-10-2005).pdf
01091-mumnp-2005-form 18(22-3-2006).pdf
01091-mumnp-2005-form 2(granted)-(29-1-2008).doc
01091-mumnp-2005-form 2(granted)-(29-1-2008).pdf
01091-mumnp-2005-form 26(5-10-2005).pdf
01091-mumnp-2005-form 3(5-10-2005).pdf
01091-mumnp-2005-form 5(5-10-2005).pdf
01091-mumnp-2005-form pct-isa-210(5-10-2005).pdf
01091-mumnp-2005-form pct-isa-237(5-10-2005).pdf
1091-mumnp-2005-correspondence-others.pdf
1091-mumnp-2005-correspondence-received-ver-271205.pdf
1091-mumnp-2005-correspondence-received.pdf
1091-mumnp-2005-correspondence-send.pdf
1091-mumnp-2005-description (complete).pdf
1091-mumnp-2005-form-pct-ipea-402.pdf
1091-mumnp-2005-form-pct-ipea-409.pdf
1091-mumnp-2005-form-pct-ipea-416.pdf
1091-mumnp-2005-form-pct-isa-220.pdf
1091-mumnp-2005-form-pct-isa-237.pdf
1091-mumnp-2005-form-pct-ro-101.pdf
1091-mumnp-2005-pct-search report.pdf
1091-mumnp-2005-sequence listing.doc
Patent Number | 219961 | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Indian Patent Application Number | 1091/MUMNP/2005 | |||||||||||||||
PG Journal Number | 33/2008 | |||||||||||||||
Publication Date | 15-Aug-2008 | |||||||||||||||
Grant Date | 15-May-2008 | |||||||||||||||
Date of Filing | 05-Oct-2005 | |||||||||||||||
Name of Patentee | ENZON PHARMACEUTICALS INC | |||||||||||||||
Applicant Address | 685 ROUTE 202/206, BRIDGEWATER, NEW JERSEY 08807, USA | |||||||||||||||
Inventors:
|
||||||||||||||||
PCT International Classification Number | C12N | |||||||||||||||
PCT International Application Number | PCT/US2004/012458 | |||||||||||||||
PCT International Filing date | 2004-04-23 | |||||||||||||||
PCT Conventions:
|