Title of Invention

A NUCLEIC ACID SEQUENCE AND A METHOD OF PRODUCING A PRODUCT OF INTEREST IN PLANT HOST SYSTEM

Abstract

ABSTRACT 3149/CHENP/2004 A nucleic acid sequence and a method of producing a product of interest in plant host system The present invention relates to a nucleic acid sequence comprising: a first nucleic acid sequence containing the nucleotide sequence that encodes the protein y-zein or a fragment thereof containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the endoplasmic reticulum (ER) of a plant cell; a second nucleic acid sequence containing a nucleotide sequence that encodes an amino acid sequence that is specifically cleavable by enzymatic or chemical means: and a third nucleic acid sequence containing the nucleotide sequence that encodes a product of interest; wherein the 3' end of said fnst nucleic acid sequence is linked to the 5' end of said second nucleic acid sequence and the 3' end of said second nucleic acid sequence is linked to the 5' end of said third nucleic acid sequence.

Full Text

The present invention relates to a nucleic acid sequence and a method of producing a product of interest in host system plants by accumulation thereof in endoplasmic reticulum-derived protein bodies, to nucleic acid encoding such products and to the use of said nucleic acids in the manufacture of constnicts and vectors for transforming host plant systems. A method for expressing and isolating heterologous products of interest, such as calcitonin (CT), in plants, is specifically disclosed. As the demand for biopbarmaceuticals is expected to increase considerably because of the remarkable advances in genome knowledge and in related biomedical research, there is a considerable interest in elaborating low cost recombinant production systems. Genetic engineering of plants to produce biophaxmaceuticals is relatively recent since other transgenic systems including bacteria, ftmgi and cultured mammalian cells, have been largely and for a long time adopted for bioproduction. Nevertheless, some recombinant therapeutic proteins using plant expression system are already on the market or in various stages of human clinical trials like hirudin, an anticoagulant protein to treat thrombosis (Parmenter et al, 1995), a chimeric IgG-IgA vaccine against dental caries (Ma et al, 1998), a bacterial vaccinogen against an enterotoxigenic strain of E. coli (Haq et al., 1995), and a recombinant dog gastric lipase to treat cystic fibrosis (Benicourt et al., 1993). Plant expression systems are attractive because expression level of recombinant proteins can be enhanced by exploiting the innate sorting and targeting mechanisms that plants use to target host proteins to organeils. Moreover plant-derived biopbarmaceuticals can be easily scale up for mass production and have the advantage to minimize health risks arising from contamination with patbogens or toxins. Plants, more and more, appear to be an attractive expression system because of their potential to provide unlimited quantities of biologically active material at low production costs and with reduced health risks. The capacity of plants to accumulate high levels of recombinant proteins and to perform most of post translationa! modifications make them considered as bioreactors for molecular fanning of recombinant therapeutics (for review see Fischer and Emans, 2000). However, important decisions concerning crop species selection, tissues choice, expression and recovery strategies and poattranslational processing are determinant for the feasibility of plant-based production toward commercialization (Cramer et al., 1999). Subcellular targeting of recombinant proteins is an important consideration for high level accumulation and correct assembly and folding of such proteins in plants, Compartimentalization of host proteins into intracellular storage organelles is generally achieved using appropriate signal peptides or whole protein fiisions. A variety of recombinant therapeutic proteins have been adressed to the following compartiments of plants, apoplastic space (McCormick et al., 1999), chloroplasts (Staub et al., 2000), endoplasmic reticulum (ER) (Stoger et al., 2000). Immunoglobulins directed to the ER compartment in transgenic plants have been showed to give lO-lOO fold higher yields than when adressed to others compartments such as the apoplasm or the cytosol (Comad and Fiedler, 1998), The targeting of complex proteins such as antibodies in the ER compartiment is particularly interesting because most of the post-translational modifications required to obtain a functional product take place inside the ER (During et al., 1990; Ma and Hein, 1995; Conrad and Fiedler, 1998). Indeed, within the ER, the signal peptide is cleaved and stress proteins such as the binding IgG protein (BiP) and enzymes such as protein disulphide isomerase (PDI), function as chaperones, bind to the unassembled protein and direct subsequent folding and assembly. In addition to these particular characteristics, available evidence indicates that plant ER is highly flexible making it an ideal reservoir for heterologous pharmaceutical proteins. The ER, even if it appears to be the gateway to the secretory pathway, is also able to store proteins for short or long periods of time. Plants store amino acids for long periods in form of specific storage proteins. One mechanism to protect these storage proteins against uncontrolled premature degradation is to deposit them into ER-derived storage organelles called protein bodies (PB) {for review, Muntz, 1998). The assembly of such organelles as the simple accumulation of recombinant proteins into the ER lumen requires as a first step the retention of the host protein. Secretory proteins when correctly folded and assembled into the ER have a variety of cellular destinations mostly by progression via the Golgi apparatus. However, ER retention of soluble transport-competent proteins ^n be induced by the carboxy-terminal retention/retrieval signal KDEL (or HDEL) (Munro et al, 1987; Wandelt et al., 1992; Vitale et ai., 1993). This conserved C-terminal motif, recognized in the Golgi apparatus through transmembrane receptors, permit the recycling of escaped ER resident proteins back to the ER (Vitale and Denecke, 1999; Yamamoto et al, 2001). Many recombinant antibody fragments have been extended with the KDEL signal in order to be stably accumulated in plants ER (Verch et al., 1998; Torres et al., 1999). An alternate way to generate retention and accumulation of recombinant proteins into the ER compartment is to create an appropriate fusion with a natural ER resident such as a seed storage protein. WO 01/75312 discloses a method for producing a cytokine in a plant host system wherein said plant host system has been transformed with a chimeric nucleic acid sequence encoding said cytokine, said chimeric nucleic acid sequence comprising a first nucleic acid sequence capable of regulating the transcription in said plant host system of a second nucleic acid sequence wherein said second nucleic acid sequence encodes a signal sequence that is linked in reading frame to a third nucleic acid sequence encoding a cytokine and a fourth nucleic acid sequence linked in reading frame to the 3' end of said third nucleic acid sequence encoding a "KDEL" amino acid sequence. Zeins are a group of proteins that are synthesized during endosperm development in com and may be separated in four groups a, p, y and 5, based on their solubility. Zeins can aggregate into PB directly in the ER. Plants or plant tissues comprising rumin stable protein bodies expressed as fusion proteins comprising a full-length zein protein and an operably linked proteinaceous material have been disclosed (WO 00/40738). y-Zein, a maize storage protein, is one of the four maize prolamins and represents 10-15% of the total protein in the maize endosperm. As other cereal prolamins, a and y-zeins are biosynthesized in membrane-bound polysomes at the cytoplasmic side of the rough ER, assembled within the lumen and then sequestrated into ER-derived PB (Herman and Larkins, 1999, Ludevid et al., 1984, Torrent et al., 1986). y-Zein is composed of four characteristic domains i) a peptide signal of 19 amino acids, ii) the repeat domain containing eight units of the hexapeptide PPPVHL (53 aa), iii) the proX domain where prolines residues alternate with others amino acids (29 aa) and iv) Ihe hydrophobic cysteine rich C-terminal domain (11 laa). The ability of y-zein to assemble in ER-derived PBs is not restricted to seeds. In fact, when y-zein gene was constitutively expressed in transgenic Arabidopsis plants, the storage protein accumulated within ER-derived PBs in leaf mesophyl cells (Geli et al, 1994). Looking for a signal responsable for the y-zein deposition into the ER-derived PB (prolamins do not have KDEL signal), it has been demonstrated that the proline-rich N-terminal domain including the tandem repeat domain was necessary for ER retention and that the C-terminal domain was involved in PB formation. However, the mechanisms by which these domains promote the PB assembly are still unknown. Calcitonin (CT), a 32 amino acids hormonal peptide is essential for correct calcium metabolism and has found widespread clinical use in the treatment of osteoporosis, hypercalcemic shock and Paget's disease (Reginster et al., 1993; Azria et al., 1995; Silverman et al., 1997). Human CT is synthetized as a preproprotein with a signal peptide of 25 amino acids and two propeptides at the N- and C-terminus (57 aa and 21 aa respectively). The resultant active peptide is 32 amino acids long with a single disulphide bridge (Cysl-Cys7) and is amidated at the carboxy terminus. In vitro, human CT aggregates which limits its usefulness as a therapeutic. Consequently, salmon CT which is less prone to aggregate is commonly used instead (Cudd et al., 1995). Production of CT is currently achieved by chemical synthesis but the cost of this production encouraged some research groups to explore alternative approaches. Human and salmon CT have been produced in E. coli (Ray et al., 1993; Hong et al., 2000), in mouse pituitary cells (MerH etal., 1996), in nonendocrine cell lines Cos-7 and CHO (Takahashi et al., 1997) and more recently in the milk of transgenic rabbits (McKee etal., 1998). Production of bioactive calcitonin by biotechnological methods requires at least two processing steps: i) generation of a glycine-extended calcitonin (Bradbury et al., 19SS) and ii) formation of a carboxy-terminal prolinamide via the action of the amidation enzyme, peptidyl glycine a-amidating monooxygenase (PAM) (Eipper et al., 1992). Since it is not currently known whether the carboxyl-amidation occurs in plant cells, in vitro amidation of plant glycine-extended calcitonin with the PAM enzyme would provide the C-terminal amide {Ray et al., 1993). SUMMARY OF THE INVENTION The problem to be solved by the present invention is to provide an alternate system for producing peptides and proteins of interest in a plant host system. The solution presented herein is based on the ability of proline rich domains of y-zein to self-assemble and to confer stability to fusion proteins in the ER of a host plant system. The use of a y-zein fusion protein based-system to accumulate a product of interest in a host system plant constitutes a successful approach to accumulate said product of interest within ER-derived PBs of plants. The invention is illustrated in the Example, wherein a fusion protein based-system to accumulate recombinant CT in ER-derived PBs in tobacco plants is described. Various proline rich domains were engineered from y-zein to serve as fusion partners through a cleavable protease site. Mature calcitonin coding region was fused at the C-terminus of the y-zein domains and expressed in transgenic tobacco plants. The fusion proteins were accumulated in ER-derived PBs in tobacco leaves. After purification, the fusion proteins were submitted to enterokinase cleavage permitting the release of calcitonin. Accordingly, an aspect of this invention relates to a nucleic acid sequence comprising (i) a nucleotide sequence encoding the protein y-zein, or a fragment thereof containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the endoplasmic reticulum; (ii) a nucleotide sequence encoding an amino acid sequence that is specifically cleavable by enzymatic or chemical means; and (iii) a nucleotide sequence encoding a product of interest; wherein said nucleotide sequences are operatively linked among them. In another aspect, this invention relates to a nucleic acid construct comprising said nucleic acid sequence. In a fiirther aspect, the invention relates to a vector containing said sequence or construct and to a cell transformed with said vector. In a further aspect, the invention relates to a transformed plant host system having said nucleic acid sequence, construct or vector. In a fiirther aspect, the invention relates to a transgenic plant host system comprising, integrated in its genome, said nucleic acid sequence. In a further aspect, the invention relates to a method for producing a product of interest in a plant host system. In a further aspect, the invention relates to a method for producing calcitonin in a plant host system. In a further aspect, the invention relates to a fusion protein, said fiision protein having an amino acid sequence corresponding to the above mentioned nucleic acid sequence. BRIEF DESCRIPTION OF DRAWINGS Figure 1 shows the nucleotide sequences and translations of y-zein (Figure LA) and y-zein derivatives RX3 (Figure 1 .B, upper), R3 (Figure 1 .B, lower), P4 (Figure 1 .C, upper) and XIO (Figure l.C, lower). Figure 2 shows the nucleotide sequence (lane 2) and translation (lane 1) of synthetic calcitonin (CT). The synthethic CT gene was constmcted using preferential plant codon usage. Codon modifications are underlined in comparation to the wild type salmon CT gene (lane 3). The synthetic gene contains at 5' end a linker sequence corresponding to the enterokinase cleavage site (EK) and is extended at 3' to produce a single C-terminal glycine. Figure 3 shows a schematic outline for the construction of pCRX3CT plasmid. The process represented was the same for the obtention of the following piasmids pCZeinCT, pCR3CT pCP4CT and pCXlOCT, the difference among them being the corresponding y-zein or y-zein derived sequences introduced. The different piasmids are not depicted in proportion. Figure 4 shows a schematic representation of piasmids pBZeinCT, pBRX3CT, pBR3CT, pBP4CT and pBXlOCT. The different piasmids are not depicted in proportion. Figure 5 shows a schematic representation of the different fusions proteins. y-2ein and 7-zein derived domains (RX3, R3, P4 and XIO) were fused to calcitonin (CT) through the enterokinase cleavable site (EK). SP, signal peptide; REPEAT, repeat domain (PPPVHL) eight units; RI, one repeat unit; Pro-X, proline-Xaa; PX, fragment of Pro-X domain; C-term, cysteine rich C-terminal domain; N, N-terminal sequence of the mature protein. Amino acids number for each fusion protein is indicated at rigth. Figure 6 shows Uie results of an immunoblot analysis of the fusion proteins in transgenic tobacco plants using y-zein antiserum. Soluble proteins were extracted from wild type (WT) and transgenic tobacco (To) leaves, separated on 15% SDS-polyacrylamide gels (20 )ig per lane) and transferred to nitrocellulose. Numbers represent the independant transgenic lines obtained for the different chimeric genes, y-zein-CT, RX3-CT, R3-CT, P4-CT. Figure 7 shows: A. Comparative western blot analysis of the different recombinant fusion proteins using CT antiserum. Soluble protein extracts were prepared from wild type plants (WT) and transgenic tobacco lines (Tl) having the maximum fusion protein expression of the related chimeric gene. 8 \xg of soluble proteins were loaded on 15% SDS-polyacrylamide gel and transferred to nitrocellose. B. Comparative northern blot analysis of the different chimeric gene transcripts. Total RNAs were isolated from the transgenic lines analyzed by immunoblot (Figure 7A), fractionated on denaturing formamide gel electrophoresis (30 jxg per lane) and capiilaiy blotted onto nylon membrane. Blots were hybridized with a random primed probe (129 bases) obtained from calcitonin cDNA. Figure 8 shows the subcellular localization of RX3-CT and P4-CT proteins in transgenic tobaco plants: (A) Inununolocalization of RX3-CT protein in KX3-CT transgenic lines using CT antiseram (dilution 1:100). (B) Immunolocalization of P4-CT protein in P4-CT transgenic lines using CT antiserum (dilution 1:100). (C) Immunolocalization of RX3-CT protein in RX3-CT transgenic lines using y-zein antiseram (dilution 1:1.500). (D) Immunolocalization of BiP protein in RX3-CT transgenic lines using BiP antiseram (dilution 1:250). (E) Immunolocalization in wild type plants using y-zein antiseram (dilution 1:1.500). seram. (F) Immunolocalization in RX3-CT transgenic plants without primary antibody (dilution 1:1,500). Immunocytochemistry on tobacco leaf sections was performed by using the primary antibodies indicated and protein A-coUoidal gold (15 imi).cw: cell wall; ch: chloroplast; pb: protein body; v: vacuole. Figure 9 shows the results of the immunoblot analysis of RX3-CT and P4-CT fusion protein EK cleavage. 12 jig of each partially purified fiision protein were incubated with 0.2 U EK during 24 hours at 20'C. Digested fusion proteins were fractionated on 18% Tris-Tricine polyacrylamide gel electrophoresis and transferred to nitrocellulose. Lanes 1, non digested fiision proteins (1 ]ig); lanes 2, digestion products; lanes 3, synthetic salmon CT standard. Figure 10 shows the results of RP-HPLC fractionation of RX3-CT fusion protein digested by EK, pCT released from RX3-CT fusion protein was detected in fraction 3 (Tr ^ 13 min) by TOF-MALDI using synthetic salmon CT as standard. Figure 11 shows the results of TOF-MALDI mass spectrometry characterization of (A) synthetic salmon CT (MW = 3433.24) and (B) plant CT (MW = 3491,93) eluted at Tr -13 min from the RP-HPLC fractionation. DETAILED DESCRIPTION OF THE INVENTION The first aspect of the invention provides a nucleic acid sequence, hereinafter referred to as the nucleic acid sequence of the invention, comprising: a first nucleic acid sequence containing the nucleotide sequence that encodes the protein y-zein, or a fragment thereof containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the endoplasmic reticulum (ER); a second nucleic acid sequence containing a nucleotide sequence that encodes an amino acid sequence that is specifically cleavable by enzymatic or chemical means; and a third nucleic acid sequence containing the nucleotide sequence that encodes a product of interest; wherein the 3' end of said first nucleic acid sequence is linked to the 5' end of said second nucleic acid sequence and the 3' end of said second nucleic acid sequence is linked to the 5' end of said third nucleic acid sequence. The first nucleic acid sequence contains the nucleotide sequence that encodes the protein y-zein, or a fragment thereof containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the ER. The term "y-zein" as used herein refers to a maize storage protein which is composed of the four characteristic domains mentioned previously in the Background of the Invention. Said term includes native y-zein proteins, as well as variants thereof and recombinant y-zein proteins which are capable of directing and retaining a protein towards the ER. Practically any nucleotide sequence encoding a y-zein protein, or a fragment thereof containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the ER, may be used. Accordingly, in a preferred embodiment, the first nucleic acid sequence contains the nucleotide sequence encoding the full-length y-zein protein. In a particular embodiment, the nucleotide sequence encoding a full-length y-zein protein is shown in Figure lA and identified in SEQ ID NO: 1. In another preferred embodiment, the first nucleic acid sequence contains a nucleotide sequence encoding a fragment of y-zein protein, said fragment containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the ER. In this case, the ftrst nucleic acid sequence may contain: - one or more nucleotide sequences encoding all or part of the repetition domain of the protein y-zein; one or more nucleotide sequences encoding all or part of the ProX domain of the protein y-zein; or - one or more nucleotide sequence encoding all or part of the repetition domain of the protein y-zein, and one or more nucleotide sequence encoding all or part of the ProX domain of the protein y-zein. In a particular embodiment, said first nucleic acid sequence contains a nucleotide sequence encoding a fragment of y-zein protein, said fragment containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the ER, selected fi-om the group consisting of - the nucleotide sequence shown in SEQ ID NO: 2 [nucleotide sequence identified asRX3 (Figure IB)], - the nucleotide sequence shown in SEQ ID NO: 3 [nucleotide sequence identified asR3 (Figure IB)], - the nucleotide sequence shown in SEQ ID NO: 4 [nucleotide sequence identified asP4 (Figure IC)], and - the nucleotide sequence shown in SEQ ID NO: 5 [nucleotide sequence identified as XIO (Figure IC)], The second nucleic acid sequence contains a nucleotide sequence that encodes an amino acid sequence that is specifically cleavable by enzymatic or chemical means. In a particular embodiment, said second nucleic acid sequence comprises a nucleotide sequence that encodes a protease cleavage site, for example, an amino acid cleavable site by a protease such as an enterokinase, Arg-C endoprotease, Glu-C endoprotease, Lys-C endoprotease, factor Xa and the like. Alternatively, the second nucleic acid sequence comprises a nucleotide sequence that encodes an amino acid that is specifically cleavable by a chemical reagent, such as, for example, cyanogen bromide which cleaves methionine residues, or any other suitable chemical reagent. The second nucleic acid sequence may be generated as a result of the union between said first nucleic acid sequence and said third nucleic acid sequence. In that case, each sequence contains a number of nucleotides in such a way that when said first and third nucleic acid sequences become linked a functional nucleotide sequence that encodes an amino acid sequence that is specifically cleavable by enzymatic or chemical means, i.e., the second nucleic acid sequence, is formed. In an alternate embodiment, the second nucleic acid sequence is a foreign sequence operatively inserted between said first and third nucleic acid sequence. The third nucleic acid sequence contains the nucleotide sequence that encodes a product of interest. In principle, any product of interest may be expressed by the system provided by the instant invention. In a preferred embodiment, the product of interest is a proteinaceous (i.e., a protein or peptide) drug, for example, a peptide hormone, such as calcitonin, erythropoietin, thrombopoietin, growth hormone and the hke, an interferon, i.e., a protein produced in response to viral infections and as cytokine during an immune response, etc. Preferably, said therapeutic products of interest are effective for treating the human or animal body. In a particular embodiment, the third nucleic acid sequence comprises a nucleotide sequence encoding calcitonin (CT), for example, human calcitonin (hCT) or salmon calcitonin (sCT), In general, in this case, said third nucleic acid sequence, preferably, includes a codon for glycine at the 3' end of said nucleic acid sequence encoding calcitonin thus rendering a glycine-extended calcitonin. According to the invention, the 3' end of said first nucleic acid sequence is linked to the 5' end of said second nucleic acid sequence and the 3' end of said second nucleic acid sequence is linked to the 5' end of said third nucleic acid sequence, i.e., said first, second and third nucleic acid sequences are in reading frame. The nucleic acid sequence of the invention may be obtained by using conventional techniques known for the skilled person in the art. In general, said techniques involve linking different fragments of the nucleic acid sequence of the invention in a suitable vector. A review of said conventional techniques may be found, for example, in "Molecular cloning, a Laboratory Manual", 2"' ed., by Sambrook et al.. Cold Spring Harbor Laboratory Press, 1989. The constraction of some vectors containing a nucleic acid of the invention is disclosed in the Example and illustrated in Figures 3 and 4. As shown therein, various proline rich domains were engineered firom y-zein to serve as fusion partners through a cleavable protease site. Mature calcitonin coding region (32 aa) was fused at the C-terminus of the y-zein domains and expressed in transgenic tobacco plants. The fiasion proteins were accumulated in ER-derived protein bodies in tobacco leaves. After purification, the fusion proteins were submitted to enterokinase cleavage permitting the release of calcitonin which may be further purified from digestion mixture by a reverse phase chromatography. In another aspect, the invention provides a fusion protein, hereinafter referred to as the fusion protein of the invention, comprising (i) the amino acid sequence of the protein y-zein, or a fragment thereof capable of directing and retaining a protein towards the ER, (ii) an amino acid sequence that is specifically cleavable by enzymatic or chemical means, and (iii) a product of interest; said fusion protein being the expression product of the nucleic acid sequence of the invention in a host plant system. The fusion protein of the invention is accumulated in stable, ER-derived PBs, in a host plant system. The enzyraatically or chemically cleavable site, which is present at the C-terminus of y-zein domains, allows to recover the product of interest afterwards. The product of interest may be then isolated and purified by conventional means. Therefore, the fusion protein of the invention constitutes a novel and successful approach to accumulate a product of interest. In an embodiment, the fusion protein of the invention comprises a fiill-length y-zein protein. A specific amino acid sequence of fiill-length y-zein is shown in Figure lA and identified in SEQ ID NO: 6. In another embodiment, the fusion protein of the invention comprises a fragment of a y-zein protein, said fragment containmg an amino acid sequence capable of directing and retaining a protein towards the ER. In a particular embodiment, the fusion protein of the invention comprises a fragment of a y-zein protein, selected from the group consisting of: - the amino acid sequence shown in SEQ ID NO: 7 [amino acid sequence corresponding to RX3 (Figure IB)], - the amino acid sequence shown in SEQ ID NO: 8 [amino acid sequence corresponding to R3 (Figure IB)], - the amino acid sequence shown in SEQ ID NO: 9 [amino acid sequence corresponding to P4 (Figure IC)], and - the amino acid sequence shown in SEQ ID NO: 10 [amino acid sequence corresponding to XIO (Figure IC)]. The fusion protein of the invention contains an amino acid sequence that is specifically cleavable by enzymatic or chemical means. In a particular embodiment, said cleavable site comprises a protease cleavage site, for example, an amino acid cleavable site by a protease such as an enterokinase, Arg-C endoprotease, GIu-C endoprotease, Lys-C endoprotease, factor Xa and the like, or an amino acid cleavable site by a chemical reagent, such as, for example, cyanogen bromide which cleaves methionine residues, or any other suitable chemical reagent. The fusion protein of the invention also contains a product of interest, for example, a proteinaceous (i.e., a protein or peptide) drug, such as a peptide hormone, an interferon, and the like. Preferably, said product of interest is effective for treating the human or animal body. In a particular embodiment, the fusion protein of the invention comprises a calcitonin (CT), for example, an optionally glycine-extended human calcitonin (hCT) or salmon calcitonin (sCT). In a further aspect, the invention provides a nucleic acid construct comprising (i) the nucleic acid sequence of the invention, and (ii) a regulatory nucleotide sequence that regulates the transcription of the nucleic acid of the invention (i), said regulatory sequence (ii) being functional in plants. Said nucleic acid sequences are operatively linked. Practically any plant functional regulatory sequence may be used. In an embodiment, said regulatory sequence (ii) is, preferably, tissi'ite the transcription of the nucleic acid of the invention in a specific tissue, such as seeds, leaves, tubercles, etc. The regulatory sequence (ii) may comprise a promoter functional in plants. Virtually, any promoter functional in plant may be used. In a particular embodiment, said regulatory sequence (ii) comprises the promoter 35SCaMV. In other particular embodiment, said reguiatoiy sequence (ii) comprises the "patatina" promoter, a storage protein promoter, the ubiquitine gene promoter, the regulatory sequences of the y-zein gene, or the like. The regulatory sequence (ii) may also contain a transcription termination sequence. Virtually, any transcription termination sequence functional in plant may be used. In a particular embodiment, said transcription termination sequence comprises the terminator 35SCaMV, the terminator of the octopine sjiithase (ocs) gene, the terminator of the nopaline synthase (nos) gene, the terminator of the y-^ein gene, and the like. The regulatory sequence (ii) may also contain a translation enhancer functional in plant. Virtually, any translation enhancer functional in plant may be used, for example, the promoting sequence for transcription of the tomato etch virus, and the like. The nucleic acid sequence of the invention, or the construct provided by this invention, can be inserted into an appropriate vector. Therefore, in a fiirther aspect, the invention provides a vector comprising the nucleic acid sequence of the invention or a nucleic acid construct provided by the instant invention. Suitable vectors Include plasmids, cosmids and viral vectors. In an embodiment, said vector is suitable for transforming plants. The choice of the vector may depend on the host cell wherein it is to be subsequently introduced. By way of example, the vector wherein the nucleic acid sequence of the invention is introduced may be a plasmid, a cosmid or a viral vector that, when introduced into a host cell, is integrated into the genome of said host cell and is replicated along with the chromosome (or chromosomes) in which it has been integrated. To obtain said vector, conventional methods can be used (Sambrook et al., 1989). In a fiulher aspect, the invention provides a plant host system, said plant host system having been transformed with the nucleic acid of the invention, or with a construct or a vector provided by the instant invention. As used herein, the term "plant host system" includes plants, includmg, but not limited to, monocots, dicots, and, specifically, cereals {e.g., maize, rice, oat, etc.), legumes (e.g., soy, etc.), cruciferous (e.g., Arabidopsis thaliana, colza, etc.) or solanaceous (e.g., potato, tomato, tobacco, etc.). Plant host system also encompasses plant cells. Plant cells includes suspension cultures, embryos, merstematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, seeds and microspores. Plant host system may be at various stages of maturity and may be grown in liquid or solid culture, or in soil or suitable medium in pots, greenhouses or fields. Expression in plant host systems may be transient or permanent. Plant host system also refers to any clone of such plant, seed, selfed or hybrid progeny, propagule whether generated sexually or asexually, and descendents of any of these, such as cuttings or seeds. The transformation of plant host systems may be carried out by using conventional methods. A review of the genetic transfer to plants may be seen in the textbook entitled "Ingenieria genetica and transferencia genica", by Marta Izquierdo, Ed. Piramide (1999), in particular. Chapter 9, "Transferencia genica a plantas", pages 283-316. In a further aspect, the invention provides a transgenic plant host system, engineered to contain a novel, laboratory designed transgene, said transgenic plant host system comprising, integrated in its genome, the nucleic acid of the invention. Said transgenic plant host system may be obtained by means of conventional techniques, for example, through the use of conventional antisense mRNA techniques and/or overexpression (in sense silencing) or others, for example, by using binary vectors or other vectors available for the different plant transformation techniques currently in use. Examples of transgenic plant host systems provided by the present invention include both monocotyledon and dicotyledonous plants, and, specifically, cereals, legumes, cruciferous, solanaceous, etc. The nucleic acid sequence of the invention is useful for producing a product of interest in a plant host system. Therefore, in a further aspect, the invention provides a method for producing a product of interest in a plant host system, which comprises growing a transformed or transgenic plant host system provided by the instant invention, under conditions that allow the production and expression of said product of interest in the form of a fusion protein. As mentioned above, said fusion protein is accumulated in stable, ER-derived PBs, in said host plant system. The enzymatically or chemically cleavable site, which is present at the C-termmus of y-zein domains, allows to recover the product of interest afterwards. The product of interest may be then isolated and purified by conventional means. Accordingly, the method provided by the instant invention further comprises, if desired, the isolation and purification of said fusion protein, and, optionally, the release of said product of interest from said fusion protein. The fusion protein is cleaved at the cleavage site by a suitable enzyme or chemical reagent, as appropriate. In a further aspect, the invention provides a method for producing calcitonin in a plant host system, comprising: a) transforming a plant host system with an expression vector or with a nucleic acid construct, comprising a regulatory sequence for the transcription of a nucleic acid sequence (nucleic acid sequence of the invention) that consists of a first nucleic acid sequence containing the nucleotide sequence that encodes the protein y-zein, or a fragment thereof containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the endoplasmic reticulum (ER); a second nucleic acid sequence containing a nucleotide sequence that encodes an amino acid sequence that is specifically cleavable by enzymatic or chemical means; and a third nucleic acid sequence containing the nucleotide sequence that encodes calcitonin; wherein the 3' end of said first nucleic acid sequence is linked to the 5' end of said second nucleic acid sequence and the 3' end of said second nucleic acid sequence is linked to the 5' end of said third nucleic acid sequence; b) generating complete plants from said plant host systems transformed with said expression vector or nucleic acid constmct; c) growing such transformed plants under conditions that allow the production and expression of calcitonin in the form of a fusion protein; and, if desired d) isolating, purifying said fusion protein and treating said fusion protein in order to release calcitonin. The invention provides, therefore, a fusion protein based system to accumulate recombinant products of interest in ER-derived PBs in plant host systems. The invention is further illustrated by the following non limitative example. EXAMPLE 1 Production of calcitonin in tobacco plants A successful example of CT production in tobacco plants is described below. Various proline rich domains were engineered from y-zein to serve as fusion partners through a cleavable protease site. Mature CT coding region (32 aa) was fused at the C-terminus of the y-zein domains and expressed in transgenic tobacco plants. A cleavable protease site was introduced at the C-terminus of y-zein domains to recover pure calcitonin afterwards. This approach provides a high accumulation of fusion proteins within the ER and the formation of ER-derived PBs in tobacco plants. Fusions proteins were highly accumulated in ER-derived PBs in tobacco leaves. The expression level of said fusion proteins reached, in some cases, up to 12.44% of total soluble proteins. After only two purification steps, the fusion proteins were submitted to enterokinase cleavage permitting the release of calcitonin. Pure calcitonin was obtained from digestion mixture by a reverse phase chromatography. Calcitonin product accumulated in tobacco plants was validated by mass spectroscopy. Fusion proteins puritication, protease digestion and full characterization of the released plant calcitonin (pCT) are also presented. I. EXPERIMENTAL PROCEDURE Construction of chimeric genes and vectors The wild type y-zein gene and four y-zein derived sequences named RX3, R3, P4 and XIO encoding different y-zein domains (Figure lA, IB and IC) were fused with a synthetic CT gene containing an enterokinase digestion site (Figure 2) and introduced in plant transformation vectors as described below and in Figure 3. y-Zein, RX3 and R3 cDNA sequences were generated by PCR using pKSG2 (Torrent et al., 1994) as template. XIO cDNA was amplified from pDR20, a plasmid produced from pKSG2 after deletion of the sequence corresponding to the repeat domain. The primers used for the different PCRs were: for y-zein cDNA sequence: Tl: 5'TCATGAGGGTGTTGCTCGTTGCCCTC3', and T4:5'CCATGGCGTGGGGGACACCGCCGGC3', for RX3 and XIO cDNA sequences: Tland T2: 5'CCATGGTCTGGCACGGGCTTGGATGCGG 3', and for R3 cDNA sequence: Tland T3:5'CCATGGTCCGGGGCGGTTGAGTAGGGTA3'. The PCR products were subcloned into a pUC 18 vector (SureCIone Ligation Kit, Pharmacia) and the resulting plasmids were named pUCZein, pUCRX3, pUCR3 and pUCXlO. The vector pUCP4 which contains the y- zein derived sequence P4 (Figure 10) was obtained during the screening of pUCRX3 derived clones, y-zein, RX3, R3, P4 and XIO cDNA fragments, containing cohesive ends of BspHI and Ncol, were inserted into the vector pCKGFPS65C (Reichel et al., 1996) previously digested with Ncol. This vector was selected because it contains the regulatory sequences for expression in plants and the GFP coding sequence that would be used for parallel targeting studies of y-zein derived proteins in transgenic plants. The vectors generated, pCZeinGFP, pCRX3GFP, pCR3GFP, pCP4GFP and pCXlOGFP contained the following regulatory sequences for expression in plant systems: i) the enhanced 35S promoter derived from the cauliflower mosaic virus {CaMVp35S), ii) the translational enhancer from tomato etch virus (TL) and iii) the transcription-termination sequence from CaMV35S (pA35S). The y-zein derived/CT chimeric constructs were generated by substitution of the GFP coding sequence with the CT synthetic gene as described below (see Figure 3). The synthetic gene encoding the 32 amino acids of active salmon CT (Figure 2) were generated from two 122 bases complementary oligonucleotides. The oligonucleotides were designed to use preferential plant codons in order to achieved high expression in plants. The 5' phosphorilated oligonucleotides synthesized using an Applied Biosystems 394 DNA synthesizer had the following sequences: Call: 5'CATGGACGACGACGACAAGTGCTCCAACCTCTCTACCTGCGTTCTTGGTAAGCT CTCTCAGGAGCTTCACAAGCTCCAGACTTACCCTAGAACCAACACTGGTTCCGGT ACCCCTGGTTGAT 3', Calll: 5'CTAGATCAACCAGGGGTACCGGAACCAGTGTTGGTTCTAGGGTAAGTCTGGAG CTTGTGAAGCTCCTGAGAGAGCTTACCAAGAACGCAGGTAGAGAGGTTGGAGCA CTTGTCGTCGTCGTC3'. After purification on 12% polyacrylamide gel, 60 pmole of each oligonucleotide were used to form the double-strand molecule. Hybridation mixture heated to 95°C for 5 min was maintained at VO^C for 1 hour and let get cold at room temperature. The synthetic cDNA fragment contained Ncol and Xbal cohesive ends at 5' and 3' terminal respectively. The synthetic CT cDNA included a 5' linker sequence corresponding to the enterokinase specific cleavage site ((Asp)4-Lys) and was extended at 3' end to produce a single glycine for further amidation of the CT peptide. The Ncol/Xbal CT cDNA was subcloned into a pUC 18 vector and was then inserted into the Ncol and BamHI restriction sites of the vectors pCZeinGFP, pCRX3GFP, pCR3GFP, pCP4GFP and pCXlOGFP contaming the derived y-zein coding sequences and deleted from the GFP coding sequence. The resulting constructs were named pCZeinCT, pCRX3CT, pCR3CT, pCP4CT and pCXlOCT {Figure 3). Effective plant transformation vectors pBZeinCT, pBRX3CT, pBR3CT, pBP4CT and pBXlOCT (Figure 4) were ultimately obtained by inserting the different Hindlll/Hindlll expression cassettes into the binary vector pBin19 (Sevan, 1984). Stable tobacco plants transformatioii Binary vectors were transferred mto LBA 4404 strains of Agrobacterium tumefaciens. Tobacco {Nicotiana tobaccum, W38) leaf discs were transformed according to the method of Draper et al. (1988). Regenerated plants were selected on medium containing 200 mg/L kanamycin and transferred to a greenhouse. Transgenic tobacco plants having the highest transgene product levels were cultivated for obtention of Tl generation. Developing leaves (approximately 12 cm long) were harvested, immediately frozen with liquid nitrogen and stored at -SO^C for further experiments. Extraction and western blot analysis of recombinant proteins Tobacco leaves were ground in liquid nitrogen and homogenized using 4 ml of extraction buffer (50 mM Tris-HCl pH 8, 200 mM dithiothreitol (DTT) and protease inhibitors (10 p,M aprotinin, 1 ^M pepstatin, 100 |iM leupeptine, 100 )JM phenylmethylsulphonyl fluoride and 100 \\M E64 [(N-{N-(L-3-trans-carboxyoxirane-2-carbonyl)-Lleucyl)-agmantine] per gram of fresh leaf material. The homogenates were stirred for 30 min at 4°C and then centrifiiged twice (15000 rpm 30 min, 4'C) to remove insoluble material. Total soluble proteins were quantified using the Bradford protein assay (Bio-Rad). Proteins were separed on 15% SDS polyaciylamide gel and transferred to nitrocellulose membranes (0.22 |jM) using a semidry apparatus. Membranes were incubated with y-zein antiserum (dilution 1/7000) (Ludevid et al., 1985) or an antiserum raised against KLH-calcitonin (CT-antiserum) (dilution 1/1000) and were then incubated with horseradish peroxidase conjugated antibodies (dilution 1/10000). Immunoreactive bands were detected by enhanced chemiluminescence (ECL westem blotting system, Amersham). Calcitonin antibodies were raised in rabbits by inoculating synthetic salmon calcitonin coupled to KLH. After four inoculations of the antigen (200 |ig each), the sera was collected, aliquoted and stored at -SCC. Sera titration were carried out by immuno-dot blots using synthetic calcitonin and ELISA assays using BSA-calcitonin as antigen. Northera blot analysis Total RNA was isolated ftom wild type and transgenic tobacco (Tl) leaves according to Logemann et al., 1987. RNA was fractionated on denaturing formamide-agarose gel electrophoresis (30 fig per lane) and was capillary blotted onto nylon membrane (Hybond N, Amersham Pharmacia Biotech). RNA blots were hybridized with a 129 bases DNA probe obtained from CT cDNA and labeled with (a-^^P) dCTP using a random primed DNA labeling kit (Roche). Hybridization was carried out overnight at 42'C and filters were washed three times for 15 min in 3X SSC and 0,5% SDS (WfW) at 65°C. Blots were detected with a phosphorlmager scanner (Fluor-S^'^ Multilmager, BIO-RAD). ELISA assays ELISA assays were conducted for plant calcitonin (pCT) quantification on soluble leaf protein extracts and partially purified y-zein-CT fiision proteins. Microtiter plates (MaxiSorp, Nalgene Nunc International) were loaded with soluble proteins (100 (j.1) diluted in phosphate-buffered saline pH 7.5 (PBS) and incubated overnight at 4'C. After washing the wells three times, unspecific binding sites were blocked with 3% bovine serum albumin (BSA) in PBS-T (PBS containing 0.]% Tween 20), one hour at room temperature. The plates were incubated with CT antiserum (dilution 1/1000) for two hours and after four washes with PBS-T, incubated with peroxidase-conjugated secondary antibodies (dilution 1/8000) (Sigma) for two hours. Primary and secondary antibodies were diluted in PBS-T containing 1% BSA. After washing extensively with PBS-T, the enzymatic reaction was carried out at 37'C with 100 |il of substrate buffer (100 mM sodium acetate pH 6, 0,01 mg/ml TMB (3,3',5,5'-tetramethylbenzidine) and 0.01% hydrogen peroxide). The reaction was stopped after 10 min with 2N sulfuric acid and the optica! density was measured at 450 nm using a Muitiskan EX spectrophotometer (Labsystems). The antigen concentration in plant extracts was extrapolated from a standard curve obtained by using calcitonin-BSA and CT antiserum (dilution 1/1000). Electron microscopy Leaves from wild-type and transgenic plants were fixed by vacuum infiltration with 1% glutaraldehyde and 2.5% paraformaldehyde in 20 mM phosphate buffer, pH 7.4 for one hour at room temperature. After washing with 20 mM phosphate buffer and 200 mM ammonium chloride successively, samples were dehydrated through ethanol series and embedded in Lowicryl K4M resin. Immunochemistry was performed essentially as described by Moore et al., 1991. Ultrathin sections were incubated with antisera against, KLH-calcitonin (1/500), aBiP (1/500) and y-zein (1/1500). Protein A-coUoidal gold (gold particles of 15 nm) was used for antibody detection. As a control, parallel incubations were carried out on non-transgenic plant samples using identical dilutions of primary antibodies and on transgenic samples without primary antibody. Sections were stained with uranyl acetate and lead citrate and examined with a model 301 electron microscope (Phillips, Eindhoven, The Netherlans). Purification and enterokinase cleavage of RX3-CT and P4-CT fusion proteins Soluble extracts of RX3-CT and P4-CT were obtained from leaves of transgenic tobaco plants (T!) in extraction buffer as described above. Solid (NH4)2S04 was progressively added at O^C to RX3-CT and P4-CT soluble extracts to 45% and 60% saturation respectively. The samples were stirred for 30 min at O^C and were then centrifuged at 15000 rpm for 45 min at A°C. The precipitated proteins were resuspended in 20 mM Tris-HCl pH 8.6 and desalted on PD 10 column (Sephadex G-25 M, Amersham Pharmacia). Desalted protein extracts were fractionated by Fast Performance Liquid Chromatography (TPLC) using an anion exchange column (HiTrap Q sepharose, Amersham Pharmacia) equilibrated with 20 mM Tris-HCl pH 8.6, 100 mM DTT. Protein elution was carried out with a linear salt gradient from 0 to 200 mM NaCI in 20 mM Tris-HCl pH 8.6, 100 mM DTT. The presence of RX3-CT and P4-CT in eluted fractions was assessed by 15% SDS polyacrylamjde gel electrophoresis and iramunoblot detection using CT antiserum. Positive firactions were desalted and concentrated with 5 K NMWL centrifiigal filters (BIOMAX, MilHpore). Quantification of RX3-CT and P4-CT fusion proteins was performed by ELISA. For EK digestion, 15 jig of partially purified fiision proteins were incubated with 0.2 U EK (EK Max, Invitrogen) in 30 fil of digestion buffer (50 mM Tris-HCl pH8, 1 mM NaCi, 0.1% Tween-20) for 24 hours at 20'C. EK digestion buffer was supplemented with 100 mM DTT. The presence of the reducing agent allows to optimize enterokinase cleavage. Digestion products were analysed on 18% Tris-Tricine polyacrylamide gel electrophoresis and released pCT was detected by immunoblot. SjTithetic salmon CT was used as positive control, PurificatioD and analysis of released pCT Plant calcitonin (pCT) released from fiision proteins by EK digestion was purified by RP-HPLC. Digestion mixture was applied to an analytical RP-C18 column (250 x 4 mm, 10 ]xM. particule size, 120 A pore size) and the column was eluted using a gradient ranging from 25 to 60% acetonitrile with 0.036% TFA in 20 min at a flow rate of 1 ml/min. The firactions collected were concentrated by lyophilization and stored at -20'C for pCT characterization. In a separate experiment, standard salmon CT was eluted under the same chromatographical conditions. TOF-MALDI mass spectrometry was used for pCT characterization. RP-HPLC fi-action aliquots were mixed with equal volume of a matrix solution (10 mg/ml a-cyano-4-hydroxycinnamic acid and 0,1% TFA) and 1 pJ of themixure was deposited on the holder and analyzed with a Voyager-DE-RP mass spectrometer (Applied Biosystems), Standard salmon CT was always used in TOF-MALDI mass spectrometry experiments as a control. C-terminal analysis of the pCT was performed by incubating the purified peptide (20 pmoles/jil) for 60 min at SVC with carboxypeptidase Y (O.lU/pl) and analysis of the digestion products by TOF-MALDI mass spectrometry. II. RESULTS Construction of several derived y-zein-CT chimeric genes The expression and successful assembly of y-zein proline rich domains into ER-derived protein bodies in plant leaves (Geli et al., 1994) provide a valuable tool to accumulate therapeutic proteins in the ER of plant tissues. y-Zein gene was deleted to create various proUne-rich truncated proteins used as fusion partner to produce CT in tobacco plants. The chimeric genes comprised the y-zein domains and a CT synthetic gene linked by a linker corresponding to a protease cleavable site. The synthetic gene encoding the 32 amino acids active salmon calcitonin was generated fi-om two complementary oligonucleotides (122 bases) designed to use preferential plant codons in order to achieve high expression of the recombinant peptide in plants. The synthetic CT cDNA (Figure 2) included at 5' end a linker sequence corresponding to the enterokinase cleavage site ({Asp)4-Lys) and at 3' end an additional codon to produce a glycine. This glycine is a necessary substrate for the amidatlng enzyme (PAM) to generate the C-terminal proHnamide essential for CT biological activity. The calcitonin cDNA was fused to the sequences encoding the y-zein domains in a C-terminal fusion. For optimal expression of the derived y-zein-CT chimeric genes in plant systems., the plant transformation vectors contained the following regulatory sequences i) the constitutive enhanced 35S promoter and the 35S terminator from the cauliflower mosaic virus and ii) the translational enhancer from tomato etch virus (TL). The different fusion proteins generated are represented in Figure 5. The y-zein-CT fiision protein contains the whole y-zein fiised to CT. The RX3-CT, R3-CT, P4-CT and XIO-CT ftision proteins contain the derived y-zein domains linked to CT in the same way as whole y-zein. These fiision proteins differ essentially in the presence or the abscence of the repeat and proX domains. Production of fusion proteins in tobacco plants All the fusion genes were used for stably tobacco plant transformation via Agrobacterium tumefaciens. At least twenty independant kanamycin-resistant plants (To) were regenerated for each fiision gene. The screening of the transgenic plants was performed by western blot analysis of soluble proteins extracts using a y-zein polyclonal antiserum. Transgenic lines immunoblot patterns representative of each fusion gene are shown in the Figure 6. As observed, recombinant fiision proteins were obtained in all transgenic lines with the exception of the XIO-CT fusion gene where no traces of ftision proteins were detected. This small fiision protein (80 amino acids) is probably unstable in tobacco plants. Two immuno-labelled bands were detected in the R3-CT transgenic lines, one with an atypical high apparent molecular mass. This fusion protein was probably subjected to post-traductional modifications such as glycosylation. Indeed, it has been demonstrated that the y-zein proline rich repeat domain is able to be glycosilated when expressed in Arabidopsis plants (Alvarez et al., 1998). Protein expression level was quite variable between the different lines of a same ftision gene with the exception of the RX3-CT fusion gene which showed a high recombinant protein expression level in all transgenic lines. An additional immunofalot screening was carried out using an antiserum specifically raised against the sCT peptide (Figure 7 A). As obsen'ed, the RX3-CT and the P4-CT proteins were sfrongly recognized by the sCT antiserum indicating that these fusions provide a better accumulation of flie CT peptide in tobacco plants. It could be noted that RX3-CT and P4-CT immunoblot patterns displayed several labelled bands, the major band corresponding to the correct apparent molecular mass of the related recombinant protein. One hypothesis could be that the high molecular weight labelled bands were the result of an oligomerization process on y-zein domains which formed during the accumulation of the fiision proteins in plants tissues. In order to check the expression levels of fusion genes in relation to protein levels, a comparative northern blot analysis (Figure 7 B) was performed using the transgenic lines analysed by immunoblot in Figure 7 A. As shown, RX3-CT and P4-CT transcripts were the more abundant demonstrating a stable accumulation of these transcripts. Surprisingly, R3-CT transcripts were relatively abundant in comparison to the low R3-CT fusion protein level detected by immunoblot. Probably , the post-fransiational modification avoid £he correct self-assembly of the fusion protein and subsequently its stability in the ER. Tlie maximum expression level of RX3-CT and P4-CT proteins, measured by ELISA on leaf protein extracts from Tl plants, were respectively 12,44% and 10.65% of total soluble proteins whereas y-zein-CT and R3-CT expression level remained as lower as 0.01 % of total soluble proteins. With regard to these results, RX3-CT and P4-CT transgenic lines were chosen for further experiments conducing to the production of plant calcitonin (pCT). SubceUular localization of fusiou proteins RX3-CT and P4-CT Expression of y-zein and two y-zein deletion mutans in Arabidopsis plants demonstrated that these proteins located within the ER of mesophyl cells forming ER-derived PBs (Geli et al., 1994). It was not evident, however, that the calcitonin fused to y-zein derivatives was sorted to similar organelles, the ER-PBs. To examine the subcellular localization in tobacco leaves of the y-zein fusion proteins containing calcitonin, the inventors used immunoelectron microscopy (Figure 8). Ultra thin sections of transgenic tobacco leaves expressing RX3-CT and P4-CT proteins, were incubated with CT antibody and protein A-gold. A lai^ PB-like organelles strongly labelled were observed in mesophyl cells of tobacco expressing RX3-CT and P4-CT (Figure 8 A and B, respectively). Few vesicles were detected per cell and their size was quite heterogeneous. Since fusion proteins contained calcitonin protein and y-zein fragments, the ultrathin sections were also incubated with y-zein antibody. As was expected, the PBs were labeled with y-zein antibody confimiing that the fusion proteins accumulated inside these organelles (Figure 8 C). To demonstrate that the PBs were formed from the ER, the sections were incubated with an antibody against the ER resident protein, BiP (Figure 8 D). The concomitant occurrence of the CT-fusion proteins and BiP in these organelles indicated that RX3-CT and P4-CT accumulated within the ER lumen to form further independent ER-derived vesicles. Since the inventors were not able to detect PB-like organelles in ultrathin sections of non-transgenic plants (Figure 8 E), the control experiments were performed without primary antibody in transgenic plants (Figure 8 F). As expected no specific label was detected in control experiments. Purification of fusion proteins and release of pCT RX3-CT and P4-CT fusion proteins were effectively extracted from transgenic tobacco leaves (Tl) using an extraction buffer including a reducing agent such as DTT (200 mM). About 85 p-g of RX3-CT and 73 ng of P4-CT were recovered per gram of fresh material. RX3-CT and P4-CT proteins were concentrated respectively by 45% and 60% ammonium sulfate precipitation. The desalted protein extracts were fractionated by FPLC using an anion exchange chromatography and the recovered fusion proteins were quantified by ELISA. RX3-CT protein represented about 80% of total purified proteins whereas P4-CT was only about 50% of total purified proteins. Such difference could be explained by the fact that more proteins precipitate at 60% of ammonium sulfate than at 45% and that consequently the precipitated P4-CT proteins contained much more contaminant proteins. The partially purified fusion proteins RX3-CT and P4-CT were digested by EK and pCT release was controlled by a Tris-Tricine polyaciylamide gel electrophoresis and immunodetection. As shown in Figure 9, a single labelled band corresponding to calcitonin was generated from both RX3-CT and P4-CT protein cleavage. Small amounts of fusion proteins RX3-CT and P4-CT remained undigested probably due to the non accessibility of the enzyme to some cleavage sites. Purification and characterization of pCT Plant calcitonin (pCT) was isolated by fractionation of the EK digestion mixtures on an analytical C18 RP-HPLC column (Figure 10} and analysis of the eluted fractions by TOF-MALDI mass spectrometry using synthetic sCT as standard (MW 3433.24, Figure II. A). pCT calcitonin was eluted at 13 min (synthetic sCT Tr = 14 min) and gave a single spectrum with a mass of 3491.93 Da by TOF-MALDI mass spectrometry that is consistent with the theoretical molecular mass of the reduced C-terminal glycine extented calcitonin (Figure 11 B). Mass spectrometry analysis of pCT subjected to carboxypeptidase Y digestion confirmed die integrity of the C-terminal glycine that is essential to produce the C-terminal proHnamide. III. DISCUSSION A successiul fiision protein-based system to accumulate salmon calcitonin in tobacco plants is presented. Two fusion proteins RX3-Cal and P4-Cal were found to strongly accumulate in ER-derived PBs of tobacco leaves. These fusion proteins contain the CT peptide and the proline rich domains of y-zein which consist in i) the repeat domain composed of eight units of the hexapeptide PPPVHL (only one unit in P4-Cal fusion protein) and ii) the proX domain where proline residues alternate with other amino acids. The y-zein proline rich domains are necessary for the correct retention and assembly of y-zein within Arabidopsis plants ER (Geli et al., 1994). The folding and the stabilization of the y-zein polypeptide chains in the ER have been attributed to the ability of the repeat and proX domains to self-assemble and to promote the formation of oligomers. The particular conformation adopted by these highly hydrophobic domains would be due to the proline rich sequences which are able to form an amphipathic secondary structure. As a result of its proper conformation, the proline rich domains would induce aggregation mechanisms involving protein-protein interactions and disuiphide cross-links conducing to the ER retention and the formation of ER-derived PBs. This example shows that when expressed in a N-terminal fusion manner the y-zein proline rich domains conserve the whole capacity to self-assemble and to promote the complex events which lead to the retention and the accumulation in the ER-derived PBs. The salmon CT involved in the fusion protein was also found to greatly accumulate in the PBs. The high expression level of CT in the transgenic tobacco plants can be attributed to the ability of the proline rich domains to fold and to stabilize the fusion protein. The deposition of the iiision protein in the PBs certainly contribute to the enrichment of the plant tissues in CT by removing it from the hydrolytic intracellular environment. As small peptides are unstable in biological systems the fiision protein approach has been currently used to produce calcitonin in heterologous systems, for example in E. coli (Ray et a!., 1993; Yabuta et al., 1995; Hong et al., 2000), in Staphylococcus carnosus (Dilsen et al, 2000) and in the milk of transgenic rabbits (Mckee et al., 1998). In this last case, the fusion of CT with human alpha lactalburain had also the purpose to mask the calcitonin activity to avoid a possible interference with the normal animal development. Inventors succeeded in rapid production of glycine extended sCT from tobacco plants: i) RX3-CaI and P4-Ca! iusion proteins were efficiently recovered from tobacco tissues because of their high solubility in the presence of reducing agents, ii) enterokinase release of calcitonin from the fusion proteins was accomplished after one purification step of the fiision protein by an anion exchange chromatography, and iii) a reverse phase chromatography led to purified CT by removing it from EK digestion mixture. Mass spectrometry analysis of the released CT confirmed that correct glycine extended CT was produced by the tobacco plants. REFERENCES Alvarez, I., Gelim M.I., Pimentei, E., Ludevid, D., Torrent, M. 1998. Lysine-rich y-zeins are secreted in fransgenic Arahidopsis plants. Planta 205:420-427. Azria, M., Copp, D.H., Zanelli, J.M. 1995. 25 years of salmon calcitonin: from synthesis to therapeutic use. Calcif Tissue Int. 57 (6): 405-408. Benicourt, C, Blanchard, C, Carriere, F., Verger, R. and Junien, J.L. 1993. Potential use of a recombinant dog gastric lipase as an enzymatic supplement to pancreatic extracts in cystic fibrosis, pp. 291-295 in Clinical Ecology of Cystic Fibrosis. Escobar H, Baquero CF, Suarez L (eds), Elsevier Sciences Publishers BV, Amsterdam. Bevan, M. 1984. Binary Agrobacterium vectors for plant transfonnation. Nucleic Acids Research 12: 8711-8721. Bradbury, A.F. and Smyth, D. G. 1988. Biosynthesis of peptide neurotransmitters: studies on the formation of peptide amides. Physiol. BohemosJov. 37:267-274. Conrad, U. and Fiedler, U. 1998. Compartment-specific accumulation of recombinant immunoglobulins in plant cells: an essential tool for antibody production and immunomodulation of physiological functions and pathogen activity. Plant Mol. Biol, 38; 101-109. Cramer, C.L., Soothe, J.G. and Oishi, K.K. 1999. Transgenic plants for therapeutic proteins linking upstream and downstream strategies. Curr. Top. Microbiol. Immunol. 240: 95-118. Cudd, A., Arvinte, T., Das, R.E., Chinni, C. and Maclnfyre, I. 1995. Enhanced potency of human calcitonin when fibrillation is avoided. J. Pharm, Sci. 84: 717-719. DUsen, S., Paul, W., Sandgathe, D., Tippe, R., FreudI, J., Kula, M.R., Takers, C, Wandrey, D. and Weuster-Botz, D. 2000. Fed-batch production of recombinant human calcitonin precursor fusion protein using Staphylococcus carnosus as an expression-secretion system. Appl. Microbiol, Biotechnol. 54; 361-369. Draper, J., Scott, R. and Hamil, J. 1988. In: Plant Genetic Transformation and Gene Expression. A Laboratory Manual (Eds. Draper, J., Scott, R., Armitage, P. and Walden, R.), Blackwell Scientific Publications During, K., Hippe, S., Kreuzaler, F. and Schell, J. 1990. Synthesis and self-assembly of a fiinctionai monoclonai antibody in transgenic Nicotiana tabacum. Plant Mol. Biol. 15: 2SI- 293. Eipper, B.A., Stoffers D.A. and Mains R.E. 1992. The biosynthesis of neuropeptides: peptide a-amidation. Annu. Rev. Neurosci. 15: 57-85, Fischer, R. and Emans, N. 2000. Molecular fanning of pharmaceutical proteins. Transgenic Research 9: 279-299. Geli, M.I., Torrent, M. and Ludevid, M.D. 1994. Two structural domains mediate two sequential events in y-zein targeting: protein endoplasmic reticulum retention and protein body formation. Plant Ceii 6: 1911-1922. Haq, T,A., Mason, H,S., Clements, J.D. and Arntzen, C.J. 1995. Oral immunization with a recombinant bacterial antigen produced in transgenic plants. Science 268; 714-7J 5- Herman, E,M. and Larkias, B.A. 1999. Protein storage bodies. Plant Ceil 11:601-613. Hong, D., MiQgqiaog, Z., Mia, L, Chaagqing, C. and Jifang, M. 2000. production of recombinant salmon calcitonin by amidation of precursor peptide using enzymatic transacylation and photolysis in vitro. Biochem. Biophys. Res.Com. 267: 362-367 Kogan, M.J., Dalcol, I., Gorostiza, P., Lopez-Igiesias, C, Pons, M., Sanz, F., Ludevid, M.D., and Giralf, E. 2001. Self-assembfy of the amphipathic helix (VHLPPP)8. A mechanism for zein protein body formation. J. Mol. Biol. 00: 1-7. Logemann, J., Schell, J., Willmitzer, L. 1987. Improved method for the isolation of RNA from plant tissues. Anal. Biochem. 163: 16-20. Ludevid, M.D., Martinez-Izquierdo, J.A., Armengol, M., Torrent, M., Puigdomenech, P. and Palau, P., J. 1985. Immunological relations between glutelin-2 and low molecular weight zein-2 proteins from maize {Zea mays) endosperm. Plant sci, 41: 41-48. Ludevid, M.D., Torrent, M., Martinez-Izquierdo, J.A., Puigdomenech, P. and Palau, P. 1984. Subcellular localization of glutelin-2 in maize. Plant Mol. Biol. 3: 277-234. Ma, J.K., Hikmat, B.Y., Wycoff, K., Vine, N.D., Chargelegue. D., Yum L., Hein, M.B. andLehner, T. 1998.Characterizationof a recombinant plant monoclonal secretory antibody and preventive immunotherapy in humans. Nat. Med. 4: 601-606. Ma, J.K. and Hein, M.B. 1995. Plant antibodies for immunotherapy. Plant Physiol. 109: 341-346. McCormick, A.A., Kumagai, M.H., Hanley, K., Turpen, T.H., Hakim, I., Grill, L.K,, Tuse, D,, Levy, S, and levy, 8, 1999. Rapid production of specific vaccines for lymphoma by expression of the tumor-derived single-chain Fv epitopes in tobacco plants. Proc. Natl. Aca, Sci. USA 96(2) 703-708. McKee, C, Gibson, A., Dalrymple, M., Emslie, L., Garner, I. and CottiDgharo, I. 1998. Production of biologically active salmon calcitonin in the milk of transgenic rabbits. Nature Biotechnology 16: 647-651. Merli, S., De Faico, S., Verdoliva, A., Tortora, M., Villain, M., Siivi, P., Cassani, G. and Fassiua, G. 1996. An expression system for the single-step production of recombinant human amidated calcitonin. Protein Express. Purif. 7: 347-354. Moore, P.J., Swords, K.M.M., Lynch, M.A. and Staehelin, L.A. 1991. Spatial organization of the assembly pathways of glycoproteins and complex polysaccharides in the Golgi apparatus of plants. J. Cell Biol 112: 589-602. Munro, S. and and Pelham, HJI.B. 1987. A C-terminal signal prevents secretion of luminal ER proteins. Cell 48: 899-907. MUntz, K. 1998. Deposition of storage proteins. Plant Mol. Biol. 38: 77-99. Parmenter, D.L., Boothe, J.G., Van Rooijen, G.J., Yeung, E.C. and Moloney, M.M. 1995. Production of biologically active hirudin in plant seeds using oleosin partitioning. Plant Mol. Biol. 29: n67-l!80. Ray, M.V., Van Duyne, P., Bertelsen, A.H., Jackson, Matthews, D.E., Sturmer, A.M,, Merkler, D.J., Consalvo, A.P., Young, S.D., Gilligan, J.P. and Shields, P.P. 1993. Production of recombinant salmon calcitonin by in vitro amidation of an Escherichia coli produced precursor peptide. Bio/Technology 11: 64-70. Reginster, J.Y. 1993. Calcitonin for prevention and treatment of osteoporosis. Am. J. Med. 95 {5A):44S-47S. Reichel, C, Mathur, J., Eckes, P., Langenkemper, K., Koncz, C, Schell, J., Reiss, B., and Maas, C. 1996. Enhanced green fluorescence by the expression of an Aequorea victoria green fluorescent protein mutant in mono- and dicotyledonous plant cells. Proc. Natl. Acad. Sci. USA 93:5888-5893. Sambrook, J., Fritscb, E., Maniatis, T., 19S9. Molecular Cloning; A laboratory manual. Cols Spring Harbor Laboratory, Cold Spring Harbor, New York. Silverman, S.L. 1997. Calcitonin. Am. J. Med. Sci. 313 (1): 13-16. Staub, J.M., Garcia, B., Graves, J., Hajdukiewicz, P.T., Hunter, P., Nehra, N., Paradkar, V., Schlittler, M., Caroll, J.A., Spatola, L., Ward, D., Ye, G. and Russell, D.A. 2000. High-yield production of a human therapeutic protein in tobacco chloroplasfs. Nature Biotechnology 18: 333-338. Stager, E., Vaquero, C, Torres, E., Sack, M., Nicholson, L., Drossard, J., Williams, S., Keen, D., Perrin, Y., Christou, P. and Fischer, R. 2000. Cereal crops as viable production and storage systems for pharmaceutical scfv antibodies. Plant Mol. Biol. 42: 583-590. Takahashi, K.I., Liu, Y.C, Hayashi, N., Goto, F., Kato, M., Kawashima, H. and Takeuchi, T. 1997. Production of bioactive salmon calcitonin from the nonendocrine cell lines COS-7 and CHO. Peptides 18: 439-444. Torrent, M., Poca, E., Campos, N., Ludevid, M.D. and Palau, J. 1986. In maize, glutelin- 2 and low molecular weight zeins are synthesized by membrane-bound polyribosomes and translocated into microsomal membranes. Plant Mol. Biol. 7: 393-403. Torrent, M., Geli, M.I., Rulr-Avila, L., Canals, JM., Puigdomenecb, P. and Ludevid, D. 1994. Role of structural domains for maize g-zein retention in Xenopus oocytes. Planta 192: 512-518. Torres, E,, Vaquero, C, Nicholson, L., Sack, M., Stoger, E., Drossard, J., Cliristou, P., Fischer, R. and Perrin, Y. 1999. Rice cell culture as an alternative production system for iijnctional diagnostic and therapeutic antibodies. Transgenic Research 8 ; 441-449. Verch, T., Yusibov, V. and Koprowski, H. 1998 Expression and assembly of a full-length monoclonal antibody in plants using a plant vims vector. J. Immunol. Methods 220: 69-75. Vitale, A,, Ceriotti, A. and Denecke, J. 1993. The role of the endoplasmic reticulum in protein synthesis, modification and intracellular transport. J. Exp. Bot. 44: 1417-1444. Vitale, A. and Denecke, J. 1999. The endoplasmic reticulum-gateway of the secretory pathway. Plant Cellll: 6I5-62S. Wandelt, C.I., Khan, M.R.I., Craig, S., Scbroeder, H.E., Spencer, D. and Higgins, T.J.V. 1992. Vicilin with carboxy-terminal KDEL is retained in the endoplasmic reticulum and accumulates to high levels in the leaves of transgenic plants. Plant J. 2: 181-192. Yabuta, M., Suzuki, Y. and Ohsuye, K. 1995. High expression of a recombinant human calcitonin precursor peptide in Escherichia coli. Appl. Microbiol. Biotechnol. 42 (5): 703- 708. Yamamoto, K., Fujii, R., Toyofuku, Y., Saito, T., Koseki, H., Hsu V.W. and Aoe, T. 2001. The KDEL receptor mediates a retrieval machanism that contributes to quality control at the endoplasmic reticulum. EMBO J. 20 (12): 3082-3091. WE CLAIM: 1. A nucleic acid sequence comprising: a first nucleic acid sequence containing the nucleotide sequence that encodes the protein y-zein or a fragment thereof containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the endoplasmic reticulum (ER) of a plant cell; a second nucleic acid sequence containing a nucleotide sequence that encodes an amino acid sequence that is specifically cleavable by enzymatic or chemical means: and a third nucleic acid sequence containing the nucleotide sequence that encodes a product of interest; wherein the 3' end of said first nucleic acid sequence is linked to the 5' end of said second nucleic acid sequence and the 3' end of said second nucleic acid sequence is linked to the 5' end of said third nucleic acid sequence. 2. The nucleic acid sequence according to claim 1 wherein said first nucleic acid sequence comprises a nucleotide sequence that encodes the full-length y-zein protein. 3. The nucleic acid sequence according to claim 1, wherein said first nucleic acid sequence comprises one or more nucleotide sequences encoding all or part of the repetition domain of the protein y-zein; one or more nucleotide sequences encoding all or part of the ProX domain of the protein y-zein, or one or more nucleotide sequence encoding all or pari of the repetition domain of the protem y-zein, and one or more nucleotide sequences encoding all or part of the ProX domain of the protein y-zein. 4. The nucleic acid sequence according to claim 1, wherein said first nucleic acid sequence is chosen from the following group; the nucleotide sequence shown in SEQ ID NO: 1 [nucleotide sequence that encodes y-zein (Figure lA)], the nucleotide sequence shown m SEQ ID NO: 2 [nucleotide sequence identified as RX3 (Figure IB)], the nucleotide sequence shown in SEQ ID NO: 3 [nucleotide sequence identified as R3 (Figure IB)], the nucleotide sequence shown in SEQ ID NO: 4 [nucleotide sequence identified as P4 (Figure IC)], and the nucleotide sequence shown in SEQ ID NO: 5 [nucleotide sequence identified as XIO (Figure IC)]. 5. The nucleic acid sequence according to claims 1 to 4, wherein said second nucleic acid sequence comprises a nucleotide sequence that encodes an amino acid sequence that defmes a protease cleavage site. 6. The nucleic acid sequence according, to claim 5, wherein said protease is an enterokinase, an Arg C endoprotease, a Glu-C endoprotease, a Lys-C endoprotease or factor Xa. 7. The nucleic acid sequence according to claims 1 to 4, wherein said second nucleic acid sequence comprises a nucleotide sequence that encodes an amino acid that is specifically cleavable by a chemical reagent. 8. The nucleic acid sequence according to claim 7, wherein said chemical reagent is cyanogen bromide. 9. The nucleic acid sequence according to claims 1 to 8, wherein said product of interest is a proteinaceous drug. 10. The nucleic acid sequence according to claim 9, wherein said proteinaceous drug is a peptide hormone or an interferon, said drug being effective for treatmg the human or animal body. 11. The nucleic acid sequence according to claim 10, wherein said peptide hormone is selected from calcitonin, erythropoietin, thrombopoietm and growth hormone. 12. The nucleic acid sequence according to claim 1, wherein said third nucleic acid sequence comprises a nucleotide sequence encodmg calcitonin and a codon for glycine at the 3' end of said nucleic acid sequence encoding calcitonin. 13. A fusion protein comprising: (i) the amino acid sequence of the protein y-zein, or a fragment thereof capable of directing and retaining a protein towards the ER of a plant cell, (ii) amino acid sequence that is specifically cleavable by enzymatic or chemical means, and (iii) a product of interest: said fusion protein being the expression product of the nucleic acid sequence of any of claims 1 to 12 in a host plant system. 14. The fusion protein according to claim 13, comprising a full-length y-zein protein. 15. The fusion protein according to claim 14, comprising the amino acid sequence shown in Figure lA and identified in SEQ ID NO: 6. 16. The fusion protein according to claim 13, comprising a fragment of a y-zein protein, said fragment containing an amino acid sequence capable of directing and retaining a protein towards the ER of a plant cell. 17. The fusion protein according to claim 16, comprising a fragment of a y-zein protein selected from the group consisting of: the amino acid sequence shown in SEQ ID NO; 7 [amino acid sequence corresponding to RX3 (Figure IB), the amino acid sequence shown in SEQ ID NO: 8 [amino acid sequence corresponding to R3 (Figure IB)], the amino acid sequence shown in SEQ ID NO: 9 [amino acid sequence corresponding to P4 (Figure IC)], and the amino acid sequence shown in SEQ ID NO: 10 [amino acid sequence corresponding to XIO (Figure IC)]. 18. The fusion protein according to claim 13, wherein said amino acid sequence that is specifically cleavable by enzymatic means comprises a protease cleavage site. 19. The fusion protein according to claim 13, wherein said amino acid sequence that is specifically cleavable by chemical means comprises a cleavage site cleavable by a chemical reagent. 20. The fusion protein according to claim 13, wherein said product of interest is a proteinaceous drug. 21. A nucleic acid construct comprising (i) a nucleic acid sequence according to any of claims 1 to 12, and (ii) a regulatory nucleotide sequence that regulates the transcription of the nucleic acid of the invention (i), said regulatory sequence (ii) being functional in plants. 22. The construct according to claim 21, wherein said regulatory sequence (ii) is tissue-specific. 23. The construct according to claim 21, wherein said regulatory sequence (ii) comprises a promoter functional in plants. 24. The construct according to claim 22, wherein said regulatory sequence (ii) comprises the promoter 35ScaMV, the "patatina" promoter, a storage protein promoter, the ubiquitine gene promoter or the regulatory sequences of the 7-zein gene. 25. The construct according to claim 21, wherein said regulatory sequence (ii) comprises a transcription termination sequence functional in plants. 26. The construct according to claim 25, wherein said regulatory sequence (ii) comprises the terminator 35SCaMV, the terminator of the octopine synthase (ocs) gene, the terminator of the nopalme synthase (nos) gene or the termmator of the y-zein gene. 27. The construct according to claim 21, wherein said regulatory sequence (ii) further comprises a translation enhancer functional in plant. 28. The construct according to claim 27, wherein said translation enhancer functional in plant comprises the promoting sequence for transcription of the tomato etch virus, and the like. 29. A vector comprising a nucleic acid sequence accordii^ to any of claims 1 to 12, or a nucleic acid construct according to any of claims 21 to 28. 30. A method for producing a product of interest in a plant host system, which comprises growing (i) a transformed plant host system, said plant host system having been transformed with a nucleic acid sequence according to any of claims 1 to 12, or with a nucleic acid construct according to any of claims 21 to 28, or with a vector according to claim 29 or (ii) a transgenic plant host system, said transgenic plant host system comprising, integrated in its genome, a nucleic acid sequence according to any of claims 1 to 13, under conditions that allow the production and expression of said product of interest in the form of a fusion protein. 31. Method for producing a fusion protein which comprises a) growing (i) a transformed plant host system, said plant host system having been transformed with a nucleic acid sequence according to any of claims 1 to 12, or with a nucleic acid construct according to any of claims 21 to 28, or with a vector according to claim 29 or (ii) a transgenic pfant host system, said transgenic plant host system comprising integrated in its genome, a nucleic acid sequence according to any of claims 1 to 13, under conditions that allow the production and expression of said product of interest in the form of a fusion protein, b) isolating and purifying said fusion protein. 32. Method for producing a protein which comprises a) growing (i) a transformed plant host system said plant host system having been transformed with a nucleic acid sequence according to any of claims 1 to 12, or with a nucleic acid construct according to any of claims 21 to 28, or with a vector according to claim 29 or (ii) a transgenic plant host system,- said transgenic plant host system comprising, integrated in its genome, a nucleic acid sequence according to any of claims 1 to 13, under conditions that allow the production and expression of said product of interest in the form of a fusion protein, b) isolating and purifying said fusion protein and c) releasing the product of interest from said fusion protein. 33. The method according to claims. 30 to 32, wherein said plant host system is a monocot or a dicot plant. 34. The method according to claim 33, wherein said plant host system is a cereal, a legume, a cruciferous or a solanacea. 35. The method according to claims 30 to 34, wherein the plant host system comprises a seed. 36. A method of producing calcitonin in a plant host system, comprising a) transforming a plant host system with an expression vector or with a nucleic acid construct, comprising a regulatory sequence for the transcription of a nucleic acid sequence (nucleic acid sequence of the invention) that consists of: a first nucleic acid sequence containing the nucleotide sequence that encodes the protein 7-zein, or a fragment thereof containing a nucleotide sequence that encodes an amino acid sequence capable of directing and retaining a protein towards the endoplasmic reticulum (ER) of a plant cell; a second nucleic acid sequence containing a nucleotide sequence that encodes an amino acid sequence that is specifically cleavable by enzymatic or chemical means and a third nucleic acid sequence containing the nucleotide sequence that encodes calcitonin, wherein the 3' end of said first nucleic acid sequence is linked to the 5' end of said second nucleic acid sequence and the 3' end of said second nucleic acid sequence is Unkedtothe 5' end of said third nucleic acid sequence: b) generating complete plants from said plant host systems transformed with said expression -vector or nucleic acid construct; c) growmg such transformed plants under conditions that allow the production and expression of calcitonin in the form of a fusion protein; and, if desired. d) isolating, purifying said fusion protein and treating said fusion protein in order to release calcitonin.

Documents:

3149-chenp-2004 abstract-duplicate.pdf

3149-chenp-2004 abstract.pdf

3149-chenp-2004 claims-duplicate.pdf

3149-chenp-2004 claims.pdf

3149-chenp-2004 correspondence-others.pdf

3149-chenp-2004 correspondence-po.pdf

3149-chenp-2004 description (complete)-duplicate.pdf

3149-chenp-2004 description (complete).pdf

3149-chenp-2004 drawings.pdf

3149-chenp-2004 form-1.pdf

3149-chenp-2004 form-18.pdf

3149-chenp-2004 form-26.pdf

3149-chenp-2004 form-3.pdf

3149-chenp-2004 form-5.pdf

3149-chenp-2004 pct.pdf

3149-chenp-2004 petition.pdf