Title of Invention | AN ISOLATED POLYPEPTIDE |
---|---|
Abstract | A highly conserved, immunologically accessible antigen at the surface of Neisseria, meningitidis organisms. Immunotherapeutic, prophylactic and diagnostic compositions and methods useful in the treatment, prevention and diagnosis of Neissetria meningitidis diseases. A proteinase K resistant Neisseria meningitidis surface protein having an apparent molecular weight of 22 kDa, the corresponding nucleotide and derived amino acid sequences (SEQ ID NO:1, N0:3, NO:5, and NO:7; SEQ ID N0:2,NO:4, NO:6, and NO:8), recombinant DNA methods for the production of the Neisseria meningitidis 22 kDa surface protein, and antibodies that bind to the Neisseria meningitidis) 22 kDa surface protein. |
Full Text | TECHNICAL FIELD OF THE INVENTION This invention relates to a highly conserved, immunologically accessible antigen at the surface of Neissezria meningitidis organisms. This unique antigen provides the basis for new immunotherapeutic, prophylactic and diagnostic agents useful in the treatment, prevention and diagnosis of Neisseria meningitidis diseases. More particularly, this invention relates to a proteinase K resistant Neisseria meningitidis surface protein having an apparent molecular weight of 22 kDa, the corresponding nuclecrtide and derived amino acid sequences (SBQ ID NO:1 to SEQ ID N0:26J,, recoitibinant DNA methods for the production of the Neisseria. msniri&itidis 22 kDa surface protein, antibodies that bind to the Neisseria meningitidis 22 kDa surface protein and methods and compositions for the diagnosis,, treatment and prevention of Neisseria meningitidis diseases. This application is divided out of Indian Patent Application No.466/CAL/96. BACKGROUND OF THE INVENTION Neisseria. meningitidis is a major cause of death and mariidity -throughout the world. Neisseria meningitidis causes both endemic and epidemic diseases, principally meningitis and meningococcemia [Gold, Evolution -of meningococcal disease, p. 69, Vedros N.A., CRC Press (1987); Schwartz et al, Clin. Microbiol. Rev., 2, p. S118 (1989)]. In fact, this organism is one of the most common causes, after Haemophilus influenzae type b, of bacterial meningitis in the United States, accounting for approximately 20% of all cases. It has been well documented that serum bactericidal activity is the major defense mechanism against Neisseria meningitidis and that protection against invasion by the bacteria correlates with the presence in the serum of anti-meningococcal antibodies [Goldschneider et al., J. Exp. Med. 129, p. 1307 {1369)} Goldschneider et al., J. Exp. Med., 129, p. 1327 (1969)]. Neisseria meningitidis are subdivided into serological groups according to the presence of capsular antigens. Currently, 12 serogroups are recognized, but serogroups A, B, C, Y, and W-135 are most commonly found. Within serogroups, serotypes, subtypes and immunotypes can be identified on outer membrane proteins and lipopolysaccharode [Frasch et al. , Rev. Infect. Dis. 7, p. 504 (1985)]. The capsular polysaccharide vaccines presently available are not effective against all Neisaeria. meningitidis isolates -and do not effectively induce the production of protective antibodies in young infants [Frasch, Microbiol. Rev, 2, p, S134 (1989); Reingold et al., Lancet, p. 114 (1985); Zollinger, in Woodrow and Levine, New generation vaccines, p. 325, Marcel Dekker Inc. N.Y. (1990)]. The capsulax polysaccharide of serogroups A, C, Y and W-135 are presently used in vaccines -against this organism, These polysaccharide vaccines are effective in the short term, however the vaccinated subjects do not-develop--an iasaunological memory, so they must be revaccinated within a three-year period to maintain their level of resistance. further, these polysaccharide vaccines do not induce sufficient levels of bactericidal antibodies to obtain the desired protection in children under two years of age, whoare the principal victims of this disease, No effective vaccine against serogroup B isolates is presently available even though these organisms are one of the primary causes of meningococcal diseases in developed countries. Indeed, the serogroup B polysaccharide is not a good immunogen, inducing only a poor response of. IgM of low specificity which is not protective [Gotschlicli et al., J. Infect. Pis., 149, p. 387 (1984); Zollinger et al., J. Clin. Invest, 63, p. 836 (1979)], Furthermore, the presence of closely similar, crossreactive structures in the glycoproteins of neonatal human brain tissue [Finite et al., Lancet, p. 355 (1983)] might discourage attempts at improving the immunogenicity of serogroup B polysacharide. To obtain a more effective vaccine, other Neisserie. meningitidis surface antigens such as lipopolysaccharide, pili proteins and proteins present in the outer membrane are under investigation. The presence of a human immune response and bactericidal antibodies against certain o£ these proteinaceous surface antigens in the sera, of immunized voluteers and cunvalescent patient a was demonstrated [Mandrell and Zollinger/ Infect. Immun., 57, p. 1590 (1989); Poolman et al., infect. Immun,, 40, p. 398 (1933) ; Rosenquist et al., J, Clin, Microbiol. 7 26, p. 1543 (1988); Wedege and Froholm Inffect. Immun. 51, p. 571 (1986); Wedege and Michaglsen, J Clin -Microbiol, , 25, p. 1349 (1987)]. Furthermore, monoclonal antibodies directed against jouter membrane proteins, such as class 1, 2/3 -and 5, were also reported to be bactericidal and to protect against experimental infections in animals [Brodeur et a1., Infec. Imrman., 50, p 510 (1985-); frasch et al, Clin, Invest. Med,, 9, p. 101 (1986); Saukkonen et al. Microb. Pathogen. , 3, p. 261 (1987); -Saukkonen et al., Vaccine, 7, p. 325 (1989)]. Antigen preparations based on Neisseria meningitidis outer membrane proteins have demonstrated immunogenic effects in animals and in humans and some of them have been tested in clinical trials [Bjune et al, , Lancet, p. 1093 (1991),. Costa et al., NIPH.Annals. 14, p. 215 (1991); Frasch et al., Med. Trop, 43, p. 177 (1982); Frasch et al., Eur. J. Clin. Microbiol.. 4, p. 533 (1985); Fraach et al. in Robbing, Bacterial Vaccines, p. 262, Praeger Publications, N.Y. (1987); frasch net -al, J Infect Dis., 158, p. 710 (1988); Moreno et al. mfec. Immun., 47, p. 527 (1985); Rosenqvist et al., J. Clin. Microblol,, 26, p, 1543 (1988); Sierra et al., NIPH Annals, 14, p. 195 (1991); wedege and Froholm, Infec. Immun, 51, p. 571 (1986); Wedege and Michaelsen, J. Clin. Microbiol., 25, p. 1349 (1987); Zollinger et al., J. Clin. Invest.. 63. p. 836 11979); Zollinger et al., HIPH Annals, 14, p. 211 (1991)}, However the existence of great interstrain antigenic variability in the outer membrane proteins can limit their use in vaccines [Frasch, Clin. Microbe.,Rev. 2, p. S134 (1989)]- Indeed, most-of these preparations induced bactericidal antibodies that were restricted to the same or related serotype from which the antigen was extracted [Zollinger in Woodrow and Levine, New Generation Vaccines, p. 325, Marcel Dekker Inc. N.Y. (1990)]. Furthermore, the protection conferred by these vaccines in young children has yet to be clearly established. The highly conserved Neisseria meningitidis outer membrane proteins such as the class A [Munkley et al. Microb. Pathogen., 11, p. 447 (1991)] and the lip protein (also called K.8) [Woods et al., Infect. Immun., 55, p. 1927 (1987)] are not interesting vaccine candidates since they do not elicit the production of bactericidal antibodies. To improve these vaccine preparations, there is a need for highly conserved proteins that would be present at the surface of all Neisseria meningitidis Strains and that would be capable of eliciting bactericidal antibodies in order to develop -a inroad spectrum vaccine. The current laboratory diagnosis of Neisseria meningitidis is usually -done by techniques such as Gram stain of smear preparations, latex agglutination or coagglutination, and the culture and isolation on enriched and selective media [Morello et al., in Balows, Manual of Clinical Microbiology, p. 258, American Society for Microbiology, weshington (1991)]. Carbohydrate degradation tests are usually perforated to confirm the identification of Neisseria mening-itidis isolates. Most of the described procedures are time-consuming processes requiring trained personnel, commerecial agglitination or coagglutination kits containing polyvalent sera directed against the capsular antigens expressed by the most prevalent serogroups are used for the rapid identification of Neisseria meningitidis However, these polyvalent sera often nonspecifically cross react with other bacterial species and for that reason should always be used in conjunction wi±h Gram stain and culture. Accordingly, there is a need for efficient alternatives to these diagnostic assays that will improve the rapidity and reliability of the diagnosis . DISCLOSURE OF THE INVENTION The present invention solves the problems referred to above by providing a highly conserved, immunologically accessible antigen at the surface of Neisseria Also provided are rcombinant DNA molecules that code for the foregoing antigen, unicellular hosts transformed with those DMA molecules, and a process for making substantially pure, recomboinant antigen. Also provided are antibodies specific to the foregoing The antigen and antibodies of this invention provide the basis for unique methods and coapositions for the detection, prevention and treatment of Neisseria meningitldxs diseases. The preferred antigen is the Neisseria meningitidis 22 kDa surface protein, including fragments, analogues and derivatives thereof. The preferred antibodies are the Me- 1 and Me-7 monoclonal antibodies specific to the Neissezia meningitidis 22 kDa surface protein. These antibodies are highly bacteriolytic against Neisseria meningitidis and passively protect mice against experimental infection. The present invention further provides methods for isolating novel Neisseria meningitidis surface antigens and antibodies specific thereto. SRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS Figure 1 depicts the nucleotide and derived amino acid sequences of the Neisseria meningitidis strain 608B 22 kDa surface protein (SEQ ID NO:1; SEQ ID N0:2). Conventional three letter Symbols are used for the amino acid residues. The open reading frame extends from the start codon at base 143 to the stop codon at base 667. The box indicates the putative ribosome binding site whereas the putative -10 promoter sequence is underlined. A 19- amino-acid signal peptide is also underlined. Figure 2 is a photograph of a Coomassie Blue stained 14% SDS-PAGE gel displaying a-chymotrypsin and trypsin digests of Neisseria meningitidis strain 608B {B:2a:P1.2) outer membrane Lane 1 contains the following molecular weight markers r Phosphorylase b (97,400); bovine serum albumin (66,200); ovalbumin (45(000); carbonic anhydrase (31,000); soybean trypsin inhibitor (21,500); and lysoayme (14,400). Lane 2 contains undigested control outer membrane preparation. Lane 3 contains a-chymotrypsin treated preparation (2mg of enzyme per mg of protein); lane 4 contains trypsin treated preparation. o Figure 3a is a photograph of a Coornmasie Blue stained 14% SDS-PAGE gel displaying proteinase K digests of Neisseria meningitidis strain 6G8B (B:2a:PI.2) outer membrane preparations. Lanes 1, 3, 5, and 7 contain undigested control. Lanes 2,4,6 and 6 contain outer membrane preparations digested with proteinase K (2 IU per mg of protein) . Lanes 1 to 4 contain preparations treated at pH 7 J2. .Lanes 5 ±x> JS c. on tain preparations treated at pK 9.0. Lanes 1, 2, 5 and 6 contain preparations treated without SDS. Lanes 3, 4, 7 and 8 contain preparations treated in the presence of SDS. Molecular weight markers are indicated on the left (in kilodaltons). Figure 3b is a photograph of a Coomasaie Blue stained 14% SDS-PAGE gel displaying tiie migration profiles of affinity purified recombinant 22 kDa protein. Lane 1 contains molecular weight .markers-: Phosphorylase b (97,400, bovine serum albumin (66,200), ovalbumin : (45,000), carbonic anhydrase (31,000), soybean trypsin inhibitor (21,500) and lysozyme (14,400). Lane 2 contains 5 ug of control affinity purified x^combinant 22 kDa protein. Lane 3 contains 5 ug of affinity purified recombinant 22 kDa protein heated at 100°C for 5 min. . Lane 4 contains 5 ug of affinity purified recombinant 22 kDa-protein .heated at 100°C for 10 fltin, . Lane 5 contains 5 ug of affinity purified recombinant 22 kDa protein heated at 1000C for 15 min. Figure 4 is a photograph, of Coomassie Blue stained 14% .SDS-PAGE gels and their corresponding Western iitanmnoblots showing the reactivity of moaodonal antibodies specific to the Neisseria. meningitidis 22 kDa surface protein. Outer membrane preparation from Neisseria meningitidis strain 608B (B;2a:P1..2) (A) untreated; (B) Proteinase K treated (2 IU per mg of protein). Lane 1 contains molecular weight markers and characteristic migration profile on 14% SDS-PAGE gel of outer meanbrane preparations. Lane 2 contains Me.-2; Lane 3 contains Me-3; lane 4 contains Me-5; lane 5 contains Me-7; and lane 6 contains an unrelated control monoclonal antibody. The molecular weight markers are phosphorylase b (97,400), bovine serum albumin (66,200), ovalbumin (45,000), carbonic anxhydrase (31,000}, soybean trypsin inhibitor (21,500) and lysozyme (14,400). The immunoblot results ehovm in Figure 4 for Me-2, Me-3, Me-5, Me-6 ana Me-7 are consistent with the imrauuoblot results obtained for Me-1. Figure S is a graphic depiction of the binding activity of the monoclonal antibodies to intact bacterial cells. The results for representative monoclonal antibodies Me-5 and Me-7 are presented in counts per minute ("CPM") on the vertical -axis. The various bacterial strains used in the assay are shown on the horizontal axis. A Haemophilus influenzae porin-specific monoclonal antibody was used as a negative control. Background counts t>elow 500 CPM were recorded and were subtracted from the binding values. Figure 6 is a photograph of .stained 14% SDS-PAGE gels and their corresponding Western iinmurioblot demonstrating the purification of the recombir.ant 22 kDa Neisseria meningitldis surface protein from concentrated culture supernatant of Escherichia coli strain BL21{DB3). Figure 6(A) is a photograph of a Coomassie Blue and silver stained 14% SDS-Page gel. L&ne 1 contains the following molecular weight markers; phosphorylase b (97,400), bovine serum albumin (66,200), ovalbumin {45,000), carbonic anhydrase (31,000), soybean trypsin inhibitor (21,500} and lyjsosyme (14,400). -fcane 2 contains outer membrane protein preparation extracted from Neiaserla tueningitidls strain 608B (serotype B:2a:pl-2)(10 mg). Lane 3 contains concentrated culture supernatant of Escherichia coli BL21(DE3) (10 mg} . Lane 4 contains affinity purified recombinant 22 kDa. Neisseria meningitldis surface protein (1 mg). Figure 6(B) is a photograph of a Coomassie Blue stained 14% SDs-PAGE gel of a-chymotrypsin, trypsin and proteinase X digests of affinity purified recoabinant 22 kDa Neisseria meningitidia surface protein. Lane 1 contains the following molecular weight markers: phosphorylase b (97,400), bovine serum albumin {66,2005, ovalbumin (45,000), carbonic anhydrase (31000), soybean trypsin inhibitor (21,500) ana lysozyme (14,400). Lanes 2 to 5 contain purified recombinant 22 kDa Neisaeria. meninigitidis -surface protein (2 mg). Lanes 7 to 13 contain bovine serum albumin (2 mg) . Lanes 2 and 7 "contain undigested protein ("NT") . Lanes 3 and 8 contain a-chymotrypsin ("C") treated protein (2 mg of enzyme per treated protein (2 mg of enzyme per mg of protein) . Lanes 5 and 10 contain proteinase K ("K") treated protein (2 IU per mg of protein) . figure 6('C) is a photograph of the Western immunoblotting of a duplicate gel using monoclonal antibody Me-5, Figure 7 is a graphical depiction of the bactericidal activity or protein A-purified anti-Neisseria menizigitidis 22 kDa surface protein monoclonal antibodies against Neissericia meningitidis strain 608B {B:2a:P1.2). The vertical axis of the graph shows the percentage of survival of the Neissericia meningitidis bacteria after exposure to various concentrations of monoclonal antibody (shown on the horizontal axis of the graph) , Figure 8 depicts the nucleotide and derived amino acid sequences of the Nedsseria meningitidis strain MCH88 22 kDa surface protein (SEQ ID NO:3; SEQ ID NO:4). Conventional three letter symbols are used for the amino acid residues. The open reading frame extends from the start codon at base 116 to the stop codon at base 643. Figure 9 depicts the nucleotide and derived amino acid sequences of the Neisseria meningitidis strain 54063 22 kDa surface protein (SEQ ID NO:5; SEQ ID NO:6) . Conventional three letter symbols are used for the amino acid residues. The open reading frame extends from the start codon at base 208 ±v the stop codon at base 732. Figure 10 depicts the nucleotide and derived amino acid sequences of the Neisseria cronorrhoeae strain b2, 22 kDa surface protein (SEQ ID NO:7; SEQ ID N0:8). Conventional three letter symbols are used for the amino acid residues. The open reading frame extends from the start codon at base 241 to the stop codon at base 765. Figure 11 depicts the consensus sequence established from the DNA sequences of the four strains of Neiaseria and indicates the substitutions or insertion of nucleotides specific to each strain. Figure 12 depicts the consensus seqauence established from the protein sequences of the four strains of Neisseria and indicates the substitutions or insertion of amino acid residues specific to each, strain. Figure 13 represents the time course of the immune response to the recombinant 22 KDa protein in rabbits expressed as the reciprocal ELISA titer. The rabbits were strain JM109 with plasmid pN2202 or with control plasmid pWKS30. The development of the specific humoral response was analysed by E3LISA using outer membrane preparations obtained from Neisseria meningritidis strain 608B (B:2a:P1.2) as coating antigen. Figure 14 represents the time course cf the immune response to the recombinant 22kDa protein in Hacaca fascicularis (cynomolgus) monkeys expressed as the reciprocal EDISA titer. The two monkeys were respectively immunized with 100µg (K28) and 200µg (1276) of affinity purified 22JcDa protein per injection. The control monkey1 (K65) was immunized with 150µg of unrelated recombinant protein following the same procedure. The development of the specific humoral response was analysed by ELISA using outer membrane preparations obtained from Neisssria meningitidis strain 608B (B:2a:Pl,2) as coating antigen. Figure 15 is a graphic representation of the synthetic peptides of the invention as well as their respective position in the full 22kDa protein of Neisseria meningitidis strain 608B (B:2a:Pl,2) . Figure 16 is a map of plasmid pNP2204 containing the gene which encodes the Neisseria meningitidis 22 -kDa. surface protein 22kDa, Neisseria meningitidis 22 kDa surface protein gene; AanpiR, ampicilliin-resistance coding region; ColEl, origin of replication; cl857, bacteriophage X cI857 temperature-sensitive repressor gene; XPL, bacteriophage l transcription promoter; Tl transcription terminator. The diection of transcription is indicated by the arrows. BgIII and BanHl are the restriction sites used to insert the 22 kDa gene in the p629 plasmid. DHTAILSD DBSCRIPTION OF THE INVENTION During our study of the ultrastructure of the outer membrane of Nsisseria meningitidis we identified a new low molecular weight protein of 22 kiiodaltons which has very unique properties. This outer membrane protein is highly resistant to extensive treatments with proteolytic enzymes, such as proteinase K, a serine protease derived from the mold Tritirachiwn album limber. This is very surprising since proteinase K resistant proteins are very rare in nature because of the potency, wide pH optimum, and'low peptide bond specificity of this enzyme [Barrett, A.J. and N.D. Rawlings, Biochem. Soc, Transactions (1991) 19: 707-715]. Only a few reports have described proteins of prokaryotic origin that are resistant to the enzymatic degradation o£ proteinase K. Proteinase K resistant proteins have been found in Leptospira species [Nicholson, V.M. -and J.F. Prescott, Veterinary Microbiol. (1993) 36:123-138], Mycoplasma. species [Butler, G.H. et al. Infec. Immun. (.1991) 59:1037-1042], Spiroplasma mirum [Bastian, F.O. et al. J. Clin. Microbiol. (1987) 25:2430- 2431] and in viruses and prions [Oncdera, t. et al. Microbiol. Immunol. (1993) 37:311-316; Prusiner, S,B. et al. Proc. Nat. Acad. Sea. USA (1593) 90:2793-2797]. Herein, we describe the use of this protein as a means for the improved prevention, treatment and diagnosis of Neisseria meningitidis infections. Thus according to one aspect of the invention we provide a highly conserved, immunologically accessible Neisseria meningitxdis -surface protein7 and fragments, analogues, and derivatives thereof. As used herein, "Neisaeria meningitidis surface protein" means any ' naturally occurring Neisseria meningitidis gene. The Neisseria meningitidis pxotein according to the invention may be of natural origin, or may be obtained through the application of molecular biology with the object of producing a recombinant protein, or fragment thereof. As used herein, highly conserved" means that the gene for the Neisseria meningitidis surface protein and the protein itself exist in greater than 50% of known strains of Neisseria meningitiais. Preferably/ the gene and its protein exist in greater than 99% of known strains of Neisseria meningitidis. Examples 2 and 4 set forth methods by which one of skill in the art would be able to test a variety o£ different Neisseria meningitidis surface proteins to determine if they are "highly conserved". As used herein, "immunologically accessible" means that the Neisseria meningitidis surface protein is present at the srurface o£ the organism and is accessible to antibodies. Example 2 sets forth methods by which one of skill in the art would be able to test a variety of different Neisseria meningitidis surface proteins to determine if they are "immunologically accessible". Inmiunological accessibility may be determined by other methods, including an -agglutination assay, an ELISA, a RIA, an immunoblotting assay, a dot-enzyme assay, a surface accessibility assay, electron microscopy, or a combination of these assays. As used herein, "fragments" of the Neisseria meningitidis surface protein include polypeptides having at least one peptide epitope, or analogues -and derivatives thereof Peptides of this type may be obtained through the application of molecular biology or synthesized using conventional liquid or solid phase peptide synthesis techniques. As used herein, "analogues" of the Neisseria meningitidis surface protein include those proteins, or fragments thereof, wherein one or more amino acid residues in the naturally occurring sequence is replaced by .another amino acid residue, providing that the overall functionality and protective properties of this protein are preserved. Such analogues may be produced synthetically, or Joy recombinant UNA technology, for example, by mutagenesis of a naturally occurring Neisseria meningitidis surface protein. Such procedures are well known in the art. For example, one such analogue is selected from the recombinant protein that may be produced from the gene for the 22kDa protein from Neisseria gonorrhoeae strain b2, as depicted in Figure 10. A further analog may be obtained from the isolation of the corresponding gene from Neisseria. lactatnica. As used herein, a "derivative" of the Neisseria meningitidis surface protein is a protein or fragment thereof that has been covalently modified, for example, with, dinitrophenol, in order to render it innnunogenic in humans. The derivatives of this invention also include derivatives of the amino acid analogues of this invention. It will be understood that by following the examples of this invention, one of skill in the art may determine without undue experimentation whether a particular fragment, analogue or derivative would be useful in the diagnosis, prevention or treatment of Neisseria meningitidis diseases. This invention also includes polymeric forms of the Neisseria meningitidis surface proteins, fragments, analogues and derivatives. These polymeric forms include, for example, one or more polypeptides that have been crosslinked with crosslinkers such as avidin/biotin, gluteraldehyde or dimethylsuberimidate, Such polymeric forms also include polypeptides containing two or more tandem or inverted contiguous Neisseria meningitidis sequences, produced from multicistronic mRNAs generated by recombinant UNA technology. This invention provides substantially pure Neissria meningitidis surface protiens. The term "substantially pure" means that the Neisseria meningitidis surface protein according to the invention is free from other proteins of Neisseria meningitidis origin. Substantially pure Neisseria -meningitidis surface protein preparations can be obtained by a variety of conventional processes, for example the procedure described in Examples 3 and 11. In a further aspect, the invention particularly provides a 22 kDa surface protein of Neisseria. meningritidis having the amino acid sequence of Figure 1 (SEQ ID N0:2), or a fragment, analogue or derivative thereof. In a further aspect, the invention particularly provides a 22 kDa surface protein of Neisseria meningitidis having the amino acid sequence of Figure -8 (SEQ ID N0:4), Figure 9 (SEQ ID NO:6) or a fragment, analogue or derivative thereof. Such a fragment may be selected from the peptides listed in Figure 15 (SEQ ID NO: 9 to SEQ ID 130:26). In a further aspect, the invention provides a 22kDa surface protein of Neisseria. gonorrhoeae having the amino acid sequence of Figure 10 {SEQ ID NO;8), or a fragment, analogue or derivative -thereof, as will be apparent from the above, any reference to the Neisseria meningitidis 22kDa protein also encompasses 22kDa proteins isolated from or made from genes isolated from Other species of. Neisseriacae such as Neisseria gonorrhoeae or Neisseria lacpcmica. A Neisseria meningitidis 22 kDa surface protein according t:o the invention may be further characterized by one or more of the following features: (1) it has an approximate molecular weight of 22 kDa as evaluated on SDS-PAGE gel; (2) its electrophoretic mobility on SDS-PAGE gel is not modified by treatment with reducing agents; (3) it has en isoelectric point (pI) in a range around pI 8 to pI 10; (4) it is highly resistant to degradation by proteolytic enzymes such as a-chymotrypsin, trypsin and proteinase K; (5) periodate oxidation does not abolish the specific binding of antibody directed against the Neisseria meningitidis 22 kDa surface protein; (6) it is ia highly conserved antigen; (7) it is accessible to antibody at the surface of intact Neisseria meningitidis organisms; (8) it can induce the production of bactericidal antibodies; (9) it can induce the production of antibodies that can protect against experimental infection; (10) it can induce, when injected into an animal host, the development of an immunelogical response that can protect against Neisseria. meningitidis infection. This invention also provides, for the first time, -a DNA sequence coding for the Neisseria meningitidis 22 kDa surface protein (SEQ ID NO:1, N0:3, NO:5, and NO:7}. "The preferred dna sequences of this invention are selected from the group consisting of: (a) the DNA sequence o£ Figure 1 {SEQ ID NO:l); (b) the DNA sequence of Figure 8 {SEQ ID NO:3) ; (c) the DNA sequence of Figure 9 (SEQ ID NO:5); {d) the DNA sequence of Figure 10 (SEQ ID N0;7) ; (e) analogues or derivatives of the foregoing DNA sequences; (f) DNA sequences degenerate to any of the foregoing DNA sequences; .and (g) fragments of any of the foregoing DNA sequences; wherein said sequences encode a product that displays the immunological activity of the Neisseria meningitidis 22 kDa surface protein. Such fragments are preferably peptides as depicted in Figure 15 {SEQ ID NO:9, through SEQ ID NO:26}. Preferably, this invention also provides, for the first time, a DNA sequence coding for the Neisseria meningitidis 22 kDa surface protein (SEQ ID NO:1) . More preferred DNA sequences of this invention are selected from the group consisting of: (a) the DNA sequence of Figure 1 {SEQ ID NO: 1); (b) analogues or derivatives of the foregoing DNA sequences; (c) DMA sequences degenerate to any of the foregoing DNA sequences; and (d) fragments of any of the foregoing DNA sequences; wherein said sequences encode a product that displays the immunological activity of the Neisseria meningitidis 22 KDa surface protein. Analogues and derivatives of the Neisseria meningitidis 22 kDa surface protein codling gene will hybridize to the 22 kDa surface protein-coding gene under the conditions -described in Example 4 . For purposes of this invention, the fragments, analogues and derivatives of the Neisseria meningitidis 22 kDa surface protein have the "immunological activity" of the Neisseria meningitidis 22 kDa surface protein if they can induce, when injected into an animal host, the development of an intmunological response that can protect against Neisseria meningitidis infection. One of skill in the art may determine whether a particular DNA sequence encodes a product ~thst displays the immunological activity o£ the Neisseria menirxgitidis 22 kDa surface protein by following the procedures set forth herein in Exsmple 6. The Neisseria meningitidis surface proteins of this invention may be isolated by a method comprising the following steps: a) isolating a culture of Neisseria meningitidis bacteris, b) isolating an outer membrane portion from the culture of the bacteria; -and c) isolating said antigen from the outer membrane portion. In particular, the foregoing step (c) may include the additional steps of treating the Neisseria meningitidis outer membrane protein extracts with proteinase K, followed by protein fractionation using conventional chrpmatography and electrophoresis. Alternatively and preferably, the Neisseria meningitidis surface proteins of this invention may be produced by the use of molecular biology techniques, as more particularly described in Example 3 herein. The use of molecular biology techniques is particularly well- suited for the preparation of substantially pure recombinant Neisseria meningitidis 22 fcDa surface protein. Thus according to a further aspect of the invention we provide a process for the production of recombinant Neisseria meningitidis -22 kDa surface protein, including fragments, analogues and derivatives thereof, comprising the steps of (1) culfcuring a unicellular host organism transformed with a recombinant DNA molecule including a DKA sequence coding for said protein, fragment, analogue or derivative and one or more -expression control sequences operatively linked to the Dna sequence, and (2) recovering a substantially pure protein, fragment, analogue or derivative. As is well known in the art, in order to obtain high expression levels of a transfacted gene in a host, the g&ne must be operatively linked to trranscriptional and translational expression control sequences that are functional in the chosen expression host. Preferably, the expression control sequences, and the gene of interest, will be contained in an expression vector that further comprises a bacterial selection marker and origin of replication. If the expression host is a eukaryotic cell, the expression vector should further comprise an expression marker useful in the expression host. A wide variety of expression host/vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors for eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E.coli, including col El, pCRl, pBR322, pMB9 and their derivatives, wider host range plasmids, such as RP4, pnage DNAs, e.g., the numerous derivatives of phage lambda, e.g. NM989, and other DNA phages, such as M13 and -filamentous single stranded DNA phages. Useful expression vectors for yeast cells include the 2 mu plasmid and derivatives thereof. Useful vectors for inject cells include pVL 941. Ill addition, any of a wide variety of expression control sequences may be used in "these vectors to express the DNA sequences of this invention. Such useful expression control sequences include the expression control sequences associated with structural genes o£ the foregoing expression vecrtors . Examples of useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the major operator and promoter regions of phage lambda, the control regions of fd coat protein, the promoter for 3- phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, eg., pho5, the promoters of the yeast alpha-mating system and other sequences known to control expression of genes of prokaryotic and eukaryotic cells or their viruses, and various combinations thereof. The Neisseria meningitidis 22 kDa surface protein's expression control sequence is particularly useful in the expression of the Neisseria meningitidis 22 kDa surface protein in E.coli (Example 3). Host cells transformed with the foregoing vectors form a further aspect of this invention, A wide variety of unicellular host cells are useful in expressing the DNA sequences of this invention. These hosts may include well known eukaryotic and prokaryotic hosts, such as strains of S.coli, Pseudomonas, Bacillus, Streptomycea, fungi, yeast, insect cells such as Spodoptera. frugiperda (SF9), animal cells such as CHO and mouse cells, African green monkey cells such as COS 1, COS 7, BSC 1, BSC 40, and BMT 10, and human cells and plant cells in tissue culture. Preferred host organisms include bacteria such as E.coli and Bacillus subtilis and mammalian cells in tissue culture. It should of course be understood that not all vectors and expression control sequences will function equally well to express the DNA sequences of this invention. Neither will all hosts function equally well with the same expression system. However, one of skill in the art may make a selection among these vectors, expression control sequences and hosts without undue experimentation and without departing from the scope of this invention. For example, in selecting a vector, the host must be Considered because the vector must replicate in it. The vector's copy number, the ability to control that copy number and the expxession of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. In selecting an expression control sequence, a variety of factors should also be considered. "These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the DNA sequences of this invention, particularly as regards portential secondary structures . Unicellular hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the DNA sequences of this invention, their secretion characteristics, their ability to fold the protein correctly, their fermentation or culture requirements, and the ease of purification from them of the products coded for by the DMA sequences of this invention. Within these parameters, one of skill in the art may select various vector/expression control sequence/host combinations that will express the DNA sequences of this invention on fermentation or in large scale animal culture. The polypeptides encoded by the DNA sequences of this invention may be isolated from the fermentation or cell culture and purified using any of a variety of conventional methods. One of skill in the art may select the most appropriate isolation and purification techniques without departing from the scope of this invention. The Neisseria meningitidis surface proteins of this invention are useful in prophylactic, therapeutic and diagnostic compositions for preventing, treating and diagnosing diseases caused by Neisseria meningitidis infection. The Neisseria. meningitidis surface proteins of this invention are useful in prophylactic, therapeutic and diagnostic compsitions for preventing, treating and diagnosing diseases caused by Neisseria gonorrhoeae, or Neisseria. lactamica infection. The Neisseria meningitidis surface proteins according to this invention -are particularly well-suited -for the generation of antibodies and for the development of a protective response against Neisseria meningitidis diseases. The Neisseria. meningitidis surface proteins according to this invent ion are particularly well-suited for the generation of antibodies and for the development of a protective "response against Neisseria. gonorrhoeae or In particular, we provide a Neisseria meningitidis 22 kDa surface protein having an amino acid sequence of Figure 1 (SEQ ID N0:2) or a fragment, analogue, or derivative thereof for use as an iramunogen and as a vaccine. In particular, we provide a Neisseria Meningitidis 22 kDa surface protein having an amino acid sequence of Figure 1 (SEQ ID N0:2), Figure 8 (SEQ ID N0:4), Figure S (SEQ ID N0:6), or Figure 10 (SEQ ID NO;8), or a fragment, analogue, or derivative thereof for use as an imnmunogen and as a vaccine. Standard immunological techniques may be employed with the Neisseria meningitidis surface proteins in order to use them as immunogens and as vaccines. In particular, any suitable host may be injected with a pharmaceutically effective amount of the Neisserla meningitidis 22kDa surface protein to generate monoclonal or polyvalent anti- Neissrria Meningitidis antibodies or to induce the development of a protective immunological response against Neisseria Meningitidis diseases. Prior to injection of the host, the Neisseria meningritidis surface proteins may be formulated in a suitable vehicle, and thus we provide ^i pharmaceutical composition comprising one or more Neisseria Meningitidis surface antigens or fragments thereof. Preffirably, the antigen is the Neisseria meningitidis 22 kDa surface protein or fragments, analogues or derivatives thereof together with -one or more pharmaceutically acceptable excipients. As used herein,, "phannaceutically effective amount" refers to an amount of one or more Beisseria Meningitidis surface antigens or fragments thereof that elicits a Sufficient titer of anti- Neisseria. meningitidis antibodies to treat or prevent Neisseria. meningitidis infection. The Neisseria, meninitidis surface proteins of this invention may also form the basis of a diagnostic test for Neisseria meningitidis infection. Several diagnostic methods are possible- For example, this invention provides a method for the detection of Neisseria meningitidis antigen in a biological sample containing or suspected of containing Neisseria meningitidis antigen comprising; a) isolating the biological sample from a patient; b) incubating an anti-Nelsseria meningitidis 22 kDa surface protein antibody or fragment thereof with the biological sample to form a mixture; and c) detecting specifically bound antibody -or bound fragment in the mixture which indicates the presence of Neisseria meningitidis antigen. Preferred antibodies in the foregoing diagnostic method are Me-1 and Me-7. Alternatively, this invention provides a method for the detection of antibody specific to Neisseria. meningitidis antigen in a biological sample containing or susprected of containing said antibody comprising: a) isolating the biological sample from a. patient; b) incubating a eisseria mendngitidis surface protein of this invention or fragment thereof with the biological .sample to form a -mixture; and d) detecting specifically bound antigen or bound fragment in the mixture which indicates the presence of antibody specific to Neisseria meningitidis antigen. One of skill in the art will recognize that this diagnostic test may take several forms, including an imnpiDological test such as an enzyme-linked iarounosorbent assay (ELISA), a radioimmunoassay or a latex agglutination assay, essentially to determine whether antibodies specific ior the protein .are present in an. organism. The DNA sequences of this invention may also be used to design DNA probes for use in detecting the presence of the pathogenic Neisseria. bacteria in a biological suspected of containing such bacteria. The detection method of this invention comprises the steps of: a) isolating the biological sample from a patient; b) incubating a DNA probe having a UNA sequence of, this invention with the biological sample to form mixture; and c) detecting specifically bound DNA probe in the mixture which indicates the presence of Neisseria. bacteria. Preferred DNA probes have the base pair sequence of figure 1 (SEQ ID NO;1), Figure 8 (SEQ ID N0:3), figure 3 (SEQ ID NO:5), or Figure 10 (SEQ ID NO:7), or consensus sequence ot Figure 11 (SEQ ID NO:9) . A more preferred DNA. probe has the 525 base pair sequence of Figure 1 (SEQ ID NO:1). The DNA probes Of this invention may also be used for detecting circulating Neisseria meningitidis nucleic acids in a Sample, for example using a polymerase chain reaction, as a method of diagnosing Neisseria meningitidis infections. the probe may be synthesized using conventional techniques and may be immobilized on a solid phase, or may be labeled with a detectable label. A preferred DNA probe for this application is an oligomer having a sequence complementary to at least about 6 contiguous nucleotides of the Neisseria meningitidis 22 kDa surface protein gene of Figure 1 {SEQ ID NO:1), Figure 8 (SEQ ID N0:3) Figure 9 (SEQ ID NO:5), figure ID (SEQ ID NO;7), or consensus sequence of Figure 11 (SEQ ID N0:9). A more preferred DNA "probe for this application is an oligomer having a sequence complementary to at least about 6 contiguous nucleotides of the Neisseria meningitidis "22 kDa surface protein gene of Figure 1 (SEQ ID NO:1). Another diagnostic method for the detection of Neisseria meningitidis Jjn a patient comprises the steps of: a) labeling an antibody of this invention or fragment thereof with a detectable label; b) administering the labeled antibody or labeled fragment to the patient; and c) detecting specifically bound labeled antibody or labeled fragment in the patient which indicates the presence of Neisseria. meningitidis. For purification of any anti-Nelsseria meningitldis surface protein antibody, use may be made of affinity chromatography delaying an immobilized Neisseria meningitidis surface protein as the affinity medium. Thus according to another aspect of the invention we provide a Neisseria. -meningitidis 22 kDa surface protein having an amino acid sequence which includes the sequence of Figure 1 (SEQ ID N0:2), Figure 8 (SEQ ID N0:4), Figure 9 (SSQ -10 130:6), or Figure 10 -(SEQ ID N0;8), or portion thereof or an analogue thereof, covalently bound to an insoluble support. Thus according to a preferred aspect of the invention we provide a Neisseria meningitidis 22 kDa surface protein of Figure 1 (SEQ ID N0:2), or portion thereof or an analogue thereof, covalently bound to an insoluble support. A further feature of The invention is the use of the Neisseria meningitidis surface proteins of this invention as immunogens for the production of specific antibodies for the diagnosis and in particular the treatment of Neisseria meningitidis infection. Suitable antibodies may be determined using appropriate screening methods, for example by measuring the ability of a particular antibody to passively protect against Neisseria meningitidis infection in a test model. One example of an animal model is the mouse model described in the Examples herein. The antibody may be a whole antibody or an antigen-binding fragment thereof and may in general belong to any immunoglobulin class. The antibody or fragment may be of animal origin, specifically of mammalian origin and more specifically of murine rat or human origin. It may be a natural antibody or a fragment thereof, or if desired, a recombinant antibody or antibody fragment. The term recombinant antibody or antibody fragment means antibody or antibody fragment which were produced using molecular- biology techniques. The antibody -Or -antibody fragments may be of polyclona.1, or preferentially, monoclonal origin. It may be specific for a number of epitcopes associated 'Neisseria meningitidis surface proteins but it is preferably specific for one. Preferably, the antibody or fragments thereof will be specific for one or more epitopes associated with the Neiaseria menxngitidis 22 kDa surface protein, Also preferred are the monoclonal antibodies Me-1 and Me-7 described herein. EXAMPLES In order that this invention may be better understood, the following examples are set forth. These examples are for purposes of illustration only, and are not to be construed as Limiting the scope of the invention in any manner. Example 1 describes the treatment of Neisseria. meningitidis outer membrane preparation with proteolytic enzymes and the subsequent identification of the Neisseria meningitidis 22 kDa surface protein. Example 2 describes the preparation xrE. monoclonal antibodies specific for Neisseria meningititdis 22 kDa surface protein. Example 3 describes the preparation of Neisseria meningitidis recombinant 22 kDa surface protein. Example 4 describes the use of DNA probes for the identification of organisms expressing the Neisseria amnlngitidis 22 kDa surface protein. Example 5 describes the use of an anti-Neisseria meningritidis 22 kDa surface protein monoclonal antibody to protect mice against Neisseria meningitidis infection. Example describes the use of purified recombinant 22 kDa surface protean to induce a protective response against Neisseria meningitidis infection. Example 7 describes the identification of the sequence for the 22kDa protein and protein-coding gene -for other strains of Neisseria. meningitidis (MCH88, and Z4Q63), and one strain o£ Neissria gonorrhoeas. Example 8 -describes the immmunological response of -rabbits and monkeys to the 22kDa Neisseria meningitldls surface protein. Example 9 describes the procedure used to map the different immunological epitopes of the 22KDa Neisseria. meningitidis surface protein. Example 10 describes the induction by heat of -an expression vector for the large scale production of the 22 kDa surface protein. Example 11 describes a purification process for the 22kDa surface protein when produced by recombinant technology. Example 12 describes the use o£ 22kDa surface protein as a human vaccine, EXAMPLE 1 Treatment Of Neisseris meningitidis Outer Meanbrane Preparations with proteolytic Bnzymes And The Subsequent Identification Of An Enzyme Resistant Ueisseria maningitldig 22 kDa Surface Protein Several antigenic preparations derived from whole cell, lithium chloride, or sarcosyl extracts were used to study the ultrastrueture of Neisseria meningitidis outer membrane. The outer membrane of Gram negative bacteria acts as an interface between the environment and the interior of the cell and contains most of the antigens that are freely exposed to the host itnraune defense. The main goal of the study was the identification of new antigens which can induce a protective response against Neisseiria menlngitldis. One approach used by the inventors to identify such antigens, was the partial disruption of the antigenic preparations mentioned bove with proteolytic enaymes. The antigenic determinants generated by the enzymatic treatments could then be identified by the subsequent analysis of the immunological and protective properties of these treated antigenic preparations. To our surprise we observed after electrophoretic resolution of Neisseria meningitldis lithium chloride outer membrane extracts, that one low molecular weight band, which, was stained with Coomassie Brilliant Blue R-250, was not destroyed by proteolytic enzyme treatments. Coomassie Blue is used to stain proteins and peptides and has no no very little affinity for the polysaccharides or lipids which are also -key components of the outer membrane. The fact that this low molecular weight antigen was stained by Coomassie blue suggested that at least part -of it As wade up -of polypeptides that are not digested toy_proteolytic eanzymes, or that are protected against the action o£ the enzymes by other surface structures. Moreover, as demonstrated below the very potent enzyme profceinase K did not digest this low molecular weight antigen even after extensive treatments. Lithium chloride extraction was used to obtain the outer membrane preparations from different strains of Neisseria meningitidis and was performed in a manner previously described by the inventors [Brodeur et al., Infect. Immun., 50, p. 510 (1985)3. The protein content of these preparations were determined by the Lowry method adapted to membrane fractions [Lowry et al., J. Biol. chem. 193, p. 265 (1951)]. Outer membrane preparations derived from Neisseria meningitidis strain 608B (B:2a;P1.2) were treated for 24 hours at 37°C and continuous shaking with either a-chymotrypsin from bovine pancreas (E.C. 3.4.21.1) (Sigma) or trypsin type 1 from bovine pancreas (E.C, 3.4.21.4) (Sigma). The enzyme concentration was adjusted at 2 mg per mg of protein to be treated. The same outer membrane preparations were also treated with different concentrations (0.5 to 24 mg per mg of protein) of proteinase K from Tritirachium Album limber (Sigma or Boehringer Mannheim, Laval, Canada) (E.C. 3.4.21.14). In order to promote protein digestion by proteinase K, different experimental conditions were used. The .samples were incubated for 1 hour,, 2. -hours, 24 hours or 4 8 hours at 37°C or 56°C with or without shaking. The pH of the mixture samples was adjusted at either pH 7.2 or pH 9.(L One % (vol/vol) of sodium dodecyl sulfate (SDS) was also added to certain samples. Immediately after treatment the samples were resolved by SDS-PAGE gel electrophoresis using the MiniProteanll® (Bio-Rad, Mississauga, Ontario, Canada) system on 14% (wt/vol) gels according to -the manufacturer's -instructions. Proteins were heated to 100°c for 5 minutes with 2-mercaptoethanol and SDS, separated on 14% SDS gels, and stained with Coomassie Brilliant Blue R-250. Figure 2 presents the migration profile on 14% SDS- PAGE gel of the proteins present in outer membrane preparations derived from Neisseria xneningltidis strain 608B (B:2a:PI.2) after treatment at 31°C tax 24 hours with a chymotrypsin and trypsin. Extensive proteolytic digestion of the high molecular weight proteins and of several major outer membrane proteins can be observed for the treated samples {Figure 2, lanes 3 and 4) compared to the untreated control (Figure 2, lane 2) . On the contrary, a protein band with an apparent molecular weight of 22 kDa was not affected even after 24 hours of contact with either proteolytic enzyme. This unique protein was further studied using a more aggressive proteolytic treatment with Proteinase k (Figure 3). Proteinase K is one of the most powerful proteolytic enzymes since it has a low peptide bond specificity and wide pH optimum. Surprisingly, the 22 kDa protein was resistant to digestion by 2 International Units (IU) of proteinase K for 24, hours at 56°C (Figure 3, lane 2). This treatment is often used in our laboratory to produce lipopolysaccharides or DNA that are almost free of proteins. Indeed, only small polypeptides can be seen after such an aggressive proteolytic treatment of the outer membrane preparation. Furthermore, longer treatments, up to 4S hours, or higher enzyifte concentrations (up to 24 IU) did not alter the amount of the 22 kDa protein. The amount and migration on SDSPAGE gel of the 22 kDa protein were not affected when the pK of the reaction mixtures was increased to pH 9.0, or when 1.0% of SDS, a strong protein denaturant was added (Jigure 3, lanes 4, 6 and 8). The combined tise of these two denaturing conditions would normally result in the complete digestion of the proteins present in the outer membrane preparations, leaving onlyami«oacid residues. Polypeptides o± low molecular weight were often observed in the digests and were assumed to be fragments of sensitive proteins not effectively digested "during "the enzymatic treatments. These fragments were most .probably protected irom further degradation by the carbohydrates and lipids present in the outer membrane. The bands with apparent molecular weight of 28 KDa and 34 JcDa which are present in treated samples are respectively the residaai enzyme and a contaminating protein present in all enzyme preparations tested. Interestingly, this study about the resistance of the 22kDa protein to proteases indicated that another protein band with apparent molecular weight of 18kDa seems to be also resistant to enzymatic degradation (Figure 3a), Clues about this 18kDa protein band were obtained when the migration profiles on SDS-PAGE gels of affinity purified recombinant 22kDa protein were analyzed (Figure 3b) . The IS kDa band was apparent only when the affinity purified recombinant 22kDa protein was heated for an extended period of time in sample buffer containing the detergent SDS before it was applied on the gel, N-terminal amino acid analysis using the Edman degradation (Example 3) clearly established that the amino acid residues (E-g-A-S- G-F-Y-V-Q) identified on the 18 kDa band corresponded to the amino acids 1-9 (SEQ ID NO. 1). These resalts indicate that the 18 and 22kDa bands as seen on the SDSFAGE is in fact derived from the same protein. This lastresult also indicates that the leader sequence is cleaved from the mature 18 kDa protein. Further studies will be done to identify the molecular modifications explaining this shift in apparent molecular weight and to evaluate their impact on the antigenic and protective properties of the protein. in conclusion, the discovery of a Neisseria. meningitidis outer membrane protein with the very rare property of being resistant to proteolytic digestion warranted further study of its molecular and immunological characteristics. The purified recombinant 22 kDa surface protein produced by Escherichia coli in Example 3 is also highly resistant to proteinase K digestion. We are presently trying to understand the mechanism which confers to the Neisseria meningitidis 22 kDa surface protein this unusual resistance to proteolytic enzymes. EXAMPLE 2 Generation of Monoclonal Antibodies Specific for the 22 kDA Neisseria maningitidis Surface Protein The monoclonal antibodies described herein were obtained from three independent fusion experiments. Female Balb/c mice (Charles River Laboratories, st Constant, Quebec, Canada) were immunised with outer membrane preparations obtained from Neisseriameninitidis strains 604A, 608B and 2241C respectively serogrouped A, B and C. The lithium chloride extraction used to obtain these outer membrane preparations was performed in a mannerpreviously described by the inventors. {Brodeur et al., Infect. Immun, 50, p. 510 (1985)]. The .protein content of these preparations were determined by the Lowry method adapted to membrane fractions [Lowry et al., J. Biol, Chem. 193, p. 265 {1951}]. Groups ot mice were injected intraperitoneally or subcutaneously twiee, at threeweek intervale with 10 mg of different combinations of the outer membrane preparations described above. Depending on the group of mice, the adjuvants used for the immunizations were either Freund's complete or incomplete adjuvant (Gibco Laboratories, Grand Island, N.Y.), or QuilA (CedarLane Laboratories, Hornby, Ont,, Canada). Three days before the fusion Procedure, the immunised mice received a final intravenous injection of 10 mg of one of the outer membrane preparations described above. The fusion protocol used to produce the hybridoma cell lines secreting the desired monoclonal antibody was described previously by the inventors [Hamel et al., J. Med. microbiol., 25, p. 2434 (1987)]. The class, subclass and lightchain type of monoclonal antibodies Me-1, Me2, Me 3, Me-5, Me-6 and Me-7 were determined by ELISA as previously reported (Martin et al., J. Clin. Microbiol,, 28, p. 1720 (1990)] and are presented in Table 1. The specificity of the monoclonal antibodies was established using Western immunoblotting following the method previously described by the inventors [Martin et al, Eur. J, Immunol. 18, p. 601 {1988)] with the following modifications. Outer membrane preparations obtained from different strains of Neisseria meningitidis were resolved on 14% SDS-PAGE gels. The proteins were transferred from the gels to nitrocellulose membranes using a semidry apparatus (Bio—Rad), Acurrent of 60 mA per gel (6X10cm) was applied for 10 minutes in the electroblot buffer consisting of 25 mM Tris-HCl, 192 mM glycine and 20% (vol/vol) zaethanol, pH 8.3. The western immunablotting experiments clearly indicated that the monoclonal antibodies Me-1, Me-2, Me-3, Me-5, Me-6 and Me 7 .recognized their specific epitopes xm "the Neisseria meqingitldis 22 kDa protein (Figure 4A). Analysis of the SDS-PAGE gels and the corresponding Western immunoblots also indicated that the apparent molecular weight of this protein does not vary from one strain to another. However, the amount of protein present in the outer membrane preparations varied from one strain to another and was not related to the serogroup of the strain. Moreover, these monoclonal antibodies still recognized their epitopes on the Neisseria meningltidls 22 kDa surface protein after treatment of the outer membrane preparation with 2 IU of proteinase K per mg of protein (treatment described in Example 1, supra) 1 Figure 4B). Interestingly, the epitopes remained intact after the enzyme digestion thus confirming that even if they are accessible in the membrane preparation to the antibodies they are not destroyed by the enzyme treatment. This latter result suggested that the mechanism which explains the observed proteinase K resistance is most probably not related to surface structures blocking the access of the enzyme to the protein, or to the protection offered by the membrane to proteins which are deeply embedded. While not shown in Figure 4, the results of the immunoblots for Me-l were consistent with the results for the other five monoclonal antibodies. A series of experiments were performed to partially characterise the Neisseria meningitidis 22 kDa surface protein and to differentiate it from the other known meningococcal surface proteins. No shift in apparent molecular weight on SDSFAGE gel of the Neisseria meningitidis 22 kDa surface protein was noted when outer membrane preparations were heated at lOO0C for 5 minutes, or at 37°C and 56°C for 30 minutes in electrophoresis sample buffer with or without 2-mercaptoethanol. This indicated that the migration of the 22kDa surface protein, when present in the outer membrane, was not heat or 2- msrcaptoethanol-modifiable. Sodium periodate oridation was used to determine if the monoclonal antibodies reacted with carbohydrate epitopes present in the outer membrane preparations extracted from Neisseria meniugitidis organisms. T'he method used to perform this experiment was previously described by the inventors.[Martin et al., Infect. Immun., 60, pp. 27182725 (1992)]. Treatment of outer membrane preparations with 100 mM of sodium pericdate for 1 hour at room temperature did not alter the reactivity of the monoclonal antibodies toward the Neisseria. meningitidis 22 kDa surface protein. This treatment normally abolishes the binding of antibodies that are specific for carbohydrates. Monoclonal antibody 2-1-CA2 {provided by Dr. A. Bhattacharjee, Walter Reed Army Institute of Research, Washington, D.C.) is specific for the lip protein (also called H.8), a surface antigen common to all pathogenic Neisseria species. The reactivity of this monoclonal : antibody with outer membrane preparations was compared to the reactivity of monoclonal antibody Me-5. The lip- specific monoclonal antibody reacted with a protein band having an apparent molecular weight of 30 kDa, while monoclonal antibody Me5 reacted with the protein band of 22 kDa. This result clearly indicates that there is no relationship between Nelsseria meningitldis 22 kDa surface protein and thelip protein, another highly conserved outer membrane protein. To verify the exposure of the 22 kDa protein at the surface of intact Neisseria meningitidis bacterial cells, a radiointmunoassay was performed as previously described by the inventors [Proulx et al, Infec, Immun., 59, p. 963 (1991)]. Sixhour and 18hour bacterial cultures were used for this assay. The six monoclonal antibodies were reacted with 9 Neisseria meningitidis strains (the serogroup of the strain is indicated in parentheses on Figure 5), 2 Neisseria gonorrhoeas strains ("NG"), 2 Moraxella catarrhalis strains ("MC") and 2 Neisseria lactamica Strains ("NL"), The radioiuamunoassay confirmed that the epitopes recognized by the monoclonal antibodies are exposed at the surface of intact Neisseria meningitidis isolates of different serotypes and serogroups and should also be accessible to the proteolytic enzymes (Figure 5). The monoclonal antibodies bound strongly to their target epitopes on the surface of all Nelsseria meningitidis strains tested. The recorded binding values (between 3,000 to 35,000 CPM), varied from one strain to another, and with the physiological state of the bacteria, A Haemophilus influenzae porin—specific monoclonal antibody was used as a negative control for each bacterial strain. Counts below 500 CPM were obtained and subsequently subtracted from each binding value. With respect to the Neisseria meningitidis strains, tested in this assay, the results shown in. Figure 5 for monoclonal antibodies Me-5 and Me-7 are representative of the results obtained with monoclonal antibodies Me-1, Me-2, Me-3 and Me-6. With respect to the other bacterial strains tested the binding activities shown for Me7 are representative of the binding activities obtained with, other monoclonal antibodies that recognized the same bacterial strain. The antigenic conservation of the epitopes recognized by the monoclonal antibodies was also evaluated. A dot enzyme irnmunoassay was used for the rapid screening of the monoclonal antibodies against a large number of bacterial strains. This assay was performed as previously described by the inventors [Lussier et al., J. Immnoassay, 10, p. 373 (1985)]. A. collection of 71 Neisseria meniagitidis strains was used in this study. The sample included 19 isolates of serogroup A, 23 isolates of serogroup. B, 13 isolates of serogroup C, 1 isolate of serogroup 29E, 6 isolates of serogroup W-135, 1 isolate of serogroup X, 2 isolates of serogroup Y, 2 isolates of serqgroup Z, and 4 isolates that were not serogrouped ("NS"). These isolates were obtained from the Caribbean Epidemiology Centre, Port of Spain, Trinidad; Children's Hospital ,of Eastern Ontario, Ottawar Canada; Department of Saskatchewan Health, Regina, Canada; Laboratoire de Sante Publique du Quebec, Montreal, Canada; Max-Planck Institut fur Molekulare Genetik, Berlin, FRG; Montitreal Children Hospital, Montreal, Canada; Victoria General Hospital, Halifax, Canada; and our own strains collection. The following bacterial species were also tested: 16 Neisserla gonorrhoeae, 4 Neisseria cinerea, 5 Neisseria lactamica, 1 Neisseria £lava, 1 Neisseria flavescens, 3 Neisseria mucosa, 4 Neisseria perflava/sicca, 4 Neisseria perflava, 1 Neisseria sicca, 1 Neisseria subflava and 5 Moraxella catarrhalis, 1 Alcaligenes feacaliz (ATCC 87505, 1 Citrobacter freuxidii (ATCC 2080), 1 Edwarsiella tarda (ATCC 15947), 1 Snterobacter cloaca [ATCC 23355), 1 Enterobacter aercgenes (ATCC 13048), 1 Escherichia coli, 1 Flavobacterium odoratum, 1 Haemophilus inflttenzae type b (Eagan strain), X Klebsiella pneumoniae (ATCC 13883) , 1 Proteus rettgeri {ATCC 25932), 1 Proteus vulgaris (ATCC 13315), 1 Pseudomonas aeruginosa (ATCC 9027), l Salmonella byphimurium (ATCC 14028), 1 Serrati marcescens {ATCC 8100), 1 Shigrella flexneri (ATCC 12022), 1 Shigella sonnei (ATCC 9290) . They were obtained from the American Type Culture Collection or a collection held in the Laboratory Centre for Disease Control, Ottawa, Canada. The reactivities of the monoclonal antibodies with the most relevant Neisseria strains are presented in Table 1, One monoclonal antibody, Me-7, recognized its specific epitope on 100% of the 71 Neisseria meningitidis strains tested. This monoclonal antibody, as well as Me-2, Me-3, Me-5 and Me-6 also reacted with certain strains belonging to other Neisserial species indicating that their specific epitope is also expressed by other closely related Neisseriaoeae. Except for a faint reaction with one Neissera lactamica strain, monoclonal antibody Me-1 reacted only with Neisseiria meningitidis isolates. Me-1 was further tested vith another sample of 177 Neisseria meningitidis isolates and was able to correctly identify more titan 99% of the total Neisseria meningitidis strains tested. Besides the Neisseria strains presented in Table 1, the monoclonal antibodies did not react with any Of the other bacterial species mentioned above. In conclusion, six monoclonal antibodies which specifically reacted with the Neisseria meningitidis 22 kDa surface protein were generated by the inventors. Using these monoclonal antibodies we demonstrated that their specific epitopes are 1) located on a proteinase K resistant 22 kDa protein present in the outer membrane of Neisseria msnlagdtidis, 2) conserved among Neisseria. meningitidis isolates, 3) exposed at the surface of intact Neisseria meningitidis cells and accessible to antibody. and 4) the reactivity of these monoclonal antibodies with the Neisseria meningitidis 22 kDa surface protein is not modified by a treatment with sodium periodate, suggesting that their specific epitopes are not located on carbohydrates. Although we found that the migration of the Neisseria meningitidis 22kDa protein is moved to an apparent molecular weight of about 18kDa when heated under stringent conditions, we observed that the migration is not modified by 2-mercaptoethanol treatment, We also demonstrated that the Neisseria meningitidis 22 kDa surface protein has no antigenic similarity with the lip protein, another low molecular weight and highly conserved protein present in the outer membrane of Neiaseria meningitidis, As will be presented in Example 3, these monoclonal antibodies also reacted with the purified, recobinant 22 kDa surface protein produced after transformation of Escherichia coli strain BL21 (DB3) with a plasmid vector PNP2202 containing the gene coding for the Neisseria meningitidis 22 kDa surface protein. EXAMPLE 3 Molecular Cloning, Sequencing Of The Gene, Nigh Yield Exprassion And Purification Of The Nelsseria maningitidis 22 kDa Surface Protein A Molecular Cloning A LambdaGEM-11 genomic DNA library from Neisseria maningitidis strain 608B (B:2a:P1.2) was constructed according to the manufacturer's recommendations (Promega CO, Madison, WI) Briefly, the genomie DNA of the 608B strain was partially digested with Sau 3AI, and fragments ranging between 9 and 23 Kb were purified on agarose gel before being ligated to the Bam HI sites of the LambdaGEM- 11 arms. The resulting recombinant phages were used to infect Escherichia coli strain LE392 (Promega) which was then plated onto LB agar plates. Nineteen positive plaques were identified after the immuno-screening of the library with the Neisseria meninigitidis 22 kDa surface proteinspecific monoclonal antibodies of Example 2 using the following protocol. The plates were incubated 15 minutes at 20°C to harden the top agar. Nitrocellulose filters were gently applied onto the surface of the plates for 30 minutes at 4°C to absorb the proteins produced by the recombinant viral clones. The filters were then washed in PBS-Tween 0,02% (vol/vol) and immunoblotted as described previously [Lussier et al., J. Imnunoassay, 10, p. 373 (1989)]. After amplification and DNa purification, one viral clone, designated clone 8, which had a 13 Kb insert was selected for the subcloning experiments. After digestion of this clone with Sac I, two fragments of 5 and 8 Kb were obtained. These fragments were purified on agarpse gel and ligated into the Sac I restriction site of the low copy number plasmid pWKS30 [Wang and Kushner, Gene, 100, p. 195 (1991)]. The recombinant plasmids were used to transform Escherichia coli strain JK109 (Promega) by electroporation (Bio-Rad, Mississauga, Ont., Canada) following the manufacturer's recommendations, and the resulting colonies were screened with the Neisseria meningitidis 22 kDa surface proteinspecific monoclonal antibodies of Example 2. Positive colonies were observed only when the bacteria were transformed with the plasmid carrying the S Kb insert. Western blot analysis (the methodology was described in Example 2) of. the positive clones showed that the protein expressed by Escherichia coli vas complete and migrated on SDS-PAGE gel like the Neisseria meningritidis 22 kDa surface protein. To further reduce the size of the insert, a clone containing the 6 Kb fragment was digested with. Cla I and a 275 Kb fragment was then ligated into the Cla I site of the pWKS30 plasmid. V7estern blot analysis of the resulting clones clearly indicated once again that the protein expressed by Escherichia. coli was complete and migrated on SDS-PAGE gel like the native Neisseria meningitidis 22kDa surface protein. After restriction analysis, two clones, designated PNP2202 and pNP2203, were shown to carry the 2.75 Kb insert in opposite orientations and were selected to proceed with the sequencing of the gene coding for the Neisseria meningitidis 22 kDa surface protein. The "Double stranded Nested Delation Kit" from Pharmacia Biotech Inc. (piscataway, NJ) was used according to the manufacturer's instructions to generate a series of nested deletions from both clones. The resulting truncated inserts were then sequenced from the M13 forward primer present on the pWKS30 vector with the "Tag Dye Deoxy Terminator Cycle Sequencing Kit" using an Applied Biosystems Inc. {Foster City, CA) automated sequencer model 373A according to the manufacturer's recommendations B. Sequence Analysis After the insert was sequenced in both directions, the micleotide sequence revealed an open reading frame consisting of 525 nucleotides (including the stop codon) encoding a protein composed of 174 amino acid residues having a predicted molecular weight of 18,000 Daltons and a pI of 9.93, The nucleotide and deduced amino acid sequences are presented in Figure 1 (SEQ ID NO:1; SEQ ID N0:2). To confirm the correct expression of the cloned gene, the N-terminal amino acid sequence of the native 22 kDa surface protein derived from Neisseria meningitidis strain 603B was determined in order to compare it with the amino acid,sequence deduced from the nucleotide sequencing data. Outer membrane preparation derived from Neisseria meningitidis strain 608B was resolved by electrophoresis on a 14% SDS-PAGE gel and transferred onto a polyvinylidine dixluoride membrane (Millipore Products, Bedford MA) according to a previously described method [Sambrook et al., Molecular Cloning; a laboratory manual, Cold Spring Harbor Laboratory Press (1939)]. The 22 kDa protein band was excised from the gel and then subjected to Edman degradation using the Applied Biosystems Inc. (Poster City, CA) model 473A automated protein sequencer following the manufacturer's recommendations, The amino acid sequence E-G-A-S-G-F-Y-V-Q-A corresponded to amino acids 110 (SEQ ID NO:2) of the open reading frame, indicating that the Neisseria menittgltldis strain 608B, 22 kDa surface protein has a 19 amino acid .leader peptide (amino acid residues 19 to 1 of SEQ ID NO:2). A search of established databases confirmed that the Neisseria. meningitidis strain 608B, 22 kDa surf aceprotein (SEQ ID NO:2) or its gene {SEQ ID NO:1) have not been described previously. C. High Yield Expression And Purification of The Recombinant Neisaeria. aenlngitidis 22 kDa Surface Protein The following process was developed in order to maximize the production and purification of the reconibinant Neisseria meningitidis 22 kDa surface protein expressed in Escherichie coli. This process is based on the observation that the recombinant 22 3kDa surface protein produced by Escherichia coli Strain BL21(DE3) [Studier and Moffat, J. Mol. Biol., 139, p. 113 (198S)] carrying the plasmid pNP2202 can be found in large amounts in the outer membrane, but can also be obtained from the culture supernatant in which it is tne most abundant protein. The culture supernatant was therefore the material used to purify the recombinant 22 kDa protein using affinity chromatography (Figure 6A), To generate an affinity chromatography matrix, monoclonal antibodies Me-2, Me-3 and Me-5 (described in Example 2) were immobilized on CNBr-activaired sepharose 4B (Pharmacia Biotech Inc., Piscataway, NJ) according to the manufacturer's instructions. To prepare the culture supernatant, an overnight culture of EBcherichia. coli strain EL21(DE3), hcarboring the plasmid pNP2202 was inoculated in LB broth (Gibco Laboratories, Grand Island, N.Y.) containing 25 mg/ml of ampicillin (Sigma) and was incubated 4 hours at B70C with agitation. The bacterial cells were removed from the culture media by two centrifugations at 10,000 Xg for 1C minutes at 4°C. The culture supernatant was filtered onto a 0.22 mm membrane (Millipore, Bedfords, Ma) and then concentrated approrimately 100 times using an ultra filtrafcion membrane (Amicon Co., Beverly, MA) witch a molecular cut off of 10,0OC Daltons. To completely solubilize the membrane vesicles, Empigen BB (Calbiochem Co., LaJolla, CA)) was added to the concentrated culture supernatant to a final concentration of 1% (vol/vol). The suspension was incubated at room temperature for one hour, dialyzed overnight against several liters of 10 mM Tris HC1 buffer, pH 7.3 containing 005% Empigen BB(vol/vol) and centrifuged at 10,000Xg for 20 minutes at 4°C. The antigen preparation was added to the affinity matarix and incubated overnight at 4°C with constant agitation. The gel slurry was poured into a chromatography colunai and washed extensively with 10 mM TrisHCl buffer, pH 7.3 containing 0.05% Emgpigen BB (vol/vol). The recombinant 22 kDa protein was then eluted from the column with. 1 M LiCl in 10 mM Tris-HCl buffer, pH 7.3. The solution.containing the eluted protein was dialyzed extensively against several liters of 1G mM TrigHCl buffer, pH 7.3 containing 0.05% Empigen BB. Coomassie Blue and silver stained SDS Page gels [Tsai and Frasch, Analytical Biochem., 119, pp. 19 (1982)3 were used to evaluate the purity of the recombinant 22 kDa surface protein at each step of the purification process and representative results are presented in Figure 6A. Silver staining of the gels Clearly demonstrated that the purification process generated a fairly pure recombinant 22 kDa protein with only a very small quantity of Escherichia coli lipopolysaccharide. The resistance to proteolytic cleavage of the purified recombinant 22 kDa surface protein was also verified and the results are presented in Figure 6B. Purified recombinant 22 kDa surface protein was treated as described in Example 1 with a-chymotrypsin and trypsin at. 2 mg per mg of protein and with 2 IU of proteinase K per mg of protein for L hour at 37°C with constant shaking. No reduction in the amount of protein was obsexved after any of these treatments. In comparison, partial or complete digestion depending on the enzyme selected was observed for the control protein which was in this case bovine serum albumin (BSA, Sigma). Furthermore, longer periods of treatment did not result in any modification of the protein. These latter results demonstrated that transformed Escherichia coli cells can express the complete recombinant 22 kDa surface protein and that this protein is also highly resistant to the action of these three proteolytic enzymes as was the native protein found in Neisseria laeningltidis. In addition, the purified recombinant 22 kDa surface protein which is not embedded in the outer membrane of Escherichia coli is still highly resistant to the action of the proteolytic enzymss. We also verified the effect of the enzymatic treatments on tne antigenic properties of the recombinant 22 kDa protein. As determine by ELISA and Western immmoblotting, the monoclonal antibodies described in Example 2 readily recognized the recombinant 22 kDa surface protein that was purified according to the process described above (Figure 6C). Moreover, the reactivity of other 22 kDa proteinspecific monoclonal antibodies, with the purified recombinant 22 kDa surface protein was not altered by any of the enzyme treatments, thus confirming that the nntigenic properties of the recombinant 22 kDa protein seem similar to the ones described for the native protein. Important data were presented in Example 3 and can be summarized as follows: 1} the complete nucleotide and amino acid sequences of the Neisseria meningitidis 22 kDa surface protein were obtained {SEQ ID NO:1; SEQ ID N0:2); 2) N-terminal sequencing of the native protein confirmed that the Neisseriz meningitidis 22 kDa gene was indeed cloned; 3) this protein was not described previously; 4) it is possible to transform a host such as Escherichia coli and obtain expression of the reeombinant Neisseria meningitidis 22 kDa surface protein in high yield; 5) it is possible to obtain the recombinant protein, free of other Neisserie meningitidis molecules and almost free of components produced by Escherichia coli; 6) the purified reeombinant 22 kDa surface protein remains highly resistant to the action of proteolytic enzymes such as a-chymotrypsin, trypsin and proteinase K; and 7) the antigenic properties of the recombinant 22 kDa protein compare to the ones described for the native Neisseria meningitidis 22 kda surface protein. EXAMPLE 4 Molecular Conservation Of The Gene Coding for the Neisseria meaingitidia 22 kDa Surface Protein To verify the molecular conservation among Naisseria. isolates of the gene coding for the Neisseria meningitidis 22 kDa surface protein, a DMA dot blot hybridization assay was used to test different Neisseria species and ether bacterial species. First/ the 525 base pair gene coding for the Neisseria meningitidis 22 kDa surface protein was amplified by PCR, purified on agarose gel and labeled boy random priming with the non radioactive BIG DMA labeling and detection system (Boehringer Mannheim, Laval, Canada) following the manufacturer's instructions. The DNA dot blot assay was done according to the manufacturer's instructions (Boehringer Mannheim). Briefly, the bacterial strains to be tested were dotted onto a positively charge nylon membrane (Boehringer Mannheim), dried and then treated as described in the DIG System's user's guide for colony lifts. pre- hybridizations and hybridizations were done at 42°C with solutions containing 50% formamide (Sigma) . The pre hybridization solution also contained 100 mg/ml of denatured herring sperm DNA (Boehringer Mannheim) as an additional blocking agent to prevent nonspecific hybridization of the DNA probe. The stringency washes and detection steps using the chemiluminescent lumigen PPD substrate were also done as described in the DIG System'.s user's guide. For the 71 Neisseria meningitidis strains tested the results obtained with monoclonal antibody Me-7 and the 525 base pair DHA. probe were in perfect agreement. According to the results, all the Neisseria meningitidis strains tested have the Neisseris meningitidis 22 kDa strrface protein gene and they express the protein since they were all recognized by the monoclonal antibody, thus confirming that this protein is highly conserved among the Neisseria meningitidis isolates (Table 2). The DNA probe also detected the gene coding for the Neiss&rla meningritidis 22 kDa surface protein in all Neisseria gonorrhceae strains tested. On the contrary, the monoclonal antibody Me-7 reacted only with 2 out of the 16 Neisseria gronorrhoeae strains tested indicating that the specific epitope is somehow absent, inaccessible or modified in Neisseria gonorrhoeae strains, or that most of the Neisseria gronorrhoeae strains do not express the protein even if they have the coding sequence in their genome (Table 2). A good correlation between the two detection methods Was also observed for Neisseria lactamica, since only one strain of Neisseria lactamica was found to have the gene without expressing the protein (Table 2) . This result could also be explained by the same reasons presented in the last paragraph. This may indicate that, although the 22kDa is not expressed, or not accessible on the surface of Neisseria gonorrhoeas strains, the 22kDs proteincoding gene of the Neisseria gonorrhoeae and Neisseria lactamica strains may be used for construction of recombinant plasmids used for the production of the 22kDa surface protein or analogs. All such protein or analogs may be used for the prevention, detection, or diagnosis of Neisseria meningitidis. More particularly, such infections may be selected from infections from Neisseria meningitidis, Neisseria gonozrhoeae, and Neisseria Lactamica Therefore, the 22kDa surface protein or analogs, may be used for the manufacture of a vaccine against such infections. Moreover, the 22kDa protein or analogs, may be used for the manufacture of a kit for the detection or diagnosis of such infections. The results obtained with Moraxella catharralis strains showed that out of the 5 strains tested, 3 reacted with monoclonal antibody Me—7, but none of them reacted with the DNA probe indicating that the gene coding tor the Neisseria meningitidis 22 kDa surface protein is absent from the genome of these strains (Table 2). Several other Neisserial species as well as other bacterial species (see footnote, Table 2) were tested and none of them were found to be positive by any of the two tests. This latter result seems to indicate that the gene for the 22 kDa surface protein is shared only among closely related species of Neisseriacae. Table 2. Reactivity of the 525 base pair DNA probe and monoclonal antibody Me-7 with different Neisseria species The following Neisserrial species and other bacterial species were aiso tested with the two assays and gave negative results: 1 Neisseria cinerea, 1 Neisseria 1lava, 1 Neisseria flavescens, 2 Neisseria mucosa, 4 Neisseria perflava/sicca, 1Neisseria perilava, 1 N.sicca,1 N. subflava, 1 Alcaligenes feacalis (ATCC 8750), 1 Bordetella pertussis (8340), 1 Bordetelle bronchtseptica, 1 Citrobacter freundii (ATCC 2080), 1 Edwarsiella,tarda (ATCC 15947), 1 Enterobacter cfoaca (ATCC 23355), 1-Enterobacter aenoyenes (ATCCT 13048), 1 Echerichia coli, 1 Flavobacterium odoratum, 1 Haemophilus influenzae type b (Eagan strain), 1 Klebsiella pneumonia© (ATCC 13883), 1 Proteus rettgeri (ATCC 25932), 1 Proteus vulgaris (ATCC 13315), 1 Pseudomonas aetuginosa (ATCC 3027), 1 Salmonella typhimurium (ATCC 14028), 1 Serrati marcescens (ATCC 8100), 1 Shigella flexneri (ATCC .12025), 1 Shigella sonnei (ATCC 9290),and 1 Xanthomonas maltophila. In conclusion, the DNA hybridization assay clearly indicated that the gene coding for the Neisseria meningitidis 22 kDa surface protein is highly conserved among the pathogenic Neisseria. Furthermore, the results obtained clearly showed that this DNA probe could become a valuable tool for the rapid and direct detection of pathogenic Neisseria bacteria in clinical specimen. This probe could even be refined to discriminate between the Neisseria meningitidis and Veisseria gonorrhoeae. BXAMPLB 5 Bacteriolytic And protective Properties Of The Monoclonal Antibodies The bactexiolytic activity of the purified Neisseria meningitidis 22 kDa surface protein-specific monoclonal antibodies was evaluated in vitro according to a method described previously [Brodeur et al., Infect, Immun., 50, p. 510 (1985); Martin et al., Infect. Immn., 60, p. 2718 (1992)]. in the presence of a guinea pig serum complement, purified monoclonal antibodies Me1 and Me7 efficiently killed Neisseria meningitidis strain 608B, Relatively low concentrations of each of these monoclonal antibodies reduced by more than 50% the number of viable bacteria. The utilization of higher concentrations of purified monoclonal antibodies Me-1 and Me-7 resulted in a sharp decrease (up. to 99%} in the number of barteril colony forming units. Importantly, the bacteriolytic activity of these monoclonal antibodies is complement dependent, since heatinactivation of the guinea pig serum for 30 minutes at 56°C completely abolished "the killing activity. The other monoclonal antibodies did not exhibit significant bacteriolytic activity against the same strain. The combined, representative results of several experiments are presented in Figure 7, wherein the results shown for Me7 are representative and consistent with the results obtained for Me-1. The results shown for Me-2 are representative and consistent with the results obtained for the other monoclonal antibodies Me-3, Me-5 and Me—6 A mouse model of infection, which was described previously by one of the inventors [Brodeur et al, Infect. Immun., 50, p. 510 (1985); Brodeur et al., Can. J. Microbiol., 32, p. 33 (1986)] was used to assess the protective activity of each monoclonal antibody. Briefly, Balb/c mice were injected intraperitoneally with 600 ml of ascitic fluid containing the monoclonal antibodies 18 hours before the bacterial challenge. The mice were than challenged with one ml of a suspension containing 1000 colony forming units of Neisseria menigitidis strain 608B, 4% mucin (Sigma) and 1.6% hemoglobin (Sigma). The combined results of several experiments are presented in Table 3. It is important to note that only the bacteriolytic monoclonal antibodies Me-1 and Me-7 protected the mice against experimental Neissenia meningitidis infection. Indeed, the injection of ascitic fluid containing these two monoclonal antibodies before the bacterial challenge significantly increased the rate of survival of Balb/c mice to 70% or more compared to the 9% observed in the control groups receiving either 600 ial Sp2/0 induced ascitic fluld or 600 ml ascitic fluid containing unrelated monoclonal antibodies. Results have also indicated that 80% of the mice survived the infection if they were previously injected with 400 µg of protein A purified Me-7 18 hours before the bacterial challenge. Subsequent experiments are presently being done to determine the minimal antibody concentration necessary to protect 50% of the mice. Lower survival rates from 20 to 40% were observed for the other Neigseria meningitidis 22 kDa surface proteinspecific monoclonal antibodies. Table 3. Evaluation of to immumoprotective potential of the 22 kDa surface proteinspecific monoclonal antibodies against Neiseeria mmnlngitidis strain 608B (B;2a:p1.2) In conclusion, the results clearly indicated that an antibody Specific for the Neisseria meninigitidis 22 kDa surface protein can efficiently protect mice against an experimental lethal challenge. The induction of protective antibodies by an antigen is one of the most important criteria to justify further research on potential vaccine candidate. EXAMPLE 6 Immunization with Purified Recombinant 22 kDa Surface Protein Confers Protection Against Subsequent Bacterial Challenge Purified recombinant 22 kDa surface protein was prepared according to the protocol presented in Example 3, and was used to immunize Balb/c mice to determine its protective effect against challenge with a lethal dose of Neisseria meningitidis 608B (B:2a;P1.2). It was decided to use the purified recombinant protein instead of the native meningococcal protein in order to insure that there was no other meningococcal antigen in the vaccine preparation used during these experiments. The mouse model of infection used in these experiments was described previously by one of the inventors [Brodeur et a1., Infeo. Immun., 50, p. 510 (1985); Brodeur et al., Can, J. Microbiol., 32, p. 33 (1986)]. The mice were each injected subcutaneously three times at three-week intervals with 100 ml of the antigen preparation containing either 10 or 20 Jig per mouse of the purified recombinant 22 kDa surface protein. QuilA was the adjuvant used for these experiments at a concentration of 25 µg per injection. Mice in the control groups were injected following the same procedure with either 10 or 20 µg of BSA, 20 fig of concentxated culture supernatant of Escherichia. colx strain BL21(DE3) carrying the plasmid pWKS30 without the insert gene for the meningococcal protein prepared as described in Example 3, or phosphate buffered saline. Serum samples from each, mouse were obtained before each injection in order to analyze the development of the immune response against the recombinant protein. Two weetks following the third immunization the mice in all groups were injected intraperitoneally with 1 ml of a suspension containing 1000 colony forming units of Neisseria meningitidis strain S08B in 4% mucin (Sigma) and 1.6% hemoglobin (Sigma) . The results of these experiments are presented in Table 4. Eighty percent (80%) of the mice immunized with the purified recombinant 22 kDa surface protein survived the bacterial challenge compared to 0 to 42% in the control groups. Importantly, "the mice in the control group injected with concentrated Bscherichia coli culture supernatant were not protected against the bacterial challenge. This latter result clearly demonstrated that the components present in the culture media and the Escherichia coil's antigens that might be present in small amounts after purification do not contribute to the observed protection against Neisseria meningitidis. Table 4. Immunization With Purified Recombinant 22 kDa Surface Protein Confers Protection Against Subsequent Bacterial Challenga with. Neisseria meniagitidia 608B (B:2a:Pl.2) strain. CONCLUTSION The injection of purified recombinant 22 kDa surface protein greatly protected the immunized mice against the development of a lethal infection by Neisseria meningitidis exemlified by murine hybridoma cell lines producing monoclonal antibodies Me-1 and Me-7 deposited in the American Type Culture Collection in Roekville, Maryland, USA on July 21, 1995. The deposits were assigned accession numbers HB 11959 (Me-l)and HB 11958 (Me-7). EXAMPLE 7 Sequence analysis of. other strains of Neisseria meningitidis and of Neisseria. gonorrhoeae The 2,75 kb claI digested DNA fragment containing the gene coding for the 22kDa surface protein was isolated from the genomic DNA of the different strains of Neisseria meiningitidis and Neisseria gonorrhoeas as described in Example 3. a) MCH88 strain: The nucleotide sequence of strain MCH88 (clinical isolate) is presented in Figure 8 (SEQ ID N0:3). From experimental evidence obtained from strain 60SB (Example 3), a putative leader sequence was deduced corresponding to amino acid 19 to 1 (M-K-K-A-L-A-A-L-I- A-L-A-L-P-A-A-A-L-A) . A search of established databases confirmed that 22kDa surface protein from Neisseria. meningitidis strain MCH 188 (SEQ ID N0:4) or its gene (SEQ ID NO:3) have not been described previously, b) Z4063 strain: The nucleotide sequence of strain Z4063 (Wang J.F. et al. Infect. Immun., 60, p.5267 (1992)) is presented in Figure 9 (SEQ ID WO:5). From experimental evidence obtained from strain 608B (Example 3), a putative leader sequence was deduced corresponding to amino acid 19 to 1 (M-K--J-C-A-L-A-T-L-I-A-L-A-L-P-A-A-A-1-A) . A search of established databases confirmed that 22kDa surface protein from Neisserist meningitidis strain 24063 (SEQ ID NO:6) or its gene {SEQ ID NO:5) have not been described previously. c) Neisseria gonorrhoeae strain b2: The nucleotide sequence of Neisseria gonorrhceae strain b2 (serotype 1, Nat.Ref, Center for Neisseria, LCDC, Ottawa, Canada) is described in Figure 10 (SEQ ID NO: 7) . From experimental evidence obtained from strain 608B (Example 3), a putative leader sequence was deduced corresponding to amino acid 29 po 1 (M-K-k-A-L-A-A-L-I-A-L-A-L-P-A-A-A-L-A) . A search of established databases confirmed that 22kDa surface protein from Neisseria gonorrhoeae strain b2 (SEQ ID NO-8) or its gene (SEQ ID NO:7) have not been described previously. Figure 11 shows the consensus sequence established from the UNA. sequence of all four strains tested. The MCH88 strain showed an insertion of one codon (TCA) at nucleotide 217, but in general the four strains showed striking homology. Figure 12 depicts the homology between the deduced aminD acid sequence obtained from the four strains. There is greater than 90% identity between all four strains. Example 8 Immunological responds of rabbits and monkeys to the 22kDa Neisseria meningitidis surfaces protein Rabbits and monkeys were immunized with the recombinant 22kDa protein to assess the antibody response in species other than the mouse. a) Rabbits Male New Zealand rabbits were immunized with outer membrane preparations obtained from E. coli strain JMl09 with the plasmid pN2202 or with the control plasmid pWKS30 (the strain and the plasmids are described in Example 3). The lithium chloride extraction used to obtain these outer membrane preparations was performed in a manner previously described by the inventors [Brodeur et al, Infect. Immun. 50, 510 (1985)]. The protein content of these preparations were determined by the Lowry method adapted, to membrane fractions [Lowry et al, J. Biol. Chem. 193, 265 (1951)]. The rabbits were injected subcutaneously and intramuscularly at several sites twice at three week intervals with 150 µg of one of the outer membrane preparations described above. QuilA, at a final concentration of 20% (vol./vol.) (CedarLane Laboratories, Hornby, Ont., Canada), was the adjuvant used for these immunizations. The developmentof the specific humoral response was analyzed by ELISA using outer membrane preparations extracted from Neisseria meningitidis strain 608B (B:2a:P1.2) as coating antigen and by Western immunoblotting following methods already described by the inventors [Brodeur et al., Infect. Immun. 50, 510 (1985) ; Martin et al, Eur. J. Immunol. 18, 601 (1988)]. Alkaline phosphatase or peroxydase-labeled Donkey anti-rabbit immunoglobulins (Jackson ImmunoResearch Laboratories, West Grove, PA) were used for these assays. The injection of E. coli outer membrane preparation containing the 22 kDa recombinant protein in combination with QuilA adjuvant induced in the rabbit a strong specific humoral response of 1/32,000 as determined by ELISA (Figure 13). The antibodies induced after the injection of the recombinant 22 kDa protein reacted with the purified recombinant 22 kDa protein, but more importantly they also recognized the native protein as expressed, folded and embedded in the outer membrane of Neisseria. meningitidis. Western Immunoblotting experiments clearly indicated that the antibodies present after the second injection recognized on nitrocellulose membrane the same protein band as the one revealed by Mab Me-2 (describedin Example 2), wnich is specific for the 22 kDa protein, b) Monkeys Two Macaca fascicularis {cynomolgus) monkeys were respectively immunized with two injections of 100 µg (K28) and 200 µg (I276) of affinity purified recombinant 22 kDa protein per injection. The methods used to produce and purify the protein from S. colt strain BL21De3 were ^escribed in Example 3. Alhydrogel, at a final concentration of 20% (vol./vol.) (edarLane Itaboratories, Hornby, Ont., Canada), was the adjuvant used for these immunizations. The mnonkeys received two intramuscular injections at three weeks interval. A control monkey (K65) was immunized within unrelated recombinant protein preparation following the same procedures. The sera were analyzed as described above. Alkaline phosphatase or Perorydaselabeled Goat anti-human immunoglobulins (Jackson ImmunoResearch Laboratories, West Grove,. PA) were used for there accure The specific antibody response of monkey K28 which was. immunized with lO0µg of purified protein per injection appeared faster and was stronger than the one observed for monkey 1276 which was injected with 200ug of protein (Figure 14). Antibodies specific for the native 22 kDa protein as detected by western immunoblotting were already present in the sera of the imaunized monkeys twenty one days after the first injection, but were .absent in the sera of the control monkey after two injections of the control antigen. Conclusion The data presented in Examples 2 and 5 clearly showed that the injection of the recombinant 22 kDa protein can induce a protective humoral response in mice which is directed against Neisseria meningitidis strains. More importantly, the results presented in this example demonstrate that this immunological response is not restricted to only one species, but this recombinant surface protein can also stimulate the immune system of other species such as rabbit or monkey. Example 9 Epitope mapping of the 22kDa Naisseria meningitidis protein Neisseria meningitidis 22 kDa surface protein was epitope mapped using a method described by one of the inventors [Martin et al. Infect. Immun (1991): 59:1457 1464]. Identification of the linear epitopes was accomplished using 18 overlapping synthetic peptides covering the entire Neisseria meninigitidis 22 kDa protein sequence derived from strain 608B (Figure 15) and hyperimmune sera obtained after immunization with this protein. The identification of immunodominant portions on the 12 kDa protein may be helpful in the design of rtev efficient vaccines. Furthermore, the localisation of these E-cell epitopes also provides valuable informatiton about the structural configuration of the protein in the outer membrane of Neisserie meninigitidis. All peptides were synthesized by BioChem immunosystems Inc. (Montreal, Canada) with the Applied Biosystems (Foster City, Calif.) automated peptide synthesizer. Synthetic peptides were purified by reversephase high pressure .liquid chromatography. Peptides CS-845, CS-847, CS-848, CS-851, CS-852 and CS-856 (Figure 15} were solttbilized in a small volume of 6m guanidine-HCl (J.T. Baker, Ontario, Canada) or dimethyl sulforide (J.T, Baker) . These peptides were .then adjusted to 1 mg/ml with distilled water. All the other peptides were freely soluble in distilled water and were also adjusted to 1 mg/ml. Peptide enzymelinked immunosorbent assays (ELISA) were performed by coating synthetic peptides onto microtitration plates (Immnulon 4, Dynatech Laboratories Inc., Chantilly, VA) at a concentration of 50 µg/ml in 50 mM carbonate buffer, pH 9.6. After overnight incubation at room temperature, the plates were washed with phosphatebuffered saline (PBS) containing 0.05% (wt/vol) Tween 20 (Sigma Chemical Co., St.Louis, Mo.) and blocked with PBS containing 0.5% (wt/vol) bovine serum albumin (Sigma] Sera obtained from mice and monkeys immunized with affinity purified recombinant 22 kDa. surface protein were diluted and lO0µl per well of each dilution were added to the SLISA plates and incubated for 1 h at 37°c. The plates were washed three times, and 100 µl of alkaline phosphatasecorrjugated goat antimouse or antihuman immunoglobulins (Jackson immunoResearch Laboratories, West Grove, PA ) diluted according to the manufacturer's recommendations was .added After incubation for 1 h at 3700, the plates were washed and 100 µl of diethanolamine (10% (vol/vol), pH 9.8) containing pnitrophenylphosphate (Sigma) at 1 mg/ml was added. After 60 min., the reaction (l-410 nm) was read spectrophotometrically with a microplate reader. Mouse and monkey antisera obtained after immunization with aff±nity purified recombinant 21 kDa protein (Example 8) were successfully used in combination with eighteen overlapping synthetic peptides to localize B-cell epitopes on the protein. These epitopes are clustered within three antigenic domains on the protein. The first region is located between amino acid residues 51 and 86. Computer analysis using different algorithms suggested that this region has the highest probability of being immnunologically important since it is hydrophilic and surface exposed. Furthermore, comparison of the four protein sequences which is presented in Figure 12 indicates that one of the major variation, which is the insertion of one amino acid residue at position 73, is also located in this region. The antisera identified a second antigenic domain located between amino acid residues 110 and 140. Interestingly, the sequence analysis revealed that seven out of the fourteen amino acid residues that are not conserved among the lour protein sequences are clustered within this region of the protein. A third antigenic domain located in a highly conserved portion of the protein, between amino acid residues 31 and 55, was recognized only by the monkeys sera. Exanple 10 Heat-inducible expression vector for the large scale production of the 22 kDa surface protein The gene coding for the Neisseria meningitidis 22 kDa surface protein was inserted into the plasmid p629 [George et a1. Bio/technology 5: 600-603 (1987) ] . A cassette of the bacteriophage l cl857 temperature sensitive repressor gene, from which the functional Pr promoter has been deleted, is carried by the plasmid p629 that uses the PL promoter to control the synthesis of the 22kDa surface protein. The inactivation of the CI857 repressor by a temperature shift from 30°C to temperatures above 38°C results in the production of the protein encoded by the plasmid. The induction of gene expression in E. coll cells by a temperature shift is advantageous for large scale fermentation since it can easily be achieved with modern fermentors. Other inducible expression vectors usually require the addition of galactoside (IPTG) in the culture media in order to induce the expression of the desired gene. A 540 nucleotide fragment was amplified by PCR from the Nedsseria meningitidis strain. 608B genomic DNA using the following two oligonucleotide primers (OCRR8: 5' TAATAGATCTATGAAAAAAGCACTTGCCAC3' and OCRR9: 3' CACqCGCAGTTTAACTCAG&TTA-5). These primers correspond to the rmcleotide sequences found at both ends of the 22 kDa gene. To simplify the cloning of the FCR product, a Bgl II (AGATCT) restriction site was incorporated into the nucleotide sequence of these primers. The PCR product was purified on agarose gel before being digested with Bgl II. This Bgl II fragment of approrimately 525 base pairs was then inserted into the Bgl II and Bam HI sites of the plasmid p623. The plasmid containing the PCR product insert named pNP2204 was used to transform E. coli strain DH5OF'IQ. A partial map of the plasmid pNP2204 is presented in Figure 16, The resulting colonies were screened with Neisseria meningitidis 22 kDa surface protein specific monoclonal antibodies described in Example 2. Western blot analysis of the resulting clones clearly indicated that the protein synthesized by E. coli was complete and migrated an SDS-PAGE gel like the native Neisseria meningitidis 22 kDa surface protein. Plasmid DNA was purified from the selected clone and then sequenced. The nucleotide sequence of the insert present in the plasmid perfectly matched the nucleotide sequence of the gene coding for the Neisseria meningitidis 22 kDa protein presented in Figure 1. To study the level of synthesis of the 22 kDa surface protein, the temperatureinducible plasmid pNF2204 was used to transform the following E. coli strains: W3110, JM105, BL21, TOPPl, TOPP2 and T0PP3 The level of synthesis of the 22 kDa surface protein and the localization of the protein in the different cellular fractions were determined for each strain. Shake flask cultures In LB broth (Gibco BRL, Life Technologies, Grand Island, NY) indicated that a temperature shift from 3 0°C to 390C efficiently induced the expression of the gene, Time ocuroc evaluation of the level of synthesis indicated that the protein appeared, as determined on SDS-PAGE gel, as soon as 30 min after induction and that the amount of protein increased constantly during the induction period. Expression levels between 8 to 10 mg of 22 kDa protein per liter were determined for E. coll strains W3110 and TOPPl. For both strains., the majority of the 22 kDa protein is incorporated in the bacterial outer meesbrane. Example 11 Purification of the Neisaeria meningitidis 22kDa protein Since the vast majority of the 22 kDa protein is found embedded in the outer membrane of E, cell strains, the purification protocol presented in this Example is different from the one already described in Example 3 where a large amount of protein was released in the culture supernatant. An overnight culture incubated, at 3COC of either E. coli strain W3110 or T0PP1 harboring the plasmid pNP2204 was inoculated in LB broth containing 50 µg/ml of Ampicillin (Sigma) and was grown at 30°C with agitation (250 rpm) until it reached a cell density of 0.6 (l=600nm) , at which point the incubation temperature was shifted to 39°C for three to five hours to induce the production of the protein. The bacterial cells were harvested by centrifugation at 8,000 xg for 15 minutes at 4°C and washed twice in phosphate buffered saline (PBS), pH 7.3. The bacterial cells were ultrasonically broken (ballistic disintegration or mechanical disintegration with a French press may also be used). Unbroken cells were removed by centrifugation at 5,000 xg for 5 minutes and discarded. The outer membranes were separated from cytoplasrnic components by centrifugation at 100,000 xg for 1 h at 10°C. The membrane-containing pellets were resuspended in a small volume of PBS, pH 7.3. To solubilize the 22 kDa surface protein from the, membranes, detergents such as Empigen BB (Calbiochem Co., LaJolla, CA), Zwittergent3,14 (Calbiochem Co.), or b octylglucoside (Sigma) were used. The detergent was added to the membrane fraction at final concentration of 31; and the mixture was incubated for 1 h at 20°C. The non soluble material was removed by centrifugation at 100,000 xg for 1 h at 10°C. The 22 kDa protein was efficiently solubilized by either three of the detergents, however b-octylglucoside had the advantage of asily removing several unwanted membrane proteins since they were not solubilized and pould be separated from the supernatant by centrifugation. To remove the detergent, the 22 kDa containing supernatant was dialyzed extensively against several changes of PBS buffer proteinase K treatment (as in Example 1) can be used to further remove unwanted proteins from the 22kDa surface protein preparation. Differential precipitation using ammonium sulfate or organic solvents, and ultrafiltration are two additional steps that can be used to remove unwanted nucleic acid and lipopolysaccharide contaminants from the proteins before gel permeation and ionexchange chromatography can be efficiently used to obtain the purified 22 kDa protein. Affinity chromatography, as described in Example 3, can also be useS to purify the 22 kDa protein. Example 12 Use of 22kDa surface protein As a Human Vaccine To formulate a vaccine for human use, appropriate 22kDa surface protein antigens may be selected from the polypeptides described herein. For example, one of skill in the art could design a vaccine around the 22kDa polypeptide or fragments thereof containing an immunogenic epitope. The use of molecular biology techniques is particularly wellsuited for the preparation of substantially pure recombinant antigens. The vaccine composition may take a variety of forms. These include, for example, solid, semisolid, and liguid dosage forms, such as powders, liquid solutions or Suspensions, and liposomes. Based on our belief that the 22kDa surface protein antigens of this invention, may elicit a protective immune response when administered to a to those used for immunizing humans with other proteins and polypeptides, e.g. tetanus and diphteria. Therefore, the compositions of this invention will preferably comprise a pharmaceutically acceptable adjuvant such as incomplete Freund's adjuvant, aluminum hydroride, a muramyl _peptide, a water-in-oil emulsion, a liposome, an ISCOM or CTE, or a non-toxic B subunit form cholera torin. Most .preferably, the compositions will include a water-in- oil emulsion or aluminum hydroride as adjuvant. The composition would be administered to the patient in any of a number of pharmaceutically acceptable forms including intramuscular, intradermal, subcutaneous or topic, Pxeferrably, the vaccine will be administered intramuscularly. Generally, the dosage will consist of an initial injection,most probably with, adjuvant, of about 0.01 to 10 mg, land preferably 0,1 to 1.0 mg of 22kDa surface protein antigen per patient, followed most probably by one or more administered at about 1 and 6 months after the intial injection. A consideration relating to vaccine development is the question of mucosal immunity. The ideal mucosel vaccine will be safely taken orally or intranasally as one or a few doses and would elicit protective antibodies on the appropriate surfaces along with systemic inmunity. The mucosal vaccine coposition may include adjuvants, inert particulate carriers or recombinant live vectors. The anti-22kDa surface protein antibodies of this invention are useful for passive immunotherapy end immunoprophylaxis of humans infected with Neisseria meninigitidis or related bacteria such as Neisseria gonorrhoeae or Neisseria lactamica. The dosage forms and regimens for such passive immunization would be similar to those of other passive immunotherapies. An antibody according to this invention is exemplified by a hybridoma producing MAbs Me-1 or Me-7 deposited in the American Type Culture Collection in Rockville, Maryland, USA on July 21, 1995, and identified as Murine Hybridoma Cell Lines,. Me-1 and Me-7 respectively. These deposits were assigned accession numbers HB 11959 (Me1) and HB 11958 (Me-7). While we have described herein a number of embodiments of this invention, it is apparent that our basic embodiments may be altered to provide other embodiments that utilize the compositions and processes of this invention. Therefore, it will be appreciated that the scope of this invention includes all alternative embodiments and variations that are defined in the foregoing specification and by the claims appended thereto; and the invention is not to be limited by the specific embodiments which have been presented Therein by way of example. SEQUENCE T.T. STING (1) GENERAL INFORMATION: (i) APPLICANT: Brodeur, Bernard R Martin, Denis Hamel, Josee Rioux, Clement (ii) TITLE OF INVENTION: PROTEINASE It RRSISTANT SURFACE PROTEIN (iii) NUMBER OF SEQUENCES: 26 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: Goudreau Gage Dubuc & Martinaau Walker (R) STREET: 800 Place Victoria, Suite 3400, Tour de la Bourse (C) CITY. Montreal (D) STATE: Quebec (E) COUNTRY; Canada (F) ZIP: H4Z 1E9 (v) COMPUTER READABLE FORM: (A) MEDTDM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM. PC-DOS/MS-DOS ' (D) SOFTWARE: Patent In Release #1.0, Version #1.25 (Vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATS: (C) CLASSIFICATION; (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: US 08/406,362 (B) FILING DATE: 17-MAR-1995 (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: US (PROVIS)60/001,983 (B) FILING DATE: 04-AUG-1995 (viii) ATTORNEY/AGENT INFORMATION: (A) NAME: Leclerc/Dubuc/Prince, Alain/Jean/Gaetan (C) RSFSRSNCS/DOCKET NUMBER: BIOVAC-1 PCT (ix) TELECOMMUNICATION INFORMAtION: (A) TELEPHONE: 5143977400 (B) TELEFAX: 5143974382 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) length; 830 base pairs (B) TYPE: nucleic: acid (C) STRANDEDNESS; double (D) TOPOLOGY: linear [ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (Vi) ORIGINAL SOURCE: (A) ORGANISM: Neisseria meningitidiS (B) STRAIN: 608B (ix) FEATURE: (A) NAME/KEY; CDS (E) LOCATION: 143..667 (ix) FEATURE: (A) NAME/KEY: sig peptide (B) LOCATION: 143..199 (ix) FEATURE: (A) NAME/KEY: mat_peptide (B) LOCATION: 200..667 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: 37CSGCAAAGC AGCCGGATAC CGCTACGTAT CTTGAAGTAT TGAAAATATT ACGATGCAAA 60 AAAGAAAATT TAAGTATATAAT ACAGCAGGAT TCTTTAACGS ATTCTTAACA AT1TTTCTAA 120 CTGACCATAA AGGAACCAAA AT ATG AAA AAA GCA CTT GCC ACA CTG ATT GCC 172 Met Lys Lys Ala Leu Ala Thr Leu Ile ALa -19 -15 -10 CTC GCT CTC CCG GCC GCC GCA CTG GCG SAA .GGC GCA _TCC J3GC 3TT TAC 520 Leu Ala Leu Pro Ala Ala Ala Leu Ala Glu Gly Ala Ser Gly Phe Tyr 5 1 5 GTC CAA GCC GAT GCC GCA CAC GCA AAA GCC TCA AGC TCT TTA GGT TGT 26B Val Gin Ala Asp Ala Ala His Ala Lys ALa Ser Ser Ser Leu Gly Ser 10 15 20 GCC AAA GGC TTC AGC CCG CGC ATC TCC GCASSC TAC CGC ATC AAC GAC 315 Ala Lys Gly Phe Ser Pro Arg Ile Ser ALa Gly Tyr Arg Ile Asn Asp 25 30 35 CTC CGC TTC GCC GTC GAT TAC ACG CGC TAC AAA AAC TAT AAA GCC CCA 3S4 Leu Arg Phe Ala Val Asp Tyr Thr Arg Tyr Lys Asn Tyr ijvs Ala Pro 40 45 50 55 TCC AbC GAT TTC AAA CTT TAG AGC ATC GGC SCG TCC CCC ATT TAC GAC 412 Ser Thr Asp Phe Lys Leu Tyr Ser Ile Gly Ala Ser Ala Ile Tyr Asp SO 65 70 TTC GAC ACC CAA TCG CCC GTC AAA CCG TAT CTC GGC GCG CGC TTG AGC 460 Phe Asp Thr Gln Ser Pro Va1 Lys Pro Tyr Leu Gly Ala Arg Leu Ser 75 80 85 CTC AAC CGC GCC TCC GTC GAC TTG GGC GGC AEC GAC AGC TTC AGC CAA 508 Leu Asn Arg Ala Ser VaI Aap Leu Gly Gly Ser ASD Sex Phe SeT Gln 90 95 ISO ACC TCC ATC GGC CTC GGC GTA TTG ACG GGC GTA AGC TAT GCC GTT ACC 556 Thr Ser Ile Gly Leu Gly Val Leu Thr Gly Val Ser Tyr Ala Val Thr 105 110 115 CCG AAT GTC GAT TTG GAT GCC GGC 1AC CGC TAG MC TAC ATC GGC AAA 604 Pro Asn Val Asp Leu Asp Ala Gly Tyr Arg Tyr Asn Tyr IIe Gly Lys 120 125 130 135 GTC AAC ACT QIC AAA AAC GTC CGT TCC GGC GAA CEG TCC GTC GGC GTG 652 Val Asn Thr Val Lys Asn Val Arg Ser Cly Glu Leu Ser Val Gly Val 140 145 150 CGC GTC AAA TTC TGATATGCGC CTTATTCTGC AAACCGCO3A GCCTTCGGOG 704 Arg Val Lye Phe 155 GTTTTCHTrr CTGCCACCGC AACTACACAA GCCGGCGGEF TSCTACGATA ATCCCGAATG 764 CTGCGGCTTC TGCCGCCCTA TTTTTTOAGG AATCCGMAT STCCAAAACC ATCATCCACA 824 ACA 330 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 174 amino acids (B) TYPE: amino acid {D} TOPOLOGY: linear (ii) MOLECUE K TYPE: protein (xi} SEQUENCE DESCRIPTION SSQ_ID NO:2: Met Lys Lys Ala Leu Ala Thr Leu Ile Ala Leu Ala Leu Pro Ala Ala -19 -15 -10 -5 Ala Leu Ala Glu Gly Ala Ser Gly phe Tyr Val Gln Ala Asp Ala Ala 15 10 His Ala Lys Ala Ser Ser Ser Leu Gly Ser Ala Lys Gly Phe Ser Pro 15 20 25 Arg Ile Ser Ala Gly Tyr Arg Ile Asn Asp Leu Arg Phe Ala Val Asp 30 35 40 45 Tyr Thr Arg Tyr Lys Asn Tyr Lys Ala pro Ser Thr Asp Phe Lys Leu 50 55 60 Tyr Ser Ile Gly Ala Ser Ala Ile Tyr Asp Phe Asp Thr Gln Ser Pro 65 70 75 Val Lys Pro Tyr Leu Gly Ala Arg Leu Ser Leu Asn Arg Ala Ser Val 80 85 90 Asp Leu Gly Gly Ser Asp Ser Phe Ser Gln Thr Ser Ile Gly Leu Gly 95 100 105 i Val Leu Thr Gly Val Ser Tyr Ala Val Thr Pro Asn Val Asp Leu Asp 110 115 120 125 Ala Gly Tyr Arg Tyr Asn Tyr Ile Gly Lys Val Asa Thr Val Lys Asn 130 135 140 Val Arg Ser Gly Glu Leu Ser Val Gly Val Arg Val Lys Phe 145 150 155 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS; (A) LENGTH: 710 base pairs (E) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY; linear (ii) MOLECULE TYPE: DMA (genoraic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (Vi) ORIGINAL SOURCE: (A) ORGANISM: Neisseria meningitridis (B) STRAIN MCH88 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 116..643 (ix) FEATURE: {A) NAME/KEY: sig_peptide (B) LOCATION: 116. .17i! (ix) FEATURE; (A) NAME/KEY: mat_peptide (B) LOCATIONS 173..S43 (xi) SEQUENCEDESCRIPTION: SEQ ID NO:3: GTATCTTGAG GCATTSAAA TATTACAAIG CAAAAGAAA ATTTCAGIAT AATACGGCAG 60 GATTCTTTAA CGGATTCTTA ACCATTTTTC TCCCTGACCA TAAAGGAATC AAGAT ATG 118 Met 19 AAA AAA GCA CTT GCC GCA CTG AOT OCC CTC GCC CTC CCG GCC GCC GCA 166 Lys Lys Ala Leu Ala Ala Leu Ile Ala Leu Ala Leu Pro Ala Ala Ala -15 -10 -5 CTG GCO GAA GGC GCA TCC G6C TTT TAC GTC CAA GCC GAT GCC GCA CAC 214 Leu Ala Glu Gly Ala Ser Gly _Phe Tyr 3Zal GLn Ala Asp Ala Ala His 15 10 GCC AAA GCC TCA AGC TCT TTA GGT TCT GCC AAA GGC TTC AGC CCG CGC 262 Ala Lys Ala Ser Ser Ser Leu Gly Ser Ala Lys Gly Phe Ser Pxo Arg 15 20 25 3 0 AVC TCC GCA GGC TAC CGC AIC AAC GAC CTC CGC TTC GCC GTC GAT TAC 310 lie Ser Ala GLy Tyr Arg lie Asn Asp Leu Arg Phe Ala Val Asp Tyr 35 40 45 ACG CGC TAC AAA AAC TAT AAA CAA GTC CCA TCC ACC GAT TTC AAA CTT 358 Thr Arg Tyr Lys Asn Tyr Lys Gla Val Pro Ser Thr Asp Phe Lys Leu 50 55 60 TAC AGC ATC GGC GCG TCC GCC ATT TAG GAC TTC GAC ACC CAA TCC CCC 406 Tyr Ser He Gly Ala Ser Ala He Tyr Asp Phe Asp Thr Gin Ser Pro 65 70 75 GTC AAA CCG TAT CTC GGC GCG CGC TTG AGC CTC AAC CGC GCC TCC GTC 454, Val Lys Prc Tyr Leu Gly Ala Arg Leu Sar Leu Asn Arg Ala Ser Val BO 85 90 GAC TIT AAC GGC AGC GAC AGC TIC AGC CAA ACC TCC ACC GGC CTC GGC 502 Asp Phe Asn Gly Ser Asp Ser Phe Ser Gin Thr Ser Thr Cly Leu Gly 95 100 105 110 CTA TTG GCG GGC GTA AGC TAT GCC GOT ACC CCG AAT GTC GAT TTG GAT 050 Val Leu Ala Gly Val Ser Tyr Ala Val Thr Pro Asn Val Asp Leu Asp 115 120 125 GCC GGC TAG CGC TAC AAC TAC ATC GGC AAA GTC AAC ACT GTC AAA AAT 598 Ala Gly Tyr Arg Tyr Asn Tyr lie Gly Lys Val Asn Thr Val Lys Aan 130 135 140 GTC CST TCC GGC GAA CTC TCC GCC GGC GTA CGC GTC AAA TTC .TGATATACGC 650 val Arg Ser Sly Glu leu ser Ala Gly Val Arg Val Lys Phe 145 150 155 GTTATTCCGC AAACCGCCGA GCCTTTCGGC GGTTTTGIITTT TCCGCCGCCG CAACTACACA 710 (2) INFORMATION FOR SBQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 175 amino acids (B) TYPE; amino aciD (D) TOPOLOGY: linear (11) MOLSCOLE TYPE: protein (Xi) S2QU3NCB DESCRIPTION; SSQ ID NO:4: Met Lys Dys Ala Leu Ala Ala Leu Ile Ala Leu Ala Xeu Pro Ala Ala -19 -15 -10 -5 Ala Leu Ala Glu Gly Ala Ser Gly Phe Tyr Val Gin Ala Asp Ala Ala 15 10 Bis Ala Lys Ala Ser Ser ser Leu Gly Ser Ala Lys Gly The Ser Pro 15 20 25 Arg He Ser Ala Gly Tyr Arg Ile Asn Asp Leu Arg Phe Ala Val Asp 30 35 40 45 Tyr Thr Arg Tvr Lys Asn Tyr Lys Gin Val Pro Ser Thr Asp Phe Lys 50 55 60 Leu Tyr Ser He Gly Ala Ser Ala Ile Tyr Asp Phe Aso Thr Gin Ser 65 70 75 Pro Val Lys Pro Tyr Leu Gly Ala Arg Leu Ser Leu Asn Arxr Ala Ser 80 85 90 Val Asp Phe Asn Gly Ser Asp Ser Phe Ser Gln Thr Ser Thr Gly Leu 95 100 105 aly Val Leu Ala Gly Val Ser Tyr Ala, Val Thr Pro Asn Val Asp Leu 110 115 120 125 WE CLAIM: 1. An isolated polypeptide comprising an amino acid sequence at least 90% identical to any one of the amino acid sequences set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, wherein the isolated polypeptide is capable of eliciting an antibody that specifically binds to a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8. 2. The isolated polypeptide as claimed in claim 1 comprising the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6. 3. The isolated polypeptide as claimed in claim 1 comprising the amino acid sequence set forth in SEQ ID NO:8. 4. An isolated polypeptide comprising the amino acid sequence set forth in any one of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26. 5. An isolated polypeptide comprising a polypeptide fragment of the amino acid sequence set forth in any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO: 8, wherein the fragment has at least one immunogenic epitope. 6. The isolated polypeptide as claimed in claim 5, wherein the polypeptide fragment is capable of eliciting an antibody that specifically binds to a polypeptide comprising the sequence set forth in any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8. 7. An isolated polypeptide comprising the amino acid sequence set forth at (a) residue 31 to residue 55 of SEQ ID NO:2; (b) residue 51 to residue 86 of SEQ ID NO:2; or (c) residue 110 to residue 140 of SEQ ID NO:2. An isolated polypeptide encoded by a DNA sequence capable of hybridizing to the complement of a polynucleotide that comprises the nucleotide sequence set forth in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7 under stringent conditions, wherein the stringent conditions comprise hybridization at 42° C and 50% formamide, and wherein the polypeptide is capable of eliciting an antibody that specifically binds to a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8. An isolated polypeptide that is a polymeric form comprising two or more tandem polypeptide sequences, wherein the two or more polypeptide sequences are chosen from SEQ ID NO:2, SEQ ID NO.4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, residue 31 to residue 55 of SEQ ID NO:2, residue 51 to residue 86 of SEQ ID NO:2, and residue 110 to residue 140 of SEQ ID NO:2. The isolated polypeptide as claimed in any one of claims 19, wherein the polypeptide is capable of inducing an immunological response against Neisseria. The polypeptide as claimed in claim 10, wherein Neisseria is Neisseria meningitidis, Neisseria gonorrhoeae or Neisseria lactamica. The polypeptide as claimed in claim 10, wherein the isolated polypeptide is a Neisseria meningitidis protein that is free from other Neisseria meningitidis proteins. The isolated polypeptide as claimed in any one of claims 112 for use in prevention or treatment of a Neisseria infection. The isolated polypeptide as claimed in claim 13, wherein the Neisseria infection is a Neisseria meningitidis infection. The polypeptide as claimed in claim 13, wherein the Neisseria infection is a Neisseria gonorrhoeae or Neisseria lactamica infection. A method of isolating the isolated polypeptide as claimed in either claim 1 or claim 2 comprising: a) isolating a culture of Neisseria meningitidis bacteria; b) isolating an outer membrane portion from the culture of the bacteria; and c) isolating the polypeptide from the outer membrane portion. The method as claimed in claim 16, comprising treating the outer membrane portion with proteinase K. The method as claimed in claim 16, wherein the polypeptide is substantially purified from other N meningitidis proteins. The method as claimed in claim 16, wherein the polypeptide is a recombinant polypeptide. An isolated polynucleotide encoding an isolated polypeptide comprising an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8, wherein the polypeptide is capable of eliciting an antibody that specifically binds to a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8. An isolated polynucleotide comprising a polynucleotide sequence selected from a) the polynucleotide sequence set forth in SEQ ID NO: 1; b) the polynucleotide sequence set forth in SEQ ID NO:3; c) the polynucleotide sequence set forth in SEQ ID NO:5; d) the polynucleotide sequence set forth in SEQ ID NO:7; and e) a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8. An isolated polynucleotide capable of hybridizing to the complement of a polynucleotide that comprises the DNA sequence set forth in any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7 under stringent conditions, wherein the stringent conditions comprise hybridization at 42° C and 50% formamide, and wherein the isolated polynucleotide encodes an isolated polypeptide capable of eliciting an antibody that specifically binds to a polypeptide consisting of the amino acid sequence set forth in any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8. The isolated polynucleotide as claimed in claim 22, wherein the encoded polypeptide is capable of inducing an immunological response against Neisseria. The isolated polynucleotide as claimed in claim 22, wherein the isolated polynucleotide is from Neisseria meningitidis. The isolated polynucleotide as claimed in claim 22, wherein the isolated polynucleotide is from either Neisseria gonorrhoeae or Neisseria lactamica. An isolated polynucleotide comprising the DNA sequence set forth from base 143 to base 667 of SEQ ID NO:1. An isolated polynucleotide comprising the DNA sequence set forth from base 200 to base 667 of SEQ ID NO:1. An isolated polynucleotide comprising the DNA sequence set forth from base 116 to base 643 of SEQ ID NO:3. An isolated polynucleotide comprising the DNA sequence set forth from base 173 to base 643 of SEQ ID NO:3. An isolated polynucleotide comprising the DNA sequence set forth from base 208 to base 732 of SEQ ID NO:5. An isolated polynucleotide comprising the DNA sequence set forth from base 265 to base 732 of SEQ ID NO:5. An isolated polynucleotide comprising the DNA sequence set forth from base 241 to base 765 of SEQ ID NO:7. An isolated polynucleotide comprising the DNA sequence set forth from base 298 to base 765 of SEQ ID NO:7. An isolated polynucleotide comprising a DNA sequence that encodes any one of the polypeptides set forth in SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ . ID NO: 17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:26. An isolated polynucleotide comprising a DNA sequence that encodes a polypeptide comprising (a) the amino acid sequence set forth from amino acid residue 31 to amino acid residue 55 of SEQ ID NO:2; (b) the amino acid sequence set forth from amino acid residue 51 to amino acid residue 86 of SEQ ID NO:2; or (c) the amino acid sequence set forth from amino acid residue 110 to amino acid residue 140 of SEQ ID NO:2. An isolated polynucleotide comprising a DNA sequence that encodes a fragment of a polypeptide, wherein the polypeptide comprises the amino acid sequence set forth in any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, and wherein the fragment has at least one immunogenic epitope. A recombinant DNA molecule comprising the isolated polynucleotide as claimed in any one of claims 2036, wherein one or more expression control sequences is operatively linked to the polynucleotide. The recombinant DNA molecule as claimed in claim 37, wherein the one or more expression control sequences is heterologous. The recombinant DNA molecule as claimed in claim 37, wherein the one or more expression control sequences is inducible. The recombinant DNA molecule as claimed in claim 39, wherein the one or more expression control sequences is induced by a stimulus selected from temperature, lactose, and IPTG. The recombinant DNA molecule as claimed in claim 37, wherein the one or more expression control sequences is a promoter selected from X PL, X PR, TAC, T7, T3, LAC, and TRP. A unicellular host transformed with the recombinant DNA molecule as claimed irl, claim 37, wherein the unicellular host is a microorganism. The unicellular host as claimed in claim 42, wherein the unicellular host is a bacterial cell. The unicellular host as claimed in claim 43, wherein the bacterial cell is Neisseria meningitidis. The unicellular host as claimed in claim 43, wherein the bacterial cell is selected from E. coli JM109, E. coli BL21 (DE3), E. coli DH5aF'IQ, E. coli W3110, E. coli JM105, E. coli BL21, E. coli TOPP1, E. coli TOPP2, and E. coli TOPP3. The unicellular host as claimed in claim 43, wherein the bacterial cell is either E. coli JM109 or E. coli BL21 (DE3). A method for producing the isolated polynucleotide as claimed in any one of claims 2036, said method comprising culturing the unicellular host as claimed in claim 42 and isolating the polynucleotide from the host cell. A method for producing a polypeptide encoded by the isolated polynucleotide as claimed in any one of claims 2036, said method comprising culturing the unicellular host as claimed in claim 42 and isolating said polypeptide from the unicellular host. The method as claimed in claim 48, wherein the polypeptide is substantially purified from host cell contaminants. A composition comprising a pharmaceutically acceptable excipient and at least one polypeptide as claimed in any one of claims 112. The composition as claimed in claim 50, wherein the composition is a vaccine. The composition as claimed in claim 51, wherein the vaccine is formulated in a suitable vehicle. The composition as claimed in claim 51, comprising an adjuvant. The composition as claimed in claim 51, comprising a particulate carrier. The composition as claimed in claim 51, wherein the vaccine comprises a pharmaceutically effective amount of the at least one polypeptide for treating or preventing a Neisseria infection. The composition as claimed in claim 55, wherein the Neisseria infection is caused by Neisseria meningitidis. The composition as claimed in claim 55, wherein the Neisseria infection is caused by N. gonorrhoeae or N. lactamica. The composition as claimed in claim 50, wherein the polypeptide is a recombinant polypeptide. A method for producing a recombinant polypeptide encoded by the isolated polynucleotide as claimed in any one of claims 2036, said method comprising culturing a unicellular host that comprises a recombinant expression vector, wherein the recombinant expression vector comprises the polynucleotide operatively linked to one or more expression control sequences, and wherein the unicellular host is a bacterial cell. The method as claimed in claim 59, wherein the one or more expression control sequences is heterologous. The method as claimed in claim 59, wherein the one or more expression control sequences is inducible. The method as claimed in claim 59, wherein the one or more expression control sequences is induced by a stimulus selected from temperature, lactose, and EPTG. The method as claimed in claim 59, wherein the one or more expression control sequences is a promoter selected from X PL, X PR, TAC, T7, T3, LAC, and TRP. The method as claimed in claim 59, wherein the bacterial cell is selected from Neisseria meningitidis, E. coli JM109, E. coli BL21 (DE3), E. coli DH5aF'IQ, E. coli W3110, E. coli JM105, E. coli BL21, E. coli TOPP1, E. coli TOPP2, and E. coli TOPP3. The method as claimed in claim 59, comprising (a) isolating a culture of the bacterial cell; (b) isolating an outer membrane portion from said culture; and (c) isolating said recombinant polypeptide from said outer membrane portion. A method of manufacturing a vaccine comprising (a) isolating a polypeptide according to the method as claimed in any one of claims 16, 48, 59, and 65; and (b) formulating the polypeptide with a pharmaceutically acceptable excipient. The method according as claimed in claim 66, wherein the method comprises formulating the polypeptide with an adjuvant. An antibody, or antigenbinding fragment thereof, that specifically binds to the polypeptide as claimed in any one of claims 112. The antibody, or antigenbinding fragment thereof, as claimed in claim 68 which is a monoclonal antibody, or antigenbinding fragment thereof. The antibody, or antigen binding fragment thereof, as claimed in claim 69, wherein the monoclonal antibody is of murine origin or human origin. The antibody, or antigenbinding fragment thereof, as claimed in claim 70, wherein the monoclonal antibody is of an IgG isotype. A composition comprising a pharmaceutically acceptable excipient and one or more antibodies, or antigenbinding fragments thereof, as claimed in any one of claims 6871. The composition as claimed in claim 72 for treating or preventing a Neisseria infection. A method for the detection of a Neisseria meningitidis antigen in a biological sample containing or suspected of containing Neisseria meningitidis antigen comprising: a) incubating the antibody, or antigenbinding fragment thereof,, as claimed in any one of claims 6871 with the biological sample to form a mixture; and b) detecting specifically bound antibody, or an antigenbinding fragment thereof, in the mixture, which indicates the presence of Neisseria meningitidis antigen. A method for the detection of an antibody specific to a Neisseria meningitidis antigen in a biological sample containing or suspected of containing the antibody, said method comprising: a) incubating the polypeptide as claimed in any one of claims 112 with a biological sample to form a mixture; and b) detecting specifically bound polypeptide in the mixture, which indicates the presence of an antibody specific to the Neisseria meningitidis antigen. A method for detecting Neisseria bacteria in a biological sample, wherein the sample contains or is suspected of containing Neisseria bacteria, said method comprising: a) incubating a DNA probe comprising the isolated polynucleotide as claimed in any one of claims 2036 with the biological sample to form a mixture; and b) detecting specifically bound DNA probe in the mixture, which indicates the presence of Neisseria bacteria. The method as claimed in claim 76, wherein the DNA probe has a sequence complementary to at least 6 contiguous nucleotides from any one of the sequences set forth from (1) base 200 to base 667 of SEQ ID NO:1; (2) base 173 to base 643 of SEQ ID NO:3, (3) base 265 to base 732 of SEQ ID NO:5, and (4) base 298 to base 765 of SEQ ID NO:7. The method as claimed in claim 76, wherein the DNA probe has a sequence complementary to a polynucleotide encoding any one of the polypeptides set forth in SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:26. The method as claimed in either claim 77 or 78 which comprises: a) providing a set of oligomers which are primers for a polymerase chain reaction method, wherein the primers flank a target region of a polynucleotide to which the DNA probe hybridizes; and b) amplifying the target region of a polynucleotide via the polymerase chain reaction method. A method for the detection of Neisseria meningitidis in a patient, substantially as herein described, particularly with reference to the examples and accompanying drawings. Dated this 13th day of July 2001 A highly conserved, immunologically accessible antigen at the surface of Neisseria, meningitidis organisms. Immunotherapeutic, prophylactic and diagnostic compositions and methods useful in the treatment, prevention and diagnosis of Neissetria meningitidis diseases. A proteinase K resistant Neisseria meningitidis surface protein having an apparent molecular weight of 22 kDa, the corresponding nucleotide and derived amino acid sequences (SEQ ID NO:1, N0:3, NO:5, and NO:7; SEQ ID N0:2,NO:4, NO:6, and NO:8), recombinant DNA methods for the production of the Neisseria meningitidis 22 kDa surface protein, and antibodies that bind to the Neisseria meningitidis) 22 kDa surface protein. |
---|
393-CAL-2001-CERTIFIED COPIES(OTHER COUNTRIES).pdf
393-CAL-2001-CORRESPONDENCE.pdf
393-cal-2001-granted-abstract.pdf
393-cal-2001-granted-assignment.pdf
393-cal-2001-granted-claims.pdf
393-cal-2001-granted-correspondence.pdf
393-cal-2001-granted-description (complete).pdf
393-cal-2001-granted-drawings.pdf
393-cal-2001-granted-examination report.pdf
393-cal-2001-granted-form 1.pdf
393-cal-2001-granted-form 13.pdf
393-cal-2001-granted-form 18.pdf
393-cal-2001-granted-form 2.pdf
393-cal-2001-granted-form 3.pdf
393-cal-2001-granted-form 5.pdf
393-cal-2001-granted-form 6.pdf
393-cal-2001-granted-reply to examination report.pdf
393-cal-2001-granted-sequence listing.pdf
393-cal-2001-granted-specification.pdf
393-cal-2001-granted-translated copy of priority document.pdf
Patent Number | 223865 | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Indian Patent Application Number | 393/CAL/2001 | |||||||||||||||
PG Journal Number | 39/2008 | |||||||||||||||
Publication Date | 26-Sep-2008 | |||||||||||||||
Grant Date | 23-Sep-2008 | |||||||||||||||
Date of Filing | 13-Jul-2001 | |||||||||||||||
Name of Patentee | SHIRE BIOCHEM INC. | |||||||||||||||
Applicant Address | 275 ARMAND-FRAPPIER BLVD., LAVAL, QUEBEC H7V 4A7 | |||||||||||||||
Inventors:
|
||||||||||||||||
PCT International Classification Number | B61 | |||||||||||||||
PCT International Application Number | N/A | |||||||||||||||
PCT International Filing date | ||||||||||||||||
PCT Conventions:
|