Title of Invention	AN ISOLATED POLYNUCLEOTIDE THAT ENCODES A PESTICIDALLY ACTIVE PROTEIN AND THE PROTEIN
Abstract	The present invention relates to an isolated polynucleotide that encodes a pesticidally active protein, wherein said protein has at least 95% identity with the amino acid sequence of SEQ ID NO:54.

Full Text

The present invention relates to an isolated polynucleotide that encodes a pesticidally active protein and the protein. Insects and other pests cost farmers billions of dollars annually in crop losses and in the expense of keeping these pests under control. The losses caused by insect pests in agricultural production environments include decrease in crop yield, reduced crop quality, and increased harvesting costs. Cultivation methods, such as crop rotation and the application of high nitrogen levels to stimulate the growth of an adventitious root system, has partially addressed problems caused by agricultural pests. Economic demands on the utilization of farmland restrict the use of crop rotation. In addition, overwintering traits of some insects are disrupting crop rotations in some areas. Thus, chemical insecticides are relied upon most heavily to guarantee the desired level of control. Insecticides are either banded onto or incorporated into the soil. The use of chemical insecticides has several drawbacks. Continual use of insecticides has allowed resistant insects to evolve. Situations such as extremely high populations of larvae, heavy rains, and improper calibration of insecticide application equipment can result in poor control. The use of insecticides often raises environmental concerns such as contamination of soil and of both surface and underground water supplies. The public has also become concerned about the amount of residual, synthetic chemicals which might be found on food. Working with insecticides may also pose hazards to the persons applying them. Therefore, synthetic chemical pesticides are being increasingly scrutinized, and correctly so, for their potential toxic environmental consequences. Examples of widely used synthetic chemical pesticides include the organochlorines, e.g., DDT, mirex, kepone, lindane, aldrin, chlordane, aldicarb, and dieldrin; the organophosphates, e.g., chlorpyrifos, parathion, malathion, and diazinon; and carbamates. Stringent new restrictions on the use of pesticides and the elimination of some effective pesticides from the market place could limit economical and effective options for controlling damaging and costly pests. Because of the problems associated with the use of organic synthetic chemical pesticides, there exists a clear need to limit the use of these agents and a need to identify alternative control agents. The replacement of synthetic chemical pesticides, or combination of these agents with biological pesticides, could reduce the levels of toxic chemicals in the environment. A biological pesticidal agent that is enjoying increasing popularity is the soil microbe Bacillus thuringiensis (B.t.), The soil microbe Bacillus thuringiensis (B.t.) is a Gram-positive, spore-forming bacterium. Most strains of B.t, do not exhibit pesticidal activity. Some B.t . strains produce, and can be characterized by, parasporal crystalline protein inclusions. These inclusions often appear microscopically as distinctively shaped crystals. Some B.t, proteins are highly toxic to pests, such as insects, and are specific in their toxic activity. Certain insecticidal B.t. proteins are associated with the inclusions. These "6-endotoxins," are different from exotoxins, which have a non-specific host range. Other species of Bacillus also produce pesticidal proteins. Certain Bacillus toxin genes have been isolated and sequenced, and recombinant DNA-based products have been produced and approved for use. In addition, with the use of genetic engineering techniques, new approaches for delivering these toxins to agricultural environments are under development. These include the use of plants genetically engineered with toxin genes for insect resistance and the use of stabilized intact microbial cells as toxin delivery vehicles. Thus, isolated Bacillus toxin genes are becoming commercially valuable. Until the last fifteen years, commercial use of 5./. pesticides has been largely restricted to targeting a narrow range of lepidopteran (caterpillar) pests. Preparations of the spores and crystals of 5. thuringiensis subsp. kurstaki have been used for many years as commercial insecticides for lepidopteran pests. For example, B. thuringiensis var. kurstaki HD-1 produces a crystalline 6-endotoxin which is toxic to the larvae of a number of lepidopteran insects. In recent years, however, investigators have discovered B.t. pesticides with specificities for a much broader range of pests. For example, other species of B.t., namely israelensis and morrisoni (a.k.a. tenebrionis, a.k.a. B,t M-7, a.k.a. B.t. san diego), have been used commercially to control insects of the orders Diptera and Coleoptera, respectively. Bacillus thuringiensis var. tenebrionis has been reported to be active against two beetles in the order Coleoptesra (Colorado potato beetle, Leptinotarsa decemlineata, and Agelastica alni). More recently, new subspecies of B.t have been identified, and genes responsible for active 6-endotoxin proteins have been isolated. H6fte and Whiteley classified 5./. crystal protein genes into four major classes (H6fte, H., H.R. Whiteley [1989] Microbiological Reviews 52(2):242-255). The classes were Cryl (Lepidoptera-specific), Cryll (Lepidoptera- and Diptera-specific), CryllT (Coleoptera-specific), and CrylV (Diptera-specific). The discovery of strains specifically toxic to other pests has been reported. For example, CryV and Cry VI have been proposed to designate a class of toxin genes that are nematode-specific. The 1989 nomenclature and classification scheme of Hofte and Whiteley for crystal proteins was based on both the deduced amino acid sequence and the host range of the toxin. That system was adapted to cover 14 different types of toxin genes which were divided into five major classes. The number of sequenced Bacillus thuringiensis crystal protein genes currently stands at more than 50. A revised nomenclature scheme has been proposed which is based solely on amino acid identity (Crickmore et ai [1996] Society for Invertebrate Pathology, 29th Annual Meeting, IIIrd International Colloquium on Bacillus thuringiensis. University of Cordoba, Cordoba, Spain, September 1-6, 1996, abstract). The mnemonic "cry" has been retained for all of the toxin genes except cytA and cytB, which remain a separate class. Roman numerals have been exchanged for Arabic numerals in the primary rank, and the parentheses in the tertiary rank have been removed. Many of the original names have been retained, with the noted exceptions, although a number have been reclassified. Manyother B,t. genes have now been identified. WO 94/21795, WO 96/10083, WO 98/44137, and Estruch, JJ. et al (1996) PNA5 93:5389-5394 describe ViplA(a), ViplA(b), Vip2A(a), Vip2A(b), Vip3A(a), and Vip3A(b) toxins obtained from Bacillus microbes. Those toxins arc reported to be produced during vegetative cell growth and were thus termed vegetative insecticidal proteins (VIP). Activity of these toxins against certain lepidopteran and certain coleopteran pests was reported. WO 98/18932 discloses new classes of pesticidal toxins. Obstacles to the successful agricultural use of Bacillus toxins include the development of resistance to 5./. toxins by insects. In addition, certain insects can be refractory to the effects of Bacillus toxins. The latter includes insects such as boll weevil and black cutworm as well as adult insects of most species which heretofore have demonstrated no apparent significant sensitivity to B.t. 6-endotoxins. While resistance management strategies in B.L transgene plant technology have become of great interest, there remains a great need for developing additional genes that can be expressed in plants in order to effectively control various insects. The subject application provides new classes of toxins and genes, in addition to those described in W098/18932, and which are distinct fi'om those disclosed in WO 94/21795, WO 96/10083, WO 98/44137, and Estruch et al. Brief Summary of the Invention The subject invention concerns materials and methods useful in the control of non-mammalian pests and, particularly, plant pests. In one embodiment, the subject invention provides novel Bacillus isolates having advantageous activity against non-mammalian pests. In a further embodiment, the subject invention provides new toxins useful for the control of non-mammalian pests. In a preferred embodiment, these pests are lepidopterans and/or coleopterans. The, toxins of the subject invention include 6-endotoxins as well as soluble toxins which can be obtained from the supernatant of Bacillus cultures. The subject invention further provides nucleotide sequences which encode the toxins of the subject invention. The subject invention further provides nucleotide sequences and methods usefiil in the identification and characterization of genes which encode pesticidal toxins. In one embodiment, the subject invention concerns unique nucleotide sequences which are usefiil as hybridization probes and/or primers in PCR techniques. The primers produce characteristic gene Segments which can be used in the identification, characterization, and/or isolation of specific toxin genes. The nucleotide sequences of the subject invention encode toxins which are distinct from previously-described toxins. In a specific embodiment, the subject invention provides new classes of toxins having advantageous pesticidal activities. These classes of toxins can be encoded by polynucleotide sequences which are characterized by their ability to hybridize with certain exemplified sequences and/or by their ability to be amplified by PCR using certain exemplified primers. One aspect of the subject invention pertains to the identification and characterization of entirely new families of Bacillus toxins having advantageous pesticidal properties. The subject invention includes new classes of genes and toxins referred to herein as MIS-7 and MIS-8. Genes and toxins of novel WAR- and SUP-classes are also disclosed. Certain MIS-1 and MIS-2 toxins and genes are also further characterized herein. These families of toxins, and the genes which encode them, can be characterized in terms of, for example, the size of the toxin or gene, the DNA or amino acid sequence, pesticidal activity, and/or antibody reactivity. With regard to the genes encoding the novel toxin families of the subject invention, the current disclosure provides unique hybridization probes and PCR primers which can be used to identify and characterize DNA within each of the exemplified families. In one embodiment of the subject invention. Bacillus isolates can be cultivated under conditions resulting in high multiplication of the microbe. After treating the microbe to provide single-stranded genomic nucleic acid, the DNA can be contacted with the primers of the invention and subjected to PCR amplification. Characteristic fragments of toxin-encoding genes will be amplified by the procedure, thus identifying the presence of the toxin-encoding gene(s). A further aspect of the subject invention is the use of the disclosed nucleotide sequences as probes to detect genes encoding Bacillus toxins which are active against pests. Further aspects of the subject invention include the genes and isolates identified using the methods and nucleotide sequences disclosed herein. The genes thus identified encode toxins active against pests. Similarly, the isolates will have activity against these pests. In a preferred embodiment, these pests are lepidopteran or coleopteran pests. In a preferred embodiment, the subject invention concerns plants cells transformed with at least one polynucleotide sequence of the subject invention such that the transformed plant cells express pesticidal toxins in tissues consumed by target pests. As described herein, the toxins useful according to the subject invention may be chimeric toxins produced by combining portions of multiple toxins. In addition, mixtures and/or combinations of toxins can be used according to the subject invention. Transformation of plants with the genetic constructs disclosed herein can be accomplished using techniques well known to those skilled in the art and would typically involve modification of the gene to optimize expression of the toxin in plants. Alternatively, the Bacillus isolates of the subject invention, or recombinant microbes expressing the toxins described herein, can be used to control pests. In this regard, the invention includes the treatment of substantially intact Bacillus cells, and/or recombinant cells containing the expressed toxins of the invention, treated to prolong the pesticidal activity when the substantially intact cells are applied to the environment of a target pest. The treated cell acts as a protective coating for the pesticidal toxin. The toxin becomes active upon ingestion by a target insect Brief Description of the Sequences SEQ ID NO, 1 is a nucleotide sequence encoding a toxin from B,t strain Javelin 1990. SEQ ID NO. 2 is an amino acid sequence for the Javelin 1990 toxin. SEQ ID NO. 3 is a forward primer used according to the subject invention. SEQ ID NO. 4 is a reverse primer used according to the subject invention. SEQ ID NO. 5 is a nucleotide sequence of a toxin gene from B.t. strain PS66D3 SEQ ID NO. 6 is an amino acid sequence from the 66D3 toxin. SEQ ID NO. 7 is a nucleotide sequence of a MIS toxin gene from B,t. strain PS177C8. SEQ ID NO. 8 is an amino acid sequence from the 177C8-MIS toxin. SEQ ID NO. 9 is a nucleotide sequence of a toxin gene from B.t. strain PS 17718 SEQ ID NO. 10 is an amino acid sequence from the 17718 toxin. SEQ ID NO-11 is a nucleotide sequence encoding a 177C8-WAR toxin gene from^.r. strain PS 177C8. SEQ ID NO. 12 is an amino acid sequence of a 177C8-WAR toxin from BA. strain PS 177C8. SEQ ID NOS. 13-21 are primers used according to the subject invention. SEQ ID NO. 22 is the reverse complement of the primer of SEQ ID NO. 14. SEQ ID NO. 23 is the reverse complement of the primer of SEQ ID NO. 15. SEQ ID NO. 24 is the reverse complement of the primer of SEQ ID NO. 17. SEQ ID NO. 25 is the reverse complement of the primer of SEQ ID NO. 18. SEQ ID NO. 26 is the reverse complement of the primer of SEQ ID NO. 19. SEQ ID NO. 27 is the reverse complement of the primer of SEQ ED NO. 20. SEQ ID NO, 28 is the reverse complement of the primer of SEQ ID NO. 21. SEQ ID NO. 29 is a MIS-7 forward primer. SEQ ID NO. 30 is a MIS-7 reverse primer. SEQ ID NO. 31 is a MIS-8 forward primer. SEQ ID NO. 32 is a MIS-8 reverse primer. SEQ ID NO. 33 is a nucleotide sequence of a MIS-7 toxin gene designated 157Cl-A from B,t. strain PS157Cl. SEQ ID NO. 34 is an amino acid sequence of a MIS-7 toxin designated 157C1-A from B,t . strainPS157Cl. SEQ ID NO. 35 is a nucleotide sequence of a MIS-7 toxin gene from BJ. strain PS201Z. SEQ ID NO. 36 is a nucleotide sequence of a MIS-8 toxin gene from BJ. strain PS31F2. SEQ ID NO. 37 is a nucleotide sequence of a MIS-8 toxin gene from BJ. strain PS185Y2. SEQ ID NO. 38 is a nucleotide sequence of a MIS-1 toxin gene from B,t. strain PS33F1. SEQ ID NO. 39 is a MIS primer for use according to the subject invention. SEQ ID NO. 40 is a MIS primer for use according to the subject invention. SEQ ID NO. 41 is a WAR primer for use according to the subject invention. SEQ ID NO. 42 is a WAR primer for use according to the subject invention. SEQ ID NO. 43 is a partial nucleotide sequence for a MIS-7 gene from PS205C, SEQ ID NO. 44 is a partial amino acid sequence for a MIS-7 toxin from PS205C. SEQ ID NO. 45 is a partial nucleotide sequence for a WAR gene from PS205C. SEQ ID NO. 46 is a partial amino acid sequence for a WAR toxin from PS205C. SEQ ID NO. 47 is a nucleotide sequence for a MIS-8 gene from PS31F2. • SEQ ID NO. 48 is an amino acid sequence for a MIS-8 toxin from PS31F2. SEQ ID NO. 49 is a nucleotide sequence for a WAR gene from PS31F2. SEQ ID NO. 50 is an amino acid sequence for a WAR toxin from PS31F2. SEQ ID NO. 51 is a SUP primer for use according to the subject invention. SEQ ID NO. 52 is a SUP primer for use according to the subject invention. SEQ ID NO. 53 is a nucleotide sequence for a SUP gene from KB59A4-6. SEQ ID NO. 54 is an amino acid sequence for a SUP toxin from KB59A4-6. Detailed Disclosure of the Invention The subject invention concerns materials and methods for the control of non-mammalian pests. In specific embodiments, the subject invention pertains to new Bacillus thuringiensis isolates and toxins which have activity against lepidopterans and/or coleopterans. The subject invention further concerns novel genes which encode pesticidal toxins and novel methods for identifying and characterizing Bacillus genes which encode toxins with useful properties. The subject invention concerns not only the polynucleotide sequences which encode these toxins, but also the use of these polynucleotide sequences to produce recombinant hosts which express the toxins. The proteins of the subject invention are distinct from protein toxins which have previously been isolated from Bacillus thuringiensis, B.L isolates useful according to the subject invention have been deposited in the permanent collection of the Agricultural Research Service Patent Culture Collection (NRRL), Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, USA. The culture repository numbers of the B.t. strains are as follows: Cultures which have been deposited for the purposes of this patent application were deposited under conditions that assure that access to the cultures is available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 U.S.C. 122. The deposits will be available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action. Further, the subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e, they will be stored with all the care necessary to keep them viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposit, and in any case, for a period of at least thirty (30) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the culture(s). The depositor acknowledges the duty to replace the deposit(s) should the depository be unable to furnish a sample when requested, due to the condition of a deposit. All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them. Many of the strains useful according to the subject invention are readily available by virtue of the issuance of patents disclosing these strains or by their deposit in public collections or by their inclusion in commercial products. For example, the Bj. strain used in the commercial product, Javelin, and the HD isolates are all publicly available. Mutants of the isolates referred to herein can be made by procedures well known in the art. For example, an asporogenous mutant can be obtained through ethylmethane sulfonate (EMS) mutagenesis of an isolate. The mutants can be made using ultraviolet light and nitrosoguanidine by procedures well known in the art. In one embodiment, the subject invention concerns materials and methods including nucleotide primers and probes for isolating, characterizing, and identifying Bacillus genes encoding protein toxins which are active against non-mammalian pests. The nucleotide sequences described herein can also be used to identify new pesticidal Bacillus isolates. The invention further concerns the genes, isolates, and toxins identified using the methods and materials disclosed herein. The new toxins and polynucleotide. sequences provided here are defined according to several parameters. One characteristic of the toxins described herein is pesticidal activity. In a specific embodiment, these toxins have activity against coleopteran and/or lepidopteran pests. The toxins and genes of the subject invention can be further defined by their amino acid and nucleotide sequences. The sequences of the molecules can be defined in terms of homology to certain exemplified sequences as well as in terms of the ability to hybridize with, or be amplified by, certain exemplified probes and primers. The toxins provided herein can also be identified based on their immunoreactivity with certain antibodies. An important aspect of the subject invention is the identification and ■ characterization of new families of Bacillus toxins, and genes which encode these toxins. These families have been designated MIS-7 and MlS-8. New WAR- and SUP-type toxin families are also disclosed herein. Toxins within these families, as well as genes encoding toxins within these families, can readily be identified as described herein by, for example, size, amino acid or DNA sequence, and antibody reactivity. Amino acid and DNA sequence characteristics include homology with exemplified sequences, ability to hybridize with DNA probes, and ability to be,amplified with specific primers. A gene and toxin (which are obtainable from PS33F1) of the MIS-1 family and a gene and toxin (which are-obtainable from PS66D3) of the MIS-2 family are also further characterized herein. A novel family of toxins identified herein is the MIS-7 family. This family includes toxins which can be obtained from B.L isolates PS 157C1, PS205C, and PS201Z. The subject invention further provides probes and primers for identification of the MIS-7 genes and toxins. A further, novel family of toxins identified herein is the MIS-8 family. This family includes toxins which can be obtained from B,t, isolates PS31F2 and PS185Y2. The subject invention further provides probes and primers for identification of the MIS-8 genes and toxins. In a preferred embodiment, the genes of the MIS family encode toxins having a molecular weight of about 70 to about 100 kDa and, most preferably, the toxins have a size of about 80 kDa. Typically, these toxins are soluble and can be obtained from the supernatant of Bacillus cultures as described herein. These toxins have toxicity against non-mammalian pests. In a preferred embodiment, these toxins have activity against coleopteran pests. The MIS proteins are further useful due to their ability to form pores in cells. These proteins can be used with second entities including, for example, other proteins. When used with a second entity, the MIS protein will facilitate entry of the second agent into a target cell. In a preferred embodiment, the MIS protein interacts with MIS receptors in a target cell and causes pore formation in the target cell. The second entity may be a toxin or another molecule whose entry into the cell is desired. The subject invention further concerns a family of toxins designated WAR-type toxins. The WAR toxins typically have a size of about 30-50 kDa and, most typically, have a size of about 40 kDa. Typically, these toxins are soluble and can be obtained from the supernatant of Bacillus cultures as described herein. The WAR toxins can be identified with primers described herein as well as with antibodies. An additional family of toxins provided according to the subject invention are the toxins designated SUP-type toxins. Typically, these toxins are soluble and can be obtained from the supernatant of Bacillus cultures as described herein. In a preferred embodiment, the SUP toxins are active against lepidopteran pests. The SUP toxins typically have a size of about 70-100 kDa and, preferably, about 80 kDa. The SUP family is exemplified herein by toxins from isolate KB59A4-6. The subject invention provides probes and primers useful for the identification of toxins and genes in the SUP family. The subject invention also provides additional Bacillus toxins and genes, including additional MIS, WAR, and SUP toxins and genes. Toxins in the MIS, WAR, and SUP families are all soluble and can be obtained as described herein from the supematant of Bacillus cultures. These toxins can be used alone or in combination with other toxins to control pests. For example, toxins from the MIS families may be used in conjunction with WAR-type toxins to achieve control of pests, particularly coleopteran pests. These toxins may be used, for example, with 6-endotoxins which are obtained from Bacillus isolates. Table 2 provides a summary of the novel families of toxins and genes of the subject invention. Certain MIS families are specifically exemplified herein by toxins which can be obtained from particular B.t isolates as shown in Table 2. Genes encoding toxins in each of these families can be identified by a variety of highly specific parameters, including the ability to hybridize with the particular probes set forth in Table 2. Sequence identity in excess of about 80% with the probes set forth in Table 2 can also be used to identify the genes of the various families. Also exemplified are particular primer pairs which can be used to amplify the genes of the subject invention. A portion of a gene within the indicated families would typically be amplifiable with at least one of the enumerated primer pairs. In a preferred embodiment, the amplified portion would be of approximately the indicated fragment size. Primers shown in Table 2 consist of polynucleotide sequences which encode peptides as shown in the sequence listing attached hereto. Additional primers and probes can readily be constructed by those skilled in the art such that alternate polynucleotide sequences encoding the same amino acid sequences can be used to identify and/or characterize additional genes encoding pesticidal toxins. In a preferred embodiment, these additional toxins, and their genes, could be obtained from Bacillus isolates. Furthermore, chimeric toxins may be used according to the subject invention. Methods have been developed for making useful chimeric toxins by combining portions of B.t. proteins. The portions which are combined need not, themselves, be pesticidal so long as the combination of portions creates a chimeric protein which is pesticidal. This can be done using restriction enzymes, as described in, for example, European Patent 0 228 838; Ge, A.Z., N.L. Shivarova, D.H. Dean (1989) Proc. Natl. Acad. Sci. USA 86:4037-4041; Ge, A.Z., D. Rivers, R. Milne, D.H. Dean (1991) J. Biol. Chem. 266:17954-17958; Schnepf, H.E., K. Tomczak, J.P. Ortega, H.R. Whiteley (1990) J. Biol. Chem. 265:20923-20930; Honee, G., D. Convents, J. Van Rie, S. Jansens, M. Peferoen, B. Visser (1991) Mol. Microbiol. 5:2799-2806. Alternatively, recombination using cellular recombination mechanisms can be used to achieve similar results. See, for example. Caramon, T., A.M. Albertini, A. Galizzi (1991) Gene 98:37-44; Widner, W.R., H.R. Whiteley (1990) J. Bacteriol. 172:2826-2832; Bosch, D., B. Schipper, H. van der Kliej, R.A. de Maagd, W.J. Stickema (1994) Biotechnology 12:915-918. A number of other methods are known in the art by which such chimeric DNAs can be made. The subject invention is meant to include chimeric proteins that utilize the novel sequences identified in the subject application. With the teachings provided herein, one skilled in the art could readily produce and use the various toxins and polynucleotide sequences described herein. Genes and toxins. The genes and toxins useful according to the subject invention include not only the full length sequences but also fragments of these sequences, variants, mutants, and fusion proteins which retain the characteristic pesticidal activity of the toxins specifically exemplified herein. Chimeric genes and toxins, produced by combining portions from more than one Bacillus toxin or gene, may also be utilized according to the teachings of the subject invention. As used herein, the terms "variants" or '"variations" of genes refer to nucleotide sequences which encode the same toxins or which encode equivalent toxins having pesticidal activity. As used herein, the term "equivalent toxins' refers to toxins having the same or essentially the same biological activity against the target pests as the exemplified toxins. For example, U.S. Patent No. 5,605,793 describes methods for generating additional molecular diversity by using DNA reassembly after random fragmentation. It is apparent to a person skilled in this art that genes encoding active toxins can be identified and obtained through several means. The specific genes exemplified herein may be obtained from the isolates deposited at a culture depository as described above. These genes, or portions or variants thereof, may also be constructed synthetically, for example, by use of a gene synthesizer. Variations of genes may be readily constructed using standard techniques for making point mutations. Also, fragments of these genes can be made using commercially available exonucleases or endonucleases according to standard procedures. For example, enzymes such as Bal3l or site-directed mutagenesis can be used to systematically cut off nucleotides from the ends of these genes. Also, genes which encode active fragments may be obtained using a variety of restriction enzymes. Proteases may be used to directly obtain active fragments of these toxins. Equivalent toxins and/or genes encoding these equivalent toxins can be derived from Bacillus isolates and/or DNA libraries using the teachings provided herein. There are a number of methods for obtaining the pesticidal toxins of the instant invention. For example, antibodies to the pesticidal toxins disclosed and claimed herein can be used to identify and isolate toxins from a mixture of proteins. Specifically, antibodies may be raised to the portions of the toxins which are most constant and most distinct from other Bacillus toxins. These antibodies can then be used to specifically identify equivalent toxins with the characteristic activity by immunoprecipitation, enzyme linked immunosorbent assay (ELISA), or Western blotting. Antibodies to the toxins disclosed herein, or to equivalent toxins, or fragments of these toxins, can readily be prepared using standard procedures in this art. The genes which encode these toxins can then be obtained from the microorganism. Fragments and equivalents which retain the pesticidal activity of the exemplified toxins are within the scope of the subject invention. Also, because of the redundancy of the genetic code, a variety of different DNA sequences can encode the amino acid sequences disclosed herein. It is well within the skill of a person trained in the art to create these alternative DNA sequences encoding the same, or essentially the same, toxins. These variant DNA sequences are within the scope of the subject invention. As used herein, reference to "essentially the same" sequence refers to sequences which have amino acid substitutions, deletions, additions, or insertions which do not materially affect pesticidal activity. Fragments retaining pesticidal activity are also included in this definition. A further method for identifying the toxins and genes of the subject invention is through the use of oligonucleotide probes. These probes are detectable nucleotide sequences. Probes provide a rapid method for identifying toxin-encoding genes of the subject invention. The nucleotide segments which are used as probes according to the invention can be synthesized using a DNA synthesizer and standard procedures. Certain toxins of the subject invention have been specifically exemplified herein. Since these toxins are merely exemplary of the toxins of the subject invention, it should be readily apparent that the subject invention comprises variant or equivalent toxins (and nucleotide sequences coding for equivalent toxins) having the same or similar pesticidal activity of the exemplified toxin. Equivalent toxins will have amino acid homology with an exemplified toxin. This amino acid identity will typically be greater than 60%, preferably be greater than 75%, more preferably greater than 80%, more preferably greater than 90%, and can be greater than 95%. These identities are as determined using standard alignment techniques. The amino acid homology will be highest in critical regions of the toxin which account for biological activity or are involved in the determination of three-dimensional configuration which ultimately is responsible for the biological activity. In this regard, certain amino acid substitutions are acceptable and can be expected if these substitutions are in regions which are not critical to activity or are conservative amino acid substitutions which do not affect the three-dimensional configuration of the molecule. For example, amino acids may be placed in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby an amino acid of one class is replaced with another amino acid of the same type fall within the scope of the subject invention so long as the substitution does not materially alter the biological activity of the compound. Table 3 provides a listing of examples of amino acids belonging to each class. In some instances, non-conservative substitutions can also be made. The critical factor is that these substitutions must not significantly detract from the biological activity of the toxin. The 6-endotoxins of the subject invention can also be characterized in terms of the shape and location of toxin inclusions, which are described above. As used herein, reference to "isolated" polynucleotides and/or "purified" toxins refers to these molecules when they are not associated with the other molecules with which they would be found in nature. Thus, reference to "isolated and purified" signifies the involvement of the "hand of man" as described herein. Chimeric toxins and genes also involve the "hand of man." Recombinant hosts. The toxin-encoding genes of the subject invention can be introduced into a wide variety of microbial or plant hosts. Expression of the toxin gene results, directly or indirectly, in the production and maintenance of the pesticide. With suitable microbial hosts, e.g., Pseudomonas, the microbes can be applied to the situs of the pest, where they will proliferate and be ingested. The result is a control of the pest. Alternatively, the microbe hosting the toxin gene can be killed and treated under conditions that prolong the activity of the toxin and stabilize the cell. The treated cell, which retains the toxic activity, then can be applied to the environment of the target pest. Where the Bacillus toxin gene is introduced via a suitable vector into a microbial host, and said host is applied to the environment in a living state, it is essential that certain host microbes be used. Microorganism hosts are selected which are known to occupy the "phytosphere" (phylloplane, phyllosphere, rhizosphere, and/or rhizoplane) of one or more crops of interest. These microorganisms are selected so as to be capable of successfully competing in the particular environment (crop and other insect habitats) with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing the polypeptide pesticide, and, desirably, provide for improved protection of the pesticide from environmental degradation and inactivation. A large number of microorganisms are known to inhabit the phylloplane (the surface of the plant leaves) and/or the rhizosphere (the soil surrounding plant roots) of a wide variety of important crops. These microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms, such as bacteria, e,g., genera Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylophilius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes; fungi, particularly yeast, e.g., genera, Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotonila, and Aureobasidium, Of particular interest are such phytosphere bacterial species as Pseudomonas syringaae Pseudomonas fluorescens, Serratia marcescens, Acetobacter xylinum, Agrobacterium tumefaciens, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus. and Azotobacter vinlandu and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, C. diffluens, C, laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, Sporobolomyces roseus, S. odorus, Kluyveromyces veronae, and Aureobasidium pollulans. Of particular interest are the pigmented microorganisms. A wide variety of ways are available for introducing a Bacillus gene encoding a toxin into a microorganism host under conditions which allow for stable maintenance and expression of the gene. These methods are well known to those skilled in the art and are described, for example, in United States Patent No. 5,135,867, which is incorporated herein by reference. Synthetic genes which are functionally equivalent to the toxins of the subject invention can also be used to transform hosts. Methods for the production of synthetic genes can be found in, for example, U.S. Patent No. 5,380,831. Treatment of cells. As mentioned above. Bacillus or recombinant cells expressing a Bacillus toxin can be treated to prolong the toxin activity and stabilize the cell. The pesticide microcapsule that is formed comprises the Bacillus toxin within a cellular structure that has been stabilized and will protect the toxin when the microcapsule is applied to the environment of the target pest. Suitable host cells may include either prokaryotes or eukaryotes. As hosts, of particular interest will be the prokaryotes and the lower eukaryotes, such as fungi. The cell will usually be intact and be substantially in the proliferative form when treated, rather than in a spore form. Treatment of the microbial cell, eg., a microbe containing the Bacillus toxin gene, can be by chemical or physical means, or by a combination of chemical and/or physical means, so long as the technique does not deleteriously affect the properties of the toxin, nor diminish the cellular capability of protecting the toxin. Methods for treatment of microbial cells are disclosed in United States Patent Nos. 4,695,455 and 4,695,462, which are incorporated herein by reference. Methods and formulations for control of pests. Control of pests using the isolates, toxins, and genes of the subject invention can be accomplished by a variety of methods known to those skilled in the art. These methods include, for example, the application of Bacillus isolates to the pests (or their location), the application of recombinant microbes to the pests (or their locations), and the transformation of plants with genes which encode the pesticidal toxins of the subject invention. Transformations can be made by those skilled in the art using standard techniques. Materials necessary for these transformations are disclosed herein or are otherwise readily available to the skilled artisan. Formulated bait granules containing an attractant and the toxins of the Bacillus isolates, or recombinant microbes comprising the genes obtainable from the Bacillus isolates disclosed herein, can be applied to the soil. Formulated product can also be applied as a seed-coating or root treatment or total plant treatment at later stages of the crop cycle. Plant and soil treatments of Bacillus cells may be employed as wettable powders, granules or dusts, by mixing with various inert materials, such as inorganic minerals (phyllosilicates, carbonates, sulfates, phosphates, and the like) or botanical materials (powdered corncobs, rice hulls, walnut shells, and the like). The fonnulations may include spreader-sticker adjuvants, stabilizing agents, other pesticidal additives, or surfactants. Liquid formulations may be aqueous-based or non-aqueous and employed • as foams, gels, suspensions, emulsifiable concentrates, or the like. The ingredients may include rheological agents, surfactants, emulsifiers, dispersants, or polymers. As would be appreciated by a person skilled in the art, the pesticidal concentration will vary widely depending upon the nature of the particular formulation, particularly whether it is a concentrate or to be used directly. The pesticide will be present in at least 1% by weight and may be 100% by weight. The dry formulations will have from about 1-95% by weight of the pesticide while the liquid formulations will generally be from about 1-60% by weight of the solids in the liquid phase. The formulations that contain cells will generally have from about 102 to about 104 cells/mg. These formulations will be administered at about 50 mg (liquid or dry) to 1 kg or more per hectare. The formulations can be applied to the environment of the pest, eg-., soil and foliage, by spraying, dusting, sprinkling, or the like. Polynucleotide probes. It is well known that DNA possesses a fundamental property called base complementarity. In nature, DNA ordinarily exists in the fonn of pairs of anti-parallel strands, the bases on each strand projecting from that strand toward the opposite strand. The base adenine (A) on one strand will always be opposed to the base thymine (T) on the other strand, and the base guanine (G) will be opposed to the base cytosine (C). The bases are held in apposition by their ability to hydrogen bond in this specific way. Though each individual bond" is relatively weak, the net effect of many adjacent hydrogen bonded bases, together with base stacking effects, is a stable joining of the two complementary strands. These bonds can be broken by treatments such as high pH or high temperature, and these conditions result in the dissociation, or "denaturation," of the two strands. If the DNA is then placed in conditions which make hydrogen bonding of the bases thermodynamically favorable, the DNA strands will anneal, or "hybridize," and reform the original double stranded DNA, If carried out under appropriate conditions, this hybridization can be highly specific. That is, only strands with a high degree of base complementarity will be able to form stable double stranded structures. The relationship of the specificity of hybridization to reaction conditions is well known. Thus, hybridization may be used to test whether two pieces of DNA are complementary in their base sequences. It is this hybridization mechanism which facilitates the use of probes of the subject invention to readily detect and characterize DNA sequences of interest. The probes may be RNA, DNA, or PNA (peptide nucleic acid). The probe will normally have at least about 10 bases, more usually at least about 17 bases, and may have up to about 100 bases or more. Longer probes can readily be utilized, and such probes can be, for example, several kilobases in length. The probe sequence is designed to be at least substantially complementary to a portion of a gene encoding a toxin of interest. The probe need not have perfect complementarity to the sequence to which it hybridizes. The probes may be labelled utilizing techniques which are well known to those skilled in this art. One approach for the use of the subject invention as probes entails first identifying by Southern blot analysis of a gene bank of the Bacillus isolate all DNA segments homologous with the disclosed nucleotide sequences. Thus, it is possible, without the aid of biological analysis, to know in advance the probable activity of many new Bacillus isolates, and of the individual gene products expressed by a given Bacillus isolate. Such a probe analysis provides a rapid method for identifying potentially commercially valuable insecticidal toxin genes within the multifarious subspecies of B.t. One hybridization procedure useful according to the subject invention typically « includes the initial steps of isolating the DNA sample of interest and purifying it chemically. Either lysed bacteria or total fractionated nucleic acid isolated from bacteria can be used. Cells can be treated using known techniques to liberate their DNA (and/or RNA). The DNA sample can be cut into pieces with an appropriate restriction enzyme. The pieces can be separated by size through electrophoresis in a gel, usually agarose or acrylamide. The pieces of interest can be transferred to an immobilizing membrane. The particular hybridization technique is not essential to the subject invention. ■ As improvements are made in hybridization techniques, they can be readily applied. The probe and sample can then be combined in a hybridization buffer solution and held at an appropriate temperature until annealing occurs. Thereafter, the membrane is washed free of extraneous materials, leaving the sample and bound probe molecules typically detected and quantified by autoradiography and/or liquid scintillation counting. As is well known in the art, if the probe molecule and nucleic acid sample hybridize by forming a strong non-covalent bond between the two molecules, it can be reasonably assumed that the probe and sample are essentially identical. The probe's detectable label provides a means for determining in a known manner whether hybridization has occurred. In the use of the nucleotide segments as probes, the particular probe is labeled with any suitable label known to those skilled in the art, including radioactive and nonradioactive labels. Typical radioactive labels include 32P, 25S, or the like. Nonradioactive labels include, for example, ligands such as biotin or thyroxine, as well as enzymes such as hydrolases or perixodases, or the various chemiluminescers such as luciferin, or fluorescent compounds like fluorescein and its derivatives. The probes may be made inherently fluorescent as described in International Application No. WO 93/16094. Various degrees of stringency of hybridization can be employed. The more severe the conditions, the greater the complementarity that is required for duplex formation. Severity can be controlled by temperature, probe concentration, probe length, ionic strength, time, and the like. Preferably, hybridization is conducted under moderate to high stringency conditions by techniques well known in the art, as described, for example, in Keller, G.H., M.M. Manak (1987) DMA Probes, Stockton Press, New York, NY., pp. 169-170. As used herein "moderate to high stringency" conditions for hybridization refers to conditions which achieve the same, or about the same, degree of specificity of hybridization as the conditions employed by the current applicants. Examples of moderate and high stringency conditions are provided herein. Specifically, hybridization of immobilized DNA on Southern blots with 32P-labeIed gene-specific probes was performed by standard methods (Maniatis et al.). In general, hybridization and subsequent washes were carried out under moderate to high stringency conditions that allowed for detection of target sequences with homology to the exemplified toxin genes. For double-stranded DNA gene probes, hybridization was carried out overnight at 20-25 ° C below the melting temperature (Tm) of the DNA hybrid in 6X SSPE, 5X Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula (Beltz, G.A., KA. Jacobs, T.H. Eickbush, P.T. Cherbas, and F.C. Kafatos [1983] Methods of Enzymology, R. Wu, L. Grossman and K. Moldave [eds.] Academic Press, New York 100:266-285), Tm=81.5°C-hl6.6 Log[Na+]+0.41(%G+C)-0,61(%fonnamide).600/length of duplex in base pairs. Washes are typically carried out as follows: (1) Twice at room temperature for 15 minutes in IX SSPE, 0.1% SDS (low stringency wash). (2) Once at Tm-20°C for 15 minutes in 0.2X SSPE, 0.1% SDS (moderate stringency wash). For oligonucleotide probes, hybridization was carried out overnight at 10-20°C below the melting temperature (Tm) of the hybrid in 6X SSPE, 5X Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. Tm for oligonucleotide probes was determined by the following formula: Tm (°C)=2(number T/A base pairs) +4(number G/C base pairs) (Suggs, S.V., T. Miyake, E.H. Kawashime, MJ. Johnson, K. Itakura, and R.B. Wallace [1981] ICN- UCLA Symp. Dev. Biol Using Purified Genes, D.D, Brown [ed.]. Academic Press, New York, 23:683-693). Washes were typically carried out as follows: (1) Twice at room temperature for 15 minutes IX SSPE, 0.1% SDS (low stringency wash). (2) Once at the hybridization temperature for 15 minutes in IX SSPE, 0.1% SDS (moderate stringency wash). In general, salt and/or temperature can be altered to change stringency. With a labeled DNA fragment >70 or so bases in length, the following conditions can be used: Low: 1 or 2X SSPE, room temperature Low: l or 2X SSPE,42°C Moderate: 0.2X or IX SSPE, 65 °C High: 0.1X SSPE,65°C. Duplex fomiation and stability depend on substantial complementarity between the two strands of a hybrid, and, as noted above, a certain degree of mismatch can be tolerated. Therefore, the probe sequences of the subject invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions permit formation of stable hybrids with the target polynucleotide of interest. Mutations, insertions, and deletions can be produced in a given polynucleotide sequence in many ways, and these methods are known to an ordinarily skilled artisan. Other methods may become known in the future. Thus, mutational, insertional, and deletional variants of the disclosed nucleotide sequences can be readily prepared by methods which are well known to those skilled in the art. These variants can be used in the same manner as the exemplified primer sequences so long as the variants have substantial sequence homology with the original sequence. As used herein, substantial sequence homology refers to homology which is sufficient to enable the variant probe to function in the same capacity as the original probe. Preferably, this homology is greater than 50%; more preferably, this homology is greater than 75%; and most preferably, this homology is greater than 90%. The degree of homology needed for the variant to function in its intended capacity will depend upon the intended use of the sequence. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations which are designed to improve the function of the sequence or otherwise provide a methodological advantage. PCR technology. Polymerase Chain Reaction (PCR) is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see Mullis, U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki, Randall K., Stephen Scharf, Fred Faloona, Kary B. Mullis, Glenn T. Horn, Henry A. Erlich, Norman Amheim [1985] "Enzymatic Amplification of P-Globin Genomic Sequences and Restriction Site Analysis for Diagnosis of Sickle Cell Anemia," Science 230:1350-1354.). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence. The primers are oriented with the 3' ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA fragment produced in the previous cycle. This results in the exponential accumulation of the specific target fragment, up to several million-fold in a few hours. By using a thermostable DNA polymerase such as Tag polymerase, which is isolated trom the thermopmnc oactenum inermus aguaticus, the amplification process can be completely automated. Other enzymes which can be used are known to those skilled in the art. The DNA sequences of the subject invention can be used as primers for PCR amplification. In performing PCR amplification, a certain degree of mismatch can be tolerated between primer and template. Therefore, mutations, deletions, and insertions (especially additions of nucleotides to the 5' end) of the exemplified primers fall within the scope of the subject invention. Mutations, insertions and deletions can be produced in a given primer by methods known to an ordinarily skilled artisan. All of the references cited herein are hereby incorporated by reference. Following are examples which illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. Example 1 - Culturing of Bacillus Isolates Useful According to the Invention The cellular host containing the Bacillus insecticidal gene may be grown in any convenient nutrient medium. These cells may then be harvested in accordance with conventional ways. Alternatively, the cells can be treated prior to harvesting. The Bacillus cells of the invention can be cultured using standard art media and fermentation techniques. During the fermentation cycle, the bacteria can be harvested by first separating the Bacillus vegetative cells, spores, crystals, and lysed cellular debris from the fermentation broth by means well known in the art. Any Bacillus spores or crystal 6-endotoxins formed can be recovered employing well-known techniques and used as a conventional 6-endotoxin B.t. preparation. The supernatant from the fermentation process contains toxins of the present invention. The toxins are isolated and purified employing well-known techniques. A subculture of Bacillus isolates, or mutants thereof, can be used to inoculate the following medium, known as TB broth: Tryptone 12 g/1 Yeast Extract 24 g/1 Glycerol 4 g/1 KH2PO4 2.1 g/1 K2HPO4 14.7 g/1 pH 7.4 The potassium phosphate was added to the autoclaved broth after cooling. Flasks were incubated at 30°C on a rotary shaker at 250 rpm for 24-36 hours. The above procedure can be readily scaled up to large fermentors by procedures well known in the art. The Bacillus obtained in the above fermentation, can be isolated by procedures well known in the art. A frequently-used procedure is to subject the harvested fermentation broth to separation techniques, e.g., centrifugation. In a specific embodiment. Bacillus proteins useful according the present invention can be obtained from the supernatant. The culture supernatant containing the active protein(s) can be used in bioassays. Alternatively, a subculture of Bacillus isolates, or mutants thereof, can be used to inoculate the following peptone, glucose, salts medium: Bacto Peptone 7.5 g/1 Glucose 1.0 g/1 KH2PO4 3.4 g/1 K2HPO4 4.35 g/1 Salt Solution 5.0ml/1 CaCU Solution 5.6 ml/1 pH 7.2 Salts Solution (100 ml) MgSO4-7H2O 2.46 g MnSO4-H2O 0.04 g ZnSO4-7H2O 0.28 g FeSO4-7H2O 0.40 g CaCl2 Solution (100 ml) CaCl2-2H2O 3.66 g The sans solution and CaCl2 solution are filter-sterilied and added to the autoclaved and cooked broth at the time of inoculation. Flasks are incubated at 30°C on a rotary shaker at 200 rpm for 64 hr. The above procedure can be readily scaled up to large fermentors by procedures well known in the art. The Bacillus spores and/or crystals, obtained in the above fermentation, can be isolated by procedures well known in the art. A frequently-used procedure is to subject the harvested fermentation broth to separation techniques, e.g., centrifugation. Example 2 - Isolation and Preparation of Cellular DNA for PCR DNA can be prepared from cells grown on Spizizen's agar, or other minimal or enriched agar known to those skilled in the art, for approximately 16 hours. Spizizen's casamino acid agar comprises 23.2 g/1 Spizizen's minimal salts [(NH4)2SO4, 120 g; K2HPO4, 840 g; KH2PO4,360 g; sodium citrate, 60 g; MgSO(4-7H2 O, 12 g. Total: 1392 g]; 1.0 g/1 vitamin-free casamino acids; 15.0 g/1 Difco agar. In preparing the agar, the mixture was autoclaved for 30 minutes, then a sterile, 50% glucose solution can be added to a final concentration of 0.5% (1/100 vol). Once the cells are grown for about 16 hours, an approximately 1 cm2 patch of cells can be scraped from the agar into 300 µ1 of 10 mM Tris-HCI (pH 8.0)-l mM EDTA. Proteinase K was added to 50 µg/ml and incubated at 55 °C for 15 minutes. Other suitable proteases lacking nuclease activity can be used. The samples were then placed in a boiling water bath for 15 minutes to inactivate the proteinase and denature the DNA. This also precipitates unwanted components. The samples are then centrifuged at 14,000 x g in an Eppendorf microfuge at room temperature for 5 minutes to remove cellular debris. The supematants containing crude DNA were transferred to fresh tubes and frozen at -20oC until used in PCR reactions. Alternatively, total cellular DNA may be prepared from plate-grown cells using the QIAamp Tissue Kit from Qiagen (Santa Clarita, CA) following instructions from the manufacturer. Example 3 -- Primers Useful for Characterizing and/or Identifying Toxin Genes The following set of PCR primers can be used to identify and/or characterize genes of the subject invention, which encode pesticidal toxins: GGRTTAMTTGGRTAYTATTT (SEQ ID NO. 3) ATATCKWAYATTKGCATTTA (SEQ ID NO. 4) Redundant nucleotide codes used throughout the subject disclosure are in accordance with the lUPAC convention and include: R = A or G M = A or C Y = C or T K = G or T W = A or T Example 4 - Identification and Sequencing of Genes Encoding Novel Soluble Protein Toxins from Bacillus Strains PCR using primers SEQ ID NO. 3 and SEQ ID NO. 4 was performed on total cellular genomic DNA isolated from a broad range of B.t. strains. Those samples yielding an approximately 1 kb band were selected for characterization by DNA sequencing. Amplified DNA firagments were first cloned into the PCR DNA TA-cloning plasmid vector, pCR2.1, as described by the supplier (Invitrogen, San Diego, CA). Plasmids were isolated fi-om recombinant clones and tested for the presence of an approximately I kbp insert by PCR using the plasmid vector primers, T3 and T7. The following strains yielded the expected band of approximately 1000 bp, thus indicating the presence of a MIS-type toxin gene: PS66D3, PS177C8, PSl 7718, PS33F1, PS157C1 (157C1-A), PS201Z, PS31F2, and PS185Y2. Plasmids were then isolated for use as sequencing templates using QIAGEN (Santa Clarita, CA) miniprep kits as described by the supplier. Sequencing reactions were performed using the Dye Terminator Cycle Sequencing Ready Reaction Kit from PE Applied Biosystems. Sequencing reactions were run on a ABI PRISM 377 Automated Sequencer. Sequence data was collected, edited, and assembled using the ABI PRISM 377 Collection, Factura, and Auto Assembler software from PE ABI. DNA sequences were determined for portions of novel toxin genes from the following isolates: PS66D3,PS177C8,PS177I8,PS33F1,PS157C1(157C1-A),PS201Z, PS31F2, and PS185Y2. These nucleotide sequences are shown in SEQ ID NOS. 5, 7, 9, 38, 33, 35, 36, and 37, respectively. Polypeptide sequences were deduced for portions of the encoded, novel soluble toxins from the following isolates: PS66D3, PS177C8, PS177I8, and PS157C1 (toxin 157C1-A). These nucleotide sequences are shown in SEQ ID NOS. 6, 8, 10, and 34, respectively. Example 5 - Restriction Fragment Length Polymorphism (RFLP') of Toxins from Bacillus thuringiensis Strains Total cellular DNA was prepared from various Bacillus thuriengensis (B.t.) strains grown to an optical density of 0,5-0.8 at 600 nm visible light. DNA was extracted using the Qiagen Genomic-tip 500/G kit and Genomic DNA Buffer Set according to protocol for Gram positive bacteria (Qiagen Inc.; Valencia, CA). Standard Southern hybridizations using 32P-lableled probes were used to identifly and characterize novel toxin genes within the total genomic DNA preparations. Prepared total genomic DNA was digested with various restriction enzymes, electrophoresed on a 1% agarose gel, and immobilized on a supported nylon membrane using standard methods (Maniatis et al.). PCR-amplified DNA fragments 1.0-1.1 kb in length were gel purified for use as probes. Approximately 25 ng of each DNA fragment was used as a template for priming nascent DNA synthesis using DNA polymerase I Klenow fragment (New England Biolabs), random hexanucleotide primers (Boehringer Mannheim) and 32PdCTP. Each 32P-lableled fragment served as a specific probe to its corresponding genomic DNA blot. Hybridizations of immobilized DNA with randomly labeled 32P probes were performed in standard aqueous buffer consisting of 5X SSPE, 5X Denhardt's solution, 0.5% SDS, 0.1 mg/ml at 65°C overnight. Blots were washed under moderate stringency in 0.2X SSC, 0.1% SDS at 65°C and exposed to film. RFLP data " showing specific hybridization bands containing all or part of the novel gene of interest was obtained for each strain. In separate experiments, alternative probes for MIS and WAR genes were used to detect novel toxin genes on Southern blots of genomic DNA by 32P autoradiography or by non-radioactive methods using the DIG nucleic acid labeling and detection system (Boehringer Mannheim; Indianapolis, IN). DNA fragments approximately 2.6 kbp (PS177C8 MIS toxin gene; SEQ ID NO. 7) and 1.3 kbp (PS177C8 WAR toxin gene; SEQ ID NO. 11) in length were PCR amplified from plasmid pMYC2450 using primers homologous to the 5' and 3' ends of each respective gene. pMYC2450 is a recombinant * plasmid containing the PS177C8 MIS and WAR genes on an approximately 14 kbp Clal fragment in pHTBluell (an E. coli / B, thuringiensis shuttle vector comprised of pBluescript S/K [Stratagene, La JoIIa, CA] and the replication origin from a resident B.t plasmed [D. Lereclus et al 1989; FEMS Microbiology Letters 60:211-218]). These DNA fragments were used as probes for MIS RFLP classes A through N and WAR RFLP classes A through L. RFLP data in Table 4 for class O was generated using MIS fragments approximately 1636 bp amplified with primers S1-633F (CACTCAAAAAATGAAAAGGGAAA; SEQ ID NO. 39) and S1-2269R (CCGGTTTTATTGATGCTAC; SEQ ID NO, 40). RFLP data in Table 5 for class M was generated using WAR fragments approximately 495 bp amplified with primers S2- 501F (AGAACAATTTTTAGATAGGG; SEQ ID NO. 41) and S2-995R (TCCCTAAAGCATCAGAAATA; SEQ ID NO 42). Fragments were gel purified and approximately 25 ng of each DNA fragment was randomly labeled with 32P for radioactive detection or approximately 300 ng of each DNA fragment was randomly labeled with the DIG High Prime kit for nonradioactive detection. Hybridization of immobilized DNA with randomly labeled 32P probes were performed in standard formamide conditions: 50% formamide, 5X SSPE, 5X Denhardt's solution, 2% SDS, 0.1 mg/ml sonicated sperm DNA at 42°C overnight. Blots were washed under low stringency in 2X SSC, 0.1% SDS at 42°C and exposed to film. RFLP data showing DNA bands containing all or part of the novel gene of interest was obtained for each strain. RFLP data using MIS probes as discussed above were as follows: RFLP data using WAR probes as discussed above were as follows: Example 6 - Characterization and/or Identification of WAR Toxins In a further embodiment of the subject invention, pesticidal toxins can be characterized and/or identified by their level of reactivity with antibodies to pesticidal toxins exemplified herein. In a specific embodiment, antibodies can be raised to WAR toxins such as the toxin obtainable fi-om PS177C8a. Other WAR toxins can then be identified and/or characterized by their reactivity with the antibodies. In a preferred embodiment, the antibodies are polyclonal antibodies. In this example, toxins with the greatest similarity to the 177C8a-WAR toxin would have the greatest reactivity with the polyclonal antibodies. WAR toxins with greater diversity react with the 177C8a polyclonal antibodies, but to a lesser extent. Toxins which immunoreact with polyclonal antibodies raised to the 177C8a WAR toxin can be obtained from, for example, the isolates designated PS177C8a, PS 17718, PS66D3, KB68B55-2, PS185Y2, KB53A49-4, KB68B51-2,PS31F2,PS74H3,PS28M,PS7rG6,PS71G7,PS7IIl,PS71Nl,PS201JJ7, KB73,KB68B46-2,KB71A35-4.KB71A116-1,PS70B2, PS7IC2, PS86D1,HD573B, PS33F1, PS67B3, PS205C, PS40C1, PS130A3, PS143A2, PS157C1, PS201Z, PS71G4, KB42A33-8, KB71A72-1, KB71A133-11, KB71AI34-2, KB69A125-3, KB69A127-7, KB69A136-2, and KB71A20-4. Isolates PS3IF2 and KB68B46-2 show very weak antibody reactivity, suggesting advantageous diversity. Example 7 - Molecular Cloning and DNA Sequence Analysis of Soluble Insecticidal Protein (MIS and WAR) Genes from Bacillus thurigiensis Strain PS205C Total cellular DNA was prepared from Bacillus thuringensis strain PS205C grown to an optical density of 0.5-0.8 at 600nm visible light in Luria Bertani (LB) broth. DNA was extracted using the Qiagen Genomic-tip 500/G kit and Genomic DNA Buffer Set according to the protocol for Gram positive bacteria (Qiagen Inc.; Valencia, CA). A PS205C cosmid library was constructed in the SuperCos vector (Stratragene) using inserts of PS205C total cellular DNA partially digested with Nde 11. XLl-Blue cells (Stratagene) were transfected with packaged cosmids to obtain clones resistant to carbenicillin and kanamycin. 576 cosmid colonies were grown in 96-well blocks in 1 ml LB + carbenicillin (100 fig/ml) + kanamycin (50µg/ml) at 37°C for 18 hours and replica plated onto nylon filters for screening by hybridization. A PCR amplicon containing approximately 1000 bp of the PS205C MIS gene was amplified from PS205 genomic DNA using primers SEQ ID NO. 3 and SEQ ID NO. 4 as described in Example 4. The DNA fragment was gel purified using QiaexII extraction (Qiagen). The probe was radiolabeled with 32P-dCTP using the Prime-It 11 kit (Stratgene) and used in aqueous hybridization solution (6X SSPE, 5X Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA) with the colony lift filters at 65 °C for 16 hours. The colony lift filters were briefly washed IX in 2XSSC/0.1%SDS at room temperature followed by two additional washes for 10 minutes in 0.5XSSC/0.1%SDS. The filters were then exposed to X-ray film for 5.5 hours. One cosmid clone that hybridized strongly to the probe was selected for further analysis. This cosmid clone was confirmed to contain the MIS gene by PCR amplification with primers SEQ ID NO. 3 and SEQ ID NO. 4. This cosmid clone was designated as pMYC3105; recombinant E. coli XL-1 Blue MR cells containing pMYC3105 are designated MR992. A subculture of MR992 was deposited in the permanent collection of the Patent Culture Collection (NRRL), Regional Researph Center, 1815 North University Street, Peoria, Illinois 61604 USA on May 4, 1999. The accession number is NRRL B-30124. A truncated plasmid clone for PS205C was also deposited on May 4, 1999. The accession number is NRRL B-30122, To sequence the PS205C MIS and WAR genes, random transposon insertions into pMYC3105 were generated using the GPS-1 Genome Priming System and protocols (New England Biolabs). The GPS2 traspo&ition vector encoding chloramphenicol resistance was chosen for selection of cosmids containing insertions. pMYC3105 cosmids that acquired transposons were identified by transformation and selection of-E. coli XLl-Blue MR on media containing ampicillin, kanamycin and chloramphenicol. Cosmid templates were prepared from individual colonies for use as sequencing templates using the Multiscreen 96-well plasmid prep (Millipore). The MIS and WAR toxin genes encoded by pMYC3105 were sequenced with GPS2 primers using the ABI377 automated sequencing system and associated software. The MIS and WAR genes were found to be located next to one another in an apparent transcriptional operon. The nucleotide and deduced polypeptide sequences are designated as new SEQ ID NOS. 43-46. Example 8 - Molecular Cloning and DNA Sequence Analysis of Soluble Insecticidal Protein (MIS and WAR) Genes from Bacillus thuringensis Strain PS31F2 a. Preparation and Cloning of Genomic DNA Total cellular DNA was prepared from the Bacillus thuringensis strain PS31F2 grown to an optical density of 0.5-0.8 at 600nm visible light in Luria Bertani (LB) broth. DNA was extracted using the Qiagen Genomic-tip 500/G kit or Genomic-Tip 20/G and Genomic DNA Buffer Set (Qiagen Inc.; Valencia, CA) according to the protocol for Gram positive bacteria. Lambda libraries containing total genomic DNA from Bacillus thuringensis strain PS31F2 were prepared from DNA partially digested with Ndell. Partial Ndell restriction digests were electrophoresed on a 0.7% agarose gel and the region of the gel containing DNA fragments within the size range of 9 - 20kbp was excised from the gel. DNA was electroeluted from the gel fragment in O.IX TAE buffer at approximately 30 V for one hour and purified using Elutip-d columns (Schleicher and Schuell; Keene, NH). Purified, fractionated DNA was ligated into BamHI-digested Lambda-GEM-11 arms (Promega Corp., Madison, WI). Ligated DNA was then packaged into lambda phage using Gigapack III Gold packaging extract (Stratagene Corp., La JoUa, CA). E. coll strain KW251 was infected with recombinant phage and plated onto LB plates in LB top agarose. Plaques were lifted onto nitrocellulose filters and prepared for hybridization using standard methods (Maniatis, et al.). DNA fragments approximately LI kb (PS177C8 MIS) or 700 bp (PS177C8 WAR) in length were PCR amplified from plasmid pMYC2450 and used as the probes. Fragments were gel purified and approximately 25 ng of each DNA fragment was randomly labeled with 32P-dCTP. Hybridization of immobilized DNA with randomly 32P -labeled PS177C8 probes was performed in standard formamide conditions: 50% formamide, 5X SSPE, 5X Denhardt's solution, 2% SDS, 0.1 mg/ml at 42'oC overnight. Blots were washed under low stringency in 2X SSC, 0.1% SDS at 42oC and exposed to film. Hybridizing plaques were isolated from the plates and suspended in SM buffer. Phage DNA was prepared using LambdaSorb phage adsorbent (Promega, Madison, WI). PCR using the oligonucleotide primers SEQ ID NO. 3 and SEQ ID NO. 4 was performed using phage DNA templates to verify the presence of the target gene. The PCR reactions yielded the expected 1 kb band in both DNA samples confirming that those phage clones contain the gene of interest. For subcloning, phage DNA was digested with various enzymes, fractionated on a 1% agarose gel and blotted for Southern analysis. Southern analysis was performed as decribed above. A Hmdlll fragment approximately 8 kb in size was identified that contained the PS31F2 toxin genes. This fragment was gel purified and cloned into the Hmdlll site of pBluescriptII (SK+); this plasmid clone is designated pMYC2610. The recombinant E. coli XLlOGold [pMYC2610] strain was designated MR983. A subculture of MR983 was deposited in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center, 1815 North University Street, Peoria, Illinois 61604 USA on May 4,1999. The accession number is NRRL B-30123. b. DNA sequencing The pMYC2610 HindJH fragment containing the PS31F2 toxin genes was isolated by restriction digestion, fractionation on a 0.7% agarose gel and purification from the gel matrix using the QiaexII kit (Qiagen Inc.; Valencia, CA). Gel purified insert DNA was then digested separately with restriction enzymes Aluh Msel, or ^al and fractionated on a 1% agarose gel. DNA fiagmeots between 0.5 and 1.5 kb were excised from the gel and purified using the QiaexII kit. Recovered fragments were ligated into EcoRV digested pBluescriptll and transformed into E. coli XLIO Gold cells. Plasmid DNA was prepared from randomly chosen transformants, digested with Notl and Apal to verify insert size and used as sequencing templates with primers homologous to plasmid vector sequences. Primer walking was used to complete the sequence. Sequencing reactions were performed using dRhodamine or BigDye Sequencing kit (ABI Prism/Perkin Elmer Apphed Biosystems) and run on ABI 373 or 377 automated sequencers. Data was analyzed using Factura, Autoassembler (ABI Prism) and Gentics Computer Group (Madison, WI) programs. The MIS and WAR genes were found to be located next to one another in an apparent transcriptional operon. The WAR gene is 5' to the MIS gene, and the two genes are separated by 4 nucleotide bases. The nucleotide sequences and deduced peptide sequences for the novel MIS and WAR genes from PS31F2 are reported as new SEQ ID NOS. 47-50. c. Subcloning and transformation of 5. thuringiensis The PS31F2 toxin genes were subclorted on the 8 kbp HinDIII fragment from pMYC2610 into the E. coli IB.t. shuttle vector, pHT370 (0. Arantes and D. Lereclus. 1991. Gene 108: 115-119), for expression from the native Bacillus promoter. The resulting plasmid construct was designated pMYC2615. pMYC2415 plasmid DNA was prepared from recombinant E.coli XL10Gold for transformation into the acrystallierous (Cry-) BJ. host, CryB (A. Aronson, Purdue University, West Lafayette, IN), by electroporation. The recombinant CryB [pMyC2615] strain was designated MR558. Example 9 - Molecular Cloning and DNA Sequence Analysis of a Novel SUP Toxin Gene from Bacillus thuringiensis strain KB59A4-6 Total cellular DNA was prepared from the Bacillus thuringensis strain KB59A4-6 grown to an optical density of 0.5-0.8 at 600nm visible light in Luria Bertani (LB) broth. DNA was extracted using the Qiagen Genomic-tip 500/G kit and Genomic DNA Buffer Set according to the protocol for Gram positive bacteria (Qiagen Inc.; Valencia, CA). DNA was digested with HinDIII nd run on 0.7%agarose gels for Southern blot analysis by standard methods (Maniatis et al.). A PCR amplicon containing the SUP-like gene (SEQ ID NO. 1) from Javelin-90 genomic DNA was obtained by using the oligos "3A-atg (GCTCTAGAAGGAGGTAACTTATGAACAAGAATAATACTAAATTAAGC) (SEQ ID NO. 51) and "3A-taa" (GGGGTACCTTACTTAATAGAGACATCG) (SEQ ID NO. 52). This DNA fragment was gel purified and labeled with radioactive 32p-dCTP using Prime-It II Random Primer Labeling Kit (Stratagene) for use as a probe. Hybridization of Southern blot filters was carried out in a solution of 6X SSPE, 5X Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA at 42oC overnight in a shaking water bath. The filters were subsequently washed in IX SSPE and 0.1% SDS once at 25oC followed by two additional washes at 37oC. Hybridized filters were then exposed to X-ray film at -80°C. An approximately 1 kbp HinDTH fiagment of KB59A4-6 genomic DNA was identified that hybridized to the Javelin 90 SUP probe. A lambda library of KB59A4-6 genomic DNA was constructed as follows. DNA was partially digested with Sau3A and size-fractionated on agarose gels. The region of the gel containing fragments between 9.0 and 23 kbp was excised and DNA was isolated by electroelution in 0.1 X TAE buffer followed by purification over Elutip-d columns (Schleicher and Schuell, Keene, NH). Size-fractionated DNA inserts were ligated into BAmHI-digested Lambda-Gem 11 (Promega) and recombinant phage were packaged using GigapackIII XL Packing Extract (Stratagene). Phage were plated on E. coli VCS257 cells for screening by hybridization. Plaques were transferred to nylon filters and dried under vacuum at 80°C. Hybridization was then performed with the Javelin 90 Sup gene probe as described above. One plaque that gave a positive signal was selected using a Pasteur pipette to obtain a plug. The plug was soaked over-night at room temperature in 1mL SM buffer + 10uL CHCl3. Large-scale phage DNA preparations (Maniatis et al.) were obtained from liquid lysates of E. coli KW251 infected with this phage. The KB59A4-6 toxin gene was subcloned into the E, coli/ B. thuringiensis shuttle vector, pHT370 (O. Arantes and D. Lereclus. 1991. Gene 108: 115-119), on an approximately 5.5 kbp SacI/ Xbal fragment identified by Southern hybridization. This plasmid subclone was designated pMYC2473. Recombinant E, coli XL10-Gold cells (Stratagene) containing this construct are designated MR993, The insecticidal toxin gene was sequenced by primer walking using pMYC2473 plasmid and PCR amplicons as DNA templates. Sequencing reactions were performed using the Dye Terminator Cycle Sequencing Ready Reaction Kit from PE Applied Biosystems and run on a ABI PRISM 377 Automated Sequencer. Sequence data was analyzed using the PE ABI PRISM 377 Collection, Factura, and AutoAssembler software. The DNA sequence and deduced peptide sequence of the KB59A4-6 toxin are reported as new SEQ ID NOS. 53 and 54, respectively. A subculture of MR993 was deposited in the permanent collection of the Patent Culture Collection (NRRL), Regional Research Center, 1815 North University Street, Peoria, Illinois 61604 USA on May 4,1999, The accession number is NRRL B-30125. Example 10 - Bioassavs for Activity Against Lepidopterans and Coleopterans Biological activity of the toxins and isolates of the subject invention can be confirmed using standard bioassay procedures. One such assay is the budworm-bollworm {Heliothis virescens [Fabricius] and Helicoverpa zea [Boddie]) assay. Lepidoptera bioassays were conducted with either surface application to artificial insect diet or diet incorporation of samples. All Lepidopteran insects were tested from the neonate stage to the second instar. All assays were conducted with either toasted soy flour artificial diet or black cutworm artificial diet (BioServ, Frenchtown, NJ). Diet incorporation can be conducted by mixing the samples with artificial diet at a rate of 6 mL suspension plus 54 mL diet. After vortexing, this mixture is poured into plastic trays with compartmentalized 3-ml wells (Nutrend Container Corporation, Jacksonville, FL). A water blank containing no B,t serves as the control. First instar larvae (USDA-ARS, Stoneville, MS) are placed onto the diet mixture. Wells are then sealed with Mylar sheeting (ClearLam Packaging, IL) using a tacking iron, and several pinholes are made in each well to provide gas exchange. Larvae were held at 25 °C for 6 days in a 14:10 (light:dark) holding room. Mortality and stunting are recorded after six days. Bioassay by the top load method utilizes the same sample and diet preparations as listed above. The samples are applied to the surface of the insect diet. In a specific embodiment, surface area ranged from 0,3 to approximately 0.8 cm2 depending on the tray size, 96 well tissue culture plates were used in addition to the format listed above. Following application, samples are allowed to, air dry before insect infestation. A water blank containing no B,t can serve as the control. Eggs are applied to each treated well and were then sealed with Mylar sheeting (ClearLam Packaging, IL) using a tacking iron, and pinholes are made in each well to provide gas exchange. Bioassays are held at 25 °C for 7 days in a 14:10 (light:dark) or 28 °C for 4 days in a 14:10 (light:dark) holding room. Mortality and insect stunting are recorded at the end of each bioassay. Another assay useful according to the subject invention is the Western com rootworm assay. Samples can be bioassayed against neonate western com rootworm larvae {Diabrotica virgifera virgifera) via top-loading of sample onto an agar-based artificial diet at a rate of 160 ml/cm2. Artificial diet can be dispensed into 0.78 cm2 wells in 48-well tissue culture or similar plates and allowed to harden. After the diet solidifies, samples are dispensed by pipette onto the diet surface. Excess liquid is then evaporated from the surface prior to transferring approximately three neonate larvae per well onto the diet surface by camel's hair brush. To prevent insect escape while allowing gas exchange, wells are heat-sealed with 2-mil punched polyester film with 27HT adhesive (Oliver Products Company, Grand Rapids, Michigan). Bioassays are held in darkness at 25 °C, and mortality scored after four days. Analogous bioassays can be performed by those skilled in the art to assess activity against other pests, such as the black cutworm (Agrotis ipsilon). Results are shown in Table 6. Example 11 — Results of Western Com Rootworm Bioassavs and Further Characterization of the Toxins Concentrated liquid supematant solutions, obtained according to the subject invention, were tested for activity against Western com rootworm (WCRW). Supematants from the following isolates were found to cause mortality against WCRW: PS31F2, PS66D3, PS177I8, KB53A49-4, KB68B46-2, BCB68B51-2, KB68B55-2, and PS177C8. Supematants from the following isolates were also found to cause mortality against WCRW: PS205A3, PS185V2, PS234E1, PS71G4, PS248N10, PS191A21, KB63B19^13, KB63B19-7, KB68B62-7, KB68B63-2, KB69A125-1, KB69A125-3. KB69A125-5, KB69A127-7, KB69A132-1, KB69B2-1, KB70B5-3, KB71A125-15, and KB71A35-6; it was confimied that this activity was heat labile. Furthermore, it was determined that the supematants of the following isolates did not react (yielded negative test results) with the WAR antibody (see Example 12), and did not react with the MIS (SEQ ID NO. 31) and WAR (SEQ ID NO. 51) probes: PS205A3, PS185V2, PS234E1, PS71G4, PS248N10, PS191A21, KB63B19-13, KB63B19-7, KB68B62-7, KB68B63-2, KB69A125-1, KB69A125-5, KB69A132-1, KB69B2-1, KB70B5-3, KB71A125-15, and KB71A35-6; the supematants of isolates KB69A125-3 and KB69A127.7 yielded positive test results. Example 12 - Culturing of 31F2 Clones and Bioassay of 31F2 Toxins on Western Com Rootworm (wCRW) E.coli MR983 and the negative control strain MR948 {E. coli XL I-Blue [pSupercos]; vector control) were grown in 250 ml bottom baffled flasks containing 50 ml of DIFCO Terrific Broth medium. Cultures were incubated in New Brunswick shaker agitating at 250 RPM, 30°C for --23 hours. After 23 hours of incubation samples were aseptically taken to examine the cultures under the microscope to check for presence of contaminants. 30 ml of culture were dispensed into a 50ml centrifuge tube and centrifuged in a Sorvall centrifuge at 15,000rpm for 20 minutes. The IX supematant was saved and submitted for bioassay against wCRW. The pellet was resuspended 5X with 10mM TRIS buffer, and was sonicated prior to submission for bioassay against wCRW. B,t strain MR558 and the negative control MR539 (B.t. cry B[pHT Blue II]; vector control) were grown in the same manner except for the omission of glycerol from the Terrific Broth medium. B.t, cell pellets were resuspended in water rather than buffer prior to sonication. Assays for the E.coli clone MR983 and B. thuringz6W5Z5 clone MRS58 containing the 31F2 toxin genes were conducted using the same experimental design as in Example 10 for western com rootworm with the following exceptions: Supernatant samples were top-loaded onto diet at a dose of--160 ul/cm2 Bx cellular pellet samples at a 5X concentration were top-loaded onto the diet at a dose of ---150 ul/ cm2 for both clones, and at --75, and at doses of --35 ul/ cm2 for the MR558 B, thuringiensis clone (quantity of active toxin unknown for either clone). Approximately 6-8 larvae were transferred onto the diet immediately after the sample had evaporated. The bioassay plate was sealed with mylar sheeting using a tacking iron and pinholes were made above each well to provide gas exchange. Both the MR983 and MR558 clones demonstrated degrees of bioactivity (greater mortality) against western com rootworm as compared to the toxin-negative clones MR948 and MRS 39. Table 7 presents the results showing the bioactivity of cloned PS31F2 toxins against western com rootworm. Toxins of the subject invention can be used, alone or in combination with other toxins, to control one or more non-maminalian pests. These pests may be, for example, those listed in Table 8. Activity can readily be confirmed using the bioassays provided herein, adaptations of these bioassays, and/or other bioassays well known to those skilled in the art. Example 14 - Insertion of Toxin Genes Into Plants One aspect of the subject invention is the transformation of plants with genes encoding the insecticidal toxin of the present invention. The transformed plants are resistant to attack by the target pest. Genes encoding pesticidal toxins, as disclosed herein, can be inserted into plant cells using a variety of techniques which are well known in the art. For example, a large number of cloning vectors comprising a replication system in E. coli and a marker that permits selection of the transformed cells are available for preparation for the insertion of foreign genes into higher plants. The vectors comprise, for example, pBR322, pUC series, M13mp series, pACYC184, etc. Accordingly, the sequence encoding the Bacillus toxin can be inserted into the vector at a suitable restriction site. The resulting plasmid is used for transformation into E. coli. The E. coli cells are cultivated in a suitable nutrient medium, then harvested and lysed. The plasmid is recovered. Sequence analysis, restriction analysis, electrophoresis, and other biochemical-molecular biological methods are generally carried out as methods of analysis. After each manipulation, the DNA sequence used can be cleaved and joined to the next DNA sequence. Each plasmid sequence can be cloned in the same or other plasmids. Depending on the method of inserting desired genes into the plant, other DNA sequences may be necessary. If, for example, the Ti or Ri plasmid is used for the transformation of the plant cell, then at least the right border, but often the right and the left border of the Ti or Ri plasmid T-DNA, has to be joined as the flanking region of the genes to be inserted. The use of T-DNA for the transfonnatiop of plant cells has been intensively researched and sufficiently described in EP 120 516; Hoekema (1985) In: The Binary Plant Vector System, Offset-durkkerij Kanters B.V., Alblasserdam, Chapter 5; Fraley et aL, Crit. Rev. Plant Sci. 4:1-46; and An et al (1985) EMBO J 4:277-287. Once the inserted DNA has been integrated in the genome, it is relatively stable there and, as a rule, does not come out again. It normally contains a selection marker that confers on the transformed plant cells resistance to a biocide or an antibiotic, such as kanamycin, G 418, bleomycin, hygromycin, or chloramphenicol, inter alia. The individually employed marker should accordingly permit the selection of transformed cells rather than cells that do not contain the inserted DNA. A large number of techniques are available for inserting DNA into a plant host cell. Those techniques include transformation with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformation agent, fusion, injection, biolistics (microparticle bombardment), or electroporation as well as other possible methods. If Agrobacteria are used for the transformation, the DNA to be inserted has to be cloned into special plasmids, namely either into an intermediate vector or into a binary vector. The intermediate vectors can He integrated into the Ti or Ri plasmid by homologous recombination owing to sequences that are homologous to sequences in the T-DNA. The Ti or Ri plasmid also comprises the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate themselves in Agrobacteria. The intermediate vector can be transferred into Agrobacterium tumefaciens by means of a helper plasmid (conjugation). Binary vectors can replicate themselves both in E, coli and in Agrobacteria. They comprise a selection marker gene and a linker or polylinker which are framed by the right and left T-DNA border regions. They can be transformed directly into Agrobacteria (Holsters et al [1978] Mol. Gen, Genet. 163:181-187). The Agrobacterium used as host cell is to comprise a plasmid carrying a vir region. The vir region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be contained. The bacterium so transformed is used for the transformation of plant cells. Plant explants can advantageously be cultivated with Agrobacterium tumefaciens or Agrobacterium rhizogenes for the transfer of the DNA into the plant cell. Whole plants can then be regenerated from the infected plant material (for example, pieces of leaf, segments of stalk, roots, but also protoplasts or suspension-cultivated cells) in a suitable medium, which may contain antibiotics or biocides for selection. The plants so obtained can then be tested for the presence of the inserted DNA. No special demands are made of the plasmids in the case of injection and electroporation. It is possible to use ordinary plasmids, such as, for example, pUC derivatives. In biolistic transformation, plasmid DNA or linear DNA can be employed. The transformed cells are regenerated into morphologically normal plants in the usual manner. If a transformation event involves a germ line cell, then the inserted DNA and corresponding phcnotypic trait(s) will be transmitted to progeny plants. Such plants can be grown in the normal manner and crossed with plants that have the same transformed hereditary factors or other hereditary factors. The resulting hybrid individuals have the corresponding phenotypic properties. In a preferred embodiment of the subject invention, plants will be transformed with genes wherein the codon usage has been optimized for plants. See, for example, U.S. Patent No. 5,380,831. Also, advantageously, plants encoding a truncated toxin will be used. The truncated toxin typically will encode about 55% to about 80% of the full length toxin. Methods for creating synthetic Bacillus genes for use in plants are known in the art. It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in,the art and are to be included within the spirit and purview of this application and of the appended claims. WE CLAIM: 1. An isolated polynucleotide that encodes a pesticidally active protein, wherein said protein has at least 95% identity with the amino acid sequence of SEQ ID NO:54, 2. The polynucleotide as claimed in claim 1, wherein said protein comprises the amino acid sequence of SEQ ID NO:54. 3. The polynucleotide as claimed in claim 1, wherein said polynucleotide comprises the nucleotide sequence of SEQ ID NO:53. 4. A microbial host cell comprising an isolated polynucleotide that encodes a pesticidally active protein, wherein said protein has at least 95%) identity with the amino acid sequence of SEQ ID NO:54, and wherein said cell is selected from the group consisting of a plant cell and a microbial cell. 5. The cell as claimed in claim 4, wherein said protein comprises the sequence of SEQ ID NO:54. 6. The cell as claimed in claim 4, wherein, said polynucleotide comprises the nucleotide sequence of SEQ ID NO:53. » 7. The microbial cell as claimed in claim 4, wherein said microbial cell is a bacterial cell. 8. An isolated, pesticidally active protein, wherein said protein has at least 95% identity with the amino acid sequence of SEQ ID NO:54. 9. The protein as claimed in claim 8, wherein said protein comprises the amino acid sequence of SEQ ID NO:54. 10. A method for controlling a lepidopteran pest wherein said method comprises contacting said pest with a protein wherein said protein has at least 95% identity with the amino acid sequence of SEQ ID NO:54. 11. The method according to claim 10, wherein said protein comprises the amino acid sequence of SEQ ID NO:54. 12. The method according to claim 10, wherein said protein is produced by and is present in a plant, and said lepidopteran pest ingests a portion of said plant, thereby contacting said protein. 13. A biologically pure culture of Bacillus thuringiensis isolate KB59A4-6 available under deposit number NRRL B-30173. 14. A method of controlling a plant pest by contacting said pest with at least one pesticidally active protein encoded by a polynucleotide as claimed in claim 1 or 3. 15. A method for controlling com rootworm wherein said method comprises contacting said com rootworm with at least one pesticidally active protein encoded by a polynucleotide as claimed in claim 1. 16. The method as claimed in claim 15 wherein said com rootworm is western com rootworm. 17. A method for controlling com rootworm wherein said method comprises contacting said com rootworm with at least one pesticidally active protein encoded by a polynucleotide as claimed in claim 1, wherein said protein is produced by B.t. isolate PS31F2.

Documents:

in-pct-2000-0604-che claims duplicate.pdf

in-pct-2000-0604-che description (complete) duplicate.pdf

in-pct-2000-0604-che drawings duplicate.pdf

in-pct-2000-604-che-abstract.pdf

in-pct-2000-604-che-assignment.pdf

in-pct-2000-604-che-claims .pdf

in-pct-2000-604-che-correspondence others.pdf

in-pct-2000-604-che-correspondence po.pdf

in-pct-2000-604-che-description complete.pdf

in-pct-2000-604-che-form 1.pdf

in-pct-2000-604-che-form 26.pdf

in-pct-2000-604-che-form 3.pdf

in-pct-2000-604-che-form 5.pdf

in-pct-2000-604-che-other documents.pdf

in-pct-2000-604-che-pct.pdf