| Title of Invention | NOVEL OLIGONUCLEOTIDE ANALOGS AND THE PROCESS FOR THEIR PREPARATION |
|---|---|
| Abstract | ABSTRACT 367/MASM996 Novel oligonucleotide analogs and the process for their preparation A compound of (he formula I in which the substituents are as described in the description. |
| Full Text | The present invention relates to novel oligonucleotide analogs having useful physical, biological and pharmaco¬logical properties, and to a process for their prepara¬tion. Their application relates to use as inhibitors of gene expression (antisense oligonucleotides, ribozymee, sense oligonucleotides and triplex-forming oligonucleo¬tides) , as probes for the detection of nucleic acids and as auxiliaries in molecular biology. Oligonucleotides are applied to a growing extent as inhibitors of gene expression (J. F. Hilligan, H. D. Hatteucci and J. C. Martin, J. Med. Chem. 36 (1993) 1923; E. Uhlmann and A. Peyman, Chemical Reviews 90 (1990) 543; S. T. Crooks, Annu. Rev. Pharmacol. Toxicol. 32 (1992) 329) . Antisense oligonucleotides are nucleic acid fragments whose base sequence is complementary to an mRNA to be inhibited. This target mRNA can be of cellular, viral or other pathogenic origin. Possible cellular target sequences are, for example, those of receptors, enzymes, growth factors, ixnmunomodulators, ion channels or oncogenes. The inhibition of virus replication with the aid of antisense oligonucleotides was described, for example, for RSV (rous sarcoma virus), HSV-1 and -2 (herpes simplex virus type I and XI), HIV (human immuno¬deficiency virus) and influenza viruses. In this case, oligonucleotides are employed which are complementary to the viral nucleic acid. The sequence of sense oligonucleotides is designed, however, such that they bind ("capture"), for example, nucleic acid-binding proteins or nucleic acid-processing enzymes and thus inhibit their biological activity (C. Helena and J. J. Toulme, Biochim. Biophys. Acta 1049 (1990) 99) . Viral targets which may be mentioned here are, for example, reverse transcriptase, DNA polymerase and transactivator proteins, in general, triplex-forming oligonucleotides have DNA as a target and, after binding to this, form a triple helical structure. Whereas with the aid of the antisense oligonucleotides, the processing (splicing etc.) of the mRNA or its trans¬lation into the protein are in general inhibited, triplex-forming oligonucleotides inhibit the tran¬scription or replication of the DNA (N. T. Thuong, and C. Helene, Angew. Chem. 105 (1993) 697; Uhlmann and Peyman, Chemical Reviews 90 (1990) 543). However, it is also possible to bind single-stranded nucleic acids with an antisense oligonucleotide in a first hybridization with formation of a double strand, which then forms a triplex structure in a second hybridization with a triplex-forming oligonucleotide. The antisense and triplex-binding regions can in this case either be accommodated in two separate oligonucleotides or else in one oligonucleotide. A further application of synthetic oligonucleotides are the so-called ribozymes, which destroy the target RHA as a result of their ribonuclease activity (D. Castanotto, J. J. Rossi, J. O. Deshler, Critical Rev. Eukar. Gene Expr. 2 (1992) 331). In DNA diagnosis, nucleic acid fragments with suitable labelling are employed as so-called DNA probes for the specific hybridization of a nucleic acid to be detected. The specific formation of the new double strand is in this case monitored with the aid of the labelling, which is preferably not radioactive. In this manner, genetic, malignant, viral or other pathogen-caused diseases can be detected. For most applications mentioned, oligonucleotides in their naturally occurring form are not very suitable or completely unsuitable. They must be chemically modified such that they meet the specific requirements. In order that oligonucleotides can be employed in biological systems, for example for the inhibition of virus repli¬cation, they must fulfill the following requirements: 1. They must have a sufficiently high stability under in vivo conditions, i.e. both in serum and intracellularly. 2. They must be constituted such that they can pass through the cell and nucleus membrane. 3. They must bind to their target nucleic acid in base-specific manner under physiological conditions in order to display the inhibitory effect. These requirements are not indispensable for DNA probes; however, these oligonucleotides must be derivatized such that detection is possible, for example by means of fluorescence, chemiluminescence, colorimetry or specific staining (Beck and Roster, Anal. Cheat. 62 (1990) 2258). A multiplicity of chemical variations of oligonucleotides are known which have been synthesized with the aim of fulfilling the abovementioned requirements better than the unmodified oligonucleotides. The chemical modifica¬tion of the oligonucleotides is usually carried out by appropriately modifying the phosphate backbone, ribose unit or the nucleobases (Uhlmann and Peyman, Chemical Review 90 (1990) 543). The modifications also include those in which both the phosphate bridge and the sugar unit have been replaced by other groups, for example by "morpholinonucleoside" oligomers (E. P. Stirchak et al.. Nucleic Acids Res. 17 (1989) 6129) or "PNAs" (P. E. Nielsen et al, Bioconj. Chem. 5 (1994) 3). PNAs, in particular, are distinguished by unusually high affinities for target RNA, but suffer from other unfavorable properties such as lack of solubility or deficient cell penetration (W. Wang et al., Tetrahedron Letters 36 (1995) 1181; M. Egholm et al., in "Innovation and Perspectives in Solid Phase Synthesis, Peptides, Proteins, Nucleic Acids", Roger Epton, Ed. Mayflower Worldwide Limited, Birmingham, 1994, 145-148). It is therefore an object to find novel oligonucleotide analogs having favorable properties. The invention therefore relates to compounds of the formula I wherein n is a number from zero to 100; B independently of one another is hydrogen, hydroxyl, (Cj-Cjj,,) -alkyl, (CJ^-CJ,,) -alkoxy, {C^-^) -alkylthio, (Cg-C20)-aryl, (C6-C20)-aryl-(C^-Cg)-alkyl, (C6-C20) -aryl- (C^-Cg) -alkoxy, A-B can also be a D- or L-amino acid condensed on via the carboxyl group or peptides consisting of these amino acids having a length of up to 5 amino acid residues, L independently of one another is N or ^hr*", and Rx is hydrogen or (C^-Cg) -alkyl which can be substi¬tuted by hydroxyl, (C^Cg)-alkoxy, (C^-Cg) -alkylthio or amino, preferably hydrogen or methyl; A independently of one another is a single bond, a methylene group or a group of the formula XIa or lib; y is »0, =S, -CH2, =C(CH3)2 or =NR , where R1 is as defined above; M is a single bond, -0-, -S- or -NR1-, where RL ia as defined above; R2 and R3 independently of one another are hydrogen, hydroxyl, (C^-Cg) -alkoxy, (C^-Cg)-alkylthio, amino, halogen, such as F, CI or Br, or (C^-Cg) -alkyl which can optionally be substituted by hydroxyl, (Cj^-Cg)-alkoxy or (Cj-Cg) -alkylthio, but are preferably hydrogen; p and q independently of one another are zero to 5; r and s independently of one another are zero to 5; D and G independently of one another are CR5RS; R and R6 independently of one another are hydrogen, (C^Cg)-alkyl, (C6-C20)-aryl, {CS~C20) -aryl- (Cx-C€) -alkyl, hydroxyl, iC^C^ -alkoxy, (C^Cg) -alkylthio, and alkyl and aryl can optionally be substituted by SR1 or HR1*1', where R1 is as defined above and R1' independently of R1 has the same meaning as R1, but R5 and R6 are preferably hydrogen; X is -0-, -S- or -NR1-, in which R1 is as defined above; Y is »0 or =S; Z is -OR8, -NR9R10 or X'Q", where X' is defined as X and Q" is defined as Q; R8 is hydrogen, (ci"cis) -alkyl, (C2-Cie) -alkenyl, (C3-Cia) -alkynyl, (C6-C12) -aryl, ^cs~cl2^ -»*Yl- (Cj^-Cg) -alkyl, where alkyl can be substituted one or more times by hydroxyl, (C^-C^ -alkoxy, F, CI or Br and aryl can be substituted 1-3 times by hydroxyl, (C-L-C*) -alkoxy, (Ca-C4) -alkyl, F, CI, Br, N02, -NR9R10, -C (0) OH, -C (0)0- (C^Cg) -alkyl or -C(0)NR9RltJ, but preferably is hydrogen, (C^Cg) - alkyl, (Cs-C12)-aryl or (Ci-C*) -alkyl, F, CI, Br or N02, and is particularly preferably hydrogen, (Ca-C6)-alkyl, phenyl or 2-(4- nitrophenyl)ethyl; R9 and R10 independently of one another are hydrogen, Q and Q' independently of one another are hydrogen or R8, or conjugates which favorably affect the properties of antisenae oligonucleotides or of triple helix-forming oligonucleotides or serve as a label of a DNA probe or in the hybridization of the oligonucleotide analog to the target nucleic acid attack this with binding or cross-linking, or are oligonucleotides which can be unmodified or modified, where the following variants are intended to be examples of some modifications (e.g. described in E. Uhlmann and A. Peyman, Chemical Reviews 90 (1990) 543; "Protocols for Oligonucleotides and Analogs", Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Ed, Humana Press, Totowa, USA 1993): a) complete or partial replacement of the 3'- and/or the 5'-phosphoric acid diester bridges, for example by phosphorothioate, phospborodithioate, NR4R4'-phosphor- amidate, boranophosphate, phosphate- (C1-C21) -0-alkyl ester, phosphate- t (C6-C12)aryl- (C1-C2i) -O-alkyl] ester, 2, 2,2-trichlorodimethylethylphosphonate, (C1-Cs)alkyl- phosphonate or (C6-C12) -arylphosphonate bridges, where R4 and R4' independently of one another are hydrogen, (ci"cl8J -alkyl, (C6-C20)-aryl, (C6-C14) -aryl- (C^-Cg) -alkyl or -(CH2)C- [NH(CH2)c]d-NR7R7, in which c is an integer from 2 to 6 and d is an integer from 0 to 6, and R7 independently of one another is hydrogen, (C^-Cg) -alkyl or (C1-C4)-alkoxy-(C1-C6)-alkyl, preferably R4 and R4' are hydrogen, (C^-Cg)-alkyl or methoxyethyl, particularly preferably hydrogen, {C^C^ -alkyl or methoxyethyl or R4 and R4', together with the nitrogen atom carrying them, can also form a 5 to 6-membered heterocyclic ring which can additionally contain a further heteroatom from the series consisting of O, S and N; b) complete or partial replacement of the 3' - or 5' - phosphoric acid diester bridges by "dephospho" bridges (see, for example, Uhlmann and Peyman in "Methods in Molecular Biology", Vol. 20, "Protocols for Oligonucleo¬tides and Analogs", S. Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, 355£f), for example by fornactftal, 3'-thioformacetal, methylhydroxylamine, oxime, methylene-dimethylhydrazo, dimethylenesulfone or silyl groups; c) complete or partial replacement of the sugar phosphate backbone, for example by "morpholinonucleoside" oligomers (E. P. Stirchak et al. , Nucleic Acids Res. 17 (1989) 6129) or -pNAs" (P. E. Nielsen et al, Bioconj. Chem. 5 (1994) 3), or PNA-DNA hybrids such as described, for example, in DE-P 44 08 528.1 and EP-A 0 672 677 (HOE 94/F 057) ; d) complete or partial replacement of the 0-D-2'-deoxyribose units, for example by a-V-2'-deoxyribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose, 2'-O- (C^-Cg) alkyl-ribose, 2'-O-(C2-C6)alkenylribose, 2'-NH2-2'-deoxyribose, j3-D-xylofuranose, a-arabinofuranose, 2,4-dideoxy-jB-D-erythrohexopyranose, and carbocyclic (e.g. Proehler, J.Am.Chem.Soc. 114 (1992) 8320) and open-chain sugar analogs (e.g. Vandendriessche et al.. Tetrahedron 49 (1993) 7223) or bicyclo sugar analogs (e.g. M. Tarkov et al., Helv. Chim. Acta 76 (1993) 481); e) complete or partial replacement of the natural nucleoside bases, for example by 5-(hydroxymethyl)uracil, 5-aminouracil, pseudouracil, dihydrouracil, 5- (Cj-Cg) -alkyluracil, 5- (C2-C6)-alkenyluracil, 5- (C2-C6)-alkynyl-uracil (for example described in Gutierrez et al., J. Am. Chem. Soc. 116 (1994) 540 or Sagi et al.. Tetrahedron Lett. 34 (1993) 2191), 5-(Ca-C6)-alkylcytosine, 5-(C2-C6)-alkenylcytosine, 5- (C2-Cfi) -alkynylcytosine (Gutierrez et al., J. Am. Chem. Soc. 116 (1994) 540 or Sagi et al., Tetrahedron Lett. 34 (1993) 2191), 5-fluorouracil, 5-fluorocytosine, 5 -chlorouracil, 5-chlorocytosine, 5-bromouracil, 5-bromocytosine or 7-deaza-7-substituted purines (for example described in Seela, Nuel. Acids Res. 20 (1992)2297); Heterocycles 34 (1992) 229). Q and Q' can also be conjugates which favorably affect the properties of antisense oligonucleotides or of triple helix-forming oligonucleotides (such as, for example, cell penetration, nuclease degradation, affinity for the target RNA/DNA, pharmacokinetics) or serve as a label of a DNA probe or in the hybridization of the oligonucleo¬tide analog to the target nucleic acid attacks this with binding or crosslinking. Examples of these are conjugates with poly lysine, with intercalators such as pyrene, acridine, phenazine, phenanthridine, with fluorescent compounds such as fluorescein, with crosslinkers such as psoralen, azidoproflavine, with lipophilic molecules such as (C12-C20>-alkyl, with lipids such as 1,2-dihexadecyl-rac-glycerol, with steroids such as cholesterol or testosterone, with vitamins such as vitamin E, with poly-or oligoathylene glycol, with (C12-Cia)-alkyl phosphate diesters, with -0-CH2-CH(OH)-0-(C12-C18)-alkyl. Preferred conjugates are those with lipophilic molecules such as (C12-C20) -alkyl, with steroids such as cholesterol or testosterone, with poly- or oligoethylene glycol, with vitamin E, with intercalators such as pyrene, with (C14-C18) -alkylphosphate diesters or with -0-CH2-CH(OH) -0- The preparation of oligonucleotide conjugates of this type is known to the person skilled in the art (see, for example, Uhlmann & Peyman, Chem. Rev. 90 (1990) 543; M. Hanoharan in "Antisense Research and Applications", Crooke and Lebleu, Eds., CRC Press, Boca Raton, 1993, Chapter 17, p.303ff and EP-A 0 552 766). Furthermore, the oligonucleotides can carry 3'-3'- and 5'-5'-inversions on the 3' or on the 5'-end (described, for example, in M. Koga et al., J. Org. Chem. 56 (1991) 3757). Aromatic groups are, for example, phenyl, naphthyl, pyrenyl, anthracenyl, phenanthryl, biphenyl, binaphthyl, tetracenyl, pentacenyl, hexacenyl, triphenylenyl, chrysenyl or benzopyrenyl. Heterocyclic groups are understood as meaning, for example, chromanyl, chromenylium-1-yl, furanyl. isochromanyl, isochromenyl, isoquinolyl, piperazinyl, quinolinyl, pyridinyl, pyrrolidinyl, imidazolyl, tetra-hydrofuranyl, aziridinyl, oxiranyl, thiophenyl, pyrimid-inyl, thiolanyl, thiazolyl, azepinyl, pyrrolyl, tetra-hydropyrrolyl, benzofuranyl, indolyl, isoindolyl, iaatinyl, dioxindolyl, indoxylyl, coumarinyl, coumaronyl, carbazoly1, pyrazolyl, pyrrolyl, indazolyl, oxazolyl, isoxazolyl, thiazolyl, 1,2,4-triazolyl, 1,2,3-triazolyL, tetrazolyl, pentazolyl, piperidinyl, pyridazinyl, phena-zinyl, phenoxazinyl, phenothiazinyl, morpholinyl, thia-zinyl, benzodiazepinyl, puriny1, xanthinyl, hypoxanth-inyl, theophyllinyl, theobrominyl, caffeinyl, pteridinyl, pterinyl, pterldinyl, alloxazinyl and nortropinyl. Natural nucleobases are understood as meaning, for example, uracil, cytoeine, 5-methyluracil, adenine and guanine and unnatural nucleobases are understood as meaning, for example, 5-nitroindole, 5-(hydroxymethyl)-uracil, 5-aminouracil, pseudouracil, dihydrouracil, 5-{C1-Cfi)-alkyluracil, 5-{C2-C6)-alkenyluracil, 5- 7-deaza-7- (C2-C7)-alkenyladenine, 7-deaza-7- (C^-Cy)-alkylguanine, 7-daaza-7- (C^-C,) -alkyladenine, 7-deaza-7-bromoguanine and 7-deaza-7-bromoadenine, particularly preferably 5- Among D- or L-amino acids, if not stated otherwise, particularly the following may be mentioned (cf. Schroder, Lubke, Peptides, Volume 1, New York 1965, pages XXII-XXIII; Houben-Weyl, Methoden der Organischen Chemie, [Methods of Organic Chemistry] Volume XV/1 and 2, Stuttgart 1974): Aad, Abu, yAbu, ABz, 2ABZ, eAca, Ach, Acp, Adpd, Ahb, Aib, gAib, Ala, (3Ala, £Ala, Alg, All, Ama, Amt, Ape, Apm, Apr, Arg, Asn, Asp, Asu, Aze, Azi, Bai, Bph, Can, Cit, Cys, Cyta, Daad, Dab, Dadd, Dap, Dapm, Dasu, Djen, Dpa, Dtc, Fel, Gin, Glu, Gly, Guv, hAla, hArg, hCys, hGln, hGlu, His, hlle, hLeu, hLys, bHet, fcPhe, hPro, hSer, hThr, hTrp, hTyr, Hyl, Hyp, 3Hyp, lie, Ise, Iva, Kyn, Lant, Lcn, Leu, Lsg, Lys, /SLys, ALye, Met, Mim, Min, hArg, Nle, Nva, Oly, Orn, Pan, Pec, Pen, Phe, Phg, Pic, Pro, APro, Pse, Pya, Pyr, Pza, Qin, Ros, Sar, Sec, Sem, Ser, Thi, 0Thi, Thr, Thy, Thx, Tia, Tie, Tly, Trp, Trta, Tyr, Val etc., whose abbreviations without a stereo-descriptor stand for the radical in the L-form, or alternatively cyclic amino acids, such as pyrrolidine-2-carboxylic acid; piperidine-2-carboxylic acid; 1,2,3,4-tetrahydroiooquinoline-3-carboxylic acid; decahydroisoquinoline-3-carboxylic acid; octahydroindole- 2-carboxylie acid; decahydroquinoline-2-carboxylic acid; octahydrocyclopenta[b]pyrrole-2-carboxylie acid; 2-azabicyclo[2.2.2]octane-3-carboxylie acid; 2-azabicyclo [2.2.1]heptane-3-carboxylie acid; 2-azabicyclo [3.1.01-hexane-3-carboxylic acid; 2-azaspiro[4.4]nonane-3-carboxylic acid; 2-azaspiro [4.5]decane-3-carboxylic acid; spirot (bicyclo [2.2.1]heptane) -2, 3-pyrrolidine-5-carboxyl¬ic acid]; epiro [ (bicyclo[2 .2.2]octane) -2,3-pyrrolidine-5-carboxylic acid]; 2-azatricyclo[4.3.0.16,9]decane-3-carboxylic acid; decahydrocyclohepta [b]pyrrole-2-carboxylic acid; decahydrocycloocta[b]pyrrole-2-carboxylic acid; octahydrocyclopentatc]pyrrole-2-carboxylic acid; octahydroisoindole-1-carboxylic acid; 2,3,3a,4,6a-hexahydrocyclopenta[b]pyrrole-2-carboxylic acid; 2,3,3a,4,5,7a-hexahydroindole-2-carboxylic acid; tetrahydrothiazole-4-carboxylic acid; isoxazolidine-3-carboxylic acid; pyrazolidine-3-carboxyl¬ic acid; hydroxypyrrolidine-2-carboxylic acid; all of which can be optionally substituted: US-A 4,344,949, US-A 4,374,847, US-A 4,350,704, EP-A 29 488, EP-A 31 741, EP-A 46 953, EP-A 49 605, EP-A 49 658, EP-A 50 800, EP-A 51 020, EP-A 52 870, EP-A 79 022, EP-A 84 164, EP-A 89 637, EP-A 90 341, EP-A 90 362, EP-A 105 102, EP-A 109 020, EP-A 111 873, EP-A 271 865 and EP-A 344 682. Alkyl and radicals derived therefrom such as alkoxy and alkylthio can be branched, unbranched or cyclic, saturat¬ed or mono- or polyunsaturated. Preferred compounds of the formula I are those wherein a is a number from zero to 50; B independently of one another is a natural nucleobase or an unnatural nucleobase; L is N; A is a group of the formula lib, in which r = 1 and s is zero, and R2, R3 = H and Y' = 0 and M is a single bond; D and G independently of one another are CHR5; R5 is hydrogen; X is -0-; Y is -0; Z is hydroxyl, methoxy, ethoxy, (4-nitrophenyl)ethoxy, propoxy, isopropoxy, butoxy, pentoxy, phenoxy or allyloxy; Q and Q' independently of one another are hydrogen, RB or oligonucleotides which can be unmodified or modified, where a) the 3' - and/or 5'-phosphoric acid diester bridges are completely or partially replaced by phosphoro-thioate, phosphorodithioate, NR4R4' -phosphoramidate, N3' -*P5' -phosphoramidate (for example described in Gryaznov et al., J. Am. Chem. Soc. 116 (1994) 3143), phosphate 0-methyl ester, phosphate 0-ethyl ester, phos- phate O-isopropyl eater, methylphosphonate or phenylphosphonate bridges; b) one, two or three 3'- or 5'-phosphoric acid diester bridges in the pyrimidine positions and at the 5'-end and/or at the 3'-end are replaced by fonnacetals and/or 3'-thioformacetals; c) the sugar phosphate backbone is completely or partially replaced by "PNAB" or PNA-DNA hybrids; d) the /3-D-2' -deoxyribose units are completely or partially replaced by 2'-P-2'-deoxyribose, 2'-0-(C^-Cg) -alkylribose, 2' -0- n is a number from 0 to 30; Q and Q' independently of one another are hydrogen, R8, in which R8 is H, (C^-Cg) -alkyl, phenyl or 2-(4-nitrophenyl)ethyl, or are oligonucleotides which can be unmodified or modified, where a) the 3'- and/or 5'-phosphoric acid diester bridges are completely or partially replaced by phoaphoro thioate, phosphorodithioate or methylphosphonate bridges; b) one, two or three 3'- or 5-phosphoric acid diester bridges are replaced at the 5'- and at the 3'-end; c) the sugar phosphate backbone is completely or partially replaced by "PNAs" or PNA-DNA hybrids; d) the fi-D-2'-deoxyribose units' are completely or partially replaced by 2'-F-2'-deoxyribose, 2'-0-(C^-C^)-alkylriboee, 2'-0- (C2-C4)alJcenylribose or 2'-NH2-2'-deoxyribose; e) the natural nucleoside bases are completely or partially replaced by 5-(C3-C6)-alkyluracil, 5-(C2-C6)-alkenyluracil, 5- (C2-Cs) -alkynyluracil, 5- (C^-Cg) -alkyl-cytosine, 5- (C2-C6)-alkenylcytosine, 5-{C2-C6)-alkynyl-cytosine, 7-deaza-7- {C2-C7) -alkynylguanine, 7-deaza-7-(C2-C7) -alkynyladenine, 7-deaza-7- (C2-C7) -alkeaylguanine, 7-deaza-7- (C2-C7) -alkenyladenine, 7-deaza-7- (C^C,) -alkylguanine, 7-deaza-7- (C1-C7) -alkyladenine, 7-deaza-7-bromoguanine, 7-deaza-7-bromoadenine. Very particularly preferred compounds of the formula I are those in which n is a number from 0 to 25; B independently of one another is a natural nucleo-base; Z is hydroxyl, ethoxy, (4-nitrophenyl)ethoxy or phe-noxy; Q and Q' independently of one another is hydrogen, R8, in which Rfl is H, (C^-CgJ-alkyl, phenyl or 2-(4-nitro¬phenyl) ethyl, or are oligonucleotides which can be unmodified or modified, where a) the 3' - and/or 5'-phosphoric acid diester bridges are completely or partially replaced by phosphorothioate bridges; c) the sugar phosphate backbone is completely or partially replaced by "PNAa" or PNA-DHA hybrids; d) the /3-D-2' -deoxyriboae units are completely or partially replaced by 2'-0-methyl, 2'-0-allyl or 2'-0-butylribose; e) the natural nucleoside bases are completely or partially replaced by 5-hexynylcytosine, 5-hexynyluracil, 5-hexynylcytosine, 7-deaza-7-propynylguanine, 7-deaza-7-propynyladenine, 7-deaza-7-methylguanine, 7-deaza-7-methyladenine, 7-deaza-7-bromoguanine, 7-deaza-7-bromo-adenine. The invention further relates to compounds of the formula I in which Q and Q' are linked, i.e. form a cyclic molecule, where the possibility should still apply that Q and Q' together afford a single bond. The synthesis of such compounds can be carried out analogously to described processes, for example Gao et al., Nucl. Acids Res. 23 (1995) 2025 or Wang and Kool, Nucl. Acids Res. 22 (1994) 2326. The invention further relates to oligonucleotides or modified oligonucleotides, for example PNAs, in which compounds of the formula I are incorporated at the 3'-end or at the 5'- end or at the 5'- and at the 3'-end. The linkage of the oligonucleotides with the compounds of the formula I is preferably carried out via the 5'- or 3'-hydroxy1 group of the nucleotide units, likewise via a phosphonic acid mono©star bond. The linkage with oligo¬nucleotides is illustrated by way of example in the formulae XVIII and XIX. R17 is H, OH, F, 2' -0- (Ci-Cg) -alkyl or 2' -O- (C2-C6) -alkenyl, preferably H or methoxy or 0-allyl, particularly preferably H. All other variables are illustrated above. Formula XX and formula XXI, in which the variables have the above meaning, illustrate by way of example the linkage with PNAs. The combinations of the compounds of the formula I according to the invention (abbreviated PMENA ifQandQ' = H) with oligonucleotides or modified oligonucleotides, for example PNAs or other modifications, as are described above, will be schemati¬cally illustrated again (OLIGO is unmodified or modified oligonuleotides): Examples of such combinations are: 5'- OLIGO - PMENA 5'- PMENA - OLIGO 5'- OLIGO - PMENA - OLIGO Further, may be mentioned : 5'- OLIGO - (PMENA - OLIGO)a {a - 1-20) 5'- PMENA - OLIGO - PMENA 5'- PMENA - (OLIGO - PMENA)a (a - 1-20) The synthesis of these combined compounds is carried out in such a way that, according to the molecule, the synthesis of the PMENA units, which is described in the following, is begun first, which are then coupled with the oligonucleotide units. In this process, the oligo¬nucleotides are coupled as monomer units or by block condensation by solid-phase synthesis or by solution synthesis by methods known to the person skilled in. the art (Sonveaux, Bioorganic Chemistry 14 (1986) 274ff), The condensations are alternatively carried out by the amidite method, the H-phosphonate method or the phosphorotriester process (Sonveaux, Bioorganic Chemistry 14 (1986) 274ff). If, conversely, PMENA units are coupled to OLIGO units, this is preferably carried out by the method described in f±). Conjugation with PNA units is carried out in the same manner or, if (monomeric or oligomeric) PNA units are coupled to PMENA units, with the methods of peptide synthesis or of ester synthesis known to the person skilled in the art. The invention furthermore relates to a process for the preparation of compounds of the formula I, which compris¬es ax) reacting compounds of the formula III in which D, G, L and X have the abovementioned meanings and S1 is a suitable protective group, such as dimethoxy-trityl, monomethoxytrityl, trityl, pixyl, tert-butoxycarbonyl or fluorenylmethoxycarbonyl, pref¬erably monomethoxytrityl or tert-butoxycarbonyl, with compounds of the formula IV in which R5 and R6 have the abovementioned meanings, in a suitable organic solvent, for example in methanol, ethanol, isopropanol, butanol, acetonitrile, dichloro-methane (DCM), chloroform, benzene, dimethylformamide (DMF), dimethyl sulfoxide (DHSO), diethyl ether, ethyl acetate (EA), tetrahydrofuran (THF), N-methylpyrrolidone, petroleum ether, xylene or toluene or mixtures of suitable solvents, preferably in methanol or ethanol, at temperatures from 0°C to 100°C, preferably at 10 to 50°C, to give compounds of the formula Va or Vb where, in the choice of the reaction conditions which are known to the person skilled in the art (e.g. in S.R. Sandler, W. Karo "Organic Functional Group Prepara¬tions'1, Vol. II, Second Edition, Academic Press, London, 1986, Chapter 12 ("Imines") } , care is to be taken that they are compatible with the protective group S1, i.e. if, for example, an acid-labile protective group such as the monomethoxytrityl protective group is chosen, no acid should be added during the reaction, bx) reacting compounds of the formula Va or Vb with compounds of the formula Via or VIb, preferably with compounds of the formula Via in which Y is as defined above, X' and X" independently of one another are defined as X, S2 and S3 independently of one another are protective groups such as methyl, ethyl, phenyl, 2-chloro-phenyl, 2,5-dichlorophenyl, 2,4-dichlorophenyl, 4 -nitrophenyl, 4-methoxyphenyl, 2-cyanoethyl, 2-(4-nitrophenyl)ethyl, allyl, benzyl, 2,2,2-tri-chloro-1,1-dimethylethyl, 4-methoxybenzyl, 2,2,2-trichloroethyl, 8-hydroxyquinoline or other phosphate protective groups, such as are known to the person skilled in the art (Sonveaux, Bioorganic Chemistry 14 (1986) 274 f f), but preferably methyl, ethyl, phenyl, 2-(4-nitropheayl)ethyl, allyl or 2,2,2-trichloroethyl, and L1 is a leaving group, preferably (Cj-C^) -alkyl, in a suitable organic solvent, for example in methanol, ethanol, isopropanol, butanol, acetonitrile, benzene, DMP, DMSO, DCH, EA, chloroform, diethyl ether, THF, N-methylpyrrolidone, petroleum ether, xylene or toluene or mixtures of suitable solvents, preferably in THF, at temperatures from 0°C to 100"C, preferably at 50 to 80°C, if appropriate with addition of bases, such as tri-(Cx-Cg) -alkylamine, H-alkylmorpholine, pyridine, N,N-dimethylaminopyridine, butyllithium, lithium diisopropylamide (LDA), sodium hydride, sodium amide. potassium carbonate, cesium carbonate, potassium tert-butoxide or complex bases such as sodium amide-R11ONa, where R11 is (C2-C6)-alkyl or CI^CHJ-O-CHJJCHJ, or uncharged, peralkylated polyaminophosphazene bases (Schwesinger, Hachr. Cham. Techn. Lab. 38 (1990) 1214; Angew. Chem. 99 (1987) 1212), but preferably without addition of base, to give compounds of the formula VII in which D, G, L, R5, R6, 81, S2, S3, X, X', X" and Y are as defined above; cL) reacting compounds of the formula VII with compounds of the formula VIII whose synthesis is described, for example, in Dueholm et al., J. Org. Chem. 59 (1994) 5767 and in which A has the abovementioned meaning, BPR has the same meaning as B, but is optionally present in protected form, i.e. if B is a natural or unnatu¬ral nucleobase, BPR is the nucleobases whose amino or hydroxyl groups are protected by suitable known protective groups, such as the para-nitrophenylethyl group, the benzoyl group, the allyl group and the para-(t-butyl)benzoyl group for the hydroxyl group and the acetyl, benzoyl, para-(t-butyl)benzoyl. para- (methoxy) benzoyl group, para-nitropnenylethoxy-carbonyl group, isobutyryl group, para-(t-butyl)-phenylacetyl group, N,N-dimethylformamidino group, fluorenylmethyloxycarbonyl group, benzyloxycarbonyl group or phenoxyacetyl group for the amino group or other protective groups customary for nucleobases in oligonucleotide chemistry (Sonveaux, Bi©organic Chemistry 14 (1986) 274ff; Beaucage, Tetrahedron 49 (1993) 2223£f) , preferably the following may be mentioned for BPR: in which R12 is hydrogen, 1-propynyl, 1-butynyl, 1-pentynyl or 1-hexyny1, in particular hydrogen, 1-propynyl or 1 -hexynyl; and R13 is hydrogen, diphenylcarbamoyl or 2-(4-nitrophenyl)-ethyl and R14 is acetyl, benzoyl, para-(t-butyl)benzoyl, para-(methoxy)benzoyl, para-nitrophenylethyloxycarbonyl, isobutyryl, para-(t-butyl)phenylacetyl, benzyloxy¬carbonyl or phenoxyacetyl, and L2 is a leaving group known to the person skilled in the art, such as CI, Br, O-S02methyl, 0-SO2tri-fluoromethyl, O-tosylate or 0-C6F5 or, if A has the meaning of formula lib, can also be OH; in a suitable organic solvent/ for exan.ple in aceto-nitrile, benzene, DMF, DMSO, DCM, EA, chloroform, diethyl ether, tetramethylurea, THF, N-methylpyrrolidone, petroleum ether, xylene or toluene or mixtures of suit¬able solvents, preferably in DM7, at temperatures from -20°C to 100°C, preferably at 0 to 50°C, if appropriate with addition of bases, such as tri- (C^-Cg) -alkylamine, N- alkylmorphol ine, pyridine, N, N- dime thylaminopyr idine, butyllithium, lithium diisopropylamide (LDA), sodium hydride, sodium amide, potassium carbonate, cesium carbonate, potassium tert-butoxide or complex bases such as sodium amide-R^ONa, where R11 is (C2-Cfi)-alkyl or CH3CH2-0-CH2CH3 or uncharged, peralfcylated polyarnino-phosphazene bases (Schwesinger, Nachr. Chem. Techn. Lab. 38 (1990) 1214; Angew. Chem. 99 (1967) 1212), if A is formula lib and L2 is OH, preferably with addition of triethylamine, diisopropylethylamine or N-ethylmorpholine or without addition of base and with addition of a coupling reagent customary for the coupling of peptide bonds, to give compounds of the formula IX dx) removing the protective group S3 from compounds of the formula XX by known processes (e.g. Greene, Wits, Protective Groups in Organic Synthesis, J. Wiley & sons. New York 1991) for example, for compounds of the formula IX, in which S2 and S3 are 2-(4-nitrophenyl) ethyl, by treatment with 0 . 1M 1,8-diazabieyclo [5.4.0] undec-7-ene (DBU) in pyridine or acetonitrile at room temperature or for compounds of the formula IX in which S2 and S3 are phenyl or ethyl, by treatment with an aqueous ammonia or for compounds of the formula IX in which S2 is 2-(4-nitrophenyl)ethyl and S3 is allyl, by treatment with Pd[P(C6H5)3] 4 and triphenylphosphine in OCH (Hayakawa et al., J. Org. Cham. 58 (1993) 5551), or for compounds of the formula IX in which S2 is 2- (4-nitrophenyl)ethyl and S3 is allyl, by treatment with 0.5M DBU in pyridine or acetonitrile or for compounds of the formula IX in which S2 is 2-cyanoethyl and S3 is allyl, by treatment with triethylamine in pyridine, or for compounds of the formula IX in which S2 is 2- (4-nitrophenyl) ethyl and S3 is 2,2,2-trichloro-1,1-dimethylethyl, by treatment with tributylphosphine, compounds of the formula X being obtained ex) removing the protective group S1 from compounds of the formula IX by known processes (e.g. Greene, Wuts, Protective Groups in Organic Synthesis, J. Wiley & Sons, Hew York 1991, Sonveaux, Bioorganic Chemistry 14 (1986) 274 ff), thus, for example, the monomethoxytrityl protec¬tive group is removed by treatment with acid, for example by treatment with 80% acetic acid, with 1-4% dichloro-acetic acid in methylene chloride or chloroform, with 2% p- toluenesulfonic acid in DCH/methanol or by treatment with 1% trifluoroacetic acid in chloroform, compounds of the formula XI obtained £1) reacting compounds of the formula XI with compounds of the formula X according to the "phosphotriester process" known from oligonucleotide chemistry (Sonveaux, Bioorganic Chemistry 14 (1986) 2744ff, Reese, J. Chem. Soc. Parkin Trans. 1993, 2291ff) in a suitable organic solvent, such as acetonitrile, benzene, DMF, DMSO, DCM, EA, chlorofrom, diethyl ether, tetramethylurea, THF, N-methylpyrrolidone, petroleum ether, xylene or toluene or mixtures of suitable solvents, preferably in pyridine, at temperatures from -20°C to 100°C, preferably at 0 to 50 °C, with addition of a coupling reagent, such as 6 -ni trobenzotriazol-1 -yloxy tris (dimethylamino) phosphonium hexafluorophosphate (NBOP, Hashmi, Nucleosides & Nucleo¬tides 13 (1994) 1059), benzotriazole-1-yloxytris (dimethylamino)phosphonium hexafluorophosphate (BOP, B, Castro, J.R. Dormoy, 6. Evin and C. Salve, Tetrahedron Lett. 1975, 1219-1222), benzotriazol-1-yloxytripyrrolid-inophosphonium hexafluorophosphate (PyBOP, J. Coste, D. Le-Nguyen and B. Castro, Tetrahedron Lett. 1990, 205-208) , O-(7-aza)benzotriazol-l-yltetramethyluronium hexafluorophosphate (HATU, L. Carpino, J, Am. Chem. Soc. 1993, 115, 4397), N,N-bis[2-oxo-3-oxazolidinyl]diamino-phosphoryl chloride (Katti, Tetrahedron Lett. 26 (1985) 2547), 2-ehloro-5,5-dimethyl-2-oxo-1,3,2-dioxaphosphorin¬ane (Stawinski, Nucl. Acids Res., Symp. Ser. 24, 1991, 229) or a compound of the formula XII in which R15 is (C6-C12) -aryl, optionally substituted one to four times by (C^-Cg) -alkyl, (Cx-Cfi) -alkoxy, nitro, chlorine or bromine and where one to 3 carbon atoms are optionally substituted by heteroatoms, preferably nitrogen, i.e. for example phenyl, tolyl, 2,4,6 -tr imethylphenyl, 2,4,6-triiBopropylphenyl, 2,3,5,6-tetramethylbenzene (Losse, Liebigs Ann. Chem. 1989, 19ff), 4-bromobenzene, 2-nitrobenzene, 4-ni trobenzene or 8-quinolyl, preferably 2,4,6-trimethylphenyl or 2,4,6-triisopropylphenyl, and R1S is a leaving group such as chlorine, bromine, imid¬azole, triazole, 4-nitroimidazole, 1,2,3,4-tetrazole or 3-nitro-l,2,4-triazole, preferably using a coupling reagent of the compound of the formula XII or BOP, PyBOP or HATU, optionally with addition of a catalyst (Reese, J. Chem. Soc. Perkin Trans. 1993, 2291ff), such as N-methyl-imidazole, pyridine-N-oxides such as 4-methoxypyridine-N-oxide or 4-ethoxypyridine-K-oxide, 4,6-dinitro-l-hydroxy-benzotriazole, 1-hydroxy-5-phenyltetrazole, 1-hydroxy-5-(4-nitrophenyl)tetrazole, 3-nitro-lH-1,2,4-triazole, 5- (3-nitrophenyl)-1H-tetrazole, 5-{3,5-dinitrophenyl)-1H-tetrazole, 5-(l-methylimidazole-2-yl)-lH-tetrazole, 5- [ (l-methylimidazole-2-yl)methyl]-1H-tetrazole or l-hydroxy-4-nitro-6-{trifluoromethyl)benzotriazole, preferably with 4-ethoxypyridine-N-oxide or 4-methoxy-pyridine-N-oxide as a catalyst, where the preparation of the coupling reagents can be carried out in situ, or else carried out separately and the solution of the activated species (compound of the formula (X) in combination with a coupling reagent can be added in a suitable solvent, to give compounds of the formula XIII in which A, BPR, D, G, L, Rs, Rs, S1, S2, S3, X, X', X- and Y are as defined above; gx) starting from compounds of the formula XIII, repeat¬ing the steps et) and fx) up to the desired chain length, compounds of the formula XIV resulting in which A, BPR, D, G, L, R5, R6, S1, S2, S3, X, X', X", Y and n are as defined above; hx) removing the protective groups S1, S2 and S3 and the protective groups on BPR according to known processes (e.g. Greene, Wuts, Protective Groups in Organic Synthe¬sis, J. Wiley & Sons, New York 1991), i.e., for example, the protective group S1 as described in step ex) , the protective groups S2 or S3, if they are 2-(4-nitrophenyl)ethyl, by treatment with 0.5M 1,8-diaza-bicyclo[5.4,0]undec-7-ene (DBU) in pyridine or acetoni-trile at room temperature, if S2 or S3 is phenyl, by treatment with aqueous ammonia, if S2 or S3 is allyl, by treatment with Pd tP(C6H5) 3] 4 and triph.enylphosph.ine in DCM (Hayakawa et «!., J. Org. Chem. 56 (1993) 5551), if S2 or S3 is 2-cyanoethyl, by treatment with trie thy lamina in pyridine, or if S2 or S3 is 2,2,2-trichloro-1,1-dimethyl-ethyl, by treatment with tributylphopphine, and the protective groupa on BPR, for example if R14 is para-nitrophenylethyloxycarbonyl, with 0.5M DBU in pyridine, if R14 is isobutyryl or benzoyl or para-mathoxybenzoyl, with cone. MH4OH at 20 to 60°C or, if R13 is 2-(4-nitro-phenyl)ethyl, by treatment with 0.5M DBD in pyridine or acetonitrile, is preferred, if S1 equals monomethoxy-trityl and S2 equals 2-(para-nitrophenyl)ethyl, prefera¬bly the monomethoxytrityl group is first removed as described in ex), then S2 is removed as described, then the remaining protective groups, for example on the nucleobasaa, are removed; and optionally introducing the groups Q and Q' according to processes known to the person skilled in the art, (see, for example, Uhlmann & Peyman, Chem. Rev. 90 (1990) 543; H. Manoharan in "Antisense Research and Applica¬tions", Crooke and Lebleu, Eds., CRC Press, Boca Raton, 1993, Chapter 17, p.303ff; EP-A 0 552 756; S. Agrawal in Methods in Molecular Biology, Vol. 26, P. 93 ff, Humana Press, Totowa 1994), and optionally cyclizing the compounds obtained according to Wang, Nucl. Acids Res. 22 (1994) 2326, whereby compounds of the formula I result. Alternatively, conjugates Q* can also be incorporated into the monomer units of the formula XXII by processes known to the person skilled in the art (J. March, "Ad¬vanced Organic Chemistry11, Pourth Ed., J. Wiley & Sons, 1992) , which are then incorporated into the compounds of the formula I according to the processes mentioned. Compounds of the formula XXII can be prepared, for example, for Q' = alkyl, by reaction of compounds of the formula XXIII with compounds of the formula Via or VXb and further reactions analogously to those described for the formulae Va and Vb. Compounds of the formula XXII can also be prepared from compounds of the formula IX by removal of the protective group S1 and introduction of the group Q' according to known processes (J. March, "Advanced Organic Chemistry", Fourth Ed., J. Wiley & Sons, 1992). Alternatively, conjugates Q and Q" can also be incorpo¬rated into the monomer units of the formula XXIV by processes known to the person skilled in the art (J. March, "Advanced Organic Chemistry11, Fourth Ed., J. Wiley & Sons, 1992), which are then incorporated into the compounds of the formula I according to the processes mentioned. Coupling reagents for the linkage of peptide bonds (see cx)) are described, for example, in Houben-Weyl, Methoden der organischen Chemie, [Methods of organic chemistry] Volume 15/2, Georg Thieme Verlag Stuttgart 1974 and further reagents such as BOP (B. Castro, J.R. Donnoy, G. Evin and C. Selve, Tetrahedron Lett. 1975, 1219-1222), PyBOP (J. Coste, D. Le-Nguyen and B. Castro, Tetrahedron Lett. 1990, 2 05-208), BroP (J. Coste, M.-N. Dufour, A. Pantaloni and B. Castro, Tetrahedron Lett. 1990, 669- 672), PyBroP (J. Coste, E. Frerot, P. Jouin and B. Castro, Tetrahedron Lett. 1991, 1967-1970) and uronium reagents, such as HBTU (V. Dour toglou, B. Gross, V. Lambropoulou, C. Zioudrou, Synthesis 1984, 572-574), TBTU, TPTU, TSTU, TNTU (R. Knorr, A. Trzeciak, W. Bannwarth and D. Gillessen, Tetrahedron Letters 1989, 1927-1930), TOTU (EP-A-0 460 446), HATU {L.A. Carpino, J. Am. Chem. Soc. 1993, 115, 4397-4398), HAPyU, TAPipU (A. Ehrlich, S. Rothemund, M. Brudel, H. Beyemann, L.A. Carpino and M. Bienert, Tetrahedron Lett. 1993, 4781-4784) , BOI (K. Akaji, N. Kuriyama, T. Kimura, Y. Fujiwara and Y. Kiso, Tetrahedron Lett. 1992, 3177- 3180) or acid chlorides or acid fluorides (L. A. Carpino, H. G. Chao, M. Beyermann and M. Bienert, J. Org. Chem., 56 (1991), 2635; J.-N. Bertho, A. Loffet, C. Pinel, F. Reuther and G. Sennyey in E. Giralt and D. Andreu (Eds.) Peptides 1990, Escorn Science Publishers B. V.1991, pp. 53-54; J. Green and K, Bradley, Tetrahedron 1993, 4141-4146), 2,4,6-mesitylenesulfonyl-3-nitro-l,2,4-triazolide (MSNT) (B. Blankemeyer-Menge, H. Nimitz and R. Prank, Tetrahedron Lett. 1990, 1701-1704), 2,5-diphenyl-2,3-dihydro-3-oxo-4-hydroxythiophene dioxide (TDOJ (R. Kirstgen, R.C. Sheppard, W. Steglich, J. Chem. Soc. Chem. Commun. 1987, 1870-1871) or activated esters (D. Hudson, Peptide Res. 1990, 51-55) in the respective references. The use of carbodiimides, e.g. dicyclohexylcarbodiimide or diisopropylcarbodiimide, is further preferred. Phos-phonium reagents, such as PyBOP or PyBroP, uronium reagents, such as HBTU, TBTU, TPTU, TSTU, TNTU, TOTU or HATU and BOI are also preferably uBed. In this case, the coupling can be carried out directly by addition of compounds of the formula VIII using the activating reagent and optionally with addition of additives such as l-hydroxybenzotr\azole (HOBt) (W. Konig, R. Geiger, Cham. Bar. 103, 788 (1970)) or 3-hydroxy-4-oxo-3,4-dihydrobenzotriazine (HOObt) (W. Konig, R. Geiger, Chem. Bar. 103, 2034 (1970)) or else the preactivation of the units as an activated ester can be carried out separately and the solution of the activated species in a suitable solvent can be added. The invention furthermore relates to a process for the preparation of the compounds of the formula I, in which n is 1 to 100, which comprises, in the compounds of the formulae XV and XVI in which A, BPR, D, G, L, R5, R6, S1, S2, S3, X, X', X" and Y are as defined above, o and p independently of one another are zero to 50, preferably zero to 20 and o + p + 1 = n; a2) in the compounds of the formula XV removing the protective group S1 as described under e1), b2) in the compounds of the formula XVI removing the protective group S3 as described under dx) and c2) coupling the resulting compounds with one another as described under fx) , compounds of the formula XIV result¬ing in which A, BPR, D, G, L, R5, R6, S1, S2, S3, X, X*, X", Y and n are as defined above, d2) and reacting these as described under hx) to give compounds of the formula I. The invention furthermore relates to a process for the preparation of the compounds of the formula I, which comprises a3) coupling compounds of the formula X in which A, BPR, V, G, L, R5, R6, S1, S2, X, X', X" and Y are as defined above, to a solid support via a SPACER according to known processes, to give compounds of the formula XVII, in which A, BPR, D, G, L, R5, Rfi, S1, S2, X, X', X" and Y are as defined above, SS is a solid support suitable for solid-phase synthe¬sis, such as aminopropyl-CPG (CPG= Controlled Pore Glass) or Tentagel, and SPACER is a group removable from the support after synthesis has taken place, such as is known to the person skilled in the art (Sonveaux, Bioorganic Chemistry 14 (1986) 274f£), for example the bis(hydroxyethyl)sulfonyl group, as is described in EP-A 0 552 76$ (HOE 92/F012), or SPACER is bifunctional conjugate molecules Q, which are linked to the solid support via known removable groups, for example is nucleotides or oligonucleotides which are bound to the solid support via a succinic acid radical (Sonveaux, Bioorganic Chemistry 14 (1986) 2?4ff) or poly- or oligoethylene glycols which are bound to the solid support via a succinic acid radical (Jasohke, Tetrahedron Lett. 34 (1993) 301) or, for example, cholesterol derivatives which are bound to the solid support via a succinic acid radical (MacKellar, Nucl. Acids Res. 20 (1992) 3411); b3) removing the protective group S1 from compounds of the formula XVII in which A, BPR, D, G, L, RS, Rs, S1, S2, SS, SPACER, X, X', X" and Y are as defined above, as described under ex); c3) reacting the resulting compound with compounds of the formula X in which A, BPH, D, G, L, R5, R6, S1, S2, X, , X', X" and Y are aa de fined above, as described under fj); d3) repeating the steps b3) and c3) up to the desired chain length; e3) optionally coupling conjugates Q' by known processes (see, for example, Uhlmann & Peyman, Chem. Rev. 90 (1990) 543; H. Kanoharan in "Antisense Research and Applica¬tions", Crooke and Lebleu, Eds., CRC Press, Boca Raton, 1993, Chapter 17, P.303ff; EP-A 0 552 766; S. Agrawal in "Methods in Molecular Biology", Vol. 26, P. 93ff, Humana Press, Totowa 1994); f3) removing the compounds produced in this way from the solid support by known processes, for example the bis(hydroxyethyl)sulfonyl linkers, as described in EP-A 0 552 766, (HOE92/F012) by treatment with DBO, the succinic acid linker by treatment with agjueous ammonia and the protective groups as described in step hx) , where the removal of the protective groups can also be carried out before the cleavage from the support and optionally coupling conjugates Q by known processes, whereby the order of the coupling of Q and Q' (e3), f3)) may be changed, and optionally cyclizing the compound obtained. The compounds of the formula I are used as inhibitors of gene expression. The invention therefore further relates to the use of therapeutically active compounds according to the invention for the production of a pharmaceutical and to a process for the production of a pharmaceutical which comprises mixing the compounds according to the invention with a physiologically acceptable excipient and also, if appropriate, suitable additives and/or auxiliaries. Therapeutically active compounds are understood in general as meaning those which, on account of the sequence of the units B which correspond to the nucleobases, carry out a function as analogs of antisense oligonucleotides, triple helix-forming oligonucleotides, aptamers (RHA or DNA molecules which can bind to specific target molecules, e.g. proteins or receptors (e.g. L.C. Bock et al., Nature 1992, 355, 564) or ribozymes (catalytic RNA, s«e for example, Castanet to et al., Critical Rev. Eukar. Gene Expr. 1992, 2, 331), in particular as analogs of antisense oligonucleotides and triple helix-forming oligonucleotides. Moreover, the present invention further relates to the use of the compounds according to the invention as a diagnostic, for example for the detection of the presence or absence or the amount of a specific double-stranded or single-stranded nucleic acid molecule in a biological sample. For use according to the invention, the compounds accord¬ing to the invention have a length (n-1) of about 6 -100, preferably of about 10 - 40, in particular of about 12 - 31 nucleotides. Otherwise, the preferred ranges, modifications or conjugations described above also apply here. The pharmaceuticals of the present invention can be used, for example, for the treatment of illnesses which are caused by viruses, for example by HIV, HSV-1, HSV-2, influenza, VSV, hepatitis B or papilloma viruses. Sequences according to the invention (base sequences) which are active against targets of this type are, for example: a) against HIV, e.g. ACACCCAATTCTGAAAATGG SEQ ID N0:1 AGGTCCCTGTTCGGGCGCCA SEQ ID N0:2 GGTCCCTGTTCGGGCGCCA SEQ ID N0:26 GTCGACACCCAATTCTGAAAATGGATAA SEQ ID N0:3 GCTATGTCGACACCCAATTCTGAAA SEQ ID N0:4 GTCGCTGTCTCCGCTTCTTCTTCCTG SEQ ID N0:5 GTCTCCGCTTCTTCTTCCTGCCATAGG SEQ ID N0:6 b) against HSV-1, e.g. GCGGGGCTCCATGGGGGTCG SEQ ID N0:7 GGAGGATGCTGAGGAGG SEQ ID NO:28 GGAGGATGCTGAGG SEQ ID N0:29 CAGGAGGATGCTGAGGAGG SEQ ID N0:30 The pharmaceuticals of the present invention are also suitable, for example, for the treatment of cancer or of restenosis. For example, in this case sequences (base sequences) can be used which are directed against targets which are responsible for carcinogenesis or cancer growth. Such targets are, for example: 1) Nuclear oncoproteins such as c-myc, N-myc, c-myb, c-fos, c-fos/jun, PCNA, p!20 2) Cytoplasmic/membrane-associated oncoproteins such as EJ-ras, c-Ha-ras, N-ras, rrg, bcl-2, cdc-2, c-raf-1, c- moB, c-src, c-abl 3) Cellular receptors such as EOF receptor, c-erbA, retinoid receptors, protein kinase regulatory subunits, c-fms 4) Cytokines, growth factors, extracellular matrix such as CSF-1, IL-6, IL-la, IL-lb, IL-2, IL-4, bFGF, myelo- blastin, fibronectin. Sequences according to the invention (base sequences) which are active against targets of this type are, for example, a) against c-Ha-ras, e.g. CAGCTGCAACCCAGC SEQ ID NO:8 c) c-myc, e.g. GGCTGCTGGAGCGGGGCACAC SEQ ID NO: 9 AACGTTGAGGGGCAT SEQ ID NO:10 d) c-myb, e.g. GTGCCGGGGTCTTCGGGC SEQ ID NO: 11 GTGCCGGGGTCTTCGGG SEQ ID NO:27 e) c-fos, e.g. GGAGAACATCATGGTCGAAG SEQ ID NO: 12 CCCGAGAACATCATGGTCGAAG SEQ ID NO: 13 GGGGAAAGCCCGGCAAGGGG SEQ ID NO: 14 f) pl20, e.g. CACCCGCCTTGGCCTCCCAC SEQ ID NO: 15 g) EGF receptor, e.g. GGGACTCCGGCGAGCGC SEQ ID NO: 16 GGCAAACTTTCTTTTCCTCC SEQ ID NO: 17 h) p53 tumor suppressor, e.g. GGGAAGGAGGAGGATGAGG SEQ ID NO: 18 GGCAGTCATCCAGCTTCGGAG SEQ ID NO: 19 1) bFQF, e.g. GGCTGCCATGGTCCC SEQ ID NO:31 The pharmaceuticals of the present invention are further suitable, for example, for the treatment of illnesses which are affected by integrins or cell-cell adhesion receptors, for example by VLA-4, VLA-2, ICAM or ELAM. Sequences according to the invention (base sequences) which are active against targets of this type are, for example a) VLA-4, e.g. GCAGTAAGCATCCATATC SEQ ID NO:20 b) ICAM, e.g. CCCCCACCACTTCCCCTCTC SEQ ID NO:21 CTCCCCCACCACTTCCCCTC SEQ ID NO:22 GCTGGGAGCCATAGCGAGG SEQ ID NO:23 c) ELAM-1, e.g. ACTGCTGCCTCTTGTCTCAGG SEQ ID NO:24 CAATCAATGACTTCAAGAGTTC SEQ ID NO: 25 The pharmaceuticals of the present invention are further suitable, for example, for the treatment of Illnesses which are induced by factors such as TNF alpha. Sequences according to the invention (base sequences) which are active against targets of this type are, for example a) TNF-alpha, e.g. TCATGOTGTCCTTTaCAGCC SEQ ID MO:32 TCATGGTGTCCTTTGCAG SEQ ID HO:33 The pharmaceuticals can be used, for example, in the form of pharmaceutical preparations which can be administered, for example, topically or orally, e.g. in the form of tablets, coated tablets, hard or soft gelatin capsules, solutions, emulsions or suspensions. They can also be administered rectally, e.g. in the form of suppositories, or parenterally, e.g. in the form of injection solutions. For the production of pharmaceutical preparations, these compounds can be processed in therapeutically inert organic and inorganic excipients. Examples of such excipients for tablets, coated tablets and hard gelatin capsules are lactose, maize starch or derivatives there¬of, talc and stearic acid or salts thereof. Suitable excipients for the production of solutions are water, polyols, sucrose, invert sugar and glucose. Suitable excipients for injection solutions are water, alcohols, polyols, glycerol and vegetable oils. Suitable excipients for suppositories are vegetable and hardened oils, waxes, fats and semiliquid polyols. The pharmaceutical prepara¬tions can also contain preservatives, solvents, stabiliz¬ers, wetting agents, emulsifiers, sweeteners, colorants, flavorings, salts for changing the osmotic pressure, buffers, coating compositions, antioxidants, and also, if appropriate, other therapeutic active compounds. A preferred administration is oral administration. A further preferred form of administration is injection. For this, the antisense oligonucleotides are formulated in a liquid solution, preferably in a physiologically acceptable buffer, such as Hank's solution or Ringer's solution. The therapeutically active compounds according to the invention, however, can also be formulated in solid form and dissolved or suspended before use. The preferred dosages for systemic administration are about 0.01 mg/kg to about 50 mg/kg of body weight per day. List of sequences: ACACCCAATTCTGAAAATGG SEQ ID NO:l AGGTCCCTGTTCGGGCGCCA SEQ ID NO:2 GTCGACACCCAATTCTGAAAATGGATAA SEQ ID NO:3 GCTATGTCGACACCCAATTCTGAAA SEQ ID N0:4 GTCGCTGTCTCCGCTTCTTCTTCCTG SEQ ID NO:5 GTCTCCGCTTCTTCTTCCTGCCATAGG SEQ ID N0:6 GCGGGGCTCCATGGGGGTCG SEQ ID N0:7 CAGCTGCAACCCAGC SEQ ID N0:8 GGCTGCTGGAGCGGGGCACAC SEO ID N0:9 AACGTTGAGGGGCAT SEQ ID NO: 10 GTGCCGGGGTCTTCGGGC SEQ ID N0:11 GQAGAACATCATGGTCGAAAG SEQ ID N0:12 CCCGAGAACATCATGGTCGAAG SEQ ID NO: 13 GGGGAAAGCCCGGCAAGGGG SEQ ID NO: 14 CACCCGCCTTGGCCTCCCAC SEQ ID N0:15 GGGACTCCGGCGCAGCGC SEQ ID N0:16 GGCAAACTTTCTTTTCCTCC SEQ ID NO: 17 GGGAAGGAGGAGGATGAGG SEQ ID N0:18 GGCAGTCATCCAGCTTCGGAG SEQ ID N0:19 GCAGTAAGCATCCATATC SEQ ID N0:20 CCCCCACCACTTCCCCTCTC SEQ ID N0:21 CTCCCCCACCACTTCCCCTC SEQ ID NO:22 GCTGGGAGCCATAGCGAGG SEQ ID N0:23 ACTGCTGCCTCTTGTCTCAGG SEQ ID N0:24 CAATCAATGACTTCAAGAGTTC SEQ ID N0:25 GGTCCCTGTTCGGGCGCCA SEQ ID N0:26 GTGCCGGGGTCTTCGGG SEQ ID N0:27 GGAGGATGCTGAGGAGG SEQ ID N0:28 GGAGGATGCTGAGG SEQ ID NO:29 CAGGAGGATGCTGAGGAGG SEQ ID N0:30 GGCTGCCATGGTCCC SEQ ID N0:31 TCATGGTGTCCTTTGCAGCC SEQ ID NO:32 TCATGGTGTCCTTTGCAG SEQ ID NO:33 Examples: 1) Di(2-(p-nitrophenyl)athyl) N-(4-methoxytriphenyl methoxy) ethylaminomethanephosphonate la) N-Fluorenylmethoxycarbonyl-2-aminoethanol 8.61 g (0.141 mol) of 2-aminoethanol were dissolved In 250 ml of dioxane and 150 ml o£ H20. At 15-20°C, 17.79 g (0.212 mol) of NaHC03 were first added, then 50 g (0.148 mol) of fluorenylmethoxycarbonyl-N-succinimide in por¬tions AN The mixture was stirred at room temperature for lh, then it was evaporated to dryness. The residue was partitioned between dichloromethane (DCM) and H20, the organic phase was dried over Na2S04 and the solvent was evaporated in vacuo. The residue was stirred with 100 ml of ether, and the product was filtered off with suction and washed well with ether. The yield was 38,77 g (97%). MS (ES+) : 284.2 (M+H)+; 1H-NMR (200 MHz, DMSO, TMS) : 5 = 3.05 (dd, 2H, CH20H) ; 3.39 (dd, 2H, N=CH2) ; 4.25 (m, 3H, Ar-£H-CH2); 4.61 (t, 1H, OH); 7.14-7.98 (m, 15H, Ar-H, NH). lb) N-Fluorenylmethoxycarbonyl- 2-amino-1-(4-methoxytri-phenylmethoxy)ethane 10 g (35.3 mmol) of N-fluorenylmethoxycarbonyl-2-amino-ethanol (from Example la), dissolved in 100 ml of absol. N,N-dimethylformamide 6 * 2.95 (t, 2H, CH20-MMTr); 3.21 (dd, 2H, N-CH2) ; 3.75 (s, 3H, OCH3); 4.25 (m, 3H, Ar-CH-CH2); 4.61 lc) 2-Amino-1-(4-methoxytriphenylmethoxy)ethane 5.0 g (9 jranol) of N- fluorenylmethoxycarbonyl-2-amino-1 -(4-methoxytriphenylmethoxy) ethane (from Example lb), dis¬solved in 50 ml of absol, DMF, were treated at room temperature with 6.55 g (90 mmol) of diethylamine and the mixture was stirred for 2h. To purity it, it was chromat-ographed on silica gel (first n-heptane/EA/TEA 50:49:1; then EA/methanol/TEA 79:20:1). The yield was 2.96 g (98.7%) . MS (ES + ) : 340.3 (M+Li)+; 1H-NMR (200 MHz, DMSO, THS) : 5 = 2.75 (t, 2H, £H20-MMTr); 2.93 (dd, 2H, N-CH2) ; 3.75 (s, 3H, OCH3); 6.83-7.47 2.96 g (8.9 mmol) of 2 - amino-1- (4-methoxytriphenyl¬methoxy) ethane (from Example lc), dissolved in 10 ml of methanol were treated with ice cooling with 1.08g (13,22 mmol) of 37% formaldehyde and stirred at room temperature for 4h, a viscous precipitate being formed. The reaction mixture was evaporated and the residue was chromatographed on silica gel to purify it (n-heptane/ EA/TEA 50:49:1). The yield was 1.7 g (55%). MS (FAB): 1042.8 (M+Li)+; 1034.8 (M-H) + . lH-HMR (200 MHz, DMSO, TMS): 6 * 2.60 (t, 6H, 0-CH2); 2.99 (t, 6H, N-CH2> ; 3.69 (s, 9H, OCH3) ; 6.78-7.42 (m, 42H, Ar-H). le) Di(2-(4-nitrophenyl)ethyl) phosphite 23.42 g (0.1 mol) of diphenyl phosphite were heated at 100°C for 14h under argon together with 33.43g (0.2 mol) of p-nitrophenylethanol, and to purify it the mixture was chromatographed on silica gel (n-heptane/EA 50:50; then SA/nethanol 80:20). Yield: 55%. MS (FAB): 403.1 341 mg (0.329 mmol) of 2-methylimino-l-(4-methoxytri-phenylmethoxy)ethane (tr inter) (from Example Id) were added to 500 mg (1.32 xnmol) of di (2- (4-nitrophenyl) ethyl) phosphite (from Example le), dissolved in 2 ml of absol. Tetrahydrofuran (THF), and the mixture was stirred at 80°C for 3 h. The solvent was evaporated and the residue was stirred at 100°C for a further 30 min. To purify it, it was chromatographed on silica gel (first EA/TEA 99:1; then EA/methanol/TEA 90:9:1). Yield: 83%. MS (FAS): 732.3 2a) 0.952g (8.27 mmol) of N-ethylmorpholine (NEM), 0.834g (2.76 mmol) of (Ns-anisoyl) cytosin-1-yl-acetic acid and 1.153 g (3.03 mmol) of 0-(7-aza)benzotriazol-l-yltetra-methyluronium hexafluorophosphate (HATU, L. Carpino, J. Am. Chem. Soc. 1993, 115, 4397) was added to 2.00 g (2.76 mmol) of di(2-(p-nitrophenyl)ethyl) N-(4-methoxy¬triphenylmethoxy) ethylaminomethanephosphonate (from Example If), dissolved in 60 ml of absol. DMF, and the mixture was stirred at room temperature for 12h. The same amount of HATU was then added once again and the mixture stirred at room temperature for a further 3h. To purify it, it was chromatographed on silica gel (DCM/methanol/TEA 95:4:1). The yield was 2.7 g (97%). MS (ES + ) : 1012.0 (M+H)+. XH-NMR (200 MHz, DMSO, TMS) : 6 ■ 2.94 (t, 4H, P-0-CH2-CH2-Ar); 3.06 (t, 2H, MMTr-O-CH2); 3.23-3.63 (m, 4H, P-£H2 + N-Cg2) ; 3.75 (s, 3H, OCH3) ; 3.83 (s, 3H, OCH3) ; 4.10 2b) Mixture as in Example 2a, but using 0-(cyano(ethoxy-carbonyDmethylenamino) -1,1,3,3-tatramethyluronium tetra-flaoroborate (TOTU, EP 0460446) instead of HATU. The yield was 57%. Spectroscopic data: see Example 2a. 3) N-(N6-Anisoyl)cytosin-l-yl-acetyl-N-(4-methoxytri- phenylmethoxy)ethylaminomethanephosphonic acid (2- (p- nitrophenyl)ethyl) monoester (triethylammonium salt) 1 g (0.99 mmol) of di (2-(p-nitrophenyl)ethyl) N-(N6-anisoyl) cytosin-1-yl-acetyl-N- (4-methoxytriphenyl-methoxy)ethylaminomethanephosphonate (from Example 2) was dissolved in 20ml of a 0.1 M solution of 1,8-diaza-bicyclo [5.4.0]uadec-7-ene (DBtJ) in absol. acetonitrile and the mixture was stirred at room temperature for 4h. The reaction mixture was partitioned between DCM and an aqueous KH2P04 solution (pH 7), the organic phase was dried over Na2S04 and the solvent was evaporated in vacuo. To purify the residue, it was chromatographed on silica gel (EA/methanol/TEA 70:29:1). The yield was 540 mg (57%) . MS (FAB): 906.5 (M-H+2Na)+; 884.6 (M+Na) + > 862.5 (M+H)*. AN-NMR (200 MHz, DMSO, TMS): & = 3.00 (m, 4H, P-O-CHj-AN-Ar + MMTr-0-£H2) ; 3.38-3.60 (m, 4H, P-CH2 + N-CHAN 1 3.73 (s, 3H, 0CH3); 3.82 (s, 3H, 0CH3); 4.01 (dt, 2H, P-0-CH2) ; 4.79& 5.03 (in each case s, broad, 2H, C0-CH2); 6.78-8.20 (m, 24H, Ar-H, cytosinyl-H); 11.00 (s broad, 1H, NH). 4) Di(2-(p-nitrophenyl)ethyl) N-(N6-aniBoyl)cytosin-l-yl- acetyl-N-{2-hydroxy)ethylamino-methanephosphonate 1.00 g (0.99 mmol) of di (2-(p-nitrophenyl)ethyl) N-(N6-anisoyl) cytosin-1-yl-acetyl-N- (4-methoxytriphenyl-methoxy) ethylaminomethanephosphonate (from Example 2) was dissolved in 80 ml of 80% aqueous acetic acid and the solution was stirred at room temperature for 4h. The solvent was evaporated and the residue was coevaporated twice with toluene. To purify it, it was chromatographed on silica gel (EA/methanol/TEA 85:14:1) . The yield was 522 mg (71%). MS (FAB) : 761.2 (M+Na)+; 739.3 (M+H)+. AN-NMR (200 MHz, DMSO, TMS) : 6 = 2.98 (t, 4H, P-0-CH2-CH2-Ar) 3.38-3.67 (m, 4H, N-CH2CH2-OH) ; 3.80-3.89 (m, 2H, F-£H.2) ; 3.91 The synthesis was carried out analogously to Example 7 from N- (N6-anisoyl)cytosin-l-yl-acetyl-N- (4-methoxytri-phenylmethoxy) ethylaminomethanephosphonic acid (2- (p-nitrophenyl)ethyl) monoester (triethylammonium salt) (Exaaple3) and di(2-(p-nitrophenyl)ethyl) N-(Ns-anisoyl) cytosin-1-yl-acetyl-N-(2-hydroxy)ethylauinomethane-phosphonate (Example 4) To purify it, the compound was chromatographed on silica gel (EA/methanol/TEA 85/14/1). Yield: 73%. MS (FAB): 1605 (M+Na)+; 1583 (M+H) *. 1H-NMR (200 MHz, DMSO, TMS): 6 = 2.94-3.18 (m, 6H, P-0-CH2-CH2-Ar) 3.26-3.95 (m, 10H) ; 3.75 (s, 3H, OCH3) ; 3.85 (s, 6H, OCH3); 3.99-4.36 (m, 8H, P-0-CH2) ; 4.75-4.92 (m, broad, 4H, C0-CH2); 6.83-8.18 (m, 38H, Ar-H, cytosinyl-H); 10.98 & 11.03 (in each case s, broad, 2H, NH). 6) 5'-HO-CAa-P(ONPE)-CAn-P(ONPE)2 The synthesis was carried out analogously- to Example 4 from "S'-MMTr-CAn-PtONPE)-CAn-P(ONPE)2" (Example 5). To purify it, the compound was chromatographed on silica gel (EA/methanol/TEA 85:14:1). The yield was 74%. MS (FAB): 1332.4 (M+Na)+; 1310.3 (M+H)+; 7) Diethyl N- (4-methoxytriphenylmethoxy)ethylamino- methanephosphonate The synthesis was carried out analogously to Example If, but using diethyl phosphite. Yield: 87.5%. MS (FAB): 490.2 methoxy)ethylaminomethanephosphonate 570.3 mg (4.22 mmol) of hydroxybenzotriazole (HOBT), 972.1 mg (8.44 mmol) of NEM, 777 mg (4.22 mmol) of thymidin-1-yl-acetic acid and 639 mg (5.06 mmol) of diisopropylcarbodiimide were added to 2.04g (4.22 mmol) of diethyl N- (4-methoxytriphenylmethoxy)ethylamino-methanephosphonate (Example 7) , dissolved in 50 ml of absol. DMF. The mixture was stirred at room temperature for 16 h, the solvent was evaporated, the residue was dissolved in DCM and the solution was extracted with saturated aqueous NaHC03 solution, then was saturated with aqueous NaCl solution. The extract was dried over sodium sulfate and the solvent evaporated. To purify it, the residue was chromatographed on silica gel (EA/methanol/TEA 98:2:1). The yield was 2.47g (90%). MS (FAB): 662.3 (in each case s, 3H, T-CH3) ; 3.10-3.40 (m, 2H, CH2-OMMTr); 3.53-3.70 (m, 4H, P-CH2 + N-CH2); 3.75 (a, 3H, OCH3); 3.83-4.16 9) N-Thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) - ethylaminomethanephosphonic acid monoethyl ester (tri- ethylammonium salt) 811 mg (1.25 romol) of diethyl K-thymin-1-yl-acetyl-N-(4-methoxytriphenylmethoxy)ethylaminomethanephosphonate (Example 8) were suspended in 3.75 ml of IN NaOH, The mixture was stirred at room temperature for 3h, then at 50°C for 6h. The reaction mixture was concentrated in vacuo and the residue was chromatographed on silica gel (EA/methanol/TEA 100:10:10, then 100:40:10). The yield was 897 mg (99.5%). MS (ES-): 620.4 (M-H)". 1H-NHR (200MHz, DNSO, TMS) : 6 m 1.18 (t,9H,N-CH2-CH3) ; 1.68 & 1.74 (in each case s, 3H, T-CH3); 2.96-3.08 (q,6H, N-CH2-CH3); 3.35(m, 2H, N-£M2); 3.43-3.70 (d, J = 11 Hz, 2H, P-CH2); 3.63 (tf 2H, CH2-0MMTr); 3.75 (a, 3H, OCH3) ; 3.78 aminome thanepho sphona te The synthesis was carried out analogously to Example 4 from diethyl N-thymin-1-yl-acetyl-N- (4-methoxytriphenyl-methoxy)ethylaminomethanephosphonate (Example 8). To purify it, the product was chromatographed on silica gel (EA/methanol 90:10). Yield: 80%. MS (FAB): 400.1 (M+Na)+; 378.1 (M+H)+. 1H-NMR (200MHz, DMSO, TMS): 6 = 1.17-1.32 (m, 6H, CH2-CH3); 1.78 (s, 3H, T-CH3); 3.40-3.69 (m, 4H, CH2-OH + N-CH2) ; 3.89 (d, J = 11 Hz, 2H, P-CH2) ; 3.92-4.19 (m, 4H, PO-CH2) ; 4.70 (s, 2H, CO-CH2); 4.98 (t,lH,OH>; 7.22 & 7.30 {in each case s, 1H, T-H); 11.25 (s, 1H, NH). 11) Diphenyl N-(4-methoxytriphenylmethoxy)ethylamino- methanephosphonate The synthesis was carried out analogously to Example If, but using diethyl phosphite. Yield: 100%. HS (FAB): 56.2 (H+Li)+. 12) N-Thymin-1-yl-acetyl-N-(4-methoxytriphenylmethoxy)- ethylaminoxnethanephosphonic acid monophenyl ester (tri- ethy1ammonium salt) The synthesis was carried out analogously to Example 81 from diphenyl N- (4-methoxytriphenylmethoxy)ethylamino-methanephosphonate (Example 11) and thymidin-1-yl-acetic acid. To purify it/ the product was chromatographed on silica gel (EA/methanol/TEA/H20 90:10:5:0.5). Yield: 47%. MS (FAB): 682.3 (M + 2Li-H) + . 1H-NMR (200 MHz, DMSO, TMS) : 6 m 1.16 13) Phenyl 4-nitrophenylefchyl N-thymin-1-yl-acetyl-N-(4- methoxytriphenylmethoxy) ethylaminomethanephosphonate 385. 4mg (0.5 ntnxo 1) of N-thymin-1-yl-acetyl-N- (4-methoxy¬triphenylmethoxy) ethylaminomethanephosphonic acid mono¬phenyl ester (triethylammonium salt) (Example 12) and 92 mg (0.55 mmol) of 4-nitrophenylethanol were coevaporated three times with absol. pyridine, then dissolved in 15 ml of absol. pyridine. 403.4 mg (0.15 mmol) of 3-nitro-l-(p-toluenesulfonyl)-1H-1,2,4- triazole (TSNT) were added at 0°C, then the mixture was stirred at 0-5°C for 16 h, the pyridine was distilled off in vacuo, the residue was taken up in EA and the solution was washed successively with saturated aqueous NaHC03 solution, then with NaCl solution. To purify it, the product was chromatographed on silica gel (EA/TEA 100:2). The yield was 162 mg. MS (FAB): 831.3 (M + 2Li - H)+; (M + Li)+. 14) Di(2-(p-nitrophenyl)ethyl) N-thymin-1-yl-acetyl-N-(4- methoxytriphenylmethoxy) ethylaminomethanephosphonate The synthesis was carried out analogously to Example 8 from di-(2-(p-nitrophenyl)ethyl) N-(4-methoxytriphenyl-methoxy) ethyl aminomethanephosphonate (Example If) and thymidin-1-yl-acetic acid. Yield: 63% MS (ES + ) : 898.4 (M+Li)+. AN-NMR (200MHz, DMSO, TMS) : 5 = 1.65 & 1.72 (in each case a, 3H, T-CH3) ; 2.96 (t, 4H, P-0-CH2-CH2-Ar); 3.06 (t, 2H, N-CH2) ; 3.67 (d, J « 11Hz, 2H, P-CH2); 3-70 15) N-Thymin-1-yl-acetyl-N-(4-methoxytriphenylmethoxy)- ethylaminomethanephoaphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) 15a) From 30 mg of phenyl 4-nitrophenylethyl N-thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) ethylamino-methanephosphonate (Example 13) 30 mg of phenyl 4-nitrophenylethyl N-thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) ethylaminomethanephosphonate (Example 13) were dissolved in a mixture of 1 ml of TEA, 1 ml of dioxane and 80 mg of p-nitrobenzaldoxime and the solution, was stirred at room temperature for 3h. The solvent was evaporated in vacuo and the residue was coevaporated three times with pyridine and twice with \ toluene. The residue was chromatographed on silica gel {EA/TEA 100:2, then EA/methanol/TEA 60:40:2). The yield was 23 mg. MS (FAB) : 755.3 (M + 2Li-H) + . AN-NMR (200 MHz, DMSO, TMS) : a - 1.15 (t,9H,N-CH2-CH3) ; 1.60 & 1.79 (m, 3H, T-CH3) ; 2.80-3.60 (m, 14H, N-CH2-CH3 + N-CH2 + P-CH2 + CH2-0MMTr + Ar-CH2); 3.73 (s, 3H, 0CH3) ; 4.01 (dt, 2H, P-0-CH2); 4.58 -4.92 (m, 2H CO-CH2) ; 6.82-8.18 (m, 19H, Ar-H, T-H); 11.30 (s, 1H, NH). 15b) From di(2-(p-nitrophenyl)ethyl) N-thymin-1-yl-acetyl-N-(4-methoxytriphenylmethoxy)ethylamino-methanephosphonate (Example 14) The synthesis was carried out analogously to Example 3 from di(2- (p-nitrophenyl) ethyl) N-thymin-1-yl-acetyl-N-{4-methoxytriphenylmethoxy) ethylaminomethanephosphonate (Example 14), but in pyridine as a solvent. Yield: 82%. Spectroscopic data: see Example 15a. 16) N-Thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) - ethylaminomethanephosphonic acid The synthesis was carried out analogously to Example 15b. N-Thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) ethyl¬aminomethanephosphonic acid is obtained in 18% yield as a by-product. MS (ES-): 592.2 (M-H)". 17) 5'-MMTr-T-P(O-ethyl)-T-P-(0-ethyl)2 361 mg (0.5 mmol) of N-thymin-1-yl-acetyl-N- (4-methoxy¬triphenylmethoxy) ethylaminomethanephosphonic acid mono-ethyl ester (triethylammonium salt) (9) and 188.7 mg (0.5 nnnol) of diethyl N-thymin-1-yl-acetyl-N-(2-hydroxy) ethylaminomethanephosphonate (10) were coevapor-ated together twice with absol. pyridine, then dissolved in 10 ml of absol. pyridine. 1.5 mmol of TSNT were added at 5-10°C and the mixture was stirred at room temperature for 16h. The pyridine was evaporated in vacuo, the residue was dissolved in EA and the solution was washed successively with saturated aqueous NaHC03 solution, then NaCl solution. It was dried over Na2S04, concentrated and to purify the residue it was chromatographed on silica gel (EA/methanol/TEA 92:8:2) . The yield was 223 mg (46%) . MS (FAB): 987.5 The synthesis was carried out analogously to Example 4 from 5'-MMTr-T-P(0-ethyl)-T-P(0-ethyl>2 (Example 17). To purify the product, it was chroma tographed on silica gel (EA/methanol/TEA 85:15:2, then 100:50:1.5). The yield was 95%. MS (FAB): 731.2 (M+Na)+ 709.1. (M+Li)+. 1H-NMR (200MHz, DMSO, THS) Characteristic signals are: thymine-H: 7.21-7.36 (m, 2H) ; C0-CH2: 4.60-4.76 (m, 4H) ; thymine-CH3: 1.63-1.79 (m, 6H). 19) 5'-MMTr-T-P{0-phenyl)-T-P(0-ethyl)2 The synthesis was carried out analogously to Example 17 from diethyl K-thymin-1-yl-acetyl-N-(2-hydroxy)ethyl-aminomethanephosphonate (Example 10) and N-thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) ethylaminomethane-phosphonic acid monophenyl ester (triethylammonium salt) (Example 12) . To purify the product, it was chroma to¬graphed on silica gel (EA/methanol/TEA 93:7:2). Yield: 58%. MS (FAB): 1051.4 (M+Na)+; 1029.5 hydroxyethyl) aminomethanephosponate The synthesis was carried out analogously to Example 4 from di (2- (p-nitrophenyl)ethyl) N-thymin-1-yl-acetyl-N-(4-methoxytriphenylmethoxy) ethylaminomethanephosphonate (Example 14) . To purify the product, it was chromato-graphed on silica gel (EA/methanol 90:10). Yield: 65%. MS (ES+) : 620.3 (H+H)+. AN-NMR (500MHz, DMSO, TMS) : 6 * 1.73 (a, 3H, T-CH3); 2.97 (t, 4H, P-0-CH2-CH2-Ar) ; 3.41 (m, 2H, N-CH2) ; 3.59 (m, 2H, SSj-OH) ; 3.83 (d, 2H, J - 11Hz; P-CH2); 4.08-4.30 (m, 4H, P-0-CH2); 4.54 & 4.78 (in each case s, broad, 2H, C0-CH2); 4.99 {t,lH, OH); 7,14-8.19 (m, 9H, Ar-H, thymidinyl-H)j 11.30 (s, broad, 1H, NH). 21) 5'-MMTr-T-P(ONPE)-T-P(0-ethyl)2 The synthesis was carried out analogously to Example 17 from diethyl N-thymin-l-yl-acetyl-N- (2-hydroxy) ethyl¬aminomethanephosphonate (Example 10) and N- thymin- 1-yl -acetyl-N-(4-methoxytriphenylmethoxy)ethylamino-methanephoaphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) (Example 15) . Instead of TSNT, 3-nitro-l-(2,4,6-triisopropylphenylsulfonyl)-1H-1,2,4-triazole (TIPSNT) was employed for the coupling. To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 95:5:2, then 90:10:2). Yield: > 90%. MS (ES+): 1109.0 (M+Li)+. *H-NMR (200MHz, DMSO, TMS) Characteristic signals are: Ar-H & thymine-H: 6.82-8.18 (m, 20H); CO-CH2: 4.51-4.76 (m, 4H) ; thymine-CH3: 1.61-1.78 (m, 6H). 22) 5'-MMTr-T-P(ONPE)-T-P(OEt)2 The synthesis was carried out analogously to Example 21 from diethyl N-thymin-1-yl-acetyl-N-(2-hydroxy)ethyl-aminomethanephosphonate (Example 10) and N-thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) -ethylarainomethanephosphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) {Example IS) . Instead of TSNT, 3-nitro-l- (2,4, 6-triiaopropylphenylsulfonyl) -1H-1,2,4-triazole (TIPSNT) was employed for the coupling. Yield: > 90%. For spectroscopic data see Example 21. 23) 5'-HO-T-P(ONPE)-T-P(OEt)2 Synthesis was carried out analogously to Example 4 from "5'-MMTr-T-P(ONPE)-T-P 24) 5'-HO-T-P(OH)-T-P(O-ethyl)2 10 mg (0.012mmol) of n5'-HO-T-P(ONPE)-T-P(OEt)2" (Example 23) were dissolved in 1 ml of a 0.5N solution of DBU in pyridine and stirred first at 4°C for 24 h, then at room temperature for 24 h. The solvent was evaporated in vacuo, and the residue was digested twice with pentane, then twice with ether, then to purify the product it was chromatographed on silica gel (EA/methanol/TEA 9:1:0.2, then 70:30:2, then 60:40:2). Yield: 10.2 mg. MS (FAB): 725.3 (M + 2Na-H)+; 703.3 (K+Na)+. Hl-HHR (200MHz, DMSO, TMS) Characteristic signals are: thymine-H: 7.15-7.70 (m, 2H); CO-CH2: 4.67-4.92 (m, 4H); thymine-CH3: 1.67-1.81 (m, 6H). 25) 5' -MMTr-T-P (ONPE) -T-P (ONPE) -T-P (OEt) 2 The synthesis was carried out analogously to Example 17 from B5'-HO-T-P(ONPE)-T-P(OEt)2- (Example 22) and N-thymin-1-yl-acetyl-N-(4-methoxytriphenylmethoxy)-ethylaminomethanephosphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) (Example 15) with addition of 1.5 eq (based on Example 23) of 4-methoxy-pyridine-N-oxide. To purify the product/ it was chromato-graphed on silica gel (EA/methanol/TEA 90:10:2, then 85:15:2). Yield: 61%. MS (ES + ) : 1555.8 (M+H)+. AN-NMR (200MHz, DMSO, TMS) Characteristic signals are: Ar-H & thymine-H: 6.83-8.20 (m, 25H); CO-CH2: 4.52-4.75 (m, 6H) ; thymine-CH3: 1.61-1.78 (m, 9H). 26) 5'-H0-T-P-(0NPE)-T-P(ONPE)-T-P(0Et)2 The syntheeis was carried out analogously to Example 4 from -5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 25) . To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 70:30:2) . The yield was 89%. MS (ES+): 1283.1 (M+H)+; 1305.0 (M+Na+). 27) 5'-MMTr-T-P(0NPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2 The synthesis was carried out analogously to Example 17 from "5'-HO-T-P-(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 26) and N-thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) -ethylaminomethanephosphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) (Example 15) with addition of 1.5 eq (based on Example 23) of 4-methoxy- pyridine-N-oxide. To purify the product, it was chro-matographed on silica gel (EA/methanol/TEA 90:10:2, then 80:20:2) . Yield: 15%. HS (ES+) : 2007 (M+H) + ; 2029 (M+Na)+. LH-NMR (200MHz, DMSO, TMS) Characteristic signals are: Ar-H & thymine-H: 6.79-8.21 The synthesis was carried out analogously to Example 4 from B5'-MMTr-T-P(ONPE)-T-P{ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 27) . To purify the product, it was chromato-graphed on silica gel (EA/methanol/TEA 70:30:2). The yield was 55%. MS (FAB)t 1735 (M+H)+; 1757 (M+Na)+. 29) 5'-MMTr-T-P(ONPE)-T-P(ONPE)2 The synthesis was carried out analogously to Example 17 from di(4-nitrophenylethyl) N-thymin-1-yl-acetyl-N-(2-hydroxyethyl) aminomethanephosponate (Example 20) and N-thymin-1-yl-acetyl-N-(4-methoxytriphenylmethoxy)ethyl-aminomethanephosphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) (Example 15) . To purify the product, it was chromatographed on silica gel (EA/meth¬anol/TEA 100:10:1, then 90:10:1). Yield: 87%. MS (FAB): 1356.2 (M + 2Li-H)+. XH~NMR (200MHz, DMSO, TMS) Characteristic signals are: Ar-H & thymine-H: 6.82-8.18 (m, 28H); CO-CH2: 4.50-4.71 (mf 4H) ; thymine-CH3: 1.59-1.78 (m, 6H). 30) 5'-HO-T-P(ONPE)-T-P(ONPE)2 The synthesis was carried out analogously to Example 4 from "S'-MMTr-T-P(ONPE)-T-P(ONPE)2" (Example 29) . To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 85:15:1, then 80:20:1). The yield was 78%. MS (ES + ) : 1072.7 (M+H)+. AN-NMR (200MHz, DMSO, THS) Characteristic signals are: Ar-H & thymine-H: 7.08-6.20 (m, 14H); CO-CH2: 4.52-4.80 (m, 4H) ; thymine-CH3: 1.70 (s, broad, 6H). 31) 5/-MMTr-CAn-P(ONPE)-CAll-P(ONPE)-CAn-P(ONPB)2 The synthesis was carried out analogously to Example 17 from N- (N6-anisoyl)cytosin-l-yl-acetyl-N- (4-methoxytri-phenylmethoxy) ethyl aminomethanephosphoni'c acid 2- (p-nitrophenyl)ethyl monoester (triethylammonium salt) (Example 3) and w5' -HO-CAn-PCONPE) -CAn-P (ONPE) 2" (Example 6) . To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 80:19:1). Yield: 66%. MS (FAB): 2155 The synthesis was carried out analogously to Example 4 from "5' -MMTr-CAn-P{ONPE) -CAn-P(ONPE) -CAn-P(ONPE)2" (Example 31) . To purify the product, it was chroma to-graphed on silica gel (EA/methanol/TEA 85:15:1, then 80:20:1). The yield was 70%. MS (*AB>! 1882 (M+H> + ; 1904 (M+Ha)+. 33) Allyl 2- (p-nitrophenyl) ethyl N- phosphonate The synthesis was carried out analogously to Example 17 from N- (N6-anisoyl)cytosin-l-yl-acetyl-N- (4-methoxytri-phenylmethoxy) ethylaminomethanephosphonic acid 2- (p-nitrophenyl)ethyl monoester (triethylammonium salt) (Example 3) and allyl alcohol. To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 95:5:1). MS (ES+): 902.1 (M+H)+; 924.1 (M+Na) + . AN-NMR (200MHz, DMSO, TMS) : 6 - 2.94-3.70 (m, 8H, P-0-CH2-CH2-Ar + MMTr-0-CH2 + N-CH2 + P-CH2); 3.75 (s, 3H, OCH3); 3.86 34) Allyl 2- (p-nitrophenyl)ethyl N- (N6-anisoyl)cytosin-1- yl-acetyl-N-(2-hydroxy)ethylaminomethanephosphonate The synthesis was carried out analogously to Example 4 from allyl 2-(p-nitrophenyl)ethyl N-(N6-anisoyl)cytosin-1-yl-acetyl-N-(4-methoxytriphenylxnethoxy)ethylamino¬methanephosphonate (Example 33). To purify the product, it was chroma tographed on silica gel (EA/methanol/TEA 94:5:1). The yield was 83%. MS (ES+) ! 630.2 35) Allyl 2-(p-nitrophenyl)ethyl N-thymin-1-yl-acetyl-N- (4 -methoxytriphenylmethoxy) ethylaminomethanephoBphonate The synthesis was carried out analogously to Example 17 from N-thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) -ethylaminomethanephosphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) (Example 15) and allyl alcohol. To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 97:3:2). The yield was 100%. MS (FAB): 805.3 (M+Na)*. 36) Allyl 2-(p-nitrophenyl)ethyl N-thymln-1-yl-acetyl-N- {2-hydroxy) ethylaminomethanephosphonate Synthesis analogously to Example 4 from allyl 2- (p-nitrophenyl)ethyl N-thymin-1-yl-acetyl-N-(4-methoxytri-phenylmethoxy)ethylaminomethanephosphonate (Example 35) . To purify the product. It was chromatographed on silica gel (EA/methanol/TEA 90:10:2). The yield was 86%. MS (ES+): 511.1 (M+H)+ 37) 5'-MMTr-T-P(ONPE)-T-P(0NPE)(0-allyl) Synthesis analogously to Example 17 from allyl 2- (p-nitrophenyl)ethyl N-thymin-1-yl-acetyl-N-(2-hydroxy)-ethylaminomethanephosphonate (Example 36) and N-thymin-1-yl-acetyl-N- (4 -methoxytriphenylmethoxy) ethylamino-methanephoaphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) (Example 15) . To purify the product, it was chromatographed on silica gel (EA/metha¬nol/TEA 90:10:2). Yield: 90%. MS (FAB): 1257.3 (M+Na)38) 5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T- P(0Et)2 Synthesis analogously to Example 17 from "5'-HO-T-P (ONPE)-T-P (ONPE)-T-P (ONPE)-T-P (OEt)2«* (Example 28) and N-thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy)ethyl-aminomethanephosphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) (Example 15) . To purify the product, it was chromatographed on silica gel (EA/metha¬nol/TEA 80:20:2). Yield: 57%. MS (FAB): 2460 (M+H)+; 2482 (M+Na)+. 39) 5'-H0-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T- P(OEt)2 Synthesis analogously to Example 4 from "5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 38). To purify the product, It was chromatographed on silica gel (EA/methanol/TEA 70:30:2). The yield was 55%. MS (FAB): 2209 (M+Na)+. 40) 5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OEt)2 4.0 mg (0.00183 mmol) of w5'-HO-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 39) were dissolved in 1.1 ml of a 0.5 molar solution of DBU in pyridine and stirred at room temperature for 24 h. The reaction mixture was evaporated in vacuo and the residue was stirred several times with toluene. The solvent was removed using a syringe, the residue was stirred again with pentane, and the solvent was removed again using a syringe. The product was dried in vacuo. The yield was 4mg of a strongly hygroscopic powder. MS (ES-): 1589.7 (M-H")_; 1611.8 (M+Na-2H)_. 41) 5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T- P(ONPE)-T-P(OEt)2 a) Synthesis analogously to Example 17 from w5'-HO-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 39) and N-thymin-1-yl-acetyl-N- (4-methoxytriphenyl-methoxy)ethylaminomethanephosphonic acid 4-nitrophenyl-ethyl monoester (triethylammonium salt) (Example 15). To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 80:20:2, then 70:30:2). MS (FAB): 2934 (M+Na)+, 2957 (M + 2Na-H) +, 2978 (M + 3Na-2H)+. b) Synthesis analogously to Example 17 from "5'-H0-T-P(ONPE)-T-P(ONPE)-T-P 24.7 mg (0.02 mmol) of "5' -MMTr-T-P (ONPE) -T-P (OKPE) (O-ailyl)" (Example 37) were dissolved in 2 ml of absol. DCM together with 16.2 mg (0.12 mmol) of diethylammonium hydrogencarbonate. At 15-20°C, a solution of 13.9 mg (0.012 mmol) of tetrakis(triphenylphosphine)palladium (0) and 2.1 mg (0.008 mmol) of triphenylphosphine in 2 ml of absol. DCM was added dropwise during the course of 2 min. The mixture was stirred at room temp, for 30 min. To purify the product, the reaction mixture was chromato-graphed on silica gel (EA/methanol/TEA 80:20:1, then 60:40:1). The product fraction was evaporated in vacuo, and the residue was triturated with pentane, then with EA/ether, then again with pentane and dried in vacuo. Yield: 57%. K$ (ES-): 1193.6 (M-H) _ . AN-H-NMR (200MHz, DMSO, TMS) : characteristic signals: 5 = 1.67 & 1.72 (in each case s, 3H, T-CH3) ; 4.60 & 4.82 (in each case s, 2H, CO-CH2) ; 6.83-8.19 (m, 24H, Ar-H, T-H) ; 43) 5'-HO-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T- p(ONPE)-T-P(OEt)2 Synthesis analogously to Example 4 from "5'-MMTr-T-P(ONPE) -T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE) -T-P(OEt)2" (Example 41). After reaction had taken place, the reaction mixture was concentrated, and the residue was coevaporated three times with toluene, then stirred, first with EA/ether, then with pentane. The residue was dried in vacuo. MS (FAB): 2662 (M+Na)+. 44) 5'-HO-T-P(OMPB)-T-P(ONPE)(O-allyl) Synthesis analogously to Example 4 from 5'-MMTr-T-P(ONPE)-T-P(ONPE)(O-allyl) (Example 37). To purify the product, it was chroma tographed on silica gel (EA/methanol/TEA 90:10:1, then 80:20:1). The yield was 87%. MS (FAB): 963.0 (M+H)+; 985.1 (M+Na) + . 45) 5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)(OH) a) 5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)(O-allyl) Synthesis analogously to Example 17 from **5-H0-T-P(0NPE) -T-P(ONPE)(O-allyl)" (Example 44) and N-thymin-1-yl-acetyl-N-(4-methoxytriphenylmethoxy)ethylaminomethane-phosphonic acid 4-nitrophenylethyl monoester (fcriethyl-ammonium salt) (Example 15). To purify the product, it was chroma tographed on silica gel (EA/methanol/TEA 90:10:1, then 85:15:1). Yield: 55% b) 5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)(OH) n5'-MMTr-T-P{ONPE)-T-P(ONPE)-T-P(0NPE)(O-allyl)" (Example 45a) was reacted with tetrakie(triphenylphosphine)-palladium (0) as described in Example 42. To purify the product, it was chroma tographed on silica gel (EA/methan¬ol/TEA 80:20:2, then 70:30:2). The product fraction was evaporated in vacuo, and the residue was triturated with pentane and ether. Yield: 98%. MS (ES+; LiCl): 1654.1 (M+Li+) 46) 5'-MMTr-T-P(0NPE)-T-P(ONPE)-T-P(QNPE)-T-P(OEt)2 Synthesis analogously to Example 17 from diethyl thymin-1-yl-acetyl-N- (2-hydroxy) ethylaminome thane -phosphonate (Example 10) and "5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)(OH)" (Example 45b). To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 90:10:2, then 80:20:2). Working up, purification and characterization as in Example 27. 47) S'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T- P(ONPE)-T-P(0Et)2 Synthesis analogously to Example 17 from w5'-HO-T-P-(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 26) and "5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)(OH)» {Example 45b). To purify the product, it was chroma tographed on silica gel (EA/methanol/TEA 80:20:2). The product fraction was evaporated in vacuo, coevaporated with toluene and purified by preparative HPLC (high-pressure liquid chromatography): RP8 LiChrospher 60, water/aceto-nitrile/ : 1:1; 0.1% ammonium acetate; 1 ml/min. Rf » 12.97 min. 48) 5'-H0-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T- P(OEt)2 a) 5'-HO-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2 Synthesis analogously to Example 4 from "5'-MMTr-T-P(ONPE) -T-P(ONPE) -T-P (ONPE)-T-P(ONPE)-T-P(ONPE) -T-P(OEt)2w (Example 47). To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 70:30:2, then 60:40:2). The product fraction was evaporated in vacuo, and the residue was stirred, first with pentane, then with ether, and dried in vacuo. Yield: 100%. MS (FAB): 2662 (M+Na)+, 2684 (M + 2Na-H)+, 2706 (M + 3Na-2H)+. b) 5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T-P(OEt)2 "5'-H0-T-P(0NPE) -T-P (ONPE)-T-P (ONPB)-T-P (ONPE)-T-P (ONPE)-T-P(0Et)2" {Example 48a) was reacted with DBU and worked up analogously to Example 40. MS (ES-): 1892 (M-H'); 1915 (M+Na-2H)". 49) 5'MMTr-T-P(0NPE) -T-P(ONPE) -T-P (ONPE)-T-P (ONPE)-T- P(ONPE)-T-P-(ONPE)-T-P(OEt)2 Synthesis analogously to Example 17 from n5'-HO-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 28) and "5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE) (OH)" (Example 45b) . To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 80:20:2, then 70:30:2). The product fraction was evaporated in vacuo, coevaporated with toluene and purified by preparative HPLC: RP8 LiChrospher 60, water/acetonitrile: 1:1; 0.1% ammonium acetate; 1 ml/min. Re = 15.24 min. MS (FAB): 3386 (M+Na)+, 3409 (H + 2Na-H)+, 50) 5'-HO-T-P(ONPE) -T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T- P (ONPE) -T-P (ONPE) -T-P (OEt) 2 Synthesis analogously to Example 4 from n5'MMTr-T-P(ONPE) -T-P (ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P-(0NPE)-T-P(OEt)2" (Example 49). To purify the product, it was evaporated in vacuo and coevaporated three times with toluene, and the residue was stirred, first with pentane, then with ether, and dried in vacuo. Yield: > 90%. MS (FAB): 3114 (M+Na) + 51) 5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T- P(OH)-T-P(OEt)2 "5'-HO-T-P (ONPE)-T-P (ONPE)-T-P (ONPE) -T-P (ONPE)-T-P (ONPE) -T-P(ONPE)-T-P(OEt)2" {Example 50} was reacted with DBU and worked up analogously to Example 40. MS (ES-): 2196 (M-H~)~; 2218 (M + Na-2H)-. 52) 5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T- P(ONPE)-T-P-(ONPE)-T-P(ONPE)-T-P-(ONPE)-T-P(OEt)2 Synthesis analogously to Example 17 from "5'-HO-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 48a) and "5' -MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)(OH)" (Example 45b). To purify the product, it was chroma, tographed on silica gel (EA/methanol/TEA 70:30:2, then 60:40:2) . The product fraction was evaporated in vacuo, coevaporated with toluene and purified by preparative HPLC: RP8 LiChrospher 60, water/acetonitrile: 1:1; 0.1% ammonium acetate; 1 ml/min. Rf = 23.95 min. 53) 5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T- P(OH)-T-P-(OH)-T-P(OH)-T-P(OEt)2 a) 5'-HO-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T- P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2 Synthesis analogously to Example 4 from "S'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P-(ONPE)-T-P(ONPE)-T-P-(ONPE)-T-P(OEt)2" (Example 52) . To purify the product, it was evaporated in vacuo and coevaporated three times with toluene, and the residue was stirred, first with pentane, then with ether, and dried in vacuo. Yield: > 90%. b) 5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T- P(OH)-T-P-(OH)-T-P(OH)-T-P(OEt)2 "5' -HO-T-P (ONPE) -T-P (ONPE) -T-P (ONPE) -T-P (ONPE) -T-P (ONPE) -T-P(ONPE)-T-P(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 53a) was reacted with DBU and worked up analogously to Example 40. MS (ES-): 2802 (M-H')'; 2825 (M + Na-2H) ". 54) Di(2-(p-nitrophenyl)ethyl) 2-(N'-tert-butoxycarbonyl-amino) ethylaminomethanephosphonate a) l-Methylimlno-2- (N' -tart-butoxycarbonylamino) ethane (trimer) 2.0 g (12.5 nnnol) of 2-amino-l- (N' -tert-butoxycarbonyl-amino) ethane, dissolved In 8 ml of methanol, were treated with ice cooling with 1.52 ml (18.72 mmol) of 37% form¬aldehyde and the mixture was stirred at room temp, for 1 h. The residue was taken up in EA, washed twice with saturated NaHC03 solution, then with NaCl solution, dried, filtered and evaporated in vacuo. To purify the product, it was chromatographed on silica gel (EA/TEA 100:0.2, then EA/methanol/TEA 90:10:0.2). The yield was 0.8 g. HS (FAB/LiCl) 523.4 (M + 2Li-H)+. AN-NMR (200MHz, DMSO, TMS): 6 - 1.38 (s, 27H, tBu-H); 2.40 (t, 6H, X-CH2); 2.99 (t, 6H, N-CH2); 3.25 (t, 6H, N-CH2) ; 6.81 (t, broad, 3H, NH) . b) 2-Di (2- (p-nitrophenyl)ethyl) 2-(N'-tert-butoxycarbon- ylamino)ethylaminomethanephosphonate l-Methylimino-2-(N'-tart-butoxycarbonylamino)ethane (trimer) (Example 54a) was reacted with di (2-(4-nitro-phenyl)ethyl) phosphite (Example le) analogously to Example If- To purify the product, it was chromatographed on silica gel (first toluene/EA/TEA 20:80:0.2; then EA/TEA 100:0.2, then EA/methanol/TEA 0.5:5:0.2). Yield: 25%. MS(ES+/LiCl) 553.3 (M+H)+, 559.3 M+Li)*, AN-NMR (200MHz, DMSO, TMS): 5 = 1.37 (s, 9H, tBu-H); 2.83 (d, J=12Hz, 2H, P-CH2); 2.55 (t, 4H, Ar-CH2) ; 2.90-3.09 (m, 4H, N-CH2-CH2-N); 4.16 (dt, 4H, PO-CH2) ; 7.52 & 8.15 (in each case d, 8H, Ar-H). 55) Di- (2-(p-nitrophenyl) ethyl N-thymin-1-yl-acetyl-N-(2- N' -tert-butoxycarbonylamino) ethylaminomethanephosponate Synthesis analogously to Example 8 from di(2-(p-nitro¬phenyl) ethyl) 2-(N'-tert-butoxycarbonylamino)ethylamino-methanephosphonate (Example 54b) and thymidin-1-yl-acetic acid. Yield: 86% MS (FAB/LiCl): 725.3 (M+Li)+. AN-NMR (200MHz, DMSO, TMS): 6 * 1.42 (s, 9H, tBu-H); 1.91 (s, 3H, T-CH3) ; 2.99-3.58 (m, 8H, P-0-CH2-£H2-Ar & N-CH2-CH2-N) ;3.75 (d, J»12Hz, 2H, P-CH2); 4.06-4.38 (m, 4H, PO-CH2) ; 7.37 & 8.15 (in each case d, 8H, Ar-H). 56) Interaction with DNA: UV melting curve The interaction of the compounds according to the inven¬tion with complementary nucleic acids was demonstrated by way of example by the recording of the UV melting curve Of "5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P(OEt)2n (Example 53b) with (dA)9. To do this, a 0.3 OD of "5' -HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P(OEt)2" and (dA) 9 in each case was prepared in 1 ml of a buffer (1 H NaCl, 20 mM MgCl2, 10 mM HEPES, pH 7.5) and the change in extinction at 260 nm was recorded as a function of the temperature (0 to 80°C). The results can be seen in FIG 1. A Tm value of about 23°C was determined from the melting curve obtained. 57) Interaction with DNAj gel shift experiment The interaction of the compounds according to the invention with complementary nucleic acids was demonstrated by way of example by the hybridization of n5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P(OEt)2" (Example 53b) with (dA)9 in a gel shift experiment. To do this, M5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P(OEt)2M (Example 53b) and (dA) 9 were in each case applied on their own and mixed in the ratio 1:1, 1:2, 1:5 and 1:10 to a nondenatured polyacrylamide gel (20%, running buffer 1 x TBE, lOmM HgCl2) and the running behavior determined. The results can be seen in FIG. 2: (dA)9 runs faster than "5'-HO-T-P(OH)-T-P(OH)-T-P(OH)-T-P(0H)-T-P-(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P(OEt)2"and in the 1:1 mixture both can only be seen weakly, instead a slower band is formed which corresponds to a complex between the two components. In the 2:1 mixture, (dA)9 can no longer be seen, instead the new band is all the more distinct. The same applies for the 5:1 or 10:1 mixture, in which additionally the distinct excess of »5'-HO-T-P (OH)-T-P (OH)-T-P(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P-(OH)-T-P(OH)-T-P(OEt)2" can be detected. 56) 5'-MMTr-T-P(0NPE)-T-P(OEthyl)2 [see also Example 21, alternative syntheses] a) 8.44 mg (10 ftmol) of N-thymin-1-yl-acetyl-N-(4- methoxytriphenylmethoxy)ethylaminomethanephosphonic acid 4-nitrophenylethyl monoester (triethylammonium salt) (Example 15), 3.77 mg (10 pmol) of diethyl N-thymin-1-yl- acetyl-N-(2-hydroxy)ethylaminomethanephosphonate (Example 10) and 64.6 mg (500 /unol) of N-ethyldiisopropylamine (DIPEA) were dissolved in 0.3 ml of absol. DHF. 44*2 mg (100 ftmol) of benzotriazolyloxy) tris(dimethylamino)- phosphonium hexafluorophosphate (BOP) were added thereto. The mixture was stirred at room temp, for 24h. About 70% yield according to TLC (EA/methanol/TEA 100:20:2; Rf = 0.5). b) Analogously to Example 58a, but using 30ftmol of HATTJ (0- (7-azabenzotriazol-l-yl) -K#N,N' ,N' -tetramethyluronium hexafluorophosphate) instead of 100 junol of BOP. About 65% yield according to TLC. 59) 2-{p-Nitrophenyl)ethyl 5'-(3'-levuloyl) thymidine N- thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) ethyl- aminome thanepho sphonate Synthesis according to Example 17 from N-thymin-1-yl-acetyl -N- (4-me thoxytriphenylmethoxy) ethylaminome thane -phosphonic acid 4-nitrophenylethyl monoester (triethyl-ammonium salt. Example 15) and 3'-levuloylthymidine. To purify the product, it was chromatographed on silica gel (DCM/methanol/TEA 98:2:0.25). The yield was 46%. MS (FAB/LiCl): 1071.4 (M+Li)+. 60) N-Thymin-1-yl-acetyl-N-(4-methoxy- triphenylmethoxy) ethylaminomethanephosphonic acid 2- (p- nitrophenyl)ethyl 5'-thymidine diester 64 mg (0.06 mmol) of 2-(p-nifcrophenyl)ethyl 5'-(3'-levuloyl thymidine N-thymin-1-yl-acetyl-N-(4-methoxytri¬phenylmethoxy) ethylaminomethanephosphonate (Example 59) were dissolved in 0.5 ml of dioxane. 9 mg (0.23 mmol) of NaBH4 in 0.12 ml of water were added and the mixture was stirred at room temperature for 20 min. The solvent was evaporated in vacuo, the residue was taken up in DCM, and the solution was extracted with water and dried. To purify the product, it was chromatographed on silica gel (DCM/methanol/TEA 92:8:0.5). The yield was 72%. MS (FAB/LiCl): 973.4 (M+Li)+, 979.4 (M + 2Li-H)+, 985.4 (M + 3Li-2H)+. 61) N-Thymin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy) - ethylaminomethanephosphonic acid 2-(p-(nitrophenyl)ethyl 5'-thymidin-3'-(cyanoethyl-N,N-diisopropyl phosphoramidite) 31 mg (0.032 mmol) of N-thymin-1-yl-acetyl-N-(4-raethoxytriphenylmethoxy) ethyl aminomethanephoaphonic acid 2-(p-nitrophenyl)ethyl 5'-thymidine diester (Example 60) were coevaporated twice with absol. CH3CN and dissolved in 0.4 ml absol. THF. First 12.4 mg (0.096 mmol) of diisopropylethylamine, then 9.8 mg (0.045 mmol) of cyanoethyl chlorodiisopropylphosphoramidite were added thereto. The mixture was stirred for 3h, filtered and evaporated in vacuo. The yield was 63%. MS (FAB/LiCl): 1173.3 (M+Li)+, 1180.4 (M + 2Li-H)+, 1186.4 (M + 3Li-2H)+. 62) Di(2-(p-nitrophenyl)ethyl) N-[N9-(06-diphenyl- carbamoyl-N2-acetylguanine]acetyl-N- (4-methoxytriphenyl- methoxy) ethylaminomethanephosponate Synthesis analogously to Example 2 from di(2-(p-nitro¬phenyl) ethyl N- (4-xnethoxytriphenylmethoxy) ethylamino-methanephosphonate (Example If) and 06-diphenylcarbamoyl-N2-acetylguanineacetic acid. To purify the product, it was chromatographed on silica gel (EA/TEA 98:2). Yield: 87% MS (FAB/LiCl): 1154.8 (M+H)\ 1160.7 (M+Li)+. 63) Di (2-(p-nitrophenyl) ethyl, N- [N9- (N4-anisoyladenine] - acetyl-N-(4-methoxytriphenylmethoxy)ethylaminomethane¬ phosponate Synthesis analogously to Example 2 from di(2-(p-nitro¬phenyl) ethyl, N- (4-methoxytriphenylmethoxy)ethylamino-methanephosphonate (Example If) and N4-anisoyladenine-acetic acid. To purify the product, it was chromato¬graphed on silica gel (DCM/methanol/TEA 95:4:1). Yield: 82%; MS (ES+): 1035.7 (M+H)+. 1H-NMR (200MHz, DHSO, TMS): 6 o 2.93 (t, 4H, P-0-CH2-£H2-Ar); 3.09 (t, 2H, MMTr-O- CH2); 3.23-3.75 (m, 4H, P-£H2 + N-CH2) ; 3.75 (a, 3H, OCH3); 3.87 (s, 3H, OCH3); 4.08 (dt, 4H, P-0-CH2); 5.28-5.42 phenylmethoxy) ethylaminomethanephosphonicacidmono(2- (p-nitrophenyl)ethyl) ester Synthesis analogously to Example 3 from di (2-(p-nltro-phenyl)ethyl) N- [N9- (N4-anisoyladenine]acetyl-K- (4-methoxytriphenylmethoxy)ethylaminomethanephosponate (Example 63) . To purify the product, it was chroinato-graphed on silica gel (EA/methanol/TEA 65:35:2) . The yield was 52%. MS (PAB/LiCl): 874.3 (2 -methoxy) ethylaminomethanephosphonate Synthesis analogously to Example 2 from di(2-(p-nitro¬phenyl) ethyl) N- (2-methoxy) ethylaminomethanephosphonate (prepared analogously to Example 1 starting from 2-methoxyethylamine by reaction with formaldehyde and di(2- (4-nitrophenyl)ethyl phosphite) and thymidin-1-yl-aeetic acid. To purify the product, it was chromatographed on silica gel (EA/methanol 90:10). Yield: 64% MS (PAB/LiCl): 640.3 (M+Li)+. 66) S'-MMTr-CAn-PtONPEJ-CAn-PtONPE) (OAllyl) Synthesis analogously to Example 17 from N- (N6-anieoyl)-cytosin-1-yl-acetyl-N- (4 -methoxy triphenylmethoxy) ethyl-aminomethanephosphonic acid (2-(p-nitrophenyl)ethyl) monoester (triethylammonium salt) (Example 3) and allyl 2-(p-nitrophenyl)ethyl N- (N6-anisoyl)cytosin-1-yl-acetyl-N- (2-hydroxy)ethylaminomethanephosphonate (Example 34) . To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 85:14:1). Yield: 36%. MS (FAB): 1474 (M+H)+; 1496 (M+Na) +. 67) S'-HO-CAn-PtONPE) -CAn-P(ONPE) (OAllyl) Synthesis analogously to Example 4 from "5'-MMTr-C*"-P(ONPE>-CAn-P(ONPE) (OAllyl)" (Example 66). To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 80:19:1). The yield was 55%. MS (FAB): 1201.3 (M+H)+, 1223.3 (M+Na}+. 68) 5'-MMTr-CAn-P(0NPE)-CAn-P(0NPE)-CAn-P(0NPE) (0-allyl) Synthesis analogously to Example 17 from N-(N6-anisoyl)-cytosin-1-yl-acetyl-N- (4-methoxytriphenylmethoxy)ethyl-aminomethanephosphonic acid 2-(p-nitrophenyl)ethyl monoester (triethylammonium salt) (Example 3) and 5'-HO-CAn-PtONPEj-CAn-PtONPE) (OAllyl) (Example 67). To purify the product, it was chroma tographed on silica gel (EA/methanol/TEA 80:20:1). Yield 58%. MS (FAB): 2046 (M+H)+; 2068 (M+Na)+. 69) S'-MMTr-CAn-PtONPEj-CAn-PtONPE) -CAn-PtONPE) (OH) Synthesis analogously to Example 42 from S'-MMTr-C*11-P(0NPE)-CAn-P(0NPE)-CAn-P(0NPE) (0-allyl) (Example 68) . To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 60:38:2). Yield: 66%. MS (FAB): 2027 (M+Na)+; 2049 (M + 2Na-H)+. 70) 5'-MMTr-CAll-P(0NPE) -CAn-PfONPE) -CAn-PtONPE) -C*11- P(ONPE) -CAn-P(0NPE) -CAn-P(ONPE)2 Synthesis analogously to Example 17 from n5' -MMTr-C*11- P(ONPE) -CAn-PtONPE) -CAn-P 71) 5'-MMTr-T-P(ONPE)-T-P(ONPE) -T-P(ONPE) -CAn-P (ONPE)-C**- P(ONPE) -CAn-PfONPEjj Synthesis analogously to Example 17 from "5'-MMTr-T-P(ONPE)-T-P(ONPE)-T-P(ONPE) (EA/methanol/TEA 60:40:2) . The product fraction was evaporated in vacuo and purified by preparative HPLC (high pressure liquid chromatography): RP8 LiChrospher 60, water/acetonitrile: 1:1; 0.1% ammonium acetate; lml/min) Rf = 16.6 min MS (FAB): 3534 (M+Na)+; 3556 (M+2Na-H)+. 72) 5' -MMTr-T-PtOHJ-T-PtOHJ-T-PtOHJ-CAn-PtOH) -CAn-PfOH) - CAn-P(OH)2 Synthesis analogously to Example 40 from N5'-MMTr-T-P(OKPE) -T-P(ONPE) -T-P(ONPE) -CAn-P (ONPE)-CAn-P (ONPE)-C*"-P(ONPE)2" (2 mg) (Example 71). MS (ES-): 2466.4 (M-H). 73) 5'-MMTr-T-P(OH)-T-P(OH)-T-P(OH)-C-P(OH)-C-P(OH)-C- P(OH)2 About 1 mg of "5' -MMTr-T-P (OH) -T-P(OH) -T-P(OH) -CAn-PCOH) -CAn-PtOHJ-CAn-PtOHjj" (Example 72) was treated with 3 ml of 33% aqueous NH4OH and stirred at room temperature for 24 h. The reaction mixture was evaporated in vacuo. Yield: about 0.6 mg (19 on) MS (ES-): 2064.5 (M-H)". 74) 5'-HO-T-P(OH)-T-P{OH)-T-P(OH)-C-P(OH)-C-P{OH)-C-P(OH)2 8 OD of "5'-MMTr-T-P(OH)-T-P(OH)-T-P(OH)-C-P(OH)-C-P(OH)-C-P{OH)2n (Example 73) were dissolved in 0.5 ml of water and added to a PolyPalc™ (Glen Research, #60-1100-10) . The MMTr group was removed following the instructions of the manufacturer (Glen Research User Guide) . Yield: about 0.35 mg (11 OD). MS (ES-) : 1792.6 (M-H)". 75)5'-MMTr-CAn-P(ONPE)-CAn-P(ONPE) -CAn-PfONPE) -T-P(ONPE)-T-P(ONPE)-T-P(ONPE)2 Synthesis analogously to Example 17 from "5' -MMTr-C*11-P(ONPE) -CAn-PtONPEj-CAn-PtONPE) (OH)" (Example 69) and"5'-HO-T-P-(ONPE)-T-P(ONPE)-T-P(OEt)2" (Example 26). To purify the product, it was chromatographed on silica gel (EA/methanol/TEA 80:20:2, then 70:30:2) . The product fraction was coevaporated with toluene, evaporated in vacuo and triturated with pentane. Yield: 48%. MS (FAB): 3744 WE CLAIM : 1. A compound ot the formula I in which n is a number from zero to 100; B independently o1 one another ts a natural nutiecbasB, an unnatural nucleobase or a reporter ligfind; A-6 can also be a D- or L-amino acid condensed on via trie carboxyl group or peptides consisting of these amino acids having a length of up to 5 amino acid esters, L independently of one another is N or f^N4, and p and q independently of one another are 2era to 5; rands independently of one another are zero loS; 0 and G Independently of one another are CFPR6; D and G Independently of one another are CHH!; R9 is hydrogen; X is -0-; Y is =0, Z is hydroxy), melhoxy, ethoxy, (d-nitrophanyl)ethoxy, propoxy. isopropoxy, butoxy, pentoxy. phenoxy or alh/loxy; 4. The compound ot the formula I as claimed In claims 1 to 3, wherein n is a number from 0 to 25; B Independently of one another is a natural nueleobase; l Is hydroxyl, ethoxy, (4-nltrophenyl)ethoxy or phenoxy; 0 and 0' Independently of one another are hydrogen, Rs, In which R8 la H, (C^CjJ-alkyl, phenyl or 2-(4-nitro-phenyl)sthyl, or are Oligonucleotides which can be unmodified or modified, where a) the 3'- and/or 5'-phosphoric acid dieeter bridges are completely or partially replaced by phosphorothioate bridges; c) the sugar phosphate backbone is completely or partially replaced by "PNAs" or PNA-DNA hybrids; dj the p-D-2'-deoxyrlbose unfts are completefy or partially replaced by 2'-0-methyl-, 2'-0-allyl- or 2'-0-butyl-ribose; e) the natural nucleoside bases are completely or partially replaced by 5-hexynylcytoslne, 5-hexynyluracll, 5-hexynyteytosine, 7-deaza-7-propynylguanine, 7-deaza-7-propynyladenine, 7-deaza-7-methylguanine, 7-d eaza - 7- methy laden i n e, 7-deaze- 7 - brum oguanine,7-deaza-7-bromoadenine. 5. A process for the preparation of compounds of the formula I as claimed in claims 1 - 4, which comprises a,} reacting compounds of the formula III in which D, G, L and X are as defined in claims 1 - 4 and S' is a suitable protective group, such as dlmethoxytrityl, monomethoxytrityl, trltyl, plxyl, lert- butyloxycarbonyl or fluorenylmethyloxycarbonyl, with compounds of the formula IV in which R5 and R6 are as defined in claims 1 -4, In a suitable organic solvent, as herein described at temperatures fromO'C to 100*C. to give compounds of the formula Va or Vb b,) reacting compounds of the formula Va or Vb with compounds of the formula Via or Vlb in which V is as defined In claims 1 • 4, X' and X" independently of one another are defined as X, S2 and S3 independently of one another are protective groups, and L1 is a leaving group, in a suitable organic solvent, as herein described at temperatures from 0eC to 100*C,. if appropriate with addition of bases, complex bases as herein described or uncharged, peralkylated pofyamino-phosphazene bases, to give compounds of the formula VII in which D- G. L. R5, Ft6, S1, Sa, S3, X, X1. X" and V are as defined in claims 1 - 4: c,) reacting compounds of the formula VII with compounds of the formula VIII in which A is as defined in claims 1 - 4, B™ has the same meaning as B, but is optionally L2 present in protected Form, and is a leaving group known to the person skilled in the art, or, if A has (he meaning of formula lib, can also be OH: in a suitable organic solvent, as herein described at temperatures from -20*0 to 10O'C, if appropriate with addition of bases, complex bases or uncharged, peralkylaled polyaminophosphazene bases, or without addition of base and with addition of a coupling reagent as herein described customary for the coupling of peptide bonds, to give compounds of the formula IX In which A.B™, D, G, L, R5, ff.S1. S2, S3, X, X , X* and Y are as defined above; d,) removing the protective group S3 from compounds of the formula IX by known processes compounds of the formula X being obtained in which A, B^, D. G. L. R5, R6, S1. S2, X'. X" and Y are as defined above; e,) removing the protective group S1 from compounds of the formula IX by known processes compounds of the formula XI being obtained in which A, Bf", D, G. L, R6: R6, S2, S3, X, X1, X" and Y are as defined above, [,) reacting compounds of the formula XI with compounds of the formula X according to the "phosphotriesler process" known from oligonucleotide chemistry in a suitable organic solvent, at temperatures from -2Q"C to 100'C, with addition of a coupling reagent or a compound of the formula XII in which R1S is (C6-C18}-aryl, oplionally substituted one to four times by (C^CgJ-alkyl, {CrCe)-alkoxy, nitro, chlorine or bromine end where one to 3 carbon atoms are optionally substituted by heteroatoms, and R16 is a leaving group, optionally with addition of a catalyst, where the preparation of the coupling reagents can be carried out in situ, or else carried out separately and the solution of the activated species can be added in a suitable solvent, to give compounds of the formula XIII tn which A, Bm, D, G, L, R5, H6. S1. &, S3, X. X1, X" and Y are as defined above; g,) starting from compounds ol the formula XIII, repeating the steps e.,) and f,) up to the desired chain length, compounds ot the formula XIV resulting in which A, BPR! D, G, L, Bs, R6, S1, S2, S3, X, X'. X" and Y are as defined above and a is as defined in claims 1 - 4; h,) removing the protective groups S',S2 and S3 and the protective groups on BPH according to known proc¬esses; and optionally introducing the groups 0 and Q' according to processes known to the person skilled in the art, and optionally cyclizing the compounds obtained, whereby compounds of the formula I result. 6. A process (or the preparation of the compounds of the formulates'claimed In claims 1 to 4, In which n & 1 to 100, which comprises, in the compounds of the formulae XV and XVI, in which A. B^.. D, G, L. H5. R6, S', S8, S3, X, X1, X" and Y are as defined in claims 1 - 4, o and p independently of one another are zero to 50 and o + p + 1 = n; aa) in the compounds of the formula XV removing the protective group S1 as described In claim 5 under e,), b2) in the compounds of the formula XVI removing the-protective group S3 as described in claim 5 under d,) and Cj) coupling the resulting compounds with one another as described In claim 5 under f,)r compounds of the (ormula XIV resulting in which A, B^, 0, G. L, R5. He, S\ S2, S3, X, X', X", Y and n are as defined above, d2) and reacting these as described in claim 5 under ht) to give compounds of the formula I. 7. A process tor the preparation ol the compounds of the formula I as claimed in claims 1 to 4. which comprteas a-j) coupling compounds of the Formula X In which A, BPR! 0, G, L, BB, Re, S1, S2, X, X', X" and Y are as defined in claims 1 - 4, to a solid support via s SPACER according to known processes, to give compounds of the formula XVII, in which A, Bm. D, G. L, R5, R*, S\ S2, X, X1, X" and Y are as defined above, SS is a solid support suitable (or solid-phase synthesis, and SPACER is a group removable from the support after synthesis has taken place, such as Is known to the person skilled in the art, or SPACER is Afunctional conjugate molecules Q, which are linked to the solid support via known removable groups', t>3} removing the protective group S1 from compounds of the formula XVII in which A. BPR. 0, G, L Rs. Rfi, S1, S2, SS. SPACER, X, X'. X" and Y are as defined above, as described in claim 5 under e^; Cg) reacting the resulting compound with compounds of the formula X in which A, BPB, D, G, L, R5. RB, S\ S2, X, X", X" and Y are as defined above, as described in claim 5 under I,); 63) repeating ifie steps 63) and C3) up to the desired chain length; ej) optionally coupling conjugates 0' by known processes; (3) removing the compounds produced in this way from the solid support by known processes, and the pro¬tective groups as described in step h,), where the removal of the protective groups can also be carried out before the cleavage from the support, and optionally coupling by conjugates Q by known processes, where the sequence of the coupling of 0 to 0' (e3), l3)) can also be changed, and optionally cyclizing the compound obtained. 8. A compound of the following lormulae: 5'-0LIG0-PMENA; 5-PMENA-OLIGO; 5'-0LIGf>PMENA-0UG0; 5'-OLIGO-(PMENA-OLIGO)a; 5'-PMENA-0LIG0-PMENA; or S-PMENA-IOLIGO-PMENA), in which a is 1 - 20, CLIGO is an optionally modified oligonucleotide, and PMENA is a compound of the formula I as claimed in claims 1 - 4, in which Q and Q' are hydrogen. |
|---|
367-mas-1996 abstract duplicate.pdf
367-mas-1996 claims duplicate.pdf
367-mas-1996 correspondence others.pdf
367-mas-1996 correspondence po.pdf
367-mas-1996 description (complete) duplicate-1.pdf
367-mas-1996 description (complete) duplicate.pdf
367-mas-1996 description (complete)-1.pdf
367-mas-1996 description (complete).pdf
367-mas-1996 drawings duplicate.pdf
| Patent Number | 224297 | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Indian Patent Application Number | 367/MAS/1996 | |||||||||||||||
| PG Journal Number | 47/2008 | |||||||||||||||
| Publication Date | 21-Nov-2008 | |||||||||||||||
| Grant Date | 10-Oct-2008 | |||||||||||||||
| Date of Filing | 08-Mar-1996 | |||||||||||||||
| Name of Patentee | HOECHST AKTIENGESELLSCHAFT | |||||||||||||||
| Applicant Address | D-65926 FRANKFURT AM MAIN, | |||||||||||||||
Inventors:
|
||||||||||||||||
| PCT International Classification Number | C07H21/00 | |||||||||||||||
| PCT International Application Number | N/A | |||||||||||||||
| PCT International Filing date | ||||||||||||||||
PCT Conventions:
|
||||||||||||||||