| Title of Invention | ARYLSULFONAMIDO-SUBSTITUTED HYDROXAMIC ACID DERIVATIVES |
|---|---|
| Abstract | ABSTRACT IN/PCT/2002/00162/CHE The present invention relates to an alpha-Amino hydroxamic acid derivative of formula (I), in which R is C2-C7-alkyl, which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, C3-C5-cycloalkyl or unsubstituted or substituted C3-C4-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S and N; or C3-C7-alkenyl or C3-C7-alkynyl, which in each case is unsubstituted or mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, C3-C5-cycloalkyl or unsubstituted or substituted C3-C6-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S and N; and the other symbols are as defined in claim 1 , are described. These compounds are MMP and in particular MMP2 inhibitors and can be used for treatment of MMP dependent diseases, in particular inflammation conditions, rheumatoid arthritis, osteoarthritis, tumors (tumor growth, metastasis, progression or invasion) and pulmonary disorders (e.g. emphysema, COPD). |
| Full Text | The invention relates to arylsulfonamido-substituted hydroxamic acid derivatives, to processes and novel intermediates for their preparation, phamnaceutical compositions comprising said derivatives, phannaceutical compositions comprising selective MMP2 inhibitors, the use of the hydroxamic acid derivatives as medicaments, a method of treating MMP, in particular MMP2, dependent diseases, in particular hyperprollferative diseases, or conditions in mammals which are responsive to MMP, in particular MMP2, inhibition, using selective MMP2 inhibitors, in particular the hydroxamic acid derivatives of fonnula I, or phannaceutical compositions comprising selective MMP2 inhibitors. In particular the hydroxamic acid derivatives of fonnula I. The invention relates in particular to a-amino hydroxamic acid derivatives of the formula I, wherein R^ is hydrogen, substituted or unsubstituted aryl, tower alkyl, substituted or unsubstituted carijocyclic aryl-lower alkyl, substituted or unsubstituted heterocyclic-lower alkyl, substituted or unsubstituted Cs-Cr-cycloalkyl, substituted or unsubstituted C3-C7-cycloalkyl-lower alkyl, hydroxy-lower alkyl, lower alkoxy-lower alkyl, lower alkyl-{tiiio, suifinyl or sulfonyl)-lower alkyl, amino-lower alkyl or mono- or di-lower alkylamino-lower alkyl; R^ is hydrogen or lower alkyl; R^ is substituted or unsubstituted Cs-Cr-cycioalkyl, substituted or unsubstituted carbocycHc aryl, substituted or unsubstituted heterocyclic aryl, substituted or unsubstituted heterocyclyl; or lower alkyl; A Is C1-C3 alkylen unsubstituted or substituted by lower alkyl; 4 lO I -O, R Is Cz-CT-alkyI, which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, Ca-Cs-cycIoalkyI or unsubstituted or substituted C rCe-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S and N; or Ca-Cralkenyl or Ca-CT-alkynyl, which in each case is unsubstituted or mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, C 3-C5-cycloall salts thereof. Compounds of fomnula I are inhibitors of matrix-degrading metalloproteinases (MMP's) and are useful for the treatment of conditions related thereto. q Is preferably 1-3, as a rule 1 or 2, preferably 1. Only if It is possible for steric reasons, can q also be 4 or 5. If q is 1, OR is, for example, In the 3 position or, preferably, in the 4 position. In a preferred embodiment of the invention, R1 or R2 represents hydrogen. In another preferred embodiment of the Invention, R1 and R2 both represent hydrogen. The general definitions used herein have the following meaning within the scope of the present Invention, unless othenn/ise specified. Halogen is, for example, fluorine, chlorine, bromine or Iodine. Preferably it is fluorine or chlorine. Unless stated otherwise, in the present disclosure organic radicals designated lower" contain not more than 7, preferably not more than 4, carison atoms. Aryl represents carbocyclic or heterocyclic aryl. A lower alkyl group is branched or unbranched and contains 1 to 7 carbon atoms, preferably 1-4 carbon atoms, and represents for example methyl, ethyl, propyl, butyl, tsopropyl and isobutyl. Carbocyclic aryl represents monocyclic or bicyclic aryl, preferably unsubstituted phenyl, or phenyl mono-, di- or trisubstituted by one, two or three radicals selected from lower alkyl, lower alkoxy, hydroxy, halogen, cyano, trifluoromethyl, lower alkyl amino, di-lower alkyl amino, phenoxy or phenyl, optionally substituted by lower alkoxy, lower alkyl, halogen, cyano, nitro or trifluoromethyl; or phenyl disubstituted on adjacent carbon atoms by lower-alkylenedioxy, such as methylenedloxy; or phenyl substituted by heterocyclic radicals as defined below, in particular pyrrolyl, imidazolyl, triazolyl, tetrazoly!, furyl, thienyl, morpholinyl, pyrrolidinyl, piperidinyl; or lower alkyl which is substituted by heterocyclic radicals as defined below, especially imidazolyl, triazolyl, chinolinyl or morpholinyl; or 1-or2-naphthyl. Preferred is unsubstituted phenyl or phenyl monosubstituted by lower alkoxy, phenoxy, phenyl, halogen or trifluoromethyl. Particulariy preferred is phenyl or phenyl monosubstituted by lower alkoxy, halogen or trifluoromethyl. Carbocyclic aryl-lower alkyl represents preferably straight chain or branched aryl-C i-C4-alkyl in which carbocyclic aryl has meaning as defined above, e.g. benzyl or phenyl-(ethyl, propyl or butyl), each unsubstituted or substituted on the phenyl ring as defined under carbocyclic aryl above, advantageously optionally substituted benzyl. Heterocyclic radicals are, in particular, mono- or bicyclic, aza-, tiiia-, oxa-, thiaza-, oxaza- or diaza radicals of aromatic character, and corresponding partly or, in particular, completely saturated heterocyclic radicals of this type, it being possible for such radicals to be mono-, di- or trisubstituted by functional groups. These radicals are linked to Vhe rest of the molecule via a C-C bond and, in particular, monocyclic or blcydlc radicals witii one niti'ogen, oxygen or sulfur atom, and in particular aromatic radicals of tills type, for example 2 -pyrryl or 3-pyrryi, pyridyl, for example 2-, 3- or 4-pyridyi, and furtiiennore thienyl, for example 2- or 3-thlenyl, or furyl, for example 2-furyi; analogous bicyclic radteals with one nitrogen, oxygen or sulfur atom are, for example, indolyl, such as 2- or 3-indolyl, quinolyl, such as 2- or 4-quinolyl, Isoquinolyl, such as 3- or 5-isoquinolyl, benzofuranyl, such as 2 -benzofuranyi, chromenyl, such as 3-chromenyl, or benzothienyl, such as 2- or 3 -benzothlenyl. Suitable monocyclic and bicyclic radicals with more than one heteroatom are, for example, imida-zolyl, such as 2-imidazolyl, pyrimldinyl, such as 2- or 4-pyrimidinyl, oxazolyl, such as 2-oxazolyl, isoxazolyl, such as 3-lsoxazolyl, orthiazolyl, such as 2-thiazolyl, or benzlmidazolyl, such as 2-benzimldazolyl, benzoxazolyl, such as 2 -benzoxazolyl, or quinazolyl, such as 2-quinazolinyi. Corresponding partiy, or, in particular, completely saturated analogous radicals are also suitable, such as 2-tetrahydrofuryl, 4-tetra hydrofuryl, 2- or 3-pyrrolidyl, 2-, 3- or 4-piperidyl and also 2- or 3-morpholinyl, 2- or 3-thiomorpholinyl, 2-piperazinyl and N,N'-bis-lower alkyl-2-plperazinyl radicals. A heterocyclic radical can be substituted by one, two or more Identical or different substi-tuents (functional groups); the following substituents are particularly suitable: free, etherified and esterified hydroxyl groups; mercapto and lower alkylthio and substituted and unsub-stituted phenylthio groups; halogen atoms; oxo groups, which are in the form of formyl (I.e. aldehyde) and keto groups, and also con-esponding acetals or ketals; azido and nitro groups; primary, secondary and, preferably, tertiary amino groups, primary or secondary amino groups, acylamino groups and diacylamino groups protected by conventional protec¬tive groups, and unmodified or functionally modified sulfo groups, such as sulfamoyi groups or sulfo groups present in salt form. All these functional groups should not be on the C atom from which the free valency comes, and they are preferably separated from it by 2 or even more C atoms. The heterocyclic radical can also carry free and functionally modified carboxyl groups, such as carboxyt groups present in salt form or esterified carboxyi groups, carbamoyl, ureido or guanidino groups, which may or may not carrry one or two hydro¬carbon radicals, and cyano groups. Substituted carbocyclic aryl R3 is preferably phenyl substituted by halogen, lower alkoxy, lower alkyl, di-lower alkyl amino, triazolyl, especially 1,2,4-trlazolyl, 1,3,4-triazolyl, or 1,2,3-triazoiyl, imidazoiyi, e.g. 1-lmidazolyl, morpholinyl, pyrrolidinyl, piperidinyl, tetrazoiyi, pyrrolyl, fury], in particular 3-furyi, tiiienyl, morpholinyl lower alkyl, quinolinyl lower alkyl, imidazoiyi lower alkyl and triazoiyi lower alkyi. In a highly preferred embodiment of the Invention R 3 represents substituted carbocydic aryl. In which embodiment substituted carbocydic aryl Is phenyl which is preferably substituted in 4 position, preferably by triazolyl, In particular 1,2,4-triazol-1 -yl. Heterocyclic aryl R3 represents monocyclic or bicydic heteroaryl, for example pyridyl, quinolyl, isoquinolyl, benzothienyl, benzofuranyl, benzopyranyl, benzothiopyranyl, furanyl, pyrrolyl, thiazolyl, oxazolyl, isoxazolyl, triazolyl, tetrazolyl, pyrrazolyl, imidazolyl, thienyl, or any said radical substituted by lower alkyl or halogen. Pyridyl represents 2-, 3- or 4-pyridyl. Thienyl represents 2- or 3-thienyl, advantageously 2-thienyl. Quinolyl represents preferably 2-, 3- or 4-quinolyl, advantageously 2-quinolyl. Isoquinolyl represents preferably 1-, 3- or 4-isoquinolyl. Benzopyranyl, benzothiopyranyl represent preferably 3-benzopyranyl or 3-benzothiopyranyt, respectively. Thiazolyl represents preferably 2- or 4-thiazolyl, advantage¬ously 4-thiazolyl. Triazolyl Is preferably 2- or 5-(1,2,4-triazolyl). Tetrazolyl is preferably 5-tetrazolyl. Imidazolyl is preferably 4-imidazolyl. Preferably heterocyclic aryl represents pyridyl. It can be substituted by one, two or more identical or different substltuents as defined for the heterocyclic radicals above. Heterocyclic R3 represents saturated or partly unsaturated, monocyclic or bicyclic hetero¬cyclic radicals, comprising between 3 and 10 cartson atoms and one or two heteroatoms selected from the group consisting of O, S and N. Preferably, heterocyclic R 3 is selected from the group consisting of piperidinyl, morphoiinyl, pyrroiidinyi, pyrroiinyl, piperazinyl and tetrahydropyranyl. It can be substituted by one, two or more identical or different substltuents as defined for the heterocyclic radicals above. Preferably, it is unsubstituted or substituted by lower alkyl. Heterocydic-lower alkyl represents preferably straight chain or branched hetero(^clic-C 1-C4-alkyl in whidi heterocyclic has the meaning as defined above, e.g. 2-, 3- or 4-piperidyi methyl or (2-,or 3-morphol[nyl)-(ethyl, propyl or butyl). Cs-CT-CycioalkyI represents a saturated cyclic hydrocarbon unsubstituted or substituted by lower alkyl which contains 3 to 7 ring carbons and is advantageously cydopentyl or cydo-hexyl unsubstituted or substituted by lower aikyi. I I i Cycloalkyl-lower alkyl represents preferably (cyclopentyl- or cyclohexyl)-(methyl or ethyl). A lower alkoxy (or alkyloxy) group preferably contains 1-4 carbon atoms, advantageously 1-" 3 carbon atoms, and represents for example, ethoxy, propoxy, isopropoxy, or most advantageously methoxy. A lower alkylthlo-group preferably contains 1-4 carbon atoms, advantageously 1-3 carbon atoms, and represents for example, ethylthio, propylthio, isopropylthio, or most advantage¬ously methylthio. A lower aikyisulfinyl-group preferably contains 1 -4 carbon atoms, advantageously 1-3 carbon atoms, and represents for example, ethylsulfinyi, propyisulfinyi, isopropylsulfinyl, or most advantageously methylsulfinyl. A lower alkylsulfonyi-group preferably contains 1-4 carbon atoms, advantageously 1-3 carbon atoms, and represents for example, ethylsulfonyl, propylsulfonyl, isopropylsulfonyl, or most advantageously methylsulfonyl. A lower acyloxy group contains preferably 1 -4 carbon atoms, and represents for example, acetoxy, propanoyloxy or butanoyloxy. Prodrug acyl derivatives are preferably those derived from an organic carbonic acid, an organic carboxylic acid or a carbamic add. > An acyl derivative which is derived from an organic carboxyKc acid is, for example, lower alkanoyl, phenyl-lower aikanoyi or unsubstituted or substituted aroyi, such as benzoyl. An acyl derivative which is derived from an organic carbonic add is, for example, alkoxy-carbonyl which is unsubstituted or substituted by an aromatic radical or is cycioalkoxy-carix)nyl which is unsubstituted or substituted by lower aikyl. An acyl derivative v^ich is derived from a cart^amic acid Is, for example, amino-cart)onyl which is substituted by lower aikyl, aryl-iower alkyl, aryt, lower alkylene or lower alkyiene interrupted by O or S. Acylamino represents preferably lower alkanoylamino or lower alkoxycarbonylamino. C1-C3 alkylen can be for example methylen, ethylen, 1,2-dlmethylethylen, 1,1-dimethyl-ethylen, propylen, 1,2-dimetbylpropylen, 2,2-diethylpropyIen or 1-methyl-2-ethylpropylen. Ci-Ca alkylen is preferably unsubstituted. Most preferably it represents methylen or ethylen. Ca-CT-alkyI radical R is branched or unbranched, contains 2 to 7 carbon atoms and is prefe¬rably mono- or disubstituted by halogen, nitre, lower acyloxy, trifluoromethoxy, cyano, C 3-Cs-cycloalkyl or Ca-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S and N which is unsubstituted or substituted by lower alkyl. More preferably it is monosubstituted by halogen, most preferably by chloro or fluoro, C yCs-cycloalkyl, most preferably cyclopropyl, or unsubstituted C a-Ce-heteroaryl comprising one or two heteroatoms, in particular one heteroatom, selected from the group consisting of O, S and N, for example furyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl or pyridinyl. C z-Cr-alkyl radical R represents for example 7-fluoroheptyl, 7-chloroheptyl, 6-fiuorohexyl, 6-chloro-hexyl, 5-chloropentyl, 5-nitropentyl, 5-cyanopentyl, 5-fluoropentyl, 4-fluoropentyl, 5,5,5-trifluoropentyl, 5-acetoxypentyl, 4-chlorobutyl, 4-fluorobutyl, 3-fluorobutyl, 4,4,4-trifluoro-butyl, 3,4-dichlorobutyl, 4,4-difluorobutyl, 4-acetoxybutyl, 4-propionyloxybutyl, 4-nitrobutyl, 4-cyanobutyl, 4-trifluoromethoxybutyl, 3,4-dicyanobutyl, 4,4-dlcyanobutyl, 4-acetyloxy-2,2-dlmethylbutyl, 4-fluoro-1-methylbutyl, 1-ethyl-4-fluorobutyl, 3-chloropropyl, 3-fluoropropyl, 2-fluoropropyl, 3-cyanopropyl, 3-trifluoromethoxypropyl, 2,3-dichloropropyl, 3-chloro-1,2-dimethylpropyl, 2-chloro-3-fluoropropyl, 3-cyano-1,2-dimethylpropyl, 2-cyano-3-fluoropropyl, 2-nitro-3-fluoropropyl, 2-cyano-3-chloropropyl, 3,3,3-trifluoropropyl, 2-chloroethyl, 2-fluoro-ethyl, 2-cyanoethyl, 2-cyclopropyletiiyl, 3-cyclopropylbutyl, 2-cyclobutylethyl, cydoprcpylmethyl, cyclobutylmethyl, 3-furylmethyl or 2-(3-furyl)ethyl. Preferably C 2-C7-alkyl radical R contains 3-5 carbon atoms and is unbranched. Preferably the substituents are located in tenriinai position. Most preferably Cz-Cralkyl radical R represents 4-cblorobutyl, 4-fluorobutyI, 3-chloropropyl or 3-fluoropropyl. Cs-Craikenyl radical R can be branched or unbranched and contains 3 to 7 carbon atoms. Cs-Craikenyl radical R represents for example 2-propenyi, 2-chioromethyl-2-propenyi, 3-butenyl, 2'43Utenyi, 4-chIoro-2-butenyt, 4-fIuoro-2-^utenyl, 4-acetoxy-2-butenyl, 2-isobutenyi, 2-pentenyl, 3-pentenyf, 5-chloro-2-pentenyl, 5-fluoro-3-pentenvf, 5-nitro-3-pentenvl. 4- pentenyl, 5-hexenyl, 3-chloro-5-hexenyI, 4-hexenyl or 6-heptenyl. Preferably C 3-C7-alkenyl radical R contains 3-5 carbon atoms and is unsubstituted. The double bond is preferably located in tenninal position. Preferably Ca-Cralkenyl radical R represents 4-pentenyl, 3-butenyl or 2-propenyl, most preferably 3-butenyl. f Ca-Cralkynyl radical R can be branched or unbranched and contains 3 to 7 carbon atoms. Preferably Ca-CT-alkynyl radical R contains 3-5 carbon atoms and is unsubstituted. C 3-C7-alkynyl radical R represents for example 2-propynyl, 2-butynyl, 4-cyano-2-butynyl, 4-nitro-2-butynyl, 3-butynyJ, 5-chloro-2-pentynyl, 2-pentynyl, 5-fluoro-3-pentynyl, 5-chloro-3-pentynyl, 3-pentyn^, 4-hexynyl or 4-heptynyl, preferably it represents 2-propynyl, 2-butynyl, 2-pentynyl or 3-pentynyl. Preferably the triple bond is located in temninal position. In particular, good results can be obtained with compounds in which R is 2-propynyi. Phamiaceutically acceptable salts of the acidic compounds of the invention are salts fomied with bases, namely cationic salts such as alkali and alkaline earth metal salts, such as sodium, lithium, potassium, calcium, magnesium, as well as ammonium salts, such as ammonium, trimethyl-ammonium, diethylammonium, and tris-(hydroxymethyl)-methyl-ammonium salte. Similarly acid addition salts, such as of mineral acids, organic carboxylic and organic sulfonic acids e.g. hydrochloric acid, methanesulfonic add, maleic acid, are also possible provided a basic group, such as pyiidyl, constitutes part of the structure. The compounds of formula I have valuable phannacologically useful properties. In particular, they display specific inhibitory actions which are of pharmacological interest The members of the enzyme family of matrix-degrading metalloproteinases (MMP's), such as gelatinase, stromelysin and collagenase, are implicated in various biological processes, e.g. tissue matrix degradation (e.g. collagen collapse) and in many pattiological conditions involving abnormal connective tissue and basement membrane matrix metabolism, such as artiiritis (e.g. osteoarthritis and rheumatoid arthritis), tissue ulceration (e.g. corneal, epidermal and gastiic ulceration), abnonnal wound healing, periodontal disease, bone disease (e.g. Pagef s disease and osteoporosis), tumor meteistasis or invasion, psoriasis, as well as HlV-lnfection (J. Leuk. Biol. 52 (2): 244-248,1992), artherosclerosis, ventricular dilatation and restenosis in angioplasty. Macrophage metalloelastase is a further matrix-degrading metalloproteinase which Is involved in the degradation of elastin and has been implicated In pathological conditions, e.g. pulmonary disorders such as emphysema and COPD (chronic obstnjctive pulmonary disease). Selectivity Is generally an advantageous feature of phamiacologically active compounds, because the side-effects of drugs comprising selective compounds are smaller compared with drugs comprising less selective compounds. Since the family of MMP's consists of several different enzymes which are involved in different biological processes, it is desirable to have selective inhibitors of singular MMP's or subgroups of tiie MMP enzyme family. The compounds of formula I and their pharmaceutically acceptable salts inhibit mati'lx degrading metalloproteinase such as gelatinase, stromelysin, and macrophage metalloelastase, and membrane type matrix metalloproteinases, such as MT1-MMP and MT2-MMP. They are particularly useful as MT1-MMP and MMP2 (gelatinase A) Inhibitors. A number of peptides are reported to interact with biological matter like enzymes, cells or receptors implicated in pathological processes or diseases. Peptides have ttie disadvantage to get easily hydrolyzed under physiological conditions, especially those physiological conditions to be found in the blood or stomach of wann-blooded animals. The compounds of fonnula I have tiie advantage to be no peptides. The compounds of formula I are non-peptide MMP2 inhibitors. Beneficial effects are evaluated In pharmacological tests generally known in the art, and as illustrated herein. The above-died properties are demonstrable In in vHro and in wo tests, using advantageously mammeds, e.g. rats, guinea pigs, dogs, rabbits, or isolated organs and tissues, as well as mammalian enzyme preparations. Said compounds can be applied in vitro in the fonn of solutions, e.g. preferably aqueous solutions, and in vivo eitiier enterally or parenterally, advantageously orally, e.g. as a suspenskm or in aqueous soluticm. The dosage in vitro may range between about 10 "^ molar and 10*'° molar concentrations. The dosage in vivo may range, depending on the route of administration, between about 0.1 and 100 mg/I One test to determine the Inhibition of stromelysin activity is based on its hydrolysis of Substance P using a modified procedure of Harrison et al (Hamson, R.A., Teahan J., and Stein R., Anal. Biochem. 180.110-113 (1989)). In this assay, Substance P Is hydrolyzed by recombinant human stromelysin to generate a fragment, Substance P 7-11, which can be quantitated by HPLC. In a typical assay, a 10 mM stock solution of a compound to be tested is diluted in the assay buffer to 50 mM, mixed 1:1 with 8 mg recombinant human stromelysin (mol. wt. 45-47 kDa, 2 Units; where 1 Unit produces 20 mmoles of Substance P 7-11 in 30 minutes) and incubated along with 0.5mM Substance P in a final volume of 0.125 mL for 30 minutes at 37*'C. The reaction is stopped by adding 10 mM EDTA and Substance P 7-11 is quantified on RP-8 HPLC. The ICso for Inhibition of stromelysin activity and Ki are calculated from control reaction without the inhibitor. The effect of compounds of the invention /n-wVo can be determined in rabbits. Typically, four rabbits are dosed orally with a compound up to four hours before being injected intra-artlcularly in both knees (N=8) with 40 Units of recombinant human stromelysin dissolved In 20 mM Tris, 10 mM CaCl2, and 0.15 M NaCi at pH 7.5. Two hours later the rabbits are sacrificed, synovial lavage is collected, and keratan sulfate (KS) and sulfated glycosamino-glycan (S-GAG) fragments released Into the joint are quantitated. Keratan sulfate is measured by an Inhibition ELISA using the method of Thonar (Thonar, E.J.-MA, Lenz, M.E., Klinswortfi, Q.K., Caterson, B., Pachman, LM., Glickman, P., Katz, R., Huff, J., Keuttner, K.E., Arthr. Rheum. ^ 1367-1376 (1985)). Sulfated glycosamlnoglycans are measured by first digesting the synovial lavage with streptomyces hyaluronidase and Uien measuring DMB dye binding using the mettiod of Goldberg (Goldberg, R.L and KolK}as, L, Connect Tiss. Res. £4,, 265-275 (1990)). For an i.v. study, a compound Is solubilized In 1 mL of PEG-400, and for a p.o. study, a compound is administered in 5 mL of fortified com starch per kilogram of body weight. Macrophage metalloelastase (MME) inhibitory activity can be determined by measuring the inhibition of the degradation of [ ^H]-elastin by truncated recombinant mouse macrophage ' metalloelastase as follows: About 2 ng of recombinant truncated mouse macrophage metalloelastase (FASEB Journal Vol. 8, A151,1994), purified by Q-Sepharose column chromatography is incubated with test compounds at the desired concentrations in the presence of 5 nM CaCI a, 400 nM NaCI, [^H]elastin (60,000 cpm/tube), and 20 mM Tris, pH 8.0, at 37 °C overnight. The samples are spun in a microfuge centrifuge at 12,000 rpm for 15 minutes. An aliquot of the supernatant is counted in a scintillation counter to quantitate degraded [ ^H]elastin. ICso's are detenmined from a range of concentrations of the test compounds and the percent inhibition of enzyme activity obtained. The inhibitory activities of compounds of fomriula I on MT1-MMP, MMP1 (collagenase 1) and MMP2 (gelatlnase A) can be detemfiined as follows: Stock solutions of substrate (MCA-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2, Knight, C.G., Willen-brock, F., Murphy, G., A novel coumarin-labelled peptide for sensitive contlnous assays of the matrix metalloproteinases, FEBS lett, 296,263-266, (1992)), are prepared in 100 % DMSO at a concentration 1.0 mM. Stock solutions of inhibitors are prepared in 100 % DMSO. The inhibitor is diluted into the assays from a solution in 100% DMSO, and controls substitute an equal volume of DMSO so that the final DMSO concentration from Inhibitor and substrate dilutions In all assays is 6.0%. Assays are performed in assay buffer (150 mM NaCI, 10 mM CaCl2,50 mM Tris-CI pH7.5,0.05% Brij-35) containing 6.0 % DMSO once the substrate and inhibitor are diluted into it The substrate concentration used in the assays is 10 pM. The test is carried out at 37 °C. The fluorescence changes are monitored using an excitation wavelength of 320 nm and an emission wavelength of 340 nm. The reaction mixture is added in duplicate to appropriate wells of a 96 well microfluor plate. The reaction mixture is preincubated with tiie inhibitor for 30 min, the reaction is started by the addition of MMP enzyme and the fluorescence intensity Is measured for 10 min. A time point that is on a linear part of the curve is chosen to determine the activity. The inhibition results are expressed as the inhibitor concentrations that produced 50% Inhibition (IC so) of the activity in the control (non-inhibited) reacb'on. In this test, the compounds of the formula i and their phamfiacoiogically acceptable salts have an inhibiting concentration IC so [^moI/litre] of 0.0001 and 0.030, usually of 0.0002 to 0.010, for MMP2 and an inhibiting concentration IC » [lamol/Iitre] of 0.0005 and 0.125, usually of 0.001 to 0.05, for MT1-MMP. Compounds of formula I exhibit an inhibiting concentration ICso for MMP1 (collagenase 1) that is up to 1000-fold higher than the ICso for MT1-MMP, generally it is about 40-fold to 200-fold higher.' Compounds of formula I exhibit an inhibiting concentration IC so for MMP1 that is up to 5000-fold higher than the ICso for MMP2, for most compounds of formula I it is about 100-fold to 2000-fold higher. The enzyme used in the above test are prepared as follows: MT1-MMP: Plasmid: The catalytic domain of the cDNA fragment encoding a full length of human MT1-MMP gene [from Prof. Motoharu Seil same buffer, the bound proteins are eluted with two volumes of a linear gradient of 0.5-1.0 M NaCI. The collected fractions (1 ml each) are dialyzed for 6 h in equilibrated buffer. Superdex G200 column (1x15 cm) (Amersham Pharmacia) is equilibarated in 20 mM Tris-' CI, pH 7.5, 5 mM CaCl2,0.02% NaNs. The desalted sample is applied to Superdex G200 column and chromatographed at 0.5 ml/min. Fractions of 1 ml are collected and 30 ml aliquots are analyzed by immunoblotting. Fractions showing ttie highest purity are pooled, concentrated in an Amicon stirred cell with a YM2 membrane and stored at -80°C. TTie eluted protein is dialyzed twice against 5 L buffer of 5 mM CaCI 2, 0.5 mM ZnS04, 20 mM Tris-CI pH7.5, then concentrated in an Amicon stirred cell with a YM2 membrane. Under these conditions, the recombinant proteins remain soluble and are correctly folded. MMP1 (Collaoenase 1) Plasmid: The cDNA for human collagenase is generated by PCR of cDNA derived from RNA isolated from human U937 cells (ATCC# CRL-2367). The primers, used to generate this cDNA, are AAGAAGCTTAAGGCCAGTATGCACAGCTTTCCT and AAGGCGGCCGCA CACCTTCTTTGGACTCACACCA, con-esponding to nucleotides 58 to 1526 of the reported cDNA sequence, GenBank accession number X05231. The resulting cDNA fragment Is subcloned Into Not I site of a mammalian expression vector pBPV-MMT (Matthias, P. et al.. J. Mol. Biol. 1986,187(4):557-68). 0127 cells (ATCC-mouse mammary tumor cell line) are grown in Dulbecco's Modified Essential Medium supplemented with 10% heat inactivated fetal bovine serum and IX antibiotic-antimycotic solution at 37 °C In a humidified CO a Incubator. Cells seeded at 8 x 10° in 100 mm dishes are transfected using a calcium phosphate precipitation method. 5 h prior to transfection, medium is replaced with fresh medium. Each dish is transfected with 15 Jig of the expression vector. Cells ire washed twice with PBS 16-18 h after transfection and are incubated in growth medium for an additional 48 h. Clones are then selected by incubation with the Neomycin related antibiotic G418 at a concentration of 400 ^ml. Media from selected clones are analyzed for collagenase expression by an enzymatic assay. Expression and Purification: 16 liters of culture medium are concentrated to 1.6 liters and tiie enzyme is Isolated by the procedures described by Wilhelm etal. (Proc. Nati. Acad. Sd. (USA). 1987; 84:6725-29). The final product is furttier purified on a Superose G-75 (Phannada/LKB, Piscataway. NJ) gel filtration column equilibrated in tiie assay buffer containing 0.15 M NaCI. Enzyme is pooled and stored in aliquots at -70°C. Recombinant procollagenase (43-45 kDa) is activated with 1 mM APMA (AminoEhenylmercuric acetate, ICN Pharmaceuticals) for 2 h at S/'C, and the APMA Is removed by extensive dialysis against the assay buffer containing 0.1 Sf^ NaCI. The activated enzyme (~36-kDa) is store( frozen at -TCC until use. MMP2 (Gelatinase A) Plasmid: The cDNA for human proMMP2 is supplied by Prof. Motoharu SeikI, Institute of Medical Science, The University of Tokyo. The cDNA encoding a full length on human pro-MMP2 is generated by PCR of cDNA derived from RNA isolated from human HT1080 cells (ATCC# CCL121). The primers to generate this cDNA are GAATTCGATGGAGGCG CTAATGGCCCGG and CTCGAGTCAGCAGCCTAGCCAGTCGGATTTGAT correspondim to full length human pro-MMP2 of the reported cDNA sequence, GenBank accession number J03210. The resulting 2.0 Kb PCR fragment is cloned Into EcoR1/Xho 1 site of pFAST BAG 1 vector (pBAC-MMP2) (Collier, I.E., Wilhelm, S.M.. Eisen, A.Z., Manner, B.L. Grant, G.A., Seltzer, J.L., Kronberger, A., He, C, Bauer, E.A. and Goldberg, Q.I. J. Biol. Chem.. 263:6579-6587,1988). Expression and Purification: For baculovirus expression of r-proMMP2, pBAC-MMP2 is transfonned into DH10BAC competent cells to produce a r-proMMP2 bacmid DNA. The recombinant bacmid DNA is transfected into cultured insect cells (Tn cells) with Cellfectin reagent (Gibco BRL). Recombinant baculovlms are plaque purified to homogeneity and are used to generate high titer stocks of the recombinant baculovirus. Expression of r-proMMP! is confirmed by gelatin zymography. Culture fluids of Tn cells infected with baculovirus are centrifuged and filtrated through a 0.22 mm pore size filter to remove cell debris. The recombinant proMMP2 as absorised to gelatin Sepharose 4B (Pharmada Biotech) In equilibration buffer of in 25 mM Tris-HCi (pH 7.5). 1 M NaCI, 10 mM CaCU, 0.05% BrijI 35 at 4^0. After washing the beads with equilibration buffer, r-proMMP2 as eluted witii equilibration buffer containing 10% DMSO. The enzyme are stored at 4'C until activation. For assay, the purified proMMP2 Is activated with 1 mM APMA for 1 hr at 37°C. MMP9 MMP9 Is prepared tovm ttie culture medium of THP1 human monocytic leukemia cells ti^eated wittr TPA. THP1 cells are maintained in a culture of DMEM/F-12 witii 10% FCS and stimulated to produce pro-MMP9 witii TPA (1 nM) in serum-free medium for 48 h. All purification procedures are carried out at 4"'C. The 1 liters of culture medium Is concentrated to 100 ml by Centricon (Amicon) and applied to a column (1x8 cm) of gelatin- sepharose (Phamiacia) equilibrated with 50 mM Tris-CI (pH=8.0), 300 mM NaCI. The fraction containing pro-MMP-9 is eluted with 10% DMSO in 50 mM Tris-CI (pH=8.0), 300 mM NaCI, then dialyzed against 50 mM Tris-CI (pH 7.5), 150 mM NaCI. The fraction is concentrated by Centricon and subjected to column chromatography of Sephadex G200 (2 x 20 cm) equilibrated with 50 mM Tris-CI (pH=7.5) containing 150 mM NaCI. The purified Pro-MMP9 is stored at -SO'C as a stock and the necessary amount of pro-form is used for activation. Pro-MMP9 is activated with 1 mM aminophenyl mercury acetate (APMA, ICN Phamna-ceutlcals) in 50 mM Tris-CI (pH=7.5) containing 150 mM NaCI, 10 mM CaClj and 0.05% Brij-35 (MMP Assay Buffer) for 18h at 37°C, and the APMA is removed by extensive dialysis against MMP Assay Buffer. The activated MMP9 is stored frozen at -80°C until use. Assav of MMP9 The activated MMP-9 (82 kDa) is then used to screen compounds. A fluorogenlc peptide, 2-N-methylamlnobenzoicacid(Nma)-Gly-Pro-Gln-Gly-Leu-Ala-Gly-Gln-Lys-N*-(2,4-dinitro-phenyl)(Dnp)-NH2 (Peptide Institute, Osaka, Japan) is used as the only substrate in all MMPs assay in this study at 25 ^M. Stock solutions of the substrate are prepared in 100 % DMSO at a concentration 1.0 mM. Assays are performed in MMP Assay Buffer. The reaction mixture is added in duplicate to appropriate wells of a 96 well microfluor plate and preincubated at 37° for 30 min. The reaction is started by tiie addition of 0.5 nM of activated MMP9. Stock solutions of each inhibitor are prepared by dissolving in 100% DMSO. Inhibitors are added into the assay mixture from the diluted solution with 100% DMSO prepared from tiie stock solutions. An equal volume of DMSO is added to controls. The final concenti^tion of DMSO from inhibitor and substrate solutions is 5.0%. The increase of fluorescence is monitored at 460 nm with excitation at 355 nm. A time point on a linear part of the curve is chosen to detemnine the activity. The inhibition resulte are expressed as tiie inhibitor concentration that produce 50% inhibition (IC so) of tiie activity in tiie control reaction. The anti-tumor effect of compounds of fomnula i can also be demonstrated e.g. in wvo in metastasis models using EGFP transfected HT1080 cells measuring the fluorescence intensity of tumor cells metastasized into the lung of nude mice with intravenously injected lumor cells or using tJie-MO melanoma cells measuring lung tumor nodules after i.v. Injection of tumor cells into BDF1 mice. EGFP transfected HT1080: Nude mice were Injected in the tail vein a suspension of tumor cells [2x10® cells / 0.1 ml of PBS (phosphate buffered saline)]. Animals were dosed with compounds p.o. at -1 hr and +5 hrs relative to the time of the cell injection at the first day (day 0). After that the animals were dosed twice a day, firstly at 9 -10:30 a.m. and secondly at 5:30 - 7:00 p.m. Compounds were administered as a suspension In 1 % carboxymethyl cellulose (Wako, Japan) at a dose of 60 mg^g twice a day. The vehicle alone was administered to the control group. On day 17, the lungs were removed from mice after sacrificing the animals. The removed lung tissues were divided into pieces of approximately 2-3 mm in diameter and then ca. 100 mg of tissues were suspended in 0.2 ml PBS in the microcentrifuge tubes followed by gentle homogenization and centrifugation. The cells were washed 3 times with 1 ml of lysing reagent (150mM NH4CI, 0.1 mM EDTA-4 Na, lOmM KHCO3 pH7.4) to lysis red blood cells and 2 times with 1 ml of PBS at room temperature. After the final wash, the cells were lysed with 0.5 ml of 1 % Triton in PBS. After centrifugation at 15000 rpm for 5 min, 0.23 ml of each supematants w as transferred into the well of a 96-weil multi plate. The fluorescence intensity w as determined by using fluorescence plate reader (Cytoflour II) at the excitation and emission wavelength of 485 and 530 nm, respectively. The obtained fluorescence was normalized per lung using the wet lung weight, in this test a decrease in the fluorescence of 74 % compared to the vehicle alone was determined for the compound of Example 68. The B16-F10 melanoma experimental metastasis model was studied following the method of Rdler. Cells were harvested by trypsinlzatlon and washed once with serum-containing medium and three times with cold PBS and then kept on ice. Mice were injected in the tail vein with a suspension of tumor cells (2x1 o' cells / 0.1 ml of PBS). Animals were dosed with compounds p.o. at -1 hr, +5 hrs, 23 hrs and 29 hrs relative to the time of ttie cell injection at the first two days (day 0,1). After that the animals were dosed once a day in tiie morning. Compounds were administered as a suspension in 1 % cartx>xymettiyl cellulose (Wako, Japan) at a dose of 120 mg/kg/dosing. Vehicle atone was administered to the control group. On day 14, the lung of ttie mice were removed after sacrificing tiie animals and tiie numbers of the tumor nodules were counted manually after fi}dng witii Bouin's solution (2 % picric acid in destilled water: 10 % fonnnaldehyde neutral buffer solution: acetic add = 15 : 5 :1). In this test a decrease in tlie number of tumor nodules of 47 % compared to the vehicle alone was detemiined for the compound of Example 68. The antitumor effect of the compounds of the invention can be determined e.g. by measuring the growth of hunian tumors implanted subcutaneously In Balb/c nude treated mice according to methodology well-known in the art in comparison to placebo treated mice. Illustrative tumors are e.g. estrogen dependent human breast carcinoma BT20 and MCF7, human bladder carcinoma T24, human colon carcinoma Colo 205, human lung adenocarcinoma A549 and human ovarian carcinoma NIH-OVCAR3. The effect on tumor angiogenesis can be determined e.g. in rats implanted with Walker 256 carcinoma in pellets to stimulate angiogenesis from vessels of the limbus, as described by Galardy et al, Cancer Res. 54. 4715 (1994). The compounds of the formula I inhibit matrix degradation and are therefore very highly suitable for the treatment of diseases which respond to inhibition of the activity of the enzymes MT1-MMP and MMP2. Osteoporosis, in particular, can be mentioned here, and also other diseases In whose course bone resorption by osteoclasts play a part, e.g. tumor-induced h^ercalcaemia, Paget's Disease or the treatment of bone metastases, and also inflammatory processes in joints and bones and degeneratives processes in cartilaginous tissue. In particular, the compounds of formula I are useful for the treatment of benign or malignant tumours which respond to Inhibition of the enzymes MT1-MMP and MMP2, e.g breast, lung, bladder, colon, ovarian, brain, and skin cancer by Inhibiting tumor growth, tumor metastasis, tumor progression or invasion and/or tumor angiogenesis. They are able to cause tumour regression and to prevent the growth of micrometastases. Other conditions to be treated with the compounds of the Invention include rheumatoid arthritis, osteoarthritis, bronchial disorders (such as asthma by inhibiting the degradation of elastin), atiierosderotic conditions (by e.g. inhibiting rupture of atiierosclerotic plaques), as well as acute coronary syndrome, heart attacks (cardiac ischemia), strokes (cerebral ischemia), restenosis after angioplasty, and also vascular ulcerations, ectasia and aneurysms. Furtiier conditions to be treated witii ttie compounds of the inventi'on are inflammatory demyelinating disorders of the nen^ous s^tem in which myelin desbuction or loss is involved (such as multiple sclerosis), optic neuritis, neuromyelitis optica (Devic's disease), diffuse and transitional sclerosis (Schiider's disease) and acute disseminated encephalomyeiitis, also demyelinating peripfieral neuropathies such as Landry-Guillain-Barre-Strohl syndrome for motor defects; also tissue ulceration (e.g. epidennai and gastric ulceration), abnormal wound healing and periodental disease. Also endometriosis, septic shock, inflammatory bowel disease, Crohn's disease and the like can be treated by the compounds of formula I. Ocular applications of the compounds of the invention include the treatment of ocular inflammation, corneal ulcerations, pterygium, keratitis, keratoconus, open angle glaucoma, retinopathies, and also their use in conjunction with refractive surgery (laser or incisional) to minimize adverse effects. Certain metalloproteinase inhibitors have been reported to also inhibit the production and release of tumor necrosis factor (TNF), e.g. TNF-a which is an important mediator of inflammation. Thus, compounds of the invention are potential anti-inflammatory agents in mammals. The effect of the compounds of the invention on atherosclerotic conditions can be svaluated using atherosclerotic plaques from cholesterol-fed rabbits which contain activated natrix metalloproteinases as described by Sukhova et al, Circulation 90,1404 (1994). The nhibitory effect on matrix metalloproteinase enzyme activity in rabbit atherosclerotic >iaques can be detennined by in situ zymography, as described by Galis et al, J. Clin, nvest. 94,2493 (1994), and is indicative of plaque rupture. "he effect on vascular aneurysms, e.g. the inhibition of aneurysm formation, can be letemoined in e)q}erimental models such as Apo-E transgenic mice and/or LDL receptor nockout mice. Abdominal aortic aneurysms represent a chronic degenerative condition [ssociated witii a life-threatening risk of oipture. Aneurysm development can be uppressed by the compounds of fonnula I. he effect on restenosis and vascular remodeling can be evaluated in tiie rat ballooned arotid artery model. The effect on demyellnating disorders of the nervous system, such as multiple sclerosis, can be evaluated by measuring the reversal of experimental autoimmune encephalomyelitis in mice, e.g. as described by Gijbels et al, J. Clin. Invest. 94i 2177 (1994). The invention relates especially to compounds of formula I, wherein R^ is hydrogen, lower alkyl; monocyclic or bicyclic carbocyclic aryl which is unsubstituted or mono-, di- or trisubstituted by lower alkyl, lower alkoxy, hydroxy, halogen, cyano, trifluoromethyl, phenoxy or phenyl which is unsubstituted or substituted by lower alkoxy, lower alkyl, halogen, cyano, nitro, trifluoromethyl or lower-alkyienedioxy; mono- or bicyclic heterocyclic aryl which is unsubstituted or substituted by one, two or more identical or different substituents selected from the group consisting of free, etherified and esterified hydroxyl groups; mercapto, lower alkylthio, substituted and unsubstituted phenyfthio groups, halogen, oxo groups, which are in the fomri of formyl and keto groups and corresponding acetals or ketals, azido, nitro, primary, secondary and tertiary amino, acylamino, diacylamino and unmodified or functionally modified sulfo groups; free and functionally modified carboxyl groups, carbamoyl, ureido, guanidino and cyano; carbocyclic aryl-lower alkyl which is unsubstituted or mono-, di- or trisubstituted by lower alkyl, lower alkoxy, hydroxy, halogen, cyano, trifluoromethyl, phenoxy or phenyl which is unsubstituted or substituted by lower alkoxy, lower alkyl, halogen, cyano, nitro, trifluoromethyl or lower-alkylenedioxy in the carbocyclic moiety; substituted or unsubstituted heterocyciic-lower alkyl which is unsubstituted or substituted by one, two or more identical or different substi tuents selected from the group consisting of free, etherified and esterified hydroxyl groups; mercapto, lower alkylthio, substituted and unsubstituted phenylthio groups, halogen, oxo groups, which are in the form of fomiyl and keto groups and corresponding acetals or ketals, azido, nitro, primary, secondary and tertiary amino, acylamino,. diacylamino and unmodified or functionally modified sulfo groups; free and functionally modified carboxyl groups, carisamoyi, ureido, guanidino and cyano, in the heterocyclic moiety; Ca-CT-cycioalkyI, which is unsubstituted or substituted by lower aikyt; Cs-CT-cycloalkyl-iower alkyl, which is unsubstituted or substituted by lower alkyl; hydroxy-Iower alkyl, lower alkoxy-lower alkyl, lower alkyl-(thlo, suffinyl or sulfonyl)-lower alkyl, amino-lower alkyl or mono* or di-iower alkylamlno-lower alkyl; R^ is hydrogen or lower alkyl; R^ is C3-C7-cycloalkyl, which is unsubstituted or substituted by lower alkyl; carbocyclic aryl, which is unsubstituted or mono-, di- or trJsubstituted by lower alkyl, lower " alkoxy, hydroxy, halogen, cyano, trifluoromethyl, phenoxy or phenyl which is unsubstituted or substituted by lower alkoxy, lower alkyl, halogen, cyano, nitro, trifluoromethyl or lower- alkylenedioxy; heterocyclic aryl, which is unsubstituted or substituted by one, two or more identical or different substituents selected from the group consisting of free, etherified and esterified hydroxyl groups; mercapto, lower alkylthio, substituted and unsubstituted phenylthio groups, halogen, oxo groups, which are in tiie form of fonnyl and keto groups and corresponding acetals or ketals, azido, nitro, primary, secondary and tertiary amino, acylamino, diacyiamino and unmodified or functionally modified suifo groups; free and functionally modified cariDOxyl groups, cariDamoyI, ureido, guanidino and cyano; heterocyclyl, which Is unsubstituted or substituted by one, two or more identical or different substituents selected from the group consisting of free, etherified and esterified hydroxyl groups; mercapto, lower alkylthio, substituted and unsubstituted phenylthio groups, halogen, oxo groups, which are in tiie form of fonnyl and keto groups and corresponding acetals or ketals, azido, nitro, primary, secondary and tertiary amino, acylamino, diacyiamino and unmodified or functionally modified sulfo groups; free and functionally modified cariaoxyl groups, carbamoyl, ureido, guanidino and cyano; or lower alkyl; A is C1-C3 alkylen unsubsb'tuted or substituted by lower alkyl; q is 1-5; and R is Ca-CralkyI, which is mono-, dl- or trisubstltuted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, Ca-Cg-cycloalkyl or Ca-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S and N, which is unsubstituted or substituted by lower alkyl; or Ca-Cralkenyl or CrCralkynyl, which In each case is unsubstituted or mono-, dl- or trisubstituted by halogen, nitro, lower acyloxy, trifluorometiioxy, cyano, C s-Cs-cycioalkyI or Cs-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S and N, which is unsubstituted or substituted by lower alkyl; and ttieir phannaceuticaliy acceptable prodrug derivatives; and pharmaceutically acceptable salts. Preferred is a compound of formula I, wherein R^ is hydrogen, substituted or unsubstituted aryl, lower alkyl, substituted or unsubstituted ' carbocyclic aryl-lower alkyl, substituted or unsubstituted heterocydic-lower alkyl, substituted or unsubstituted Ca-CT-cydoalkyI, substituted or unsubstituted Ca-CT-cycloalkyl-lower alkyl, hydroxy-lower alkyl, lower alkoxy-lower alkyl, lower alkyl-(thlo, sulfinyl or sulfonyl)-ldwer alkyl, amino-lower alkyl or mono- or di-lower alkylamino-iower alkyl; R^ Is hydrogen or lower alkyl; R^ is substituted or unsubstituted Ca-CT-cycloalkyI, substituted or unsubstituted carbocyclic aryl, substituted or unsubstituted heterocyclic aryl, or lower alkyl; A is Ci-Cs alkylen unsubstituted or substituted by lower alkyl; q is 1-5; R is Ca-Cy-alkyl, which is mono-, dl- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy or cyano; Ca-Cralkenyl or Ca-CT-alkynyl, which in each case is unsubstituted or mono-, dl- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy or cyano; and pharmaceutically acceptable prodrug derivatives; and phannaceutically acceptable salts thereof. Furthermore, a compound of formula I is preferred, wherein Ri is hydrogen, lower alkyl, or carijocycllc aryl-lower alkyl which is unsubstituted or mono-, dl- or trisubstituted by lower alkyl, lower alkoxy, hydroxy, halogen, cyano, trifluoromethyl, phenoxy or phenyl which is unsubstituted or substituted by lower alkoxy, lower alkyl. halogen, cyano, nitro, trifluoromethyl or lower-alkylenedioxy In the carbocyclic moiety; Ra Is hydrogen or lower alkyl; R3 is Ca-CT-cycloalkyI, which is unsubstituted or substituted by lower alkyl, cari30cyclic aryl, which is unsubstituted or mono-, di- or trisubstituted by lower alkyl, lower alkoxy, hydroxy, dl-lower alkyl amino, halogen, cyano, trifluoromethyl, phenoxy triazolyl, imidazoiyi, morpholinyl, pyrrolidinyl, piperidinyl, tetrazolyl, pyrroiyi, furyi, thienyi, morpholinyl lower alkyt, quinolinyl lower alkyl, imkJazolyl lower alkyt and triazolyl lower alkyl or phenyl which is unsubstituted or substituted by lower alkoxy, bwer alkyl, halogen, cyano, nitro, trifluorome%i or lower-alkylenedioxy; heterocyclic aryl, which is unsubstituted or substituted by one, two or more identical or different substituents selected from the group consisting of free, etherified and esterified hydroxyl groups; mercapto, lower alkylthio, substituted and unsubstituted phenylthio groups. Inalogen, oxo groups, which are in the fomn of fonnyl and keto groups and corresponding acetals or ketals, azido, nitro, primary, secondary and tertiary amino, acylamino, diacylamino and unmodified or functionally modified sulfo groups; free and functionally modified carboxyl groups, carbamoyl, ureido, guanidino and cyano; heterocyclyl, which is unsubstituted or substituted by one, two or more identical or different substituents selected from the group consisting of free, etherified and esterified hydroxyl groups; mercapto, lower alkylthio, substituted and unsubstituted phenylthio groups, halogen, oxo groups, which are in the form of formyl and keto groups and con'espondlng acetals or ketals, azido, nitro, primary, secondary and tertiary amino, acylamino, diacylamino and unmodified or functionally modified sulfo groups; free and functionally modified carboxyl groups, cari^amoyl, ureido, guanidino and cyano; or lower alkyl; A is CrCa alkylen unsubstituted or substituted by lower alkyl; q is 1 or 2; R is Ca-CralkyI, which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, Ca-Cs-cycloalkyI or Cg-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S and N, which is unsubstituted or substituted by lower alkyl; or Ca-Cralkenyl or CrCT-alkynyl, which in each case is unsubstituted or mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, C a-Cs-cycloalkyI or Ca-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S and N, which is unsubstituted or substituted by lower aik^; and phamnaceutlcally acceptable prodrug derivatives; and phannaceutically acceptable salts thereof. The invention relates In particular to compounds of formula I, wherein Ri is hydrogen, lower alkyl, or substituted or unsubstituted cartx)cyclic aryi-lower aikyi; Ha is hydrogen or lower alkyl; R3 is substituted or unsubstituted Cs-CVc^cloalkyi, substituted or unsubstituted carbocyciic aryi, substituted or unsubstituted heterocyclic aryi, or tower alkyi; A is C1-C3 alkylen unsubstituted or substituted by lower alkyl; q is 1 or 2; and R is C2-C7-alkyl, which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy or cyano; Ca-CT-alkenyl or Ca-Cralkynyl, which in each case is unsubstituted or mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy or cyano. Compounds of formula 1 which are preferred are those in which Rt is hydrogen, lower alkyl, or substituted or unsubstituted carbocyclic aryl-lower alkyl; R2 is hydrogen or lower alkyl; R3 is substituted or unsubstituted Ca-CT-cycloalkyI; phenyl which is unsubstituted or mono- or disubstituted by lower alkyl, lower alkoxy, hydroxy, nitro, amino, lower-alkyi amino, carbamoyl, trifluoromethyl, trifluoromethoxy, lower alkylthio, lower acyloxy or halogen; pyridyl, pyrimidyl, pyrryl, imidazolyl, indolyl, thienyl, benzothienyl, furyl, benzofuranyl, oxazolyl, thiazolyl; or lower alkyl; A is C1-C3 alkylen unsubstituted or substituted by lower alkyl; q is 1 or 2; R is C2-C7-alkyl, which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy or cyano; Cs-Cy-alkenyl or CrCr-alkynyl, which in each case is unsubstituted or mono-, di- or trisubstituted by haJogen, nitro, lower acyloxy, trifluoromethoxy or cyano; and their phamiaceutically acceptable prodmg derivatives and their phamnaceutlcally acceptable salts. The Invention relates in particular to compounds of formula I, wherein Ri is hydrogen, lower alkyl, or phenyl lower alkyl; R2 Is hydrogen or lower alkyl; R3 is phenyl which is unsubstituted or monosubstituted by lower alkyl, lower alkoxy, hydroxy, nitro, amino, lower-alkyi amino, carbamoyl, trifluoromethyl, lower alkylthio, or halogen; pyridyl, or lower alkyl; A is C1-C3 alkylen unsubstituted or substituted by lower alkyl; q is 1 or 2; R is C2-Crall^i> which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy or cyano; unsubstituted Ca-Cralkenyi or unsubstituted Ca-Cralkynyl; and their phamnaceutlcally acceptable prodrug derivatives and their pharmaceutically acceptable salts. In particular, compounds of formula I are preferred, in which Ri is hydrogen, lower allcyl, or phenyl lower alkyl; R2 is hydrogen; R3 is phenyl monosubstituted by lower alkoxy or halogen; or lower alkyl; A is C1-C3 aikylen; qlsl; R Is C2-C7-alM. which is mono- or trisubstituted by halogen; unsubstituted C rC7-alkenyl or unsubstituted Ca-Cralkynyl; and their pharmaceutically acceptable prodrug derivatives and their pharmaceutically acceptable salts. One prefen'ed embodiment of the invention relates to compounds of fomiula I, wherein Ri Is hydrogen; R2 is hydrogen; R3 is phenyl monosubstituted by lower alkoxy or halogen; A is C1-C3 alkylen; qisi; R is unsubstituted Ca-Cs-alkenyl, in which the double bond is tenninally located; or unsubstituted Ca-Cs-alkynyl, in which the triple bond is tennlnally located; and to their pharmaceutically acceptable prodaig derivatives and their phanriaceutically acceptable salts. Another preferred embodiment of the invention relates to compounds of fonnuia I, wherein Ri Is hydrogen; R2 is hydrogen; R3 Is phenyl monosubstituted by lower alkoxy or halogen; A is methylen or ethylen; qisi; R is unbranched Cs-Cs-alkyI, which is temiinaliy monosubstituted by halogen; and to their pharmaceutically acceptable prodrug derivatives and their pharmaceutically acceptable salts. Very preferred are compounds of formula I, wherein Ri is liydrogen, lower alkyl, or phenyl lower alkyl; Ra is hydrogen; R3 is Ca-CT-cycloalkyI, which is unsubstituted or substituted by lower alkyl; phenyl which is unsubstituted or mono- or disubstituted by lower alkyl, lower alkoxy, hydroxy, nitro, amino, lower alkyl amino, di-lower alkyl amino, carbamoyl, trifluoromethyl, trifluoromethoxy, lower alkylthio, lower acyloxy, halogen, triazolyl, imidazolyl, morpholinyl, pyrrolidinyl, piperidinyl, tetrazolyl, pyrrolyl, furyl, thienyl, morpholinyl lower alkyl, qulnolinyl lower alkyl, imidazolyl lower alkyl, triazolyl lower alkyl; pyridyl, pyrimidyl, pyrryl, imidazolyl, indolyl, thienyl, benzothienyl, furyl, benzofuranyl, oxazoiyi, thiazoiyi, which in each case are unsubstituted or substituted by lower alkyl or halogen; heterocyclyl, which is unsubstituted or substituted by lower alkyl and which is selected from the group consisting of piperidinyl, morpholinyl, pyrrolidinyl, pyrrolinyl, piperazinyi and tetrahydropyranyl; A is methylen or ethylen; qisi; R is Ca-Cr-alkyl, which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, Ca-Cs-cycloalkyI or Ca-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S, and N which is unsubstituted or substituted by lower alkyl; Ca-Cr-alkenyl or Ca-Cralkynyl, which in each case is unsubstituted or mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano; Ca-Cs-cycloalkyI or Cg-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S, and N, which is unsubstituted or substituted by lower alkyl and their pharmaceutically acceptable prodrug derivatives and pharmaceutically acceptable salts. A more preferred embodiment of the invention relates to compounds of formula I, wherein Ri is hydrogen, lower alkyf, or phenyl lower alkyl; R2 is hydrogen; R3 Is phenyl which is unsubstituted or mono- or disubstituted by lower alkyl, lower alkoxy, di-lower alkyl amino, halogen, triazolyl, Imidazole, morpholinyl, pyn-olidinyl, piperidinyl, tetrazolyl, pyrrolyl, furyl, thien^, morpholinyl lower alkyl, qulnolinyl lower alkyl. imidazoM lower alkyl, triazoiyi lower alkyl; pyrldyl, which is unsubstituted or substituted by haolgen; heterocyciyi, which is unsubstituted and which is selected from the group consisting of piperidinyl, morpholinyl, pyn'olidlnyl, pyrrolinyl, piperazinyl and tetrahydropyranyl; A is methylen; qis1; R is unsubstituted Ca-Cs-alkenyl, In which the double bond is terminally located; unsubstituted Cs-Cs-alkyny^. in which the triple bond is temiinally located; or unbranched C 3- Cralkyl, which is terminally monosubstituted or trisubstituted by halogen, or tenninally monosubstituted by furyl or cyclopropyl; and to pharmaceutically acceptable prodrug derivatives; and pharmaceutically acceptable salts thereof. The compounds of the formula I and their pharmaceutically acceptable prodrug derivatives and phamriaceutically acceptable salts are prepared by processes known per se, for example a) by reacting a compound of the formula II in which R, q, Ri and R2 are as defined above for compounds of the formula I and the black circular plane indicates ttiat the compound is bound to a polymer resin, free functional groups present in the compound, if necessary, being protected by easily detachable protective groups, In a suitable solvent, e.g. tetrahydrofuran, first with triphenylphosphine, an alcohol of the structure III, ("') i in which A and R3 are as defined above for compounds of formula I, and diethyl azodi-carboxylate, free functional groups present in this compound, if necessary, being protected by easily detachable protective groups or, in accordance with the principle of latent functio-" nality, being in a fonn which can be converted into the functional groups and then to cleave the product of the reaction from the polymer resin by a further reaction with trifluoroacetic acid in a suitable solvent, e.g. dichloromethane, or b) by reacting a compound of the formula IV n which R, q, A, Ri, R2 and R3 are as defined above for compounds of the formula I, free unctional groups present in the compound, if necessary, being protected by easily letachable protective groups, in a suitable solvent, e.g. dichloromethane, first with >xalylchlorlde in dimethylformamlde and then with hydroxylamine in a mixture of water and Btrahydrofuran, or ) by reacting a compound of the fomiula V in which R, q, A, Ri, R2 and R3 are as defined above for compounds of the fomiula I, free functional groups present in the compound, if necessary, being protected by easily detachable protective groups, in a suitable solvent, e.g. acetic acid ethyl ester, with aqueous hydrogendilorlde and, after carrying out process a), b) or c) and detaching the protective groups present and, if necessary, converting functional groups into the final fomi according to formula I, if necessary for the preparation of a salt, converting a resulting free compound of the fomiula I into a salt or, if necessary for preparation of a free compound, converting a resulting salt of a compound of the formula Unto the free compound. Processes b) and c) are preferred for compounds of formula I in which R i and R2 are both hydrogen at the same time. The above processes are described in more detail below: The end substances of the fomnula I can contain substituents which can also be used as protective groups in starting substances for the preparation of other end substances of the formula I. Unless otherwise evident from the context, "protective groups" in this text, are therefore only those easily detachable groups which are not a constituent of the particular desired end substance of the formula I. Protective groups, their introduction and their detachment are described, for example, in "Protective Groups in Organic Chemistry", Plenum Press, London, New York 1973, and in "Methoden der organischen Chemie" [Methods of Organic Chemistry], Houben-Weyl, 4th Edition, Volume 15/1, Georg-Thieme-Verlag, Stuttgart 1974 and in T. W. Greene, "Protective Groups in Organic Synthesis', John V^flley & Sons, New York 1981. It Is characteristic of protective groups that they can be detached easily, i.e. without undesirable side reactions taking place, for example by solvolysis, reduction, photolysis or also under physiological conditions. Protection of free functional groups in tiie starting material of the formula II Is as a rule not necessary. If desired, free carboxyl or amino groups In the radicals R, R1, R2 or R3 of a compound of formula II, III, IV or V can be present in protected form. Functional groups, such as, In particular, leaving groups, for example halogen or toluenesulfonate, however, can also be present, in accordance witii the principle of latent Ajnctionality, in a fomi which can be converted Into one of the functional groups according to formula I. Thus, a protected amhio group, e.g. incorporated In radical R, can first be set free by detaching the amino- protective group and the free amino group can then be converted into halogen via an azide in a manner known per se. A protected amino group can be, for example, in the form of an easily detachable acyi-amino, arylmethylamino, ethprified mercaptoamino or 2-acyl-lower alk-1-en-yi-amino group. In a corresponding acylamino group, acyl is, for example, the acyl radical of an organic carboxylic acid having, for example, not more than 18 C atoms, in particular an alkane-carboxylic acid which is unsubstituted or substituted, for example by halogen or aryl, or of a benzoic acid which is unsubstituted or substituted, for example by halogen, lower aikoxy or nitro, or of a carbonic acid half-ester. Such acyl groups are, for example, lower alkanoyl, such as formyi, acetyl or propionyl, halo-lower alkanoyl, such as 2-haloacetyi, in particular 2-chloro-, 2-bromo-, 2-iodo-, 2,2,2-trifIuoro- or 2,2,2-trichloroacetyl, benzoyl which is unsubstituted or substituted, for example by halogen, lower aikoxy or nitro, for example benzoyl, 4-chlorobenzoyl, 4-methoxybenzoyl or 4-nitrobenzoyl, or lower alkoxycarbonyl which is branched in \he 1 position of tiie lower alkyl radical or suitably substituted in the 1 or 2 position, in particular tert-lower alkoxycarbonyl, for example tert-butyloxycarbonyl, arylmethoxycarbonyl witii one or two aryl radicals, which are preferably phenyl which is unsubstituted or mono- or polysubstituted, for example by lower alkyl, in particular tert-lower alkyl, such as tert-butyl, lower aikoxy, such as methoxy, hydroxyl, halogen, for example chlorine, and/or nitro, such as unsubstituted or substi'tuted benzyloxycarbonyl, for example 4-nitro-benzyloxycarbonyl, or unsubstituted or substituted diphenylmethoxycarbonyl, for example benzhydryloxycarbonyl or dl-(4-metiioxyphenyl)-methoxycaitonyl, aroylmetiioxy-carbonyl. In which the aroyl group is preferably benzoyl which Is unsubstituted or substi¬tuted, for example by halogen, such as bromine, for example phenacyloxycarbonyl, 2-halo-lower alkoxycarbonyl, for example 2,2,2-trichloroethoxycarbonyl, 2-bromoethoxy-carbonyi or 2-iodoethoxycarbonyi, or 2-(trlsubstituted sllyl)-ethoxycarbonyi, in which the substituents independentiy of one another are each an aliphatic, araliphatic, cycloallphatic or aromatic hydrocarbon radical which has not more than 15 C atoms and is unsubstituted or substi¬tuted, for example substituted by lower alkyl, lower aikoxy, aryl, halogen or nitro, such as con'esponding unsubstituted or substituted lower alkyl, phenyl-lower alkyl, cycloalkyi or phenyl, for example 2-tri-lower alkylsilylethoxycarbonyl, such as 2-trimethyisilyl-ethoxy-carbonyl or 2-(cK-n-butyi-methyl-siIyi)-ethoxycarbonyl, or 2-triarylsllyIethoxycarbonyt, such as 2-tiiphenylsiiylethoxycarbonyl. In an arylmethylamino group which is a mono-, di- or, in particular, triarylmethylamino group, the aryl radicals are, in particular, substituted or unsubstituted phenyl radicals. Such groups' are, for example, benzyl-, diphenylmethyl- and, in particular, tritylamlno. An etherified mercapto group in an amino group protected with such a radical is, in particular, arylthio or aryl-lower alkylthio, in which aryl is, in particular, phenyl which is unsubstituted or substituted, for example by lower alkyl, such as methyl or tert-butyl, lower alkoxy, such as methoxy, halogen, such as chlorine, and/or nitro. A con-esponding amlno-protective group is, for example, 4-nitrophenylthlo. In a 2-acyl-lower alk-1-en-1-yl radical which can be used as an amino-protective group, acyl is, for example, the con-esponding radical of a lower alkanecarboxyllc acid, of a benzoic acid which is unsubstituted or substituted, for example by lower alkyl, such as metiiyl or tert-butyl, lower alkoxy, such as methoxy, halogen, such as chlorine, and/or nitro, or, in particular, of a carbonic acid half-ester, such as a carbonic acid lower alkyl half-ester. Con-esponding protective groups are, in particular, 1 -lower alkanoyl-prop-1 -en-2-yl, for example 1 -acetyl-prop-1 -en-2-yl, or 1 -lower alkoxycarbonyl-prop-1 -en-2-yl, for example 1 -ethoxycarbonyl-prop-1 -en-2-yl. Preferred amino-protective groups are acyl radicals of carbonic acid half-esters, in particular tert-butyloxycarbonyl, benzyloxycarbonyl which is unsubstituted or substituted, for example as defined, for example 4-nitro-benzyloxycart>onyl, or diphenylmethoxycarbonyl, or 2-halo-lower alkoxycarbonyl, such as 2,2,2-tiichloretiioxycarbonyl, and furtiiermore tiityl or fonnyl. Prefen'ed protected carboxyl groups are, for example, tert-butoxycarbonyl, benzyloxy¬carbonyl or diphenylmethoxycarbonyl which are unsubstituted or substituted, or 2 -trimetiiyl-sllyl-etiioxycarbonyl. The reaction between tiie derivative of tiie formula II and the alcohol of tiie fomnula 111 can be. carried out in suitable inert solvents. If possible, on tiie basis of ttie physical nature of the alcohol of tiie fomraula III, however, tiie reaction can also be carried out without a foreign solvent, and the ateohol of ^e formula III is employed In a large excess, for example a hundred times the equivalent amount, both as tiie reagent and as tiie solvent The reaction Is carried out under shaking or stirring and under an argon or nitrogen atmosphere. Depending on the nature of the specific reactants the reaction is carried out at a tempe¬rature between 0 °C and 90 °C, preferably between +20 "C and +60 "C, for example at room temperature or 50 "C. Optionally it is carried out in a high pressure tube. After a period of for example between 12 and 24 hours, further triphenylphosphine, diethyl azodl-carboxylate and also alcohol of formula III can be added. The product of the first reaction stage is filtered of and washed with tetrahydrofuran, an alcohol, e.g. 2-propanol, and dichloromethane. Cleavage of the product from the polymer resin is accomplished by treatment of the reaction product with trifluoroacetic acid In dichloromethane for 15 to 30 minutes at a temperature between 20 "C and 50 "C, e.g. room temperature or 30 "C. The cleavage reaction of the compound of the formula V can be carried out in suitable inert solvents, like acetic acid ethyl ester or tetrahydrofuran. The solvent can also be pure water or a mixture of water with another solvent, depending on the solubility of the compound of fomnula V in which case the solvent water would also be the reagent. The reaction is usually canied out at room temperature, but it can also be carried out at temperatures between 0 °C and 100 "C depending of the reactivity of the compound of formula V. Normally, the cleavage reaction is can-ied out with aqueous hydrogen chloride, but other Bronsted acids and Lewis acids can also be employed instead, like e.g. hydrogen bromide, diluted sulfuric acid, p-toluene sulfonic acid, boron trifluoride or metall cations. The protective groups which are not a constituent of the desired end product of the fonmula I are detached In a manner known per se, for example by means of solvolysis, in particular hydrolysis, alcoholysls or acldolysis, or by means of reduction, in particular hydrogenoiysis or chemical reduction, if necessary in stages or simultaneously. The detachment of the protective groups can be earned out before, after or simultaneously with tfie cleavage of the product from the polymer resin. A protected amino group is set free In a manner known per se and, depending on the nature of the protective groups, In diverse manners, preferably by means of solvolysis or reduction. 2-Halo-iower alkoxycarisonylamino (if appropriate after conversion of a 2-bromo-lower alkoxycarbonylamino group into a 2-iodo-iower alkoxycarbonylamino group), aroyt-methoxycarbonylamino or 4-nitrobenzyloxycarbonylamlno can be split, for example, by treatment witii a suitable chemical reducing agent, such as zinc in the presence of a suitable carboxyiic acid, sucii as aqueous acetic acid. Aroylmetlioxycarbonylamino can also be split by treatment with a nucleophilic, preferably salt-forming reagent, such as sodium tiiiophenoiate, and 4-nitro-benzyloxycarbonylamino can also be split by treatment with an alkali metal dithionite, for example sodium dithionite. Substituted or unsubstituted diphenyi-methoxycarbonylamino, tert-lower alkoxycarbonylamino or 2-trisubstltuted silylethoxy-carbonylamino can be split by treatment with a suitable acid, for example fomiic or trifluoro-acetic acid, substituted or unsubstituted benzyloxycarbonylamino can be split, for example, by means of hydrogenolysis, i.e. by treatment with hydrogen in the presence of a suitable hydrogenatlon catalyst, such as a palladium catalyst, and triarylmethylamino or fonnyiamino can be split, for example, by treatment with an acid, such as a mineral acid, for example hydrochloric acid, or an organic acid, for example formic, acetic or trifluoroacetic acid, if appropriate in the presence of water, and an amino group protected by an organic silyl group can be set free, for example, by means of hydrolysis or aicoholysis. An amino group protected by 2-haloacetyl, for example 2-chloroacetyl, can be set free by treatment with thiourea in tfie presence of a base or with a thioiate salt, such as an alkali metal thiolate, of urea and subsequent solvolysis, such as aicoholysis or hydrolysis, of the condensation product fomried. An amino group protected by 2-substituted silylethoxycarbonyl can also be converted Into the free amino group by treatment with a hydrofluoric add salt which supplies fluoride anions. The starting material of the formula 11 is obtained as follows: In the first stage, a compound of fomula VI tetrafluoroborat (TPTU), 0-(3,4-dihydro-4-oxo-1,2,3-benzotriazin-3-yl)-N,N,N',N'-tetra-methyluronium-tetrafluoroborat (TDBTU) or 0-(1,2-dihyclro-2-oxo-1-pyriciyl)-N,N,N',N'-bis-(tetramethylen)-uronlum-hexafluorophosphat in the presence of dimethylacetamide and a suitable amine, e.g. N-ethyldiisopropyl amine, in a suitable solvent, such like dichloro-methane, and then at room temperature with aminooxy-2-chlortrityl polystyrene resin. The resin is isolated and shaken twice or three times for a period of 15 to 60 minutes, e.g. 30 minutes, with a freshly prepared dichloromethane/piperidine solution to provide a compounc of fonnula Vll in which the black circular plane indicates that the compound is bound to a polymer resin and in which Ri and Ra are as defined above for compounds of the fonnula I. If Ri and Ra are both hydrogen prefers^ly the first stage is carried out as follows: the aminooxy-2-chlortrityl polystyrene resin is mixed in a suitable solvent, such like dichloro-methane, with a compound of fonnula VI, In which R i and R2 are both hydrogen, in the presence of 1-hydroxybenzotriazole hydrate and 1,3-diisopropylcarbodiimlde and the resulting mixture then treated with N-ethyl-diisopropylamlne at room temperature. The obtained resin is isolated and shaken twice for a period of 15 to 45 minutes, e.g. 20 minutes, with a freshly prepared dichloromethane/piperidine solution to provide a compound of formula Vll, in which the black circular plane indicates that the compound is bound to a polymer resin and in which Ri and R2 are both hydrogen. In the second stage, the compound of formula Vll is reacted with a compound of fomiula ^111 in which R and q are as defined above for compounds of the fomriuia I and Y is a suitable leaving group, preferably halogen, such as chlorine, bromine or iodine, optionally in the presence of 4-dimethylaminopyridine and a suitable amine, e.g. N-ethyldilsopropylamine, li a suitable solvent, e.g. dichloromethane. The starting material of the fonnula V is obtained as follows: In the first stage, a compound of fomnula IX (IX) in which R3 is as defined above for compounds of the formula I, R 4 is hydrogen or lower alkyl and D is CrCa aikyien, unsubstltuted or substituted by lower alkyl, is reacted in a suitable solvent, e.g. methylen-diloride, at a temperature between - ICC and +15 "C, preferably between O'C and + 5°C, with a compound of formula X (X) in which Ri and R2 are as defined above for compounds of the fomnula I and R s is methyl 01 ethyl in the presence of trietiiylamine or anotiier suitable amine and MgSO 4 to afford a compound of formula Xl in which Ri, Ra and R3 are as defined above for compounds of the formula I, R 4 is hydrogen or lower alkyl, R5 is methyl or ethyl and D is C1-C2 alkylen. In the second stage, the compound of fonnula XI is reacted with sodium borohydride in a suitable solvent, e.g. in a mixture of tetrahydrofuran and methanol at a temperature between -15°C and 5 "C, preferably -lO^C and CC, or another hydrogen donating agent to afford a compound of formula XII in which A, Ri, R2 and R3 are as defined above for compounds of the formula I and R 5 is methyl or ethyl. In the third stage the compound of fonnula XII is reacted with a compound of formula Vlll' in which R' is hydrogen, q is as defined above for compounds of the fomiula I and Y is a suitable leaving group, preferably halogen, such as chlorine, bromine or Iodine, in a suitable solvent, e.g. dichloromethane, in the presence of a suitable amine, e.g. triethylamine, to give a compound of fomiula XIII in which R' is hydrogen and q. A, R i, Ra anc , are as defined above for compounds of the formula I and R5 is methyl or ethyl. A compound of fonnula VIM' in which R' is hydrogen can be prepared by reacting hydroxybenzenesulfonic acid sodium salt with thionyl chloride in dimethylformamlde or another suitable solvent at a temperature of 60 'C to 70 °C, preferably 65 "C. In the fourth stage the compound of fonnula XIII is reacted with a compound of fomnula XIV Y-R (XIV) in which R is as defined above for compounds of formula I and Y is a suitable leaving group, preferably halogen, such as chlorine, bromine or iodine, in the presence of K 2CO3 at room temperature in a suitable solvent, e.g. dimethylfomiamide, to afford a compound of formula XV, in which R, q, A, Ri, R2 and R3 are as defined above for compounds of the fonnula I and R 5 Is methyl or ethyl. In the fifth stage the compound of fonnula XV is further reacted with an alkali metal hydroxide, e.g. LIOH, in a suitable solvent or mixture of solvents, e.g. a mixture of tetirahydrofuran, an alcohol and water, to give a compound of fonnula IV in which R, q, A, Ri, R2 and R3 are as defined above for compounds of ttia formula I. In the sixth stage the compound of fomiula IV is reacted with a compound of fomiula XVI and a carbodiimlde, like 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, in the presence of 1-hydroxybenzotriazole, in a suitable solvent, lil<:e dimethylfonnamide at a temperature between and preferably to give compound of formula v in which r q ri rj r3 are as defined above for compounds the fomiula i.> A compound of formula Vlll' can also be reacted with a compound of fomnula XIV before the reaction with a compound of formula XII as described above. General process conditions: Free compounds of the formula I which are obtainable by tfie process and have salt-forming properties can be converted into their salts in a manner known per se, for example by treatment with acids or suitable derivatives thereof, for example by addition of the acid in . question to the compound of the formula I dissolved in a suitable solvent, for example an ether, such as a cyclic ether, in particular dioxane, and especially tetrahydrofuran. Com¬pounds of the fomnula I with acid groups, for example free carboxyl groups, are treated, for example, with a suitable base, for example a hydroxide, cartonate or bicarbonate, for salt formation. Isomer mixtures obtainable according to the invention can be separated into the individual isomers in a manner known per se, for example racemates can be separated by fomiation of salts with optically pure salt-forming reagents and preparation of the diastereomer mixture thus obtained, for example by means of fractional crystallization. The abovementloned reacttons can be cam'ed out under reaction conditions known per se, in tiie absence or, usually, presence of solvents or diluents, preferably those which are inert towards tiie reagents used and dissolve these, in tiie absence or presence of catelysts, condensation agents (for example phosphonis pentoxide) or neutralizing agents, for example bases, in particular nitrogen bases, such as triethylamine hydrochloride, depen¬ding on the nature of the reaction and/or of the reaction participants, at a reduced, normal or elevated temperature, for example in the temperature range from about - 80 "C to about 200°C, preferably from about - 20"C to about 150°C, for example at the boiling point of the solvent used or at room temperature, under atmospheric pressure or in a closed vessel, if appropriate under pressure, and/or in an inert atmosphere, for example under a nitrogen atmosphere. The reaction conditions stated specifically in each case are prefen-ed. Solvents and diluents are, for example, water, alcohols, for example lower alkylhydroxides, such as methanol, ethanol, propanol or, in particular, butanol, diols, such as ethylene glycol, triols, such as glycerol, or aryl alcohols, such as phenol, acid amides, for example carboxylic acid amides, such as dimethylformamide, dimethylacetamide or 1,3-dimethyl-3,4,5,6-tetrahydro-2(1H)-pyrimidinone (DMPU), carboxylic acids, in particular formic acid or acetic add, amides of inorganic acids, such as hexamethylphosphoric acid triamide, ethers, for example cyclicethers, such as tetrahydrofuran or dioxane, or acyclic ethers, such as diethyl ether or ethylene glycol dimettiyl ether, halogenated hydrocariaons, such as halo-lower alkanes, for example methylene chloride or chlorofomri, ketones, such as acetone, nitriles, such as acetonitrile, acid anhydrides, such as acetic anhydride, esters, such as ethyl acetate, bisalkanesulfines, such as dimethyl sulfoxide, nitrogen-containing heterocyclic compounds, such as pyridine, hydrocarbons, for example lower alkanes, such as heptane, 3r aromatics, such as benzene, toluene or xylene(s), or mixtures of these solvents, it being possible for the suitable solvents to be chosen in each case for the abovementioned eactlons. The customary processes are used for woridng up the compounds of the formula I which can be obtained or their salts, for example solvolysis of excess reagents; recrystallization; chromatography, for example partition, ion or gel chromatography, in particular preparative high pressure liquid chromatography; partition between an inorganic and organic solvent phase; one or several exbactions, in particular after addification or increasing tiie basicity or the salt content; drying over hygroscopic salts; digestion; filtration; washing; dissolving; evaporation (if necessary in vacuo or under a high vacuum); distillation; crystallization, for example of tiie resulting compounds in the form of an oil or from ttie mother liquor, it also being possible for the product to be seeded with a crystal of the end product; or a combination of two or more of the working up steps mentioned, which can also be employed repeatedly. Starting materials and interrnediates can be used in the pure form for example after woi1 The compounds, including their salts, can also be obtained in the fonn of hydrates, or their crystals can include, for example, the solvent used for the crystallization. Those starting substances which lead to the novel compounds of the fonmula I described above as particularly valuable are preferably employed in the process of the present invention. The Invention also relates to those embodiment forms of the process in which a compound obtainable as an intemnediate at any process stage is used as the starting substance and the missing process steps are carried out, or in which a starting substance is formed under the reaction conditions or Is used in the form of a derivative, for example a salt thereof. The invention also relates to the compounds of the formula II in which R, q, Ri and R2 are as defined above for compounds of the formula I and the blacl The invention also relates to the nomnoimris nf the formula IV in vyhich R, q, A, Ri, R2 and R3 are as defined above for compounds of the formula I, free functional groups present In the compound, if necessary, being protected by easily detachable protective groups, which can be used as starting material for the preparation of the compounds of the formula I. The invention also relates to the compounds of the formula V in which R, q. A, Ri, R2 and R3 are as defined above for compounds of the formula I, free functional groups present In the compound, if necessary, being protected by easily detachable protective groups, which can be used as starting material for the preparation of ttie compounds of the fonnnula I. The invention also relates to the compounds of tiie fonnuia VIII in which R is as defined above for compounds of the formula I or hydrogen, q is as defined above for compounds of the formula I and Y is halogen, free functional groups present in the compound, if necessary, being protected by easily detachable protective groups, which can be used as starting material for the preparation of the compounds of the fomnula I. The present invention also relates to methods of using the compounds of the invention and their phamriaceutlcally acceptable salts, or phamiaceutical compositions thereof, in mammals for inhibiting the matrix-degrading metalloproteinases, e.g. stromelysin, gelatinase and macrophage metalloelastase, for inhibiting tissue matrix degradation, and for the treatment of matrix-degrading metalloproteinase dependent conditions as described herein, e.g. inflammation, rheumatoid arthritis, osteoarthritis, also tumors (tumor growth, metastasis, progression or Invasion), pulmonary disorders (e.g. emphysema), and the like described herein. Tumors (carcinomas) include mammalian breast, lung, bladder, colon, prostate and ovarian cancer, and skin cancer, including melanoma and Kaposi's sarcoma. Furthermore, the Invention relates to a method for treatment of conditions or diseases, especially those described herein, associated with MMP2 comprising administering to warm¬blooded animals, including humans, in need thereof a therapeutically effective amount of a selective MMP2 inhibitor or of a pharmaceutically acceptable salt or a pharmaceutically acceptable prodrug derivative of such a selective MMP2 inhibitor. In particular, the Invention relates to a metiiod for treatment of hyperproliferative diseases, especially those described herein and more especially a tumor disease, associated witti MMP2 comprising administering to wami-blooded animals, including humans, in need tiiereof an antihyperproliferatlvally effective amount of a selective MMP2 inhibitor or of a pharmaceutically acceptable salt or a pharmaceutically acceptable prodrug derivative of such a selective MMP2 inhibitor. The term "selective MMP2 inhibitor" as used herein means a compound exhibiting an inhibiting concentration IC50 for the enzyme MMP1 that is at least 100-fold higher than the inhibiting concentration ICso for the enzyme MMP2 as determined by the methods described herein. Preferably, the selective MMP2 inhibitor exhibit an Inhibiting concentration IC »for the enzyme MMP1 that is at least 1000-fold higher than the IC »for the enzyme MMP2. More preferably, the selective MMP2 inhibitor exhibit an inhibiting concentration IC 50 for the enzyme MMP1 that is at least 2000-fold higher than the IC 50 for the enzyme MMP2. The term "non-peptide" as used herein means a compound without a substructure comprising a chemical bond between an aliphatic amine and a carboxylic acid. Furthemiore, the invention relates to a method for treatment of conditions or diseases, especially those described herein, associated with MMP's comprising administering to warm-blooded animals, including humans, in need thereof a therapeutically effective amount of a compound of fonnula I or of a phamnaceuticaiiy acceptable salt or a pharmaceuticatly acceptable prodrug derivative of such a compound. The invention relates in particular to a method of treating warm-blooded animals, including humans, suffering from a hyperproliferative disease, especially a tumor disease, and in particular a hyperproliferative disease which responds to inhibition of MMP2 or MT1 -MMP, which method comprises administering an antihyperproliferativally effective amount of a compound of the fonnula I or of a pharmaceutically acceptable salt or a phamnaceutically acceptable prodrug derivative thereof, or the use of a compound of the fonmula I for such treatment. The Invention relates also to the use of a compound of formula i or of a pharmaceutically acceptable salt thereof in the inhibition of MMP2 or MT1-MMP or botii enzymes in warm¬blooded animals, including humans, or. in the preparation of phannaceutical compositions for use in ttie therapeutic treatment of the human or animal body, in particular for the chemotherapy of tumours. Depending on the species, age, individual condition, mode of administration and the . particular clinical picture, effective doses, for example daily doses of approximately 0.1 to about 5 g, preferably about 0.5 to about 2 g, of a compound of tiie present Invention are administered to a wann4}looded animal of appro)dmately 70 kg body weight. The invention relates also to pharmaceutical compositions comprising an effective amount, especially an amount effective in the treatment of one of the above-mentio ned disorders, of the active ingredient together with phannaceutically acceptable carriers that are suitable for topical, enteral, for example oral or rectal, or parenteral administration and that may be inorganic or organic, solid or liquid. There are used for oral administration especially tablets or gelatin capsules that comprise the active ingredient together with dilu ents, for example lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycerol, and/or lubricants, for example silica, talc, stearic acid or salts thereof, such as magnesium or calcium stearate, and/or polyethylene glycol. Tablets may also comprise binders, for example magnesium aluminum silicate, starches, such as com, wheat or rice starch, gela tin, methylcellutose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone, and, if de sired, disintegrators, for example starches, agar, alginic acid or a salt thereof, such as so dium alginate, and/or effervescent mixtures, or adsorbents, dyes, flavorings and sweete ners. It is also possible to use the pharmacologically active compounds of the present in ventlon in the fonn of parenterally administrable compositions or in the fonm of infusion so lutions. Such solutions are preferably Isotonic aqueous solutions or suspen sions which, for example in the case of lyophilized compositions that comprise the active ingredient alone or together with a canier, for example mannitol, can be made up prior to use. The pharmaceut ical compositions may be sterilized and/or may comprise excipients, for example presen^a fives, stabilisers, wetting agents and/or emulsifiers, solubilisers, salts for regulating the os motic pressure and/or buffers. The present phamnaceutical compositions, which may, if de sired, comprise other pharmacologically active substances, such as antibiotics, are prepa red in a manner known perse, for example by means of conventional mixing, granulating, confectioning, dissolving or lyophillsing processes, and comprise approximately from 1% to 95%, especially from approximately 1 % to approximately 20%, active ingredient(s). The following Examples serve to illustrate the Invention wittiout limiting the scope tiiereof. Temperatures are given In degrees Centrigrade. If not mentioned othenwise, all evaporations are perfonned under reduced pressure, preferably between about 15 and 100 mmHg (s 20-133 mbar). The sticture of final products, intemnediates and starting materials is continmed by standard analytical metiiods, e.g. microanalysis and specb'oscopic characteristics (e.g. MS, IR, NMR). /^breviations used are tiiose o^nventionai in tiie art To the resjn of stage 1.2 (90 mg, -0.06 mmol) are added successively under an argon atmosphere triphenylphosphine (238 mg, 0.91 mmol) in dry THF (0.5 ml) and 4-chlorobenzyl alcohol (129 mg, 0.91 mmol). Finally, neat diethyl azodicarboxylate (0.141 ml, 0.91 mmol), is slowly added. After shaking for 15 h at 50°C the suspension is filtered and the resin washed with THF (2x). The reaction is repeated twice with fresh reagents. The slurry is filtered and the resin rinsed with THF (2x), alternating with 2-propanol and THF (3x) and dichloromethane (3x). The product is cleaved from the support by treating the resin with a solution of TFA (95%)/dichloromethane 5:95 (v/v) for 20 min at 30**C. After filtration, a second analogous cleavage is canied out. The residue obtained after filtration and removal of the solvent is purified by preparative HPLC to yield (R)-2-[(4-Chloro-benzyI)-(4-propoxy-benzenesulfonyl)-amino]-N-hydroxy-3-phenyl-propionamide; MS (ES+): 503 (M+H) *. Stage 1.1: Polymer-bound (R)-2-Amino-N-hydroxy-3-phenyl-propionamide propylamine (1.02 ml, 5.94 mmol). After stirring for 5 min the mixture Is added to aminooxy-2-chlorotrityl polystyrene resin (2.8 g, 2.7 mmol; Tetrahedron Lett. 1997,38,3311-3314) and the resulting suspension shaken at r.t. for 16 h. The mixture is filtered and the resin washed alternating with DMA and dichloromethane (3x). The described coupling procedure is repeated with a freshly prepared mixture of N-{9-fluorenylmethoxycariDonyl)-D-phenyl-alanine (2.09 g, 5.4 mmol), TPTU (1.76 g, 5.94 mmol) and N-ethyldiisopropyiamlne (1.02 ml, 5.94 mmol) in dichloromethane/DN/lA 1:1 (20 ml). After 16 h the suspension is filtered and the resin washed with DMA (2x), alternating with H2O and DMA (2x), alternating with 2-propanol and THF (3x), THF (2x) and dichloromethane (3x). The resin thus obtained is shaken for 30 min with a freshly prepared solution of dichloromethane/piperidine 8:2 (25 ml). After filtration, this process Is repeated tvwce with fresh dichloromethane/piperidine solutions. The suspension is filtered, the resin washed with dichloromethane (2x), alternating with 2-propanol and dichloromethane (2x), dichloromethane (3x) and dried In vacuo, thus providing polymer-bound (R)-2-amlno-N-hydroxy-3-phenyl-propionamlde. Stage 1.2: Polvmer-bound (R)-N-Hvdroxv-3-phenyl-2-(4-propoxv-benzenesulfonvlamino)-propionamide To 400 mg (-0.33 mmol) resin from stage 1.1 are added successively dry dichloromettiane (2ml), 4-dimethylamlnopyrldine (4 mg, 0.033 mmol), 4-propoxy-benzenesulfonyl chloride (309.8 mg, 1.32 mmol) dissolved in dry dichtoromethane (1 ml), and N-ethyldilsopropyl-amlne (0^8 ml, 1.64 mmol). After shaking for 15 h at r.t. the suspension is filtered and the resin washed with dichloromethane (3x), alternating with DMA and H aO (2x), 0.2M aequous citric add, alternating with DMA and H2O (2x), alternating with 2-propanol and THF (3x), and with dichloromethane (4x). The resin is dried under reduced pressure to provide polymer-bound (R)-N-hydroxy-3-phenyl-2- 0.56 mmol), is added at r.t. After stirring for 15 h at r.t. the slurry is filtered and the resin rinsed with dichloromethane (3x), alternating with 2-propanol and dichloromethane (3x) and dichloromethane {3x). The product is cleaved from the support by treating the resin with a solution of TFA (95%)/dichloromethane 5:95 (v/v). The residue obtained after filtration and removal of the solvent is purified by preparative HPLC to yield 2-{[4-(4-fluoro-butoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy-acetamide; MS (ES+): 441 (M+Hf. Stage 58.1: Polymer-bound 2-Amino-N-hydroxy-acetamide To a suspension of aminooxy-2-chlorotrityl polystyrene resin (3.0 g, 3.15 mmol) in dry dichloromethane (30 ml) Is added a mixture of N-(9-fluorcnylmethoxycarbonyl}-glycine (3.40 g, 11.4 mmol), 1 -hydroxybenzotriazole hydrate (1.27 g, -8.33 mmol) and 1,3-diisopropylcarbodiimide (1.3 ml, 8.34 mmol) in dry dichloromethane (20 ml). The resulting mixture is treated wth N-ethyldiisopropylamlne (1.41 ml, 8.24 mmol) and stin-ed at r.t. for 15 h. After filtration, the resin is washed with DMF (2x), alternating with H zO and DMF (3x), alternating with THF and 2-propanol (3x), THF (2x) and dichloromethane (3x). The coupling procedure is repeated with a fresh mixture of N-(9-fluorenylmethoxycaribonyl)-glycine (3.03 g, 10.2 mmol), 1-hydroxybenzotriazole (1.26 g, -8.23 mmol), 1,3-diisopropylcariDodiimide (1.4 ml, 8.98 mmol) and N-ethyldiisopropylamlne (1.41 ml, 8.24 mmol) in dry dichloromethane (30 ml). After stining for 16 h the suspension is filtered and the polymer washed as described above. The resin thus obtained Is treated with a freshly prepared solution of dichloromethane / piperidlne 8:2 (100 ml), stirred at r.t for 20 min. and separated via filtration. This process is repeated twice with fresh dichloromethane/piperidine solution. The resin is washed with dichloromethane (2x), alternating with 2-propanol and dichloromethane (2x), dichloromethane (2x), 2-propanol (2x) and dried in vacuo, thus providing polymer-bound 2-amino-N-hydroxy-acetamide. Stage 58.2: Polymer-bound 2-[4-(4-Ruoro-butoxy)-benzenesulfonylamlno]-N-hydroxy- acetamide To the resin from stage 58.1 (350 mg, -0.3 mmol) are added successively 4-(4-fluoro- butoxy)-benzenesulfonyl chloride (306 mg. 1.15 mmoO In dry dichloromethane (4 ml), and N-ethyldllsopropylamlne (0.24 ml, 1.40 mmol) in dry dichloromethane (4 ml). After stining for 15 h at r.t the suspension is filtered and the resin washed with dichloromethane (2x), DMF (2x), alternating with H2O and DMF (3x), alternating with THF and 2-propanol {3x), 67 2-[(4-but-3-enyloxy-benzenesulfonyl)-(4- I chloro-benzyl)-aminol-N-hyclroxy- 425 acetamide Example 68 To a solution of 48.81 g (0,114 mol) of {[ 4-(3-chloro-propoxy)-benzenesulfonyl]-(4-methoxy-ben2yl)-amino}-acetic acid in 500 ml of CH2CI2,19.56 ml (0.228 mol) of oxalyl chloride and 0.88 ml (0.011 mol) of DMF are added dropwise at 0 - 5 °C under N2 atmosphere. The mixture Is stirred for 1 h at 0-5 °C and 1 h at r.t. To a solution of 226 ml (3.42 mol) of) 50 % hydroxylamine in H2O (Aldrich) in 1200 ml of THF, a solution of the freshly prepared above acid chloride In CH2CI2 is added over 45 min. at -10 to -5 °C through a teflon tube using N2 gas pressure. The reaction mixture is stirred for 30 min at - 5 to 0 °C and filtered through paper filter to remove insoluble precipitates. The filtrate is diluted with H 2O and extracted with CH2CI2. The combined extracts are washed with brine, dried over MgSO 4 and concentrated under reduced pressure. The product is collected by filtration and washed witii ether to give 43.03 g of 2-{[4-(3-chloro-propoxy)-benzenesulfonyl]-(4-methoxy-ben2yl)-amino}-N-hydroxy-acetamide; NMR (CDCI3): 2.2 - 2.35 (m, 2H), 3.69 (s. 2H), 3.76 (t, 2H, J=6Hz). 3.79 (s, 3H). 4.21 (t. 2H, J=6Hz), 4.26 (s, 2H), 6.77 (br s, 1H), 6.85 (d. 2H, J=9.04Hz). 7.03 (d, 2H, J=9.04Hz), 7.15 (d, 2H, J=9.04Hz), 7.78 (d, 2H, J=8.56Hz). 8.82 (br s, 1H). Stage 68.1: To a solution of 77.46 g (0.617 mol) of glycine methylester hydrochloride in CH 2CI2,92 ml (0.66 mol) of triethylamine, a solution of 60 g (0.44 mol) of p-anlsaldehyde In 50 ml of CH2CI2 and 40 g of MgSO* are successively added at 0 - 5 °C under N2 atmosphere. After stirring for 18 h at r.t. the reaction mixture is filtered through celite and washed with CH 2Cl2. The filtrate is concentrated under reduced pressure and then the crude mixture is diluted with AcOEl. The AcOEl solution is filtered again to remove triettiylamine hydrochloride and the filtrate diluted with toluene and concentrated under reduced pressure (azeotropic removal of H2O) to give 91.3 g of [(4-methoxy-benzylldene)-aminol-acetlc add mettiyl ester as light yellow crystals; NMR (CgDe): 3.18 (s, 3H). 3.34 (s, 3H), 4.13 (s, 3H). 6.69 (d, 2H, J=8.56Hz). 7.70 (d, 2H, Js8.56Hz), 7.79 (s. 1H). stage 68.2: To a solution of 91.3 g (0.441 mol) of [(4-methoxy-benzylidene)-amino]-acetic acid methyl ester in 500 ml of THF and 1000 ml of MeOH, 20 g (0.529 mol) of sodium borohydride is added portionwise at -10 to 0 °C. The reaction mixture is stirred for 30 min. at -10 to 0 "C and quenched with sat. NH4CI. After adding of ice- water, the mixture is concentrated to 1/4 of whole volume and extracted with AcOEt. The combined extracts are washed with H 2O and brine, dried over MgS04and concentrated under reduced pressure to give (4-methoxy-benzylamino)-acetic acid methyl ester; NMR (CDCI3): 1.87 (br s, 1H), 3.41 (s, 2H), 3.73 (s, 3H), 3.74 (s, 2H), 3.8 (s, 3H), 6.86 (d, 2H, J=8.56Hz),7.24 (d, 2H, J=8.56Hz). Stage 68.3: To a solution of 30.97g (0.148 mol) of (4-methoxy-benzylamino)-acetic acid methyl ester in 200 ml of dioxane and 200 ml of H 20,25 ml (0.178 mol) of triethylamine a solution of 43.9g (0,163 mol) of 4-(3-chloro-propoxy)-benzenesulfonyl chloride in 100 ml of dioxane is added at 0 - 5 °C. The mixture is allowed to wami to r.t. and stirred for 3 h. The reaction mixture is neutralized with 1N HCI and extracted with AcOEt. The combined extracts are dried over MgS04 and concentrated under reduced pressure to give {[4-(3-chloro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-acetic acid methyl ester; NMR (CDCU): 2.25 -2.35 (m. 2H), 3.56 (s, 3H), 3.75 (t, 2H, J=6.04Hz), 3.79 (s, 3H). 3.9 (s, 2H), 4.2 (t, 2H, J=6.04Hz), 4.39 (s, 2H), 6.84 (d, 2H, J=8.56Hz), 6.99 (d, 2H, J=9.08Hz). 7.16 (d, 2H. J=9.08Hz), 7.83 (d, 2H, J=8.56Hz). Stage 68.4: To a solution of 59.7 g (0.135 mol) of {[4-(3-chloro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino^acetic acid methyl ester in 500 ml of MeOH, 500 ml of THF and 200 ml of H20,11.3g of Li0H:H2O (0.27 mol) Is added at 0 - 5 °C. The mixture is allowed to wami to r.t. and stln-ed for 4 h. The reaction mixture is concentrated under reduced pressure and diluted with H2O eufid AcOEt. After acidifying wl* 2N HCI at 0 - 5 "C, the mixture Is extracted with AcOEt. The combined extracts are washed witti brine and concentrated under reduced pressure to give {[ 4-(3-chloro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino]-acetic acid; NMR (CDOa): 2.25 - 2.29 (m. 2H), 3.75 (t, 2H. J=6Hz), 3.79 (s. 3H), 3.91 (s, 2H). 4.19 (t, 2H, J=6Hz), 4.38 (s, 2H), 6.84 (d. 2H. J=8.56Hz). 6.99 (d, 2H, J=8.56Hz), 7.13 (d. 2H, Js9.04Hz), 7.82 (d, 2H. J=9.04 Hz). Example 69 A solution of 0.22 g of 2-{[4-{4-fluorobutoxy)-benzenesulfonylH4-methoxy-^3en2yl)-amino}-N-(1-ethoxy-1-methyl-ethoxy) acetamide in 30 ml of AcOEt is treated with 7 ml of 5N aqueous HCl for 10 min. at r.t. and the mixture is extracted with AcOEt. The combined extracts are washed with sat. NaHCOa and brine, dried over MgS04 and concentrated under reduced pressure to give solids which are washed with ether to afford 2-{[4-(4-fluorobutoxy)-benzenesulfonylH4-methoxy-benzyl)-amino]-N-hydroxy-acetamide;NMR (CDCb): 1.83 - 2.05 (m, 4H), 3.69 (s, 2H). 3.78 (s, 3H), 4.09 (t, 2H. J=5.56Hz). 4.25 (s. 2H), 4.48 (t, 1H, J=5.52Hz). 4.55 - 4.65 (m, 1H), 6.84 (d, 2H, J=8.56Hz), 7.00 (d, 2H, J= 9.04Hz), 7.02 (br s, 1H), 7.15 (d, 2H, J=8.56Hz), 7.77 (d, 2H, J=8.56Hz), 8.85 (br s, 1H). Stage 69.1: A solution of 31.4 ml (430 mmol) of thionyl chloride and 0.2 ml (2.58 mmol) of DMF was quickly added to 10 g (43 mmol) of 4-hydroxybenzenesulfonic acid sodium salt under N 2 atmosphere. The resulting mixture is stirred at 65 °C for 6 h. At the end of this time, the mobile, nearly homogenous reaction mixture is poured on ice with vigorous stining. An oily lower layer Is produced and which Is dissolved in 100 ml of CH 2CI2. The aqueous layer is extracted with CHzClz and the combined organic solution is dried over MgS04and concentrated under reduced pressure to give 8.19 g of 4-hydroxybenzenesulfonyl chloride; NMR (CDCb): 5.3 (br s, 1 H), 7.01 (d, 2H, J=:9.08Hz), 7.94 (d, 2H, J=9.08Hz). Stage 69.2: To a solution of 8.7g (45.2 mmol) of 4-hydroxybenzenesuIfonyl chloride In 80 ml of CH zCIa, a solution of 6.75 g (32.3 mmol) of (4-methoxy-benzylamino)-acetic acid methyl ester in 20 ml of CH2CI2 and 12 ml (79.2 mmol) of triethylamlne were added dropwise at 0 °C. The resulting mixture is stinted for 4 h at r.t., neutralized with cold IN aqueous HCl and extracted with CH2CI2. The combined extracts are washed with H2O and brine, dried over MgS04 and concentrated under reduced pressure. The residue is purified by column chromatography on silica gel (eluent; AcOEtCHaCfe = 50:1 - 5:1) to give [(4-hydroxy-benzenesulfonyl)- Stage 69.3: To a suspension of 1 g (2.74 mmol) of [(4-hydroxy-benzenesulfonylH4-mettioxy-benzyl)- ' aminoj-acetic acid methyl ester and 1,14 g (8.22 mmol) of K 2CO3 in 8 ml of DMF, 0.59 ml (5.47 mmol) of 1-bromo-4-flUDrobutane is added dropwise at r.t. After stirring for 18 h at r.t., the reaction mixture is diluted with H2O and extracted with AcOEt. The combined extracts are washed with brine, dried over MgS04 and concentrated under reduced pressure. The residue is purified by column chromatography on silica gel (AcOEtrn-hexane = 3:1) to give {[4-(4-fluorobutoxy)-ben2enesulfonylH4-mettioxy-benzyl)-amino}-acetic acid methyl ester; NMR (CDCI3): 1.86 - 1.96 (m, 4H), 3.57 (s, 3H). 3.79 (s, 3H), 3.90 (s, 2H), 4.08 (t, 2H, J=6.04Hz), 4.39 (s, 2H). 4.46 (t, 1H, J=6.04Hz), 4.55 - 4.65 (m, 1H). 6.83 (d, 2H. J=8.56Hz), 6.97 (d. 2H. J=9.08Hz), 7.15 (d, 2H, J=8.56Hz), 7.82 (d, 2H. J=9.08Hz). Stage 69.4: To a solution of 1.04 g (2.37 mmol) of {[4-(4-fIuorobutoxy) -benzenesulfonylH^-methoxy-benzyl)-amino}-acetic acid methyl ester in 15 ml of THF, 15 ml of MeOH and 7 ml of H aO, 0.24 g (5.7 mmol) of LiOH mono-hydrate is added in portions and the mixture is stin-ed for 30 min at 0 - 5 °C. After stirring for additional 3.5 h, the reaction mixture is acidified with IN aqueous HCi and extracted with AcOEt. The combined extracts are washed with brine, dried over MgS04 and concentrated under reduced pressure to give {[4-(4-fluoro-butoxy)-benzenesulfonylH4-nnethoxy-benzyl)-amino}-acetic acid; NMR (CDCI3): 1.86 -1.96 (m, 4H), 3.79 (s, 3H), 3.90 (s. 2H). 4.08 (t, 2H, J=5.52H2), 4.38 (s, 2H), 4.48 (t, 1H, J=6.04Hz), 4.55 - 4.65 (m, 1H), 6.84 (d, 2H, J=8.56Hz), 6.98 (d. 2H, J=9.08Hz), 7.14 (d. 2H, J=8.56Hz), 7.81 (d, 2H, J=9.08Hz). Stage 69.5: To a solution of 20 g (123 mmol) of N-hydroxyphthallmide in 360 ml of CH 3CN, 26.42 ml (276 mmol) of 2-methoxypropene and 42.36 mg (0.246 mmol) of anhydrous p-toluene-sulfonlc add are added in portions at r.L After stining for 1 h, the mixture is diluted with 25 ml of sat. NaHCOa and concentrated under reduced pressure. The residue is extracted witfi EtOAc and the organic layer is washed with H2O and brine, dried over MgS04 and concentrated under reduced pressure to give 21.84 g of 2-(1-methoxy-1-methyl^thoxy)-isolndole-1,3-dlone as a white solid; NMR (CDCI3): 1.57 (s, 6H), 3.61 (s, 3H), 7.75 (dd, 2H, J=5.56Hz, J==3.0Hz), 7.83 (dd, 2H, J=5.56H2, J=:3.0H2). stage 69.6: To a solution of 21.8 g (92.8 mmol) of 2-(1-methoxy-1-methyl-elhoxy)-isoindoIe-1,3-dione in 200 ml of CH2CI2 and 70 ml of MeOH, 191.2 ml (191.2 mmol) of 1M Hydrazine In THF is added dropwise over 40 mln,at 0 - 5 °C. After stining for 2 h at r.t. the mixture is filtered to remove insoluble precipitates. The filtrate is concentrated under reduced pressure, extracted witti ether. The combined extracts are washed with 10 % NaOH , dried over MgS04 and concentrated under reduced pressure to give O-(l-methoxy-l-methyl-ethyl)-hydroxytamine; NMR (CDCb): 1.36 (s, 6H), 3.25 (s, 3H), 4.95 (br s. 2H). Stage 69.7: To a solution of 0.425 g (1 mmol) of desired {[4-{4-fluorobutoxy)-benzenesulfonyl]-{4-methoxy-benzyl)-amlno}-acetic acid and 0.27 g (2 mmol) of HOBT in 4 ml of DMF, a solution of 0.116 g of 0-(1-methoxy-1-methyl-ethyl)-hydroxylamine in 1 ml of DMF and 0.23 g of WSCD were successively added at 0 - 5 °C and the mixture was stirred for 1 h. After stining for additional 2 h at r.t., the mixture is diluted with H 2O and extracted with AcOEt. The combined extracts are dried over MgS04and concentrated under reduced pressure. The residue is purified by column chromatography on silica gel (eluent; AcOEtin-hexane = 1:1) to give 2-{[4-(4-fluorobutoxy)-benzenesulfonylH4-'T»ethoxy-benzyl)-amino}-N-(1-ethoxy-1-methyl ethoxy) acetamide; NMR (CDCI3): 1.35 (s, 6H), 1.83-2.0 (m. 4H), 3.29 (s, 3H), 3.70 (s, 2H), 3.78 (s, 3H), 4.08 - 4.11 (m, 2 H), 4.32 (s, 2 H), 4.47 - 4.49 (m. 1 H), 4.60 (br s, 1 H), 6.80 - 6.90 (m, 2H). 6.95 - 7.05 (m, 2H), 7.10 - 7.25 (m, 2H). 7.79 (d, 2H, J=9.06H2), 8.46 (br s. 1H). Analogously to Example 69 the following hydroxamic acids of Examples 70 to 76 are obtained. Example 70: 2-{[4-(4-chlorobutoxy)-ben2enesulfonylH4-methoxy-benzyl)-amlno}-N-hydroxy-acetamlde; NMR (CDCb): 1-95 - 2.05 (m. 4H), 3.55 - 3.65 (m, 2H), 3.68 (s. 2H). 3.77 (s, 3H). 4.07 (br s. 2H). 4.25 (s. 2H), 6.84 (d. 2H, J=8.56Hz). 6.99 (d, 2H. J=9.04H2). 7.00 (br s. 1H), 7.15 (d, 2H, J=8.56Hz), 7.77 (d, 2H, J=9.04H2). 8.84 (br s, 1 H). Example 71: {(4-methoxy-benzylH4-(4,4,4-trifluorobutoxy)-benzenesulfonyl]-amino}-N-hydroxy-acetamide; NMR (CDCI3): 2.01 - 2.15 (m, 2H), 2.25 - 2.40 (m, 2H), 3.70 (s, 2H), 3.79 (s, 3H), 4.10 (t. 2H, J=6.04Hz), 4.26 (s, 2H), 6.73 (br s, 1H), 6.85 (d, 2H, J=8.56Hz), 7.01 (d, 2H, J=9.08Hz), 7.15 (d, 2H, J=8.56Hz), 7.78 (d, 2H, J=9.08Hz), 8.83 (br s, 1H). Example 72: {[4-(4-fluoropropoxy)-benzenesulfonylH4- [(4-but-3-en-1-yloxy-benzenesulfonyIH4-methoxy-benzyl)-amino]-N-hydroxy-acetamide; NMR (CDCb): 2.50 - 2.65 (m, 2H), 3.70 (s, 2H), 3.79 (s, 3H), 4.09 (t, 2H, J=7.04Hz). 4.26 (s, 2H), 5.13 - 5.22 (m, 2H), 5.75 - 5.95 (m, 1H), 6.56 (br s, 1 H), 6.84 (d, 2H, J=8.56Hz), 7.01 (d. 2H, J=9.04Hz), 7.15 (d, 2H, J=8.56Hz), 7.76 (d, 2H, J=9.04Hz). 8.83 (br s, 1H). Example 74: 2-{[4-(3-chloropropoxy)-benzenesulfonyll-pyridlne-3-ylmethyl-amino}-N-hydroxy-acetamlde; NMR (DMSO-d6): 2.20 - 2.22 (m, 2H), 3.78 (s , 2H), 3.71 - 3.90 (m, 4 H), 4.22 (s, 2H), 4.51 (s, 2H), 7.17 (d, 2H, J=8.08Hz). 7.84 (d, 2H, J=8.56Hz), 7.95 (br s, 1H), 8.47 (d, 2H, J=7.08Hz), 8.80 (br s. 1H), 8.87 (s. 1H), 10.97 (br s, 1H). Example 75: [(4-methoxy-benzylH'*-prop-2-ynyloxy-benzenesulfonyl]-anfiinol-N-hydroxy^acetamide; NMR (CDCb): 3.61 (s, 2H), 3.75 (s, 3H), 4.31 (s, 2H), 4.90 (d. 2H. J=2.0Hz), 6.90 (d, 2H, J=a.56Hz). 7.10-7.20 (m, 4H), 7.85 (d. 2H, J=8.56 Hz). 8.89 (br s. 1H). 10,51 (br s. 1H). Example 76: [(4-methoxy-benzylH4-but-2-ynyloxy-benzenesulfonyl]-amino]-N-hydroxy^acetamlde;NMR (CDCIg): 1.85 (s. 3H). 3.59 (s. 2H), 3.74 (s, 3H), 4.29 (s, 2H), 6.88 (d, 2H. J=8.56Hz). 7.11 -7.20 (m, 4H), 7.82 (d, 2H, J=9.04H2), 8.87 (br s, 1H). 10.48 (br s. 1H). Example 77: To a solution of 0.697g (0.719 mmol) of [4-(3-chloropropoxy)-benzenesulfonyl]-(2,2-dimethyl-propyl)-amino acetic acid ethyl ester and 0.248g (3.57 mmol) of hydroxyiamine hydrochloride salt in 6 ml of MeOH, freshly prepared NaOMe from 0.25g (6.247 mmol) of NaH in MeOH Is added at 0 °C. After stirring for 18 h at r.t, the mixture is poured into ice-water and extracted with AcOEt. The combined extracts are washed with brine, dried over MgS04 and concentrated under reduced pressure. The residue is purified by column chromatography on silica gel (AcOEtn-hexane = 3:1) to 2-{[4-(3-chloropropoxy)-benzenesulfonyl}-(2,2-dimethyl-propyl)-amino-N-hydroxy-acetamide; NMR (CDCI3): 0.98 (s, 9H), 2.20 - 2.35 (m, 2H), 2.95 (s, 2H), 3.69 (s, 2H), 3.75 (t, 2H, J=6.12 Hz). 4.20 (t, 2H, J=5.76Hz), 7.03 (d. 2H, J=8.92Hz), 7.06 (br s, 1H), 7.76 (d, 2H, J=8.92Hz), 9.54 (br s, 1H). Stage 77.1: To a solution of 3.5 g (13 mmol) of 4-(3-chloropropoxy)-benzenesulfonyl chloride in 100 ml of CHzClz, a solution of 1.62 g (18.56 mmol) of neopentyi amine in 15 ml of CH zCIa and 2.59 ml (18.56 mmol) of triethyl amine are added dropwise at 0 - 5 °C. After stining for 2.5 h at r.t., the reaction mixture is neutralized with IN aqueous HCI and extracted with AcOEt. The combined extracts are washed with brine, dried over MgSO 4 and concentrated under reduced pressure to give 4-(3-chloropropoxy)-N-(2,2-dlmethyl-propyl)-benzenesulfonamide; NMR (CDCb): 0.879 (s, 9H), 2.20 - 2.35 (m, 2H), 2.66 (d, 2H, J=6.88Hz), 3.76 (t, 2H, J=6.28Hz), 4.20 (t, 2H, J=5.84Hz), 4.35 - 4.465 (m, 1H), 6.98 (d, 2H. J=8.88Hz), 7.77 (d. 2H, J=8.88Hz). Stage 77.2: To a suspension of 0.197 g (4.93 mmol) of NaH in 10 ml of THF, a solution of 1 g (3.13 mmol) of 4-(3-chloropropoxy)-N-(2,2-dimethyl-propyl)-ben2enesulfonamide in 10 ml of THF is added in portions at 0 °C and ttie resulting mixture is stirred for 30 min at r.t To the solution, 0.55 ml (4.93 mmol) of bromo-ethylacetate is added and tiie reaction mfocture is stinred for 40 min. at r.t, neutralized wlUi 1N aqueous Hd and extracted with AcOEt The combined e^Aracts are washed vidtii brine, dried over MgS04 and concentrated under reduced pressure. The residue is purified by column chromatography on silica gel (AcOEtn- benzenesulfonylamino)-N-hyciroxy-4-methyl-valeramide, are prepared in analogy with the preparation described in Example 1, stage 1.2. The polymer-bound compounds 2-[4-(3-chloro-propoxy)-benzenesulfonylaminol-N-hVv..wA.y-acetamide, 2-[4-{3-fluoro-propoxy)-benzenesulfonylamlno]-N-hydroxy-acetamide and 2-[4-(but-3-en-1-yloxy)-benzenesulfonylamino]-N-hydroxy-acetamide are prepared in analogy with the preparation described in Example 58, stage 58.2. 78.3: Compounds of formula VHI 78.3.1: 4-(3-ChloroproDOxv) benzenesulfonvl chloride To a solution of 52.75g (0.265 mol) of (3-chloro-propoxy)-benzene in 100 ml of CH 2CI2, a solution of 19.4 ml (0.292 mol) of chlorosulfonic acid in 100 ml of CH 2CI2 is added dropwise at 0-5 "C under Nj atmosphere. The mixture is allowed to warm to ambient temperature and stinted for 2 hours. To the mixture, 29.6 ml (0.345 mol) of oxalyl chloride and 4 ml (0.052 mol) of DMF are added dropwise at r.t. and the mixture Is stirred for 18 h at r.t The reaction mixture is poured into ice-water, extracted with CH2CI2. The combined extracts are dried over MgS04 and concentrated under reduced pressure to give 58.5 g of 4-(3-chloropropoxy) benzenesulfonyl chloride; NMR(CDCl3): 2.26 - 2.36 (m, 2H), 3.76 (t, 2H, J=6.04Hz), 4.24 (t, 2H, J=6.04Hz), 7.06 (d, 2H, J=9.08Hz). 7.98 (d, 2H, J=9.08Hz). Stage 78.3.1.1 (3-Chloro-propoxv)-benzene To a suspension of 44g (0.318 mol) of K 2CO3 in 300ml of acetone, 15g (0.159 mol) of phenol and 18.9 ml (0.191 mol) of 1 -bromo-3-chloropropane are added successively at r.t under Nz atmosphere. The mixture is refluxed for 6 h and concentrated under reduced pressure. The crude mixture is diluted with cold IN aqueous NaOH and extracted with AcOEt. The combined extracts are washed with H 2O, dried over MgS04 and concentrated under reduced pressure to give 26.25 g of (3-chloro-propoxy)-benzene (yield 83 %); NMR (CDCI3): 2.20-2.27 (m, 2H), 3.75 (t, 2H, J=6.04Hz), 4.11 (t, 2H. J=6.04Hz). 6.9-6.97 (m, 3H), 7.25-7.31 (m,2H). 78.3.2: 4-f3-Ruoro-propoxv)-benzenesulfonvl chloride A stirred mixhire of the sodium salt of 4-hydroxybenzenesulfonic add dihydrate (3.49 g, 15 mmd) In ethane! (15 ml) Is treated successively at r.t witti 2N NaOH (7.5 ml, 15 mmoO and 1-bromo-3-fIuoro-propane (1.37 ml, 15 mmoO and refluxed for 15 h. The crystalline residue obtained after removal of the solvent is triturated with ethanol / H 2O (2:1) and chilled to O'C. The product Is filtered off. washed with cold ethanol / H 2O (2:1) and dried in vacuo to yield the sodium salt of 4-(3-fluoro-propoxy)-benzenesulfonic acid. A mixture of this salt (2.89 g, 11.3 mmol) and dichloromethane (5 ml) is treated at r.t. with SOCI2 (5 ml, 68.9 mmo!) and DMF (0.2 ml). After stirring for 72 h at r.t., the residue is treated with ice-water and the aequous phase extracted twice with diethyl ether. The combined organic layers are dried with Na2S04, evaporated and the residue dried in vacuo to yield the title compound; NMR (CDCI3) d: 7.98 and 7.04 (AA'BB', 4H), 4.77 (t, 1H). 4.53 (t, 1H), 4.20 (t, 2H), 2.08-2.25 (m, 2H). 78.3.3: 4-(3-Fluoro-butoxy)-benzenesulfonvl chloride The title compound is prepared by analogy with the synthesis of 4-(3-fluoro-propoxy)-benzenesulfonyl chloride described under Example 78.3.2; NMR (CDCI3) d: 7.96 and 7.02 (AA'BB'. 4H), 4.64 (t, 1H). 4.40 (t, 1H), 4.11 (t, 2H), 1,73-2.06 (m, 4H). 78.3.4: 4-(But-3-envloxv)-benzenesulfonvl chloride A stirred mixture of the sodium salt of 4-hydroxybenzenesulfonic acid dihydrate (4.65 g, 20 mmol) in ethanol (20 ml) is treated successively at r.t. with 2N NaOH (10 ml, 20 mmol) and 4-bromo-1-butene (2.03 ml, 20 mmol) and refluxed for 15 h. The solvent is partially distilled off and the residue chilled to O'C. The crystalline product is filtered off and washed with cold H2O. The filtrate is concentrated under vacuum until a precipitate appears. After addition of H2O the suspension Is chilled to O'C and filtered. The residue is rinsed with cold H 2O, combined with the first crop of crystals and dried in vacuo to yield the sodium salt of 4-(but-3-enyloxy)-benzenesulfonic acid. A mixture of this salt (2.67 g, 10,7 mmol) and dichloro¬methane (5 ml) is treated at r.t. with SOCI 2 (5 ml, 68.9 mmol) and DMF (0.2 ml). After stinring for 15 h at r.t, the residue Is treated with Ice-water and the aequous phase extracted twice . with diethyl ether. The combined organic layers are dried with Na 2SO4, evaporated and the residue dried in vacuo to yield the title compound; NMR (CDCI3) d: 7.96 and 7.02 (AA'BB', 4H). 5.77-5.99 (m, 1H), 5.09-5.26 (m, 2H). 4.11 (t, 2H), 2.51-2.66 (m,2H). Example 79: To a solution of 4.2 g (7.93 mmol) of 2-I(4-bijt-3-enyloxy-benzenesulfonyl)-(4-[1,2,4]triazol-1-yl-benzyl)-amlnol-N-(1-methoxy-1-methyl-ethoxy)-acetamide (stage 79.6) In 100 ml of AcOEt, 28 ml of 5 N aqueous hydrochloride are added at r.t After stirring for 5 min, pred- pitates are filtered off and dried in vacuo to give 2-[(4-but-3-enyloxy-benzenesulfonyl)-(4-[1,2,4]triazol-1-yl-ben2yl)-amino]-N-hydroxy-acetamide-hydrochIoride salt as coloriess powder. ^H-NMR (400 MHz, DMS0-d6): 2.45 - 2.55 (m, 2H). 3.67 (s, 2H), 4.13 (t. 2H, J = " 6.56 Hz), 4.41 (s, 2H), 5.09 - 5.22 (m, 2H). 5.90 (m, 1H), 7.10 (d, 2H, J = 9.04 Hz), 7.45 (d, 2H, J = 8.56 Hz). 7.75 - 7.85 (m, 4H), 8.25 (s. 1H). 9.32 (s, 1H). 10.55 (brs, 1H). Stage 79.1:4-But-3-enyioxy-benezenesulfonic acid sodium salt To a suspension of 25 g (108 mmol) of p-phenolsulfonic acid sodium salt-dihydrate in 100ml of ethanol, 54 ml of 2 N aqueous sodium hydroxide (160 mmol) and 11 ml (108 mmol) of 4-bromo-1-butene are successively added at r.t. After refluxing for 15 h at 90 °C, the mixture is cooled to 0 "C to afford predpitates which are filtered off, washed twice with cold water and dried in vacuo to give 4-but-3-enyloxy-benezenesulfonic acid sodium salt. ^H-NMR (400 MHz, DMSO-d6): 2.30 - 2.40 (m, 2H), 3.89 (t, 2H, J = 6.6Hz), 4.92 - 5.07 (m, 2H). 5.70 -5.80 (m, 1H), 6.72 (d, J = 11.4 Hz, 2H), 7.96 (d, J = 11.4 Hz, 2H). Stage 79.2:4-But-3-enyloxy-benezenesulfonyl chloride To a suspension of 13 g (62 mmol) of 4-but-3-enyloxy-benezenesulfonic acid sodium salt in 25 ml of CH2CI2,24.1 ml (333mmol) of thionyl chloride and 0.9 ml of DMF are successively added at r.t. After stirring for 15 h at r.t., the reaction mixture is poured into ice water, extracted with ether, dried over MgS04 and concentrated under reduced pressure to give 4-but-3-enyloxy-benezenesulfonyl chloride. 'H-NMR (400 MHz, CDCb): 2.55 - 2.65 (m, 2H), 4.14 (t, 2 H, J = 6.6Hz), 5.10 - 5.25 (m, 2H), 5.72 - 5.95 (m, 1H), 7.04 (d, 2H, J = 9.04 Hz), 7.96 (d, 2H, J = 9.04 Hz). Stage 79.3:4-11,2,4] Triazol-l-yl-benzaldehyde To a solution of 6.44ml (60 mmol) of p-fluorobenzaldehyde in 40 ml of pyridine, 4.14g (60 mmol) of 1,2.4-triazole, 0.286g (2 mmol) of copper(l)oxide and 9.12g (66 mmol) of potasium carbonate are succeslvely added at r.t. After stirring for 18 h at 125 "C, the reaction mixture Is concentrated under reduced pressure. TTie residue is diluted with CHCI3 and filtered through celite. The filtrate is concetrated and purified by flash column diromatography on silica gel (eiuent n-Hexane: AcOEt = 4:1 ~ AcOEt only - AcOEt: MeOH = 20:1) to give 4-11 ^,4J triazcH-yl-benzaldehyde as major product and 4-11,3.4] triazol-1-yl-benzaIdehyd© as minor product 'H-NMR (400 MHz, CDCb): 7.61 (d, 2H, J « 8.56 Hz), 8.09 (d, 2H. J s 8.56 Hz), 8.59 (s, 1H). 10.10 (s, 1H) (minor product).; 7.91 (d, 2H, J = 7.07 Hz), 8.05 (d, 2H, J = 7.07 Hz). 8.16 (s, 1H), 8.69 (s, 1H), 10.07 (s, 1H) (major product). Stage 79.4: (4-[1,2,4] Triazol-1 -yl-benzyIamlno)-acetic acid ethyl ester To a solution of 3.5 g (20 mrpol) of 4-(1,2,4] triazol-1-yl-benzaldehyde and 4.19 g (30 mmoj) of glycine ethyl ester hydrochloride In 100ml of CH 2CI2,4.18 ml (30 mmol) of triethyl amine aind excess of MgS04 (14 g) are successively added at r.t. After being stirred for 18 h at r.t., the reaction mixture is filtered through celite and concentrated under reduced pressure. The residue is diluted with AcOEt and filtered again. The filtrate is concentrated under reduced pressure to give the crude imine. To a solution of the crude imine In 12 ml of MeOH, 0.756 mg (20 mmol) of NaBH4 is added at -10 "C. After being stirred for 1 h, the reaction is quenched with sat NH4CI and the reaction mixture is extracted with AcOEt .The combined extracts are washed with brine, dried over MgS04 and concentrated under reduced pressure. The residue is purified by column chromatography on silica gel (eluent: n-Hexane: AcOEl = 1:10) to give the titie compound. ^H-NMR (400 MHz. CDCb): 1.29 (t, 3H. J = 7.04 Hz), 1.90 (brs. 1H), 3.43 (s , 2H), 3.88 (s, 2H), 4.21 (q. 2H. J = 7.04 Hz), 7.49 (d, 2H. J = 8.56 Hz), 7.64 (d, 2H, J = 8.56 Hz). 8.10 (s, 1H), 8.55 (s, 1H). Staoe 79.5: [(4-But-3-enyloxy-benzensuIfonyl)-(4-[1,2,4] triazol-1-yl-benzyl)-amino]-acetic acid ethyl ester To a solution of 2 g (7.683 mmol) of (4-[1,2,4] triazol-1-yl-benzylamino)-acetic acid ethyl ester in 15 ml of dioxane and 15 ml of H 20,2.3 g (9.22 mmol) of 4-but-3-enyloxy-benzene-sulfonyl chloride and 1.3 ml (9.22 mmol) of triethyl amine are successively added at 0 -5 °C. After being stin-ed for 18 h at r.t., tiie reaction mixture is diluted with H 2O andextracted with AcOEt. The combined extracts are washed with brine, dried over MgSO 4 and concentrated under reduced pressure. The residue is purified by column chromatography on silica gel to give the title compound. 'H-NMR (400 MHz, CDCb): 1.17 (t, 3H. J = 7.04 Hz), 2.55 - 2.65 (m , 2H). 3.95 (s. 2H), 4.07 (t, 2H. J = 7.04 Hz), 4.09 (t, 2H, J = 6.56 Hz), 4.53 (s, 2H). 5.10 - 5.25 (m, 2H), 5.85 - 5.95 (m, 1H), 6.99 (d, 2H, J = 8.04Hz), 7.44 (d, 2H, J =» 7.56 Hz), 7.64 (d, 2H, J = 8.04Hz), 7.82 (d. 2H. J =: 7.56 Hz), 8.11 (s, 1H), 8.55 (s, 1H). Stage 79.6:2-{(4-But-3-enyloxy-benzenesulfonyl)-(4-{1,2,4]triazol-1 -yl-benzyO-amlno]-N-(1 -methoxy-1-methyl-ethoxy)-acetamide To a solution of 3.61 g (7.67 mmol) of [(4-but-3-enyloxy-benzensulfonyl)-(4-[1,2,4] triazol-1-yl-benzyO-aminoJ-acetic acid ethyl ester in 38 ml of THF and 38 ml of MeOH, 0.966 g (23 mmol) of lithum hydroxide monohydrate and 4 ml of H 2O are added at 0-5 °C. After being stin-ed for 3.5 h, the reaction mixture is acidified with 2 N aqueous hydrochloride at 0 -5 "C and concentrated und^r reduced pressure to give [(4-but-3-enyloxy-ben2ensulfonyl)-(4-[1,2,4] triazol-1-yl-benzyl)-amino]-acetic acid as a colorless powder. To a solution of 3.76 g of the above prepared acid and 1.87 g (13.81 mmol) of l-hydroxybenztriazole (HOBT) in 35 ml of DMF, 1.61g (15.34 mmol) of 0-(1-methyoxy-1-methyl-ethyl)-hydroxylamine and 1.91 g (12.275 mmol) of 1-ethyl-3-(3-dJmethylaminopropyl)-carbodlimide are added successively at 0 °C. After being stirred for 3.5 h at r.t, the reaction mixture is poured into ice water and the mixture is extracted with AcOEt The combined extracts are washed with brine, dried over MgS04and concentrated under reduced pressure. The residue is purified by column chromatography on silica gel (eluent: n-Hexane: AcOEt = 1:3-1:4) to give the title compound. 'H-NMR (400 MHz, CDCb): 1.34 (s, 6H), 2.55 - 2.65 (m, 2H), 3.29 (s, 3H), 3.73 (s, 2H), 4.09 (t, J = 6.60 Hz, 2H), 4.44 (s, 2H). 5.10 - 5.25 (m, 2H). 5.85 - 5.95 (m, 1H), 7.01 (d, 2H. J = 8.52Hz), 7.44 (d, 2H. J=8.0 Hz), 7.64 (d, 2H, J = 8.52Hz), 7.81 (d, 2H, J = 8.0 Hz), 8.10 (s, 1H), 8.54 (s, 1H), 8.62 (brs, 1H). Example 80: 2-rf4-But-3-envloxv-benzenesulfonvn-(4-imida2ol-1 -vl-benzvlVaminol-N-hydroxy-acetamide-hydrochloride To a solution of 0.39 g (0.74 mmol) of 2-[(4-but-3-enyloxy-benzenesulfonyl)-(4-imidazol-1-yl-benzyl)-amino]-N-(1-methoxy-1-methyl-ethoxy)-acetamlde (stage 80.4), 2.46 ml of 6 N aqueous hydrochloride is added at r.t. After being stirred for 15 min, the reaction mixture is neutralized with sat NaHCOaand extracted with AcOEt. The combined extracts are washed with brine, dried over MgS04 and concentrated under reduced pressure to give 2-[(4-but-3-enyfoxy-benzenesulfonyl)-(4-imldazol-1 -yH5enzyl)-amino]-N-hydroxy-acetamide as a coloriess powder. To a solution of 0.17 g (0.37 mmol) of the above prepared hydroxy acetamide in 3 ml of dioxane, 0.447 ml of 1 N aqueous hydrochloride is added and stin-ed forlO min. The reaction mixture is concentrated under reduced pressure and dried in vacuo to give ther title compound. ^H-NMR (400 MHz, DMS0-d6): 2.40 - 2,50 (m, 2H), 3.61 (s, 2H), 4.07 (t. 2H, J = 6.52H2), 4.37 (s, 2H), 5.00 - 5.15 (m, 2H). 5.75 - 5.90 (m. 1H), 7.04 (d, 2H. J = 8.56 Hz), 7.48 (d, 2H, J s 8.56 Hz), 7.65 - 7.75 (m, 5H), 7.81 (s, 1 H), 8.19 (s, 1H), 9.57 (s,1H). 10.54 (brs, 1H). stage 80.1:4-lmidazol-1-yl-ben2alclehyde To a solution of 20 g (161.1 mmol) of p-fluorobenzaldehyde in 300 ml of DMF, 19.8 g (290.8 mmol) of imidazole and 44.5 g (322.24 mmol) of potaslum carbonate are step by step added at r.t. After being stirred for 5.5 h at 100 °C, the reaction mixture is cooled to r.t, diluted with ice water and then the mixture is extracted with AcOEt and CH 2CI2. The combined extracts are concentrated under reduced pressure to give 4-imidazol-1-yl-benzaldehyde as a pale yellow powder. 'H-NMR (400 MHz, CDCI3): 7.26 (s, 1H), 7.38 (2, 1H), 7.59 (d, 2H, J = 8.56 Hz), 7.98 (s, 1H), 8.02 (d, 2H, J = 8.56 Hz), 10.05 (s, 1H). Stage 80.2: (4-lmidazol-1-yl-benzylamlno)-acetic acid methyl ester The title compound is prepared in the same manner as (4-[1,2,4] Triazol-1-yl-benzyl-amino)-acetic acid ethyl ester (stage 79.4). 'H-NMR (400 MHz, CDCb): 1.92 (fars, 1H), 3.45 (s, 2H). 3.75 (s. 3H), 3.86 (s, 2H), 7.20 (s, 1H), 7.27 (s, 1H), 7.35 (d, 2H, J = 8.56 Hz), 7.45 (d, 2H, J = 8.56 Hz), 7.84 (S,1H). Stage 80.3: [(4-But-3-enyloxy-benzensulfonyl)-(4-imidazol-1-yl-benzyl)-amino ]-acetic acid methyl ester The title compound is prepared in the same manner as [(4-but-3-enyloxy-benzensulfonyl)-(4-[1,2,4]triazol-1-yl-benzyl)-amlno]-acetic acid ethyl ester (stage 79.5). ^H-NMR (400 MHz, CDCI3): 2.55 - 2.65 (m. 2H). 3.59 (s, 3H), 3.95 (s, 3H), 4.05 - 4.10 (m, 2H). 4.51 (s, 2 H), 5.10 - 5.25 (m. 2H), 5.85 - 6.00 (m, 1H), 6.99 (d, 2H, J = 7.04Hz), 7.20 (s, 1H), 7.27 (s, 1H), 7.35 (d, 2H, J = 8.56 Hz), 7.40 (d, 2H, J = 8.56Hz), 7.83 (d, 2H, J = 7.04 Hz), 7.84 (s, 1H). Stage 80.4:2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-imidazol-1 -yl-benzyl)-amino]-.N(1 -methoxy-1-methyl-ethoxy)-acetoamlde The titie compound Is prepared in ttie same manner as 2-{(4-but-3-enyloxy-benzene-sulfonyl)-(4-[1,2,4]triazol-1 -yl-benzyl)-aminol-N-(1 -methoxy-1 -methyI-ethoxy)-acetamlde (stage 79.6). 'H-NMR (400 MHz, CDCb): 1.35 (s, 6H). 2.55 - 2.65 (m. 2H), 3.28 (s, 3H). 3.73 (s, 2H), 4.05 - 4.15 (m, 2H), 4.42 (s, 2H), 5.10 - 5.25 (m, 2H), 5.82 - 5.95 (m, 1H), 7.01 (d. 2H. J = 8.52Hz), 7.20 (s, 1H), 7.24 (s, 1H), 7.34 (d. 2H, J =: 8.56 Hz), 7.44 (d, 2H, J = 8.52H2), 7.81 (d. 2H, J = 8.56 Hz), 7.83 (s, 1H). 8.72 (br s, 1H). Example 86: Dry capsules 3000 capsules, each of which contain 0.25 g of one of the compounds of the formula I mentioned in the preceding Examples as active Ingredient, are prepared as follows: Composition Active ingredient 75.00 g Lactose 750.00 g Avicel PH 102 300.00 g (microcrystalline cellulose) Polyplasdone XL 30.00 g (polyvlnylpyn'olidone) Magnesium stearate 9.00 g Preparation process: The active ingredient is passed through a No. 30 hand screen. The active ingredient, lactose, Avicel PH 102 and Polyplasdone XL are blended for 15 minutes in a mixer. The blend is granulated with sufficient water (about 500 mL), dried in an oven at 35°C overnight, and passed through a No. 20 screen. Magnesium stearate Is passed through a No. 20 screen, added to the granulatton mixture, and the mixture is blended for 5 minutes in a mixer. The blend is encapsulated in No. 0 hard gelatin capsules each containing an amount of the blend equivalent to 25 mg of the active ingredient. Example 87: In vitro activity on MT1-MMP. MMP1. MMP2 and MMP9 The inhibitory activities of compounds of formula I on MT1-MMP, MMP1, MMP2 and MMP9 as detennined in the in vitro tests described in the present application are given in Tabel I. Table I Example I MT1-MMP I MMP1 I MMP2 I MMP9 ICso [^mol/iitre] ICso bunoi/litre] IC50 [}xmol/lltre] ICso Ijimol/iitre] WE CLAIM: 1. An a-amino hydroxamic acid derivative of the formula I, wherein Ri is hydrogen, C1.7 alkyl, or substituted or unsubstituted carbocyclic aryl- C1-7 alkyl; R2 is hydrogen or C1.7 alkyl; R3 is substituted or unsubstituted Ca-Cz-cycloalkyI; phenyl which is unsubstituted or mono- or disubstituted by halogen, lower alkoxy, C1-7 alkyl, di-lower alkyl amino, triazolyl, imidazolyl, morpholinyl, pyrrolidinyi, piperidinyl, tetrazolyl, pyrrolyl, furyl, thienyl, morpholinyl C1-7 alkyl, quinolinyl C1-7 alkyl, imidazolyl C1.7 alkyl and triazolyl C,.7 alkyl; pyridyl, quinolyl, isoquinolyl, benzothienyl, benzofuranyl, benzopyranyl, benzothiopyranyl, furanyl, pyrrolyl, thiazolyl, oxazolyl, isoxazolyl, triazolyl, tetrazolyl, pyrrazolyl, imidazolyl, thienyl, or any said radical substituted by C1.7 alkyl or halogen; piperidinyl, morpholinyl, pyrrolidinyi, pyrrolinyl, piperazinyl and tetrahydropyranyl unsubstituted or substituted by C1-7 alkyl; or C1.7 alkyl; A is C1-C3 alkylen unsubstituted or substituted by C1-7 alkyl; q is 1 or 2; R is C2-C7-alkyl, which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, Ca-Cs-cycloalkyI or Ca-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S, and N which is unsubstituted or substituted by C1-7 alkyl; C3-C7-alkenyl or Cs-Cr-alkynyl, which in each case is unsubstituted or mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano; Ca-Cs-cycloalkyl or Ca-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S, and N, which is unsubstituted or substituted by C1.7 alkyl; and pharmaceutically acceptable prodrug acyl derivatives; and pharmaceutically acceptable salts thereof, wherein organic radicals designated "lower" contain not more than 7 carbon atoms; and with the proviso that a compound of formula I is not 2-[(4-But-2-ynyloxy-benzenesulfonyl)-pyridin-3-ylmethyl-amino]-N-hydroxy-acetamide hydrochloride, 2-[(4-But-2-ynyloxy-benzenesulfonyl)-pyridin-3-ylmethyl-amino]-N-hydroxy-propionamide hydrochloride, 2-[(4-But-2-ynyloxy-benzenesulfonyl)-(3-phenyl-propyl)-amino]-N-hydroxy-acetamide hydrochloride, 2-[(4-But-2-ynyloxy-benzenesulfonyl)-pyridin-3-ylmethyl-amino]-N-hydroxy-3-methyl-butyramide, 1-[{[4-(2-Butynyloxy)phenyl]sulfonyl}(3-pyridinylmethyl)amino]-N-hydroxycyclohexamecaboxamide or 2-[{4-But-2-ynyloxy-benzenesulfonyl)-methyl-amino]-2-cyclohexyl-N-hydroxy-acetamide hydrochloride. 2. The compound of formula I according to claim 1, wherein Ri is hydrogen, Ci-/ alkyl, or phenyl C1.7 alkyl; R2 is hydrogen; R3 is phenyl monosubstituted by lower alkoxy or halogen; or C1-7 alkyl; A is C1-C3 alkylen; qis1; R is Ca-Cy-alkyI, which is mono- or trisubstituted by halogen; unsubstituted Ca-Cz-alkenyl or unsubstituted Ca-Cy-alkynyl; and pharmaceutically acceptable salts thereof. 3. The compound of formula I according to claim 1, wherein Ri is hydrogen; R2 is hydrogen; R3 is phenyl monosubstituted by lower alkoxy or halogen; A is Ci-Ca alkylen; qis1; R is unsubstituted Cs-Ce-alkenyi, in which the double bond is terminally located; or unsubstituted Ca-Cs-alkynyl, In which the triple bond is terminally located; and pharmaceutically acceptable salts thereof. 4. Thecompound of formula I according to claim 1, wherein Ri is hydrogeri; R2 is hydrogen; R3 is phenyl monosubstituted by lower alkoxy or halogen; A is methyien or ethyien; q is 1; and R is unbranched Cs-Cs-alkyI, which is terminally monosubstituted by halogen; and pharmaceutically acceptable salts thereof. 5. The compound of formula I according to claim 1, wherein Ri is hydrogen, C1-7 alkyl, or phenyl C1-7 alkyl; R2 is hydrogen; R3 is Cs-Cr-cycloalkyI, which is unsubstituted or substituted by C,./ alkyl; phenyl which is unsubstituted or mono- or disubstituted by C1-7 alkyl, lower alkoxy, hydroxy, nitro, amino, lower alkyl amino, di-lower alkyl amino, carbamoyl, trifluoromethyl, trifluoromethoxy, lower alkylthio, lower acyloxy, halogen, triazolyl, imidazolyl, morpholinyl, pyrrolidinyl, piperidinyl, tetrazolyl, pyrrolyl, furyl, thienyl, morpholinyl I C1.7 alkyl, quinolinyl C1-7 alkyl, imidazolyl C1.7 a'kyi, triazolyl C1.7 alkyl; pyridyl, pyrimidyl, pyrryl, imidazolyl, indolyl, thienyl, benzothienyl, furyl, benzofuranyl, oxazolyl, thiazolyl, which in each case are unsubstituted or substituted by C1.7 alkyl or halogen; heterocyclyl, which is unsubstituted or substituted by lower alkyl and which is selected from the group consisting of piperidinyl, morpholinyl, pyrrolidinyl, pyrrolinyl, piperazinyl and tetrahydropyranyl; A is methyien or ethyien; q is1; R is C2-C7-alkyl, which is mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano, Ca-Cs-cycloalkyI or Cs-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S, and N which is unsubstituted or substituted by C1.7 alkyl; C3-C7-alkenyl or Ca-Cr-alkynyl, which in each case is unsubstituted or mono-, di- or trisubstituted by halogen, nitro, lower acyloxy, trifluoromethoxy, cyano; Ca-Cs-cycloalkyI or Ca-Ce-heteroaryl comprising one or two heteroatoms selected from the group consisting of O, S, and N, which is unsubstituted or substituted by C1.7 alkyl; and pharmaceutically acceptable salts thereof. 6. Thecompound of formula I according to claim 1, wherein Ri is hydrogen, C1-7 alkyl, or phenyl C1.7 alkyl; R2 is hydrogen; R3 is phenyl which is unsubstituted or mono- or disubstituted by C1-7 alkyl, lower alkoxy, di-lower alkyl amino, halogen, triazolyl, imidazolyl, morpholinyl, pyrrolidinyl, piperidinyl, tetrazolyl, pyrrolyl, furyl, thienyl, morpholinyl C1.7 alkyl, quinolinyl c,.7 alkyl. imidazolyl C1.7 alkyl, triazolyl C1.7 alkyl; pyridyl, which is unsubstituted or substituted by haolgen; heterocyclyl, which is unsubstituted and which is selected from the group consisting of piperidinyl, morpholinyl, pyrrolidinyl, pyrrolinyl, piperazinyl and tetrahydropyranyl; A is methylen; q is 1; R is unsubstituted Cs-Cs-alkenyl, in which the double bond is terminally located; unsubstituted Ca-Cs-aikynyl, in which the triple bond is terminally located; or unbranched C3- Cs-alkyl, which is terminally monosubstituted or trisubstituted by halogen, or terminally monosubstituted by furyl or cyciopropyl; and pharmaceutically acceptable salts thereof. ^- The compound of the formula I according to claim 1 selected from the group consisting of (R)-2-[(4-Chloro-benzyl)-(4-propoxy-benzenesulfonyl)-amino]-N-hydroxy-3-phenyl- propionamide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-fluoro-benzyl)-amino}-N-hydroxy-3-methyl- butyramide, {R)-2-{{4-(3-Chloro-propoxy)-benzenesuifonylJ-(3-methoxy-benzyl)-amino}-N-hydroxy-3- methyl-butyramide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-3- methyl-butyramide, (R)-2-{{4-Chloro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-3-methyl- butyramide, (R)-2-{(4-Fluoro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-3-methyl- butyramide, (R)-2-{(4-Fluoro-benzyl)-[4-{3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-3-methyl- butyramide. (R)-2-{(4-Ch!oro-benzyl)-[4-(4-fluoro-butoxy)-ben2enesulfonyl]-amino}-N-hyclroxy-3-methyl- butyramide, (R)-2-{(4-Fluoro-benzyl)-[4-(4-fluoro-butoxy)-ben2enesulfonyl]-amino}-N-hyclroxy-3-methyl- butyramide, (R)-2-{[4-(4-Fluoro-butoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy-3- methyl-butyramide, (R)-2-[(4-But-3-enyIoxy-benzenesulfonyl)-(4-chloro-benzyl)-amino]-N-hydroxy-3-methyl- butyramide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-fluoro-benzyl)-amino]-N-hydroxy-3-methyl- butyramide, (R)-2-[(4-But-3-enyloxy-benzenesulfonylH3-methoxy-benzyl)-amino]-N-hydroxy-3-methyl- butyramide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-methoxy-benzyl)-amino]-N-hydroxy-3-methyl- butyramide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy- propionamide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy- propionamide, (R)-2-{(4-Chloro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy- propionamide, (R)-2-{(4-Fluoro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy- propionamide, (R)-2-{[4-(3-Fluoro-propoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy- propionamide, (R)-2-{(4-Fluoro-benzyl)-[4-(4-f!uoro-butoxy)-benzenesuifonyl]-amino}-N-hydroxy- propionamide, {R)-2-{[4-(4-Fluoro-butoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy- propionamide, (R)-2-{[4-{4-Fluoro-butoxy)-ben2enesulfonyl]-{4-methoxy-benzyl)-amino}-N-hydroxy- propionamide, (R)-2-[(4-But-3-enyIoxy-benzenesulfonyl)-(4-chloro-benzyl)-amino]-N-hydroxy-propionamide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(3-methoxy-benzyl)-amino]-N-hydroxy- propionamide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-methoxy-benzyl)-amino]-N-hydroxy- propionamide, (R)-2-{(4-Chloro-benzyl)-[4-{3-chloro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-3-phenyl- propionamide, (R)-2-{I4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-fIuoro-benzyl)-amino}-N-hydroxy-3-phenyl- propionamide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy-3- phenyl-propionamide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-3- phenyl-propionamide, (R)-2-{(4-ChIoro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-3-phenyl- propionamide, (R)-2-{(4-Fluoro-benzyl)-[4-(3-fIuoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-3-phenyl- propionamide, (R)-2-{[4-(3-Fluoro-propoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy-3- phenyl-propionamide, (R)-2-{[4-(3-Fluoro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-3- phenyl-propionamide, (R)-2-{(4-Chloro-benzyl)-[4-(4-fluoro-butoxy)-benzenesulfonyl]-amino}-N-hydroxy-3-phenyl- propionamide, (R)-2-{(4-FIuoro-benzyl)-[4-(4-fluoro-butoxy)-benzenesulfonyl]-amino}-N-hydroxy-3-phenyl- propionamide, (R)-2-{[4-(4-Fluoro-butoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-arnino}-N-hydroxy-3- phenyl-propionamide, (R)-2-{[4-(4-Fluoro-butoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-3- phenyl-propionamide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-chloro-benzyl)-amino]-N-hydroxy-3-phenyl- propionamide, {R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-fluoro-benzyl)-amino]-N-hydroxy-3-phenyl- propionamide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(3-methoxy-benzyl)-amino]-N-hydroxy-3-phenyl- propionamide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-{4-methoxy-benzyl)-amino]-N-hydroxy-3-phenyl- propionamide, (R)-2-{(4-Chloro-benzyl)-[4-(3-chloro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-4-methyl- valeramide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-fluoro-benzyl)-amino}-N-hydroxy-4-methyl- valeramide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy-4- methyl-valeramide, (R)-2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-4- methyl-valeramide, (R)-2-{(4-Chloro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-4-methyl- valeramide, (R)-2-{(4-Fluoro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-4-methyl- valeramide, (R)-2-{[4-(3-Fluoro-propoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy-4- methyl-valeramide, (R)-2-{[4-(3-Fluoro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-4- metiiyl-valeramide, (R)-2-{(4-Chloro-benzyl)-[4-(4-fluoro-butoxy)-benzenesulfonyl]-amino}-N-hydroxy-4-methyl- valeramide, (R)-2-{(4-Fluoro-benzyI)-[4-(4-fluoro-butoxy)-benzenesulfonyl]-amino}-N-hydroxy-4-methyl- valeramide, (R)-2-{[4-(4-Fluoro-butoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy-4- methyl-valeramide, (R)-2-{[4-(4-Fluoro-butoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-4- methyl-valeramide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-chloro-ben2yl)-amino]-N-hydroxy-4-methyl- valeramide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyi)-(4-fluoro-benzyl)-amino]-N-hydroxy-4-methyl- valeramide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(3-methoxy-benzyl)-amino]-N-hydroxy-4-methyl- valeramide, (R)-2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-methoxy-benzyl)-amino]-N-hydroxy-4-methyl- valeramide, 2-{[4-(4-Fluoro-butoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-liydroxy-acetamide, 2-{[4-(3-Chioro-propoxy)-benzenesulfonyl]-(4-fluoro-benzyl)-amino}-N-hydrbxy-acetamide, 2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(3-methoxy-benzyl)-amino}-N-hydroxy-acetamide, 2-{(4-Chloro-benzyl)-[4-(3-chloro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-acetamide, 2-{(4-Fluoro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-acetamide, 2-{[4-(3-Fluoro-propoxy)-benzenesulfonyl]-(3-methoxy-benzyI)-amino}-N-hydroxy-acetamide, 2-{(4-Chloro-benzyl)-[4-(3-fluoro-propoxy)-benzenesulfonyl]-amino}-N-hydroxy-acetamide, 2-{(4-Fluoro-benzyl)-[4-(4-f!uoro-butoxy)-benzenesulfonyl]-amino}-N-hydroxy-acetamide, 2-{(4-Chloro-benzyl)-[4-(4-fluoro-butoxy)-benzenesulfonyl]-amino}-N-hydroxy-acetamide, 2-[(4-But-3-enyloxy-benzenesulfonyi)-(4-chloro-benzyl)-amino]-N-hydroxy-acetamide, 2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-acetamide, 2-{[4-(4-Fluorobutoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino]-N-hydroxy-acetamide, 2-{[4-(4-Chlorobutoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-acetamide, {(4-Methoxy-benzylH4-(4,4,4-trifluorobutoxy)-benzenesulfonyl]-amino}-N-hydroxy- acetamide, {[4-(4-Fiuoropropoxy)-benzenesulfonyl]-(4-methoxy-benzyl)-amino}-N-hydroxy-acetannide, [(4-But-3-en-1-yloxy-benzenesulfonyl]-(4-methoxy-benzyl)-amino]-N-hydroxy-acetamide, 2-{[4-(3-Chloropropoxy)-benzenesulfonyl]-pyridine-3-ylmethyl-amino}-N-hydroxy-acetamide, [(4-Methoxy-benzyl)-[4-prop-2-ynyloxy-benzenesulfonyl]-amino]-N-hydroxy-acetamide, [(4-Methoxy-benzylH4-but-2-ynyloxy-benzenesulfonyl]-amino]-N-hydroxy-acetamide, 2-{[4-(3-Chloropropoxy)-benzenesulfonyl}-(2,2-dimethyl-propyl)-amino-N-hydroxy- acetamide, 2-[(4-But-3-enyloxy-benzenesulfony!)-(4-[1,2,4]triazol-1 -yl-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-imidazol-1-yl-benzyl)-amino]-N-hydroxy-acetamide- hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-morphoIin-4-yl-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride, 2-[(2-Cyclopropylethoxy-benzenesulfonyl)-(4-[1,2,4]triazol-1 -yl-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride salt, 2-[(Cyclopropylmethoxy-benzenesuifonyl)-(4-[1,2,4]triazol-1-yl-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride salt, 2-[(3-Furylmethoxy-benzenesulfonyl)-(4-[1,2,4]triazol-1-yl-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride salt, 2-[2-(3-Furyl)ethoxy-benzenesuIfonyl)-(4-[1,2,4]triazol-1 -yl-benzyl)-amino]-N-hydroxy- acetamide-hydrochlorfde salt, 2-{[4-But-3-enyloxy-benzenesulfonyl]-(6-fluoro-pyridine-2-yl)methyl-amino}-N-hydroxy- acetamide, 2-{[4-But-3-enyloxy-benzenesulfonyl]-(2-fluoro-pyridine-4-yl)methyl-amino}-N-hydroxy- acetamide, 2-{[4-But-3-enyloxy-benzenesulfonyl]-(6-fluoro-pyridine-3-yl)methyl-amino}-N-hydroxy- acetamide, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(piperidin-4-yl-methyl)-amino]-N-hydroxy-acetamide- hydrochloride, 2-[{4-But-3-enyloxy-benzenesulfonyl)-(piperidin-1-yl-methyl)-amino]-N-hydroxy-acetamide- hydrochloride, 2-[(4-But-3-eny!oxy-benzenesu!fonyIHmorpholin-4-yl-methyl)-amino]-N-hydroxy-acetamide- hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(pyrrolidin-1-yl)-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(piperidin-1-yl)-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(1,2,3-triazol-2-yl)-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(tetrazol-1-yl)-benzyl)-amino]-N-hydroxy-acetamide- hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(1,3,4-triazol-1-yl)-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(1,2,3-triazol-1-yi)-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(pyrrol-1-yl)-benzyl)-amino]-N-hydroxy-acetamide, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-dimethylaminobenzyl)-amino]-N-hydroxy-acetamide- hydrochloride, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(3-furyl)-benzyl)-amino]-N-hydroxy-acetannide, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-(thien-5-yl)-benzyl)-amino]-N-hydroxy-acetamide, 2-[(4-But-3-enyloxy-benzenesulfonyl)-(4-morpholin-4-ylmethyl-benzyl)-amino]-N-hydroxy- acetamide-hydrochloride, 2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(4-(morpholin-4-ylmethyl)-benzyl)-amino}-N- hydroxy-acetamide, 2-{[4-(3-Chlord-prdpoxy)-benzeriesulfonyl]-(quihdlih-4-ylrriethyl)-amino}-N-hydroxy- acetamide, 2-{[4-(3-Chloro-propoxy)-benzenesulfonyl]-(imidazol-4-ylmethyl)-amino}-N-hydroxy- acetamide, 2-{[4-{3-Chloro-propoxy)-benzenesulfonyl]-(1,2,4-tria20l-3-ylmethyl)-amino}-N-hydroxy- acetamide, and the pharmaceutical acceptable salts thereof. 8. A pharmaceutical composition comprising a compound of the formula I according to any one of claims 1-7 or a pharmaceutically acceptable salt or a pharmaceutically acceptable prodrug acyl derivative of such a compound together with a pharmaceutical carrier. 9. A process for the preparation of an a-amino hydroxamic acid derivative of the formula I, wherein R\ R^, R^, A, q and R are as defined in claim 1 or a salt ttiereof, which comprises reacting a compound of the formula it in which R, q, Ri and Rz are as defined above for compounds of the formula I and the black circular plane indicates that the compound is bound to a polymer resin, free functional groups present in the compound, if necessary, being protected by easily detachable protective groups, in a suitable solvent, first with triphenylphosphine, an alcohol of the structure 111, HO-A-R3 ('") in which A and R3 are as defined above for compounds of formula 1, and diethyl azodi-carboxylate, free functional groups present in this compound, if necessary, being protected by easily detachable protective groups or, in accordance with the principle of latent functio¬nality, being in a form which can be converted into the functional groups and then to cleave the product of the reaction from the polymer resin and if necessary for the preparation of a salt, converting a resulting free compound of the formula I into a salt or, if necessary for preparation of a free compound, converting a resulting salt of a compound of the formula I into the free compound. 10, A compound of the formula II (II) in which R, q, A, Ri, R2 and R3 are as defined above for compounds of the formula I, free functional groups present in the compound, if necessary, being protected by easily detachable protective groups, or a salt thereof. Dated this 29 day of Januray 2002 |
|---|
in-pct-2002-0162-che abstract-duplicate.pdf
in-pct-2002-0162-che abstract.pdf
in-pct-2002-0162-che claims-duplicate.pdf
in-pct-2002-0162-che claims.pdf
in-pct-2002-0162-che correspondence-others.pdf
in-pct-2002-0162-che correspondence-po.pdf
in-pct-2002-0162-che description (complete)-duplicate.pdf
in-pct-2002-0162-che description (complete).pdf
in-pct-2002-0162-che form-1.pdf
in-pct-2002-0162-che form-3.pdf
in-pct-2002-0162-che pct search report.pdf
| Patent Number | 221395 | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Indian Patent Application Number | IN/PCT/2002/162/CHE | ||||||||
| PG Journal Number | 37/2008 | ||||||||
| Publication Date | 12-Sep-2008 | ||||||||
| Grant Date | 23-Jun-2008 | ||||||||
| Date of Filing | 29-Jan-2002 | ||||||||
| Name of Patentee | NOVARTIS AG | ||||||||
| Applicant Address | LICHTSTRASSES 35, CH-4056 BASEL | ||||||||
Inventors:
|
|||||||||
| PCT International Classification Number | C07C311/29 | ||||||||
| PCT International Application Number | PCT/EP00/07641 | ||||||||
| PCT International Filing date | 2000-08-07 | ||||||||
PCT Conventions:
|
|||||||||