Indian Patents
Title of Invention

MACROLIDE-CONJUGATES WITH ANTI-INFLAMMATORY ACTIVITY
Abstract The present invention relates to macrolide conjugate-steroid derived compounds of Formula I: wherein D, L and M are as defined in the specification.
Full Text This invention relates to macrolide conjugate-steroid derived
compounds of formula I
Priority Claim: This Application claims priority to Croatian patent application HR
P20030324 filed April 24, 2003 herein incorporated by reference in its entirety.
Summary of the Invention
The present invention relates to: a) new compounds represented by the structure I:

wherein M represents a macrolide subunit derived from macrolides, possessing the
property of accumulation in inflammatory cells, D represents either a steroid subunit
or nonsteroidal subunit derived from nonsteroidal anti-inflammatory drugs (NSAID),
and L represents a chain linking M and D; b) their pharmacologically acceptable salts
and solvates; c) processes and intermediates for their preparation and d) their activity
and use in the treatment of inflammatory diseases and conditions in humans and
animals. Specifically the macrolide subunit is an azithromycin aglycone subunit and
the linkage to D is effected via the linker L through the nitrogen at position 9a of the
aglycone subunit.
Background of the Invention
Anti-inflammatory medicaments can be classified into those of steroid and of
nonsteroidal type. Steroid anti-inflammatory compounds are still the most effective
ones in the treatment of inflammatory diseases and conditions such as: asthma,
chronic obstructive pulmonary disease, inflammatory nasal diseases such as allergic
rhinitis, nasal polyps, intestinal diseases such as Crohn's disease, colitis, ulcerative
colitis, dermatological inflammations such as eczema, psoriasis, allergic dermatitis,
neurodermatitis, pruritis, conjunctivitis and rheumatoid arthritis. In addition to
excellent potency and effectiveness, medicaments of this type also possess numerous
unfavourable side-effects, (e.g. disturbance of carbohydrate metabolism, decreased
calcium resorption, decreased excretion of endogenous corticosteroids and
disturbance of physiological functions of the pituitary gland, adrenal cortex and
thymus. Steroids present on the market are highly effective against inflammatory
conditions and processes whereas their systemic side-effects are diminished. Patent
applications WO 94/13690; 94/14834; 92/13872 and 92/13873 describe the so-called
"soft" steroids or hydrolysable corticosteroids designed for topical application at the
inflammation site, whereas their systemic side-effects are diminished due to the
hydrolysis in the serum, wherein the active steroid very rapidly hydrolyses into the
inactive form. An ideal steroid, however, without unfavourable effects in a long-term
and continuous treatment as required for the control of diseases such as asthma or
Crohn's disease has yet to be found, so that there are intense efforts on the discovery
and development of steroids with improved therapeutic profile.
Macrolide antibiotics accumulate preferentially within different cells of subjects,
especially within phagocyte cells such as mononuclear peripheral blood cells, and
peritoneal and alveolar macrophages. (Gladue, R. P. et al, Antimicrob. Agents
Chemother. 1989, 33, 277-282; Olsen, K. M. et al, Antimicrob. Agents Chemother.
1996, 40, 2582-2585). Inflammatory effects of some macrolides have been described
in the literature, although their effects are relatively weak. For example, the anti-
inflammatory effect of erythromycin derivatives (J. Antimicrob. Chemother. 1998, 41,
37-46; WO Patent Application No. 00/42055) and azithromycin derivatives has been
described (EP Pat. Br. 0283055). Anti-inflammatory effects of some macrolides are
also known from in vitro and in vivo studies in experimental animal models such as in
zymosan-induced peritonitis in mice (J. Antimicrob. Chemother. 1992, 30, 339-348)
and endotoxin-induced neutrophil accumulation in rat trachea (J. Immunol. 1997, 159,
3395-4005). The modulating effect of macrolides upon cytokines such as interleukin 8
(IL-8) (Am. J. Respir. Crit. Care. Med. 1997, 156, 266-271) and interleukin 5 (IL-5)
(EP Pat. Br. 0775489 and EP Pat. Br. 771564) is known as well.
HR Patent Application No. 20010018, WO 04/005309, WO 04/005310 and WO
02/05531 herein incorporated by reference in their entireties describe compounds of
the form:

wherein M represents a macrolide subunit possessing the property of accumulation in
inflammatory cells, A represents an anti-inflammatory subunit which can be steroid or
nonsteroidal and L represents a chain linking M and A, and improved therapeutic
action of these compounds in the treatment of inflammatory diseases and conditions
The macrolide portion of the conjugate has always one or two sugar moities
Compounds in which the steroid or nonsteroidal subunit are linked to the macrolide
subunit, via the macrolide nitrogen having only the aglycone moiety, without sugar
substituents either in C/3 or C/5 position, also possessing the earlier mentioned
therapeutic action, have hitherto not been described.
Detailed Description of the Invention
A characteristic of compounds represented by Formula I is selective accumulation in
target organs and cells in the above mentioned inflammatory diseases and conditions.
These pharmacokinetic properties, enable the compounds represented by Formula I to
act at the inflammation site in inflammation cells by inhibiting the production of
inflammation mediators. In such a manner, the unfavourable systemic side-effects of
corticosteroids or non-steroidal anti-inflammatory molecules are avoided and the
therapeutic action of either the steroid or the NSAID moiety is targeted to the area
where it is most needed. Following local or systemic application molecules rapidly
accumulate in inflammation cells wherein they act by inhibiting the production of
cytokines and chemokines and/or other inflammatory mediators thus suppressing the
inflammation.
According to the known and established state of the art, compounds represented by
Formula I, which are the object of the present invention, their pharmacologically
acceptable salts, pharmaceutical compositions comprising them, and processes for
malting them have hitherto not been described. None of the compounds which are the
object of the present invention has been described either as anti-inflammatory
substance or as an inhibitor of eosinophilic accumulation in inflammation tissues.
In one aspect, the present invention relates to:
a) compounds represented by Formula I:

I
wherein M represents a macrolide subunit with substructure II:

wherein
R1, R2 , R3, R4 and R5 are, independently of each other, hydrogen or groups such as
C1-C4 alkyl (preferably methyl), alkanoyl (preferably acetyl), alkoxycarbonyl
(preferably methoxycarbonyl or tert-butoxycarbonyl), aryhnethoxycarbonyl
(preferably benzyloxycarbonyl), aroyl (preferably benzoyl), arylalkyl (preferably
benzyl), alkylsilyl (preferably trimethylsilyl) or alkylsilylalkoxyalkyl (preferably
trimethylsilylethoxymethyl);
In another aspect R1, R2, R3, R4 and R5 are independantly chosen from the group
consisting of C1-C4 alkyl and hydrogen.
In another aspect R1, R2, R3, R4 and R5 are independantly chosen from the group
consisting of methyl and hydrogen.
Rn represents the covalent link with X1 of chain L;
L represents a linker chain with substructure III:
-X1-(CH2)m-Q-(CH2)n-X2-
III
wherein
X1 is -CH2- or -C(O)-;
X2 is -NH- or -O-;
Q is -NH- or -CH2-;
m and n are, independently, integers from zero to 4;
with the proviso that if Q=NH, n cannot be zero;
In another aspect X1 is CH2 and X2 is NH.
In another aspect of the invention m=l, 11= 1 and Q=CH2
This definition of the linking group is preferred not only for conjugates of
nonsteroids and macrolides of Formula II but for any conjugate within Formula I.
Other linking groups can be used as long as they provide the necessary spacer and can
serve to link one subunit of the Formula 1 with the other, as is well-known in the art.
For example at U.S. Patent 6,297,260, which is incoiporated by reference in its
entirety, at claim 1 and the specific list of NSAIDs contained therein.
D represents a nonsteroidal subunit derived from nonsteroidal anti-inflammatory
drugs (NSAID) or a steroid subunit preferably a steroid of substructure IV:
wherein
Ra, Rb, independently, are hydrogen or halogen;
Rf is hydrogen, hydroxyl group or halogen (preferably chlorine) or forms a C=O
(carbonyl) group with the carbon atom to which it is linked;
Rc is the covalent link with X2 of chain L;
Rd and Re, independently, are hydrogen, hydroxy, methyl or C1-C4 alkoxy (preferably
methoxy or n-propoxy) or together with the pertaining C-atoms represent 1,3-
dioxolane ring which can be additionally alkyl or alkenyl mono or di-substituted
(preferably 2,2-dimethyl or 2-imonopropyl or trans-propenyl ring)
RJ is hydrogen or halogen (preferably chlorine).
In another aspect the present invention relates to compounds of Formula IV
chosen from the group consisting of
In another aspect, the present invention relates to processes for preparation of
the foregoing compounds and to intermediates which may be used in such
preparation.
hi a third aspect, the present invention relates to combinations of one or more
of the foregoing compounds in quantities sufficient for suppression of inflammatory
processes; (e.g. two or more NSAED conjugates of the invention, two or more steroid
conjugates of the invention, two or more compounds of the invention with at least one
being an NSAED conjugate of the invention and at least one being a steroid conjugate
of the invention.) These combinations offer more pronounced antiinflammatory
activity if needed to treat inflamatory disease and conditions.
In yet an additional aspect, the present invention directed to methods for the
use of the foregoing compounds in the treatment of disorders and conditions caused
by inflammatory processes or to uses of the present compound in the treatment of the
foregoing disorders or in the manufacture of medicaments for such treatment.
In yet another aspect of the invention pharmaceutical compositions comprising
a compound of the invention and pharmaceutically acceptable salts or solvates thereof
including pharmaceutically acceptable diluent or earner are contemplated. Examples
include but are not limited to carboxymethylcellulose and salts thereof, polyacrylic
acid and salts thereof, carboxyvinyl polymers and salts thereof, alginic acid and salts
thereof, propylene glycol alginate, chitosan, hydroxypropylcellulose,
hydroxypropylmethycellulose, hydroxyethylcellulose, ethylcellulose, methycellulose,
polyvinyl alcohol, polyvinyl pyrolidone, N-vinylacetamide polymer, polyvinyl
methacrylate, polyethylene glycol, pluronic, gelatin, methyl vinyl elher-maleic
anhydride copolymer, starch, soluble starch croscaremlose, pullulan and a copolymer
of methyl acrylate and 2-ethylhexyl acrylate lecithin, lecithin derivative, propylene
glycol fatty acid esters, glycerin fatty acid esters, sorbitan fatty acid esters,
polyoxyethylene sorbitan fatty acid esters, polyethylene glycol fatty acid esters
polyoxyethylene hydrated caster oil, polyoxyethylene alkyl ethers, and pluronic.
Appropriate buffer system if diluent is used is in pH range of 4 to 8, together with low
molecular weight alcohols like thanol and isopropanol. The use of preservatives and
masking agents is suitable.
In yet another aspect of the invention is a method of treatment of inflamatory
diseases, disorders, and conditions characterized by or associated with an undesirable
inflammatory immune response and all diseases and conditions induced by or
associated with an excessive secretion of TNF-a and IL-1 which comprises
administering to a subject a therapeutically effective amount of a compound of the
invention.
In yet another aspect of the invention is a method of treating inflammatory
conditions and immune or anaphylactic disorders associated with infiltration of
leukocytes into inflamed tissues in a subject in need thereof which comprises
administering to said subject a therapeutically effective amount of a compound of the
invention.
m yet another aspect of the invention inflammatory conditions and immune
disorders to be treated by the compounds of the invention are chosen from the group
consisting of asthma, adult respiratory distress syndrome, bronchitis, cystic fibrosis,
rheumatoid arthritis, rheumatoid spondylitis, osteoarthritis, gouty arthritis, uveitis,
conjunctivitis, inflammatory bowel conditions, Crohn's disease, ulcerative colitis,
distal proctitis, psoriasis, eczema, dermatitis, coronary infarct damage, chronic
inflammation, endotoxin shock, and smooth muscle proliferation disorders.
In yet another aspect of the invention inflammatory conditions and immune
disorders to be treated by the compounds of the invention are chosen from the group
consisting of asthma, adult respiratory distress syndrome, chronic obstructive
pulmonary diseases, inflammatory bowel conditions, Crohn's disease, bronchitis, and
cystic fibrosis.
In yet another aspect of the invention is a method of treatment of
inflammatory diseases, disorders and conditions characterized by or associated by
excessive unregulated production of cytokines or Inflamatory mediators which
comprises administering to a subject a therapeutically effective amount of a
compound of the invention.
Symbols M, L and D represent three different subunits of compounds of Formula I.
The symbol M represents the macrolide subunit, and the symbol D represents the
steroid or nonsteroidal subunit linked through the chain JL with the macrolide subunit
M.
In Formula I, D can represent a nonsteroidal anti-inflammatory subunit, i.e., a moiety
of a nonsteroidal antiinfiammatory drug (NSAID). Suitable NSAlDs include, but are
not limited to, those which inhibit cyclooxygenase, the enzyme responsible for the
biosyntheses of the prostaglandins and certain autocoid inhibitors, including inhibitors
of the various isoenzymes of cyclooxygenase (including, but not limited to,
cyclooxygenase-1 and -2), and as inhibitors of both cyclooxygenase and lipoxygenase
relates to nonsteroidal anti-inflammatory drug (NSAID), such as the commercially
available NSAIDs aceclofenac, acemetacin, acetaminophen, acetaminosalol, acetyl-
salicylic acid, acetyl-salicylic-2-amino-4-picoline-acid, 5-aminoacetylsalicylic acid,
alclofenac, aminoprofen, amfenac, ampyrone, ampiroxicam, anileridine, bendazac,
benoxaprofen, bermoprofen, a-bisabolol, bromfenac, 5-bromosalicylic acid acetate,
bromosaligenin, bucloxic acid, butibufen, carprofen, celecoxib, chromoglycate,
cinmetacin, clindanac, clopirac, sodium diclofenac, diflunisal, ditazol, droxicam,
enfenamic acid, etodolac, etofenamate, felbinac, fenbufen, fenclozic acid, fendosal,
fenoprofen, fentiazac, fepradinol, flufenac, fiufenamic 'acid, flunixin, flunoxaprofen,
flurbiprofen, glutametacin, glycol salicylate, ibufenac, ibuprofen, ibuproxam,
indomethacin, indoprofen, isofezolac, isoxepac, isoxicam, ketoprofen, ketorolac,
lornoxicam, loxoprofen, meclofenamic acid, mefenamic acid, meloxicam,
raesalamine, metiazinic acid, mofezolac, montelukast, mycophenolic acid,
nabumetone, naproxen, niflumic acid, nimesulide, olsalazine, oxaceprol, oxaprozin,
oxyphenbutazone, paracetamol, parsalniide, perisoxal, phenyl-acethyl-salicylate,
phenylbutazone, phenylsalicylate, pyrazolac, piroxicam, pirprofen, pranoprofen,
protizinic acid, reserveratol, salacetamide, salicylamide, salicylaniide-O-acetyl acid,
salicylsulphuric acid, salicin, salicylamide, , salsalate, sulindac, suprofen,
suxibutazone, tamoxifen, tenoxicam, theophylline, tiaprofenic acid, tiaramidc,
ticlopridine, tinoridine, tolfenamic acid, tolmctin, tropesin, xenbucin, ximoprofen,
zaltoprofen, zomepirac, tomoxiprol, zafirlukast and cyclosporine. Additional NSAID
genera and particular NSAID compounds are disclosed in U.S. Patent 6,297,260,
incorporated entirely by reference (especially in the generic formulas of its claim 1
and the recitation of specific list of NSAID's contained therein and in claim 3, and
thiazulidene NSAIDs disclosed in International Patent Application WO 01/87890,
incorporated herein by reference in its entirety. Preferred are indomethacin,
flufenamic acid, flunixin and theophylline. Most preferred is indomethacin. In
certain embodiments, the NSAID subunit is neither acetyl salicylic acid nor
mycophenolic acid.
In formula I D may also represent a steroid subunit including, but not limited to,
corticosteroids (such as glucocorticoids and mineralocorticoids) and androgens. Non-
limiting examples of corticosteroids include cortisol, cortisone, clobetasol,
hydrocortisone, fludrocortisone, fludroxycortide, flumetasone, flunisolide,
fluocinolone, fluocinonide, fluocortolone, fluorometholone, prednisone, prednisolone,
6-alpha-methylprednisolone, triamcinolone, alclometasone, beclometasone,
betamethasone, budesonide, dexamethasone, amcinonide, cortivazol, desonide,
desoximethasone diflucortolone, difluprednate, fluclorolone and dichlorisone,
fluperinidene, fluticasone, halcinonide, meprednisone, methylprednisolone,
paramethasone, prednazoline, prednylidene, tixocortol, triamcinolone, and acid
derivatives thereof, e.g., acetate, propionate, dipropionate, valerate, phosphate,
isonicotinate, metasulfobenzoate, tebutate, and hemisuccinate).
Unless stated otherwise, the following terms have the meanings ascribed to
them below.
"Halogen" means a halogen atom which may preferably be: fluorine, chlorine
or bromine (the most preferably fluorine or chlorine).
"Alkyl" means a linear or branched saturated monovalent hydrocarbon radical
of one to ten carbon atoms, more preferably one to six carbon atoms The preferred
straight-chain or branched-chain alkyls include methyl, ethyl, propyl, iso-propyl,
butyl, sec-butyl and tert-butyl. C1-C4 alkyl is prefcred. Methyl is most preferred.
Alkyl groups may be substituted with one up to five substituents including halogen
(preferably fluorine or chlorine), hydroxy, alkoxy (preferably methoxy or ethoxy),
acyl, acylamino cyano, ammo, N-(C1-C4)alkylamino (preferably N-methylamino or
N-ethylamino), N,N-di(C1-C4-alkyl)amino (preferably dimethylamino or
diethylamino), aryl (preferably phenyl) or heteroaryl, thiocarbonylamino, acyloxy,
amino, amidino, alkylamidino, thioamidino, aminoacyl, aminocarbonylamino,
aminothiocarbonylamino, aminocarbonyloxy, aryl, heteroaryl, aryloxy, aryloxyaryl,
nitro, carboxyl, carboxylalkyl, carboxyl-substituted alkyl, carboxyl-cycloalkyl,
carboxyl-substituted cycloalkyl, carboxylaryl, carboxyl-substituted aryl,
carboxylheteroaryl, carboxyl-substituted heteroaryl, carboxylheterocyclic, carboxyl-
substituted heterocyclic, cycloalkyl, cycloalkoxy, heteroaryloxy, heterocyclyloxy, and
oxycarbonylamino. Such substituted alkyl groups are within the present definition of
"alkyl." The present definition of alkyl carries over to other groups having an alkyl
moiety such as alkoxy or alkanoyl.
"Alkenyl" means a linear or branched monovalent hydrocarbon radical of two
to ten and preferably two to six carbon atoms which has at least one double carbon-
carbon bond. Alkenyl groups may be substituted with the same groups as alkyl and
such optionally substituted alkenyl groups are encompassed within the term
"alkenyl". Ethenyl, propenyl, butenyl and cyclohexenyl are preferred.
"Alkynyl" means a linear or branched monovalent hydrocarbon radical, having
a straight-chain or a branched-chain of two to ten, and preferably two to six carbon
atoms and containing at least one and preferably no more than three triple carbon-
carbon bonds. Alkynyl groups can be substituted with the same groups as alkyl, and
the substituted groups are within the present definition of alkynyl. Ethynyl, propynyl
and butynyl groups are preferred.
"Cycloalkyl" means a cyclic group having 3-8 carbon atoms having a single
ring optionally fused to an aryl or heteroaryl group. The cycloalkyl groups can be
substituted as specified for "aryl" below, and the substituted cycloalkyl groups are
within the present definition of "cycloalkyl". Preferred cycloallcyls are cyclopentyl
and cyclohexyl.
"Aryl" means an unsaturated aromatic carbocyclic group having 6-14 carbon
atoms having a single ring such as phenyl or multiple fused rings such as naphthyl.
Aryl may optionally be further fused to an aliphatic or aryl group or can be substituted
with one or more substituents such as halogen (fluorine, chlorine and/or bromine),
hydroxy, C1-C7 alkyl, C1-C7 allcoxy or aryloxy, C1-C7 alkylthio or arylthio,
alkylsulfonyl, cyano or primary or nonprimary amino.
"Heteroaryl" means a monocyclic or a bicyclic aromatic hydrocarbon ring
having from 2 to 10 carbon atoms and from 1 to 4 heteroatoms, such as O, S or N.
The heteroaryl ring may optionally be fused to another heteroaryl, aryl or aliphatic
cyclic group. Examples of this type are furan, thiophene, imidazole, indole, pyridine,
oxazole, thiazole, pyrrole, pyrazole, tetrazole, pyrimidine, pyrazine and triazine, with
furan, pyrrole, pyridine and indole being preferred. The term includes groups that are
substituted with the same substituents as specified for aryl above.
"Heterocyclic" means a saturated or unsaturated group having a single or multiple
rings and from 1 to 10 carbon atoms and from 1-4 heteroatoms selected from
nitrogen, sulfur or oxygen, wherein in a fused ring system the other ring or rings can
be aryl or heteroaryl. Heterocyclic groups can be substituted as specified for alkyl
groups and the thus substituted heterocyclic groups are within the present definition.
When Rc represents a covalent link, the nonsteroidal or steroid subunit D is linked via
Rc with the chain L to the macrolide subunit M.
When Rn represents a covalent bond, the macrolide subunit M is linked via Rn with
the chain L to the nonsteroidal or steroid subunit D.
In the preparation of the compounds represented by Formula I of the specified
pharmacological activity, in the present invention certain new compounds were
prepared as intermediates in the preparation of pharmacologically active compounds.
The present invention also relates to such intermediates.
The term "salts" can include acid addition salts or addition salts of free bases.
Examples of acids which may be employed to form pharmaceutically acceptable acid
addition salts include but are not limited to salts derived from nontoxic inorganic
acids such as nitric, phosphoric, sulfuric, or hydrobromic, hydroiodic, hydrofluoric,
phosphorous, as well as salts derived from nontoxic organic acids such as aliphatic
mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydtoxyl alkanoic
acids, alkanedioic acids, aromatic acids, aliphatic and aromatic sulfom'c acids, and
acetic, maleic, succinic, or citric acids. Non-limiting examples of such salts include
napadisylate, besylate, sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate,
phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate,
pyrophosphate, chloride, bromide, iodide, acetate, trifluoroacetate, propionate,
caprylate, isobutyrate, oxalate, malonate, succinate, suberate, sebacate, fumarate,
maleate, mandelate, bcnzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate,
phthalate, benzenesulfonate, toluenesulfonate, phenylacetate, citrate, lactate, maleate,
tartrate, methanesulfonate, and the like. Also contemplated are salts of amino acids
such as arginate and the like and gluconate, galacturonate (see, for example, Berge S.
M. et al. "Pharmaceutical Salts," J. of Phanna. Sci., 1977; 66:1).
The acid addition salts of said basic compounds are prepared by contacting the
free base form with a sufficient amount of the desired acid to produce the salt in the
conventional manner. The free base form may be regenerated by contacting the salt
form with a base and isolating the free base in the conventional manner. The free base
forms differ from their respective salt forms somewhat in certain physical properties
such as solubility in polar solvents, but otherwise the salts are equivalent to their
respective free base for purposes of the present invention.
Pharmaceutically acceptable base addition salts are formed with metals or
amines, such as alkali and alkaline earth metals or organic amines. Examples of
metals used as cations are sodium, potassium, magnesium, calcium, and the like.
Examples of suitable amines are N,N'-dibenzylethylenediamine, chloroprocaine,
choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine,
and procaine.
The base addition salts of said acidic compounds are prepared by contacting
the free acid form with a sufficient amount of the desired base to produce the salt in
the conventional manner. The free acid form may be regenerated by contacting the
salt form with an acid and isolating the free acid in the conventional manner.
The phrase "pharmaceutically acceptable", as used in connection with
compositions of the invention, refers to molecular entities and other ingredients of
such compositions that are physiologically tolerable and do not typically produce
untoward reactions when administered to a mammal (e.g., human). Preferably, as
used herein, the term "pharmaceutically acceptable" means approved by a regulatory
agency of the Federal or a state government or listed in the U.S. Pharmacopeia or
other generally recognized pharmacopeia for use in mammals, and more particularly
in humans.
The term "carrier" applied to pharmaceutical compositions of the invention
refers to a diluent, excipient, or vehicle with which an active compound is
administered. Such pharmaceutical carriers can be sterile liquids, such as water,
saline solutions, aqueous dextrose solutions, aqueous glycerol solutions, and oils,
including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil,
soybean oil, mineral oil, sesame oil and the like. However, since memantine is highly
soluble, aqueous solutions are preferred. Suitable pharmaceutical carriers are
described in "Remington's Pharmaceutical Sciences" by E.W. Martin, 18th Edition.
Particularly preferred for the present invention are carriers suitable for immediate-
release, i.e., release of most or all of the active ingredient over a short period of time,
such as 60 minutes or less, and make rapid absorption of the drug possible.
The present invention also encompasses solvates (preferably hydrates) formed by the
compounds represented by Formula I or their salts.
The present invention also relates to all possible tautomeric forms which can be
formed by individual compounds of Formula I.
The present invention also encompasses prodrugs of Formula I compounds,
i.e., compounds which release an active parent drug according to Formula (I) in vivo
when administered to a mammalian subject. Prodrugs of a compound of Formula I are
prepared by modifying functional groups present in the compound of Formula I in
such a way that the modifications may be cleaved in vivo to release the parent
compound. Prodrugs include compounds of Formula I wherein a hydroxy, amino, or
carboxy group of a Formula I compound is bonded to any group that may be cleaved
in vivo to regenerate the free hydroxyl, amino or carboxy group, respectively.
Examples of prodrugs include, but are not limited to esters (e.g., acetate, formate, and
benzoate derivatives) of compounds of Formula I.
The compounds of Formula I have one or more chirality centers and, depending on
the nature of individual substituents, they can also have geometrical isomers. Isomers
that differ in the arrangement of their atoms in space are termed "stereoisomers".
Stereoisomers that are not mirror images of one another are termed "diastereomers"
and those that are non-superimposable mirror images of each other are termed
"enantiomers". When a compound has a cliiral center, a pair of enantiomers is
possible. An enantiomer can be characterized by the absolute configuration of its
asymmetric center and is described by the R- and S-sequencing rules of Cahn and
Prelog, or by the manner in which the molecule rotates the plane of polarized light
and designated as dextrorotatory or levorotatory (i.e., as (+) or (-)-isomer
respectively). A chiral compound can exist as either an individual enantiomer or as a
mixture of enantiomers. A mixture containing equal proportions of the enantiomers is
called a "racemic mixture". The present invention encompasses all individual isomers
of compounds of Formula I. The description or naming of a particular compound in
the specification and claims is intended to include both individual enantiomers and
mixtures, racemic or otherwise, thereof. Methods for the determination of
stereochemistry and the separation of stereoisomers are well-known in the art.
A "pharmaceutically acceptable excipient" means an excipient that is useful in
preparing a pharmaceutical composition that is generally safe, non-toxic and neither
biologically nor otherwise undesirable, and includes an excipient that is acceptable for
veterinary use as well as human pharmaceutical use. A "pharmaceutically acceptable
excipient" as used in the present application includes both one and more than one
such excipient.
"Treating" or "treatment" of a state, disorder or condition includes:
(1) preventing or delaying the appearance of clinical symptoms of the state, disorder
or condition developing in a mammal that may be afflicted with or predisposed to the
state, disorder or condition but does not yet experience or display clinical or
subclinical symptoms of the state, disorder or condition,
(2) inhibiting the state, disorder or condition, i.e., arresting or reducing the
development of the disease or at least one clinical or subclinical symptom thereof, or
(3) relieving the disease, i.e., causing regression of the state, disorder or condition or
at least one of its clinical or subclinical symptoms.
The benefit to a subject to be treated is either statically significant or at least
perceptible to the patient or to the physician
A "therapeutically effective amount" means the amount of a compound that, when
administered to a mammal for treating a state, disorder or condition, is sufficient to
effect such treatment. The "therapeutically effective amount" will vary depending on
the compound, the disease and its severity and the age, weight, physical condition and
responsiveness of the mammal to be treated.
The four classic symptoms of acute inflammation are redness, elevated temperature.
Swelling, and pain in the affected area, and loss of function of the affected organ.
Symptoms and signs of inflammation associated with specific conditions include:
• rheumatoid arthritis- pain, swelling, warmth and tenderness of the involved
joints; generalized and morning stiffness;
• insulin-dependent diabetes mellitus- insulitis; this condition can lead to a
variety of complications with an inflammatory component, including:
retinopathy, neuropathy, nephropathy; coronary artery disease, peripheral
vascular disease, and cerebrovascular disease;
• autoimmune thyroiditis- weakness, constipation, shortness of breath, puffiness
of the face, hands and feet, peripheral edema, bradycardia;
• multiple sclerosis- spasticity, blurry vision, vertigo, limb weakness,
paresthesias;
• uveoretinitis- decreased night vision, loss of peripheral vision;
• lupus erythematosus- joint pain, rash, photosensitivity, fever, muscle pain,
puffiness of the hands and feet, abnormal urinalysis (hematuria, cylinduria,
proteinuria), glomerulonephritis, cognitive dysfunction, vessel thrombosis,
pericarditis;
• scleroderma- Raynaud's disease; swelling of the hands, arms, legs and face;
skin thickening; pain, swelling and stiffness of the fingers and knees,
gastrointestinal dysfunction, restrictive lung disease; pericarditis,; renal
failure;
• other arthritic conditions having an inflammatory component such as
rheumatoid spondylitis, osteoarthritis, septic arthritis and polyarthritis- fever,
pain, swelling, tenderness;
• other inflammatory brain disorders, such as meningitis, Alzheimer's disease,
AIDS dementia encephalitis- photophobia, cognitive dysfunction, memory
loss;
• other inflammatory eye inflammations, such as retinitis- decreased visual
acuity;
• inflammatory skin disorders, such as , eczema, other dermatites (e.g., atopic,
contact), psoriasis, burns induced by UV radiation (sun rays and similar UV
sources)- erythema, pain, scaling, swelling, tenderness;
• inflammatory bowel disease, such as Crohn's disease, ulcerative colitis- pain,
diarrhea, constipation, rectal bleeding, fever, arthritis;
• asthma- shortness of breath, wheezing;
• other allergy disorders, such as allergic rhinitis- sneezing, itching, runny nose
• conditions associated with acute trauma such as cerebral injury following
stroke- sensory loss, motor loss, cognitive loss;
• heart tissue injury due to myocardial ischemia- pain, shortness of breath;
• lung injury such as that which occurs in adult respiratory distress syndrome-
shortness of breath, hyperventilation, decreased oxygenation, pulmonary
infiltrates;
• inflammation accompanying infection, such as sepsis, septic shock, toxic
shock syndrome- fever, respiratory failure, tachycardia, hypotension,
leukocytosis;
• other inflammatory conditions associated with particular organs or tissues,
such as
nephritis (e.g., giomerulonephritis)-oliguria, abnormal urinalysis;
inflamed appendix- fever, pain, tenderness, leukocytosis;
gout- pain, tenderness, swelling and erythema of the involved joint, elevated
serum and/or urinary uric acid;
inflamed gall bladder- abdominal pain and tenderness, fever, nausea,
leukocytosis;
chronic obstructive pulmonary disease- shortness of breath, wheezing;
congestive heart failure- shortness of breath, rales, peripheral edema;
Type II diabetes- end organ complications including cardiovascular, ocular,
renal, and peripheral vascular disease
lung fibrosis- hyperventilation, shortness of breath, decreased oxygenation;
vascular disease, such as atherosclerosis and restenosis- pain, loss of
sensation, diminished pulses, loss of function
and alloimmunity leading to transplant rejection- pain, tenderness, fever.
Subclinical symptoms include without limitation diagnostic markers for inflammation
the appearance of which may precede the manifestation of clinical symptoms. One
class of subclinical symptoms is immunological symptoms, such as the invasion or
accumulation in an organ or tissue of proinflammatory lymphoid cells or the presence
locally or peripherally of activated pro-inflammatory lymphoid cells recognizing a
pathogen or an antigen specific to the organ or tissue. Activation of lymphoid cells
can be measured by techniques known in the art.
"Delivering" a therapeutically effective amount of an active ingredient to a particular
location within a host means causing a therapeutically effective blood concentration
of the active ingredient at the particular location. This can be accomplished, e.g., by
local or by systemic administration of the active ingredient to the host.
The term host or subject in need thereof as used herein refers to a mammal preferably
a human.
The term leaving group refers to a chemical group which is capable of being displaced
by a nucleophile. Examples of such groups include but are not limited to halogen,
mesylate, tosylate and ester groups.
Methods of Preparation
A further aspect of the present invention relates to a method for the preparation of
compounds within Formula I comprising:
a) for the compounds of Formula I, wherein X2 is -NH-
a reaction of the steroid or nonsteroidal subunit of the substructure V:

(wherein L| represents a leaving group such as hydroxy)
and the amino group of the macrolide subunit of the substructure VIa:

VIa
for the compounds of Formula I, wherein X2 represents -O-;
a reaction of the steroid or nonsteroidal subunit of the substructure V
(wherein L1 represents a leaving group such as hydroxy, and the hydroxyl
group of the macrolide subunit of the substructure VIb:
Methods of preparation:
a) A compound within Formula I is prepared by a reaction of a carboxylic acid
of the steroid or nonsteroidal subunit of the substructure V and the amino group of the
macrolide subunit of the substructure Via whereby the amide linkage is effected, and
using the usual derivatives having an activating effect on carboxylic acid such as
mixed anhydrides, especially carbodiimides or benzotriazole. The reaction proceeds
in the presence of a base (preferably an organic base), e.g. triethylamine, at room
temperature under an inert atmosphere, e.g. a nitrogen or argon blanket, over a period
from several hours to several days.
Steroid or nonsteroidal subunits of the substructure V are either commercially
available products or have been obtained, like the starting macrolide subunits of the
substructure Via by methods for preparation of analogous compounds described in
our earlier patent applications (HR Patent Application No. 20010018; WO Patent
Application No. 02/055531); WO 04/005309; WO 04/005310 herein incorporated by
reference in their entireties.
The reaction is generally performed with acid derivatives which have the
ability to activate the carboxylic acid group of steroidal anti-inflammatory subunit,
such as halogenides, mixed anhydrides and especially carbodiimides (such as -(3-
dimethylarninopropyl)-3-ethyl-carbodiimide (EDC)) and benzotriazoles. The reaction
proceeds in the presence of a base, such as an organic base (e.g., triethylamine), at
room temperature under an inert atmosphere such as nitrogen or argon. The reaction
may require several hours to several days to come to completion.
For example, when L is -K-NH- (wherein K is the portion of the L molecule
attached to the macrolide) the compound of Formula I can be formed by derivatizing
an NH group on the macrolide ring to an -N-K-(NH2)- group and reacting the
derivatized macrolide with a steroid or nonsteriodal anti-inflammatory subunit
represented by Formula V:
b) Preparation of a compound of Formula I is carried out by a reaction of the
carboxylic acid of the steroid or nonsteroidal subunit of the substructure V and the
hydroxyl group of the macrolide subunit of the substructure VIb whereby the ester
bond is formed, and the reaction proceeds by using carboxylic acid activating agents
such as mixed anhydrides, especially carbodiimides. The reaction proceeds at low
temperatures (preferably -5°C) under an inert atmosphere, e.g. nitrogen or argon
blanket, over the period from several hours to several days.
Starting macrolide subunits of the substructure VIb are compounds described in the
literature or can be prepared by the procedures described for the preparation of
analogous compounds (Costa, A. M. et al., Tetrahedron Letters 2000, 41, 3371-3375).
For example, the reaction of an alkenoyl derivative having the formula
CH2=CH(CH2)mC(O)O-alkyl (preferably methylacrylate) with the secondary nitrogen
atom of the macrolide subunit, yields a chain having an ester group at its end. The
ester group is then reduced with a metal hydride (preferably LiAlH4) in an anhydrous
organic solvent at a lower temperature (preferably 0 °C) to yield an alcohol derivative
of the substructure VIb.
For example, when linkage L is -K-O-, the compound of Formula I can be
formed by (1) derivatizing an NH group on a rnacrolide to an N-K-OH group and (2)
reacting the derivatized macrolide with the free carboxylic acid group on a steroid or
nonsteroidal subunit:

The non-steroidal anti-inflammatory subunit D may contain a -C(O)L1 group (such as
a free carboxylic acid group) or be derivatized by methods known in the art.
Scheme I
l.Pyr
2. NEt3, 4-PP, CH2C12
NSAID-OH +, SUCCINIC ANHYDRIDE NSAID-OC(O)CH2CH2COOH
According to Scheme I, NSAID compounds having a hydroxyl group may
alternatively be derivatized by the action of succinic anhydride in the presence of
pyridine followed by reaction of the intermediate so produced with triethylamine, 4-
pyrrolopyridine in methylene chloride to produce NSAID having free carboxylic acid
group (Huang CM. et al. Chem.&Biol. 2000,7,453-461, Hess S. et al. Bioorg.&Med.
Chem. 2001, 9, 1279-1291) The NSAID derivatives so produced may be coupled
either to a linker macrolide compound such as formula Via or VIb.
Scheme II
According to Scheme II, NSAID compounds having an amino group may
alternatively be derivatized by the action of sodium hydride and tert-butyliodoacetate
in N,N-dimethylforniamide to produce a (butoxy carbonyl derivative of the NSAID
which is then reacted with (trifluoracetic acid in methylene chloride to produce
NSAID having free carboxylic acid group (Hess S. et al. Bioorg.&Med. Chem. 2001,
9, 1279-1291). The NSAID derivatives so produced may be coupled either to a linker
macrolide compound such as formula VIa or VIb.
Scheme HI
DMAP
NSAID-NH, + SUCCINIC ANHYDRIDE NSAID-NHC(0)CH2CH2COOH
DIPEA, DMF
Alternatively by NSAID compounds having an amino group may be derivatized
according to Scheme III by the action of succinic anhydride in the presence of
dimethylaminopyridine, N,N'-diisopropylethylamine in dimethylformamide to
produce NSAID having free carboxylic acid group (Pandori M. W. et al.
Chem.&Biol. 2002, 9, 567-573). The NSAID derivatives so produced may be coupled
either to a linker macrolide compound such as formula VIa or VIb.
Compounds of Formula I can generally be obtained so that: one end of the chain L is
first linked to the macrolide subunit M, and then the other end of the chain is linked to
the nonsteroidal or steroid subunit D; or one a of the chain L is first linked to the
nonsteroidal or steroid subunit D and then the other end of the chain is linked to the
macrolide subunit M, and, finally, one end of the yet unformed chain is linked to the
macrolide subunit M, and the other end of the also unformed chain is linked to the
nonsteroidal or steroid subunit D, and subsequently the ends are chemically linked to
form the chain L.
To prevent undesirable side-reactions, it is frequently necessary to protect certain
groups such as e.g. a hydroxy or amino group. A comprehensive discussion of the
ways in which such groups may be protected and methods for cleaving the resulting
protected derivatives is given by for example T.W. Greene and P.G.M Wuts in
Protective Groups in Organic Synthesis 2nd ed., John Wiley & Son, Inc 1991 and by
P..T. Kocienski in Protecting Groups, Georg Thieme Verlag 1994 which are
incorporated herein by reference. Examples of suitable amino protecting groups
include acyl type protecting groups (e.g. formyl, trifluoroacetyl and acetyl), aromatic
urethane type protecting groups (e.g. ben2yloxycarbonyl (Cbz) and substituted Cbz,
and 9-fluorenylmethoxycarbonyl (Fmoc)), aliphatic urethane protecting groups (e.g. t-
butyloxycarbonyl (Boc), isopropyloxycarbonyl and cyclohexyloxycarbonyl) and alkyl
type protecting groups (e.g. benzyl, trityl and chlorotrityl). Examples of suitable
oxygen protecting groups may include for example alkyl silyl groups, such as
trimethylsilyl or tert-butyldimethylsilyl; alkyl ethers such as tetrahydropyranyl or tert-
butyl; or esters such as acetate. Hydroxy groups may be protected by reaction of for
example acetic anhydride, benzoic anhydride or a trialkylsilyl chloride in an aprotic
solvent. Examples of aprotic solvents are dichloromethane, N,N-dimethylformamide,
dimethylsulfoxide, tetrahydrofuran and the like.
For example, one possibility for the protection of the amino group is phthalimide.
Deprotection using hydrazine is described in the examples.
Corresponding protection for amino and alkylamino groups are groups such as
alkanoyl (acetyl), alkoxycarbonyl (methoxycarbonyl, etoxycarbonyl or tert-
butoxycarbonyl), arylmethoxycarbonyl (benzyloxycarbonyl), aroyl (benzoyl) and
alkylsilyl group (trimethylsilyl or trimethylsilyletoxymethyl). The conditions for
elimination of the protective group depend on the selection and properties of that
group. Thus, for example, acyl groups such as alkanoyl, alkoxycarbonyl and aroyl
group can be removed by hydrolysis in the presence of a base (sodium or potassium
hydroxide), tert-butoxycarbonyl or alkylsilyl (trimethylsilyl) group can be removed
with a corresponding acid (for example, hydrochloric, sulphuric, phosphoric or
trifluoroacetic acid), while arylmethoxycarbonyl group (benzyloxycarbonyl) can be
removed by hydrogenolysis in the presence of a catalyst such as palladium-on-
charcoal.
A further aspect of the present invention relates to the methods for using the
compounds of Formula I as anti-inflammatory, anti-anaphylactic and
immunomodulating agents which can be administered in different ways, depending on
the inflammation site, e.g. percutaneously, orally, buccally, rectally, parenterally or by
inhalation when application within the respiratory tract is intended.
A further aspect of the present invention relates to the methods for using the
compounds of Formula I as anti-inflammatory, anti-anaphylactic and
immunomodulating agents which can be administered in different ways, depending on
the inflammation site. Further, the present invention relates to pharmaceutical
compositions containing an effective dose of compounds of the present invention as
well as pharmaceutically acceptable excipients, such as carriers or diluents.
The preparation of the pharmaceutical compositions of the invention can
include mixing, granulating, tabletting and dissolving the ingredients. Chemical
carriers can be in solid or liquid form. Solid carriers can be lactose, sucrose, talc,
gelatine, agar, pectin, magnesium stearate, fatty acids without limitation. Liquid
earners can be syrups, oils such as olive, sunflower seed or soybean oils, water, or
physiologic saline without limitation. Similarly, carriers may also contain a
component for a sustained release of the active component such as glyceryl
monostearate or glyceryl distearate. Several forms of pharmaceutical compositions
can be prepared. If a solid carrier is used, these forms can include tablets, caplets,
solid gelatinous capsules, powders or granules without limitation that can be
administered orally. The amount of the solid carrier can vary but mainly it is in the
range from 25 mg to 1 g. If a liquid carrier is used, the formulation can be in the form
of a syrup, emulsion, soft gelatinous capsules, or sterile injectable liquids, or
nonaqueous liquid suspensions topically or systemically, e.g., orally, parenterally,
percutaneously, mucosally, e.g., buccally, intranasally, intrarectally and
intravaginally. "Parenterally" means by intravenous, intramuscular or subcutaneous
route. The corresponding preparations of the compounds of the present invention can
be used in the prophylaxis as well as in the therapeutic treatment (prevention, delay,
inhibition or relief) of several disorders (diseases and other pathological inflammatory
conditions) caused by or associated with an abnormal or undesirable (excessive,
nonregulated, or dysregulated) inflammatory immune response involving the
production of inflammatory cytokines or other inflammation mediators, including
without limitation TNF-a and IL-1/3. These disorders include autoimmune diseases
such as rheumatoid arthritis, insulin-dependent diabetes mellitus, autoimmune
thyroiditis, multiple sclerosis, uveoretinitis, lupus erythematosus, scleroderma; other
arthritic conditions having an inflammatory component such as rheumatoid
spondylitis, osteoarthritis, septic arthritis and polyarthritis; other inflammatory brain
disorders, such as meningitis, Alzheimer's disease, AIDS dementia encephalitis, other
inflammatory eye inflammations, such as retinitis; inflammatory skin disorders, such
as , eczema, other dermatites (e.g., atopic, contact), psoriasis, burns induced by UV
radiation (sun rays and similar UV sources); inflammatory bowel disease, such as
Crohns disease, ulcerative colitis; asthma; other allergy disorders, such as allergic
rhinitis; conditions associated with acute trauma such as cerebral injury following
stroke, heart tissue injury due to myocardial ischemia, lung injury such as that which
occurs in adult respiratory distress syndrome; inflammation accompanying infection,
such as sepsis, septic shock, toxic shock syndrome, other inflammatory conditions
associated with particular organs or tissues , such as nephritis (e.g.,
glomerulonephritis), inflamed appendix, gout, inflamed gall bladder, chronic
obstructive pulmonary disease, congestive heart failure, Type II diabetes, lung
fibrosis, vascular disease, such as atherosclerosis and restenosis; and alloimmunity
leading to transplant rejection. The compounds can also be administered by
inhalation when application within the respiratory tract is intended. A further object
of the present invention relates to the preparation of various pharmaceutical forms of
the compounds to achieve the optimal bioavailability of the active compound of
Formula I.
For percutaneous or mucosal external administration, the compound of
Formula I can be prepared in a form of an ointment or cream, gel or lotion.
Ointments, creams and gels can be formulated using a water or oil base with addition
of an appropriate emulsifier or gelling agent Formulation of the present compounds
is especially significant for respiratory inhalation, wherein the compound of Formula
I is to be delivered in the form of an aerosol under pressure. It is preferred to
micronize the compound of Formula I after it has been homogenised, e.g., in lactose,
glucose, higher fatty acids, sodium salt of dioctylsulfosuccinic acid or, most
preferably, in carboxymethyl cellulose, in order to achieve a microparticle size of 5
um or less for the majority of particles. For the inhalation formulation, the aerosol
can be mixed with a gas or a liquid propellant for dispensing the active substance. An
inhaler or atomizer or nebulizer may be used. Such devices are known. See, e.g.,
Newman et al., Thorax, 19S5, 40:61-676 Berenberg, M., J. Asthma USA, 1985,
22:87-92. A Bird nebulizer can also be used. See also U.S. Patents 6,402,733;
6,273,086; and 6,228,346.
The compound of the structure I for inhalation is preferably formatted in the
form of a dry powder with micronized particles, as described herein.
The compound can also be incorporated into a formulation for treating
inflammation localized in an organ or tissue, e.g., Crohn's disease, where it can be
administered orally or rectally. Formulations for oral administration can incorporate
excipients enabling bioavailability of the compound at the site of inflammation. This
can be achieved by different combinations of enteric and delayed release
formulations. The compound of Formula 1 can also be used in the treatment of
Crohn's disease and intestinal inflammation disease if the compound is applied in the
form of a clyster, for which a suitable formulation can be used, as is well known in
the field.
A therapeutically effective amount of the compound of the present invention
can be determined by methods known in the art. Since the compound of the present
invention is more efficiently delivered to the desired site than the corresponding anti-
inflammatory steroid or NSAID drug alone, a lesser amount of the compound on a
molar basis than of the steroid or NSAID anti-inflammatory drug can be administered
while still achieving the same therapeutic effect. Furthermore, since administration of
the compound results in fewer side effects than with the corresponding steroid or
NSAID anti-inflammatory drug, the steroid or NSAID amount can be increased.
Thus, the table below serves only as a guide. A threshold therapeutically effective
amount of the compound, a pharmaceutically salt thereof, a solvate thereof, or a
prodrug thereof is generally equal to or less than a therapeutically effective amount of
the nonsteroidal anti-inflammatory drug on a molar basis. Broad and preferred
effective amounts of the compound, a pharmaceutically salt thereof, a solvate thereof,
or a prodrug thereof are shown in the table below.
For example, if the preferred amount range for prednisone is 1-50 mg/day, this
corresponds to a range of 2.79 µmol to 139.5 µmol per day. The starting amount
range for a hybrid steroid-macrolide conjugate according to the invention will be also
2.79 µmol to 139.5 µnol of conjugate per day. This dosage can be fine-tuned in light
of the present specification using the ordinary skill in the act.
The efficacy of the present compounds can be assessed by any method for
assessing inflammation or anti-inflammatory effect. There are many known methods
for this.purpose including without limitation use of contrast ultrasound in conjunction
with injection of microbubbles, measurement of inflammatory cytokines (such as
TNF-a, IL-1, IFN-7) measurement of activated immune system cells (activated T
cells, cytotoxic T cells specifically recognizing the inflamed or transplanted tissue) as
well as by observation (reduction of oedema reduction of erythema, reduction of
pruritus or burning sensation, reduction of body temperature, improvement in function
of the afflicted organ) as well as any of the methods provided below as well as any of
the methods provided below.
The therapeutic effect of compounds of the present invention was determined
in in vitro and in vivo experiments such as the following.
The beneficial antiinflammatory effect of the compounds of the present
invention was determined in the following in vitro and in vivo experiments:
Formulations for oral administration can be so designed to enable bioavailability of
the compound at the site of inflammation in the intestines. This can be achieved by
different combinations of delayed release formulations. The compound of Formula I
can also be used in the treatment of Crohn's disease and intestinal inflammation
disease if the compound is applied in the form of an enema, for which a suitable
formulation can be used.
The corresponding preparations of the compounds of the present invention can be
used in the prophylaxis (including without limitation the prevention, delay or
inhibition of recurrence of one or more of the clinical or subclinical symptoms
discussed and defined in connection with the definitions of "treatment" above, as
well as in the therapeutic treatment of several diseases and and pathological
inflammatory conditions including: asthma, chronic obstructive pulmonary disease,
inflammatory nasal diseases such as allergic rhinitis, nasal polyps, intestinal diseases
such as Crohn's disease, colitis, intestinal inflammation, ulcerative colitis,
dermatological inflammations such as eczema, psoriasis, allergic dermatitis,
neurodermatitis, pruritis, conjunctivitis and rheumatoid arthritis.
The biological effect of the compounds of the present invention was determined in the
following in vitro and in vivo experiments:
Assay of Binding to Human Glucocorticoid Receptor
The gene for the alpha isoform of human glucocorticoid receptor was cloned by
reverse polymerase chain reaction. The total RNA was isolated from human
peripheral blood lymphocytes according to the instructions of the manufacturer
(Qiagen), transcripted into eDNA with AMV reverse transcriptase (Roche) and the
gene was multiplied by specific primers 1)
5'ATATGGATCCCTGATGGACTCCAAAGAATCATTAACTCC3' and 2)
5'ATAT-CTCGAGGGCAGTCACnTTGATGAAACAGAAG3' The reaction
product obtained was cloned into the XhoI/BamHI site of Bluescript KS plasmid
(Stratagene), subjected to sequencing by the dideoxy fluorescent method with Ml3
and M13rev primers (Microsynth) and then it was cloned into the XhoI/BamHI site of
pcDNA3.1 Hygro(+)plazmid (Invitrogen). lxl05 COS-1 cells were seeded onto a 12-
well plate (Falcon) in DMEM medium (Life Technologies) with 10% FBS
(Biowhitaker) and cultivated to a 70% confluence at 37 °C in an atmosphere with 5%
CO2. The medium was removed and 1 )µg of DNA, 7 µl of PLUS reagent and 2 µl of
Lipofectamin (Life Technologies) in 500 µl of DMEM were added per well. The cells
were incubated at 37 °C in an atmosphere with 5% CO2 and after 5 hours the same
volume of 20% FBS/DMEM was added. After 24 hours, the medium was completely
changed. 4S hours after transfection, the test compounds in different concentrations
and 24 nM [3H]dexamethazone (Pharmacia) in DMEM medium were added. The cells
were incubated for 90 minutes at 37 °C in an atmosphere with 5% CO2, washed three
times with PBS buffer (Sigma) cooled to 4 °C (pH=7,4), and then lysed in Tris buffer
(pH=8,0) (Sigma) with 0.2% of SDS (Sigma). After the addition of UltimaGold XR
(Packard) scintillation liquid, the residual radioactivity was read in a Tricarb
(Packard) P-scintillation counter.
Compounds 1 and 2 have the affinity for glucocorticoid receptor since in the assay
they displace radioactive dexamethasone from the glucocorticoid receptor.
Assay of Inhibition of Mouse T-cell Hybridoma 13 Proliferation as a Result of
Apoptosis Induction
In a 96-well plate, triplicates of test steroid dilution in RPMI medium (Institute of
Immunology, Zagreb) with 10% FBS were performed. To the solutions of
compounds, 20000 cells per well were added and incubated overnight at 37 °C in an
atmosphere with 5% CO2, then 1 µCi of [3H]thymidine (Pharmacia) was added and
the mixture was incubated for additional 3 hours. The cells were harvested by
applying a vacuum over GF/C filter (Packard). Onto each well, 30 µl of Microscynt O
scintillation liquid (Packard) was added and the incorporated radioactivity was
measured on a (3-scintillation counter (Packard). The specificity of apoptosis
induction by glucocorticoids was proven by antagonizing the proliferation inhibition
with mifepristone (Sigma).
Compounds 1-5, 6 and 8 exhibit inhibition of T-cell hybridoma 13 proliferation in the
concentrations from 1 juM to 1 nM.
Measurement of the inhibition of interleukin 4, interleukin 5 and interferon
production by y concanavalin-A induced murine splenocytes
Splenocytes were isolated from the spleen of Balb/C mice sacrificed by thiopental
injection (Pliva). Spleens were chopped and mononuclear cells separated on
Histopaque 1083 (Sigma Diagnostics, Cat. No 1083-1). Into a 96-well plate,
compounds diluted in RPMI medium (Institute of Immunology) were pipetted with
10% foetal bovine serum (Biowhittaker) and cells (200000 per well) in the same
medium, and cdncanavalin-A stimulator (Sigma cat No C5275) at the final
concentration of 5 µg/ml were added. Positive control, in place of the dilution of
compounds, consisted of RPMI medium with 10% foetal bovine serum and
concanavalin-A in the same concentration of. Cells were incubated for 72 hours at 37
°C, 95% humidity and in an atmosphere with 5% CO2. Until determination of
cytokines, the cells were frozen at -70 °C.
Cytokines interleukin 4, interleukin 5 and interferon y were determined by the specific
ELISA method, according to manufacturer's recommendations (R&D).
Inhibition (as percentage) was calculated using the following formula:
%inh=(l-concentration of cytokines in sample/concentration of cytokins in positive
control)* 100
Compounds 1-5, 6 and 8 inhibit the production of cytokines in concentrations from 1
µM to 1 nM.
Model of Lung Eosinophilia in Mice
Male Balb/C mice with a body weight of 20-25 g were randomly divided into groups,
and sensitised by an i.p. injection of ovalbumin (OVA, Sigma) on day zero and day
fourteen. On the twentieth day, the mice were subjected to a challenge test by i.n.
(intranasal) application of OVA (positive control or test groups) or PBS (negative
control). 48 hours after i.n. application of OVA, the animals were anaesthetized and
the lungs were rinsed with 1 mL of PBS. The cells were separated on Cytospin 3
cytocentrifuge (Shandon). The cells were stained in Diff-Quick (Dade) and the
percentage of eosinophils was determined by differential counting of at least 100
cells.
Fluticasone (GlaxoWellcome) and beclomethasone (Pliva d.d.) were used as standard
substances, with positive and negative control.
The compounds were administered daily i.n. or i.p. in different doses 2 days before
the challenge test and up to the completion of the test.
Compounds 1 and 2 statistically significantly reduced (t-test, p eosinophils in the lung rinse with respect to positive control.
Cold Stress Model
Male Wistar rats with a body weight of 200 - 250 g (our own breeding) were
randomly divided into groups. The carrier (lactose) in the volume of 0.5 mL/100 g s.c.
was applied to the negative and positive control group. Test substances and the
standard were applied once daily over three days in the dose of 2 mg/kg in the volume
of 0.5 mL/100 g of body weight. The standard was applied in the dose of 1 mg/kg, in
the volume of 0.5 mL/100 g of body weight.
On day three, 2 hours after the last treatment, all animals, except for the negative
control group, were subjected to cold stress at 4 C for 1 hour. After the stress, the
animals were anaesthetized with thiopental (Pliva d.d.) and blood from all animals
was drawn on K2 EDTA into test tubes. Plasma samples were frozen at -70 C.
Corticosteronc levels were determined by fluorimetric method according to Silber.
Thymuses were removed from animals and weighed, and their weights were
compared with the negative and positive control. Standards, fluticasone
(GlaxoWellcome) and budesonide (Steraloids), statistically significantly reduced
corticosterone plasma levels and reduced the weight of the thyrnus (P Corticosterone levels and thymus weights for compound 1 were on the level of those
of the control group of animals subjected to stress.
SYNTHETIC METHODS AND EXAMPLES
PRECURSORS
In the following examples of methods of preparation, which in no way limit the
uniqueness of the invention, the synthesis of the compound of Formula I from
macrolide precursors M1-M5 and steroid precursors D.1-D9 and nonsteroidal
precursors D10, Dl 1, D12, and D13 is described.
Macrolide subunits
Macrolide subunits M1-M5 are compounds represented by the following general
structure:
Method A
a) Compound Ml (480 mg; 1.1 mmol) was dissolved in 10 mL of
acrylonitrile and the reaction mixture was heated at 95 °C for 24 hours.
Subsequently, the solvent was evaporated under reduced pressure. 500 mg
of the compound M2 was obtained, which was used for further synthesis
without previous purification.
b) Compound M2 (500 mg) was dissolved in 20 mL of absolute ethanol and
hydrated with the catalyst PtO2 (60 mg) for two days at the pressure of
40 arm. The mixture was purified was purified on a silica gel column,
eluent CHCl3:MeOH:NH4OH=6:1:0.1. 193 mg of compound M4 was
obtained.
The properties of compounds Ml, M2 and M4 are given in Table 1.
Method B
a) Compound Ml (lg; 2.4 mmol) was dissolved in 30 mL of methylacrylate.
The reaction mixture was heated at the temperature of 90 °C overnight.
The solvent was then evaporated under reduced pressure. 1.08 g of raw
compound M3 was obtained.
b) Lithium aluminium hydride (225 mg) was added into 30 mL of dry THF
and 1 g of compound M3 dissolved in 10 mL THF was added in a flow of
argon. The reaction mixture was stirred at the temperature from 0 to 5oC
for 1 hour. Then water was added to the mixture to destroy the excess
lithium aluminium hydride (until the colour changed to white). The
reaction mixture was then filtered and the filtrate was evaporated under
reduced pressure. 784 mg of product M5 was obtained. The mixture
obtained was purified on a silica gel column, eluent
CHCl3:MeOH:NH4OH=6:1:0.1.
The properties of compounds M3 and M5 are given in Table 1.
Steroid subunits
Steroid subunits D1-D9 are compounds represented by the following general
structure:
Nonsteroidal subunits
Precursors for the synthesis are nonsteroidal anti-inflammatory drugs (NSAID), such
as aceclofenac, acemetacin, acetaminophen, acetaminosalol, acetyl-salicylic acid,
acetyl-salicylic-2-amino-4-picoline-acid, 5-aminoacetylsalicylic acid, alclofenac,
amino-profen, amfenac, anileridine, bendazac, benoxaprofen, bennoprofcn, a-
bisabolol, bromfenac, 5-bromosalicylic acid acetate, bromosaligenin, bucloxic acid,
butibufen, carprofen, chromoglycate, cinmetacin, clindanac, clopirac, sodium
diclofenac, difluuisal, ditazol, enfenamic acid, etodolac, etofenamate, felbinac,
fenbufen, fenclozic acid, fendosal, fenoprofen, fentiazac, fepradinol, flufenamic acid,
flunixin, flunoxaprofen, flurbiprofen, glutametacin, glycol salicylate, ibufenac,
ibuprofen, ibuproxam, indomethacin. indoprofen, isofezolac, isoxepac, isoxicam,
ketoprofen, ketorolac, lornoxicam, loxoprofen, meclofenamic acid, mefenamic acid,
meloxicam, mesalamine, metiazinic acid, mofezolac, montelukast, naproxen, niflumic
acid, olsalazine, oxaceprol, oxaprozin, oxyphcnbutazone, parsalmide, perisoxal,
phenyl-acethyl-salicylate, phenylbutazone, phenylsalicylate, pyrazolac, piroxicam,
pirprofen, pranoprofen, protizinic acid, salacetamide, salicylamide-O-acetyl acid,
salicylsulphuric acid, salicin, salicylamide, salsalate, sulindac, suprofen,
suxibutazone, tenoxicam, tiaprofenic acid, tiaramide, tinoridine, tolfenamic acid,
tolnietin, tropesin, xenbucin, ximoprofen, zaltoprofen, zomepirac, tomoxiprol,
zafirlukast, and some example of precursors are indomethacin (D10), flufenaraic acid
(D11), flunixin (D12) and 2-methoxycarbonylethyltheophylline (D13):
Compound Dl (825 mg; 2.18 mmol) was dissolved in 15 mL of dry dichlormethane
in a flow of argon. Subsequently, 2.86 mL of triethylamine, 601 mg of
hydroxybenzotriazole, 1.82 g of macrolide M4 (2.18 mmol) and 3.1 g of l-(3-
dimethylaminopropyl)-3-ethylcarbodiiniide hydrochloride were added into the
solution. The reaction mixture was stirred at room temperature overnight. The solvent
was evaporated under reduced pressure. The mixture obtained was purified on a silica
gel column, eluent CHCl3:MeOH:NH4OH=6:1:0.1. 1.44 g of compound 1 was
obtained; MS (m/z): 837.5 [MH]+. IR (KBr) cm-1: 3422, 2938, 2874, 1710, 1663,
1624, 1560, 1528, 1458, 1376, 1302,1245, 1176, 1139, 1089, 1052, 1036, 1012, 959,
929, 894, 816, 754, 706, 669 .
Example 2
Compound 2: (I; M = M4. D = D5)
Compound D5 (57.8 mg; 0.16 mmol) was dissolved in 5 mL of dry dichlormethane in
a flow of argon. 0.209 mL of triethylamine was added to the solution, clarifying it.
Subsequently, 43.9 mg of hydroxybenzotriazole, macrolide M4 (76 mg; 0.1595
mmol) and 129.2 g of l-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride
were added. The reaction mixture was stirred at room temperature overnight. The
solvent was evaporated under reduced pressure. The mixture obtained was purified on
a silica gel column, eluenl CHCl3:MeOH:NH4OH=6:1:0.1. 32 mg of compound 2 was
obtained; MS (m/z): 821.4 [MH]+. IE. (KBr) cm-1: 3423, 2939, 2876, 1718, 1664,
1625, 1560, 1541, 1458, 1376, 1353, 1296, 1249, 1178, 1089, 1054, 975, 959, 928,
889,828,811,750,669.
Example 3
Compound 3: (I: M = M4, D = D3)

Compound D3 (165 mg; 0.453 mmol) was dissolved in 10 mL of dry dichlormetane.
0.595 mL of triethylamine was added to the solution. Subsequently, 125 mg of
hydroxybenzotriazole, macrolide M4 (216 mg; 0.453 mmol) and 644 mg of l-(3-
dimethylaminopropyl)-3-ethylcarbodiirnide hydrochloride were added to the reaction
mixture. The reaction mixture was stirred at room temperature for 24 hours. The
solvent was evaporated under reduced pressure. The mixture obtained was purified on
a silica gel column, eluent CHCl3:MeOH:NH4OH=6:1:0.1. 241 mg of compound 3
was obtained; MS (m/z): 823.7 [MH]+.
Example 4
Compound 4: (I; M = M4. D = D2)

Compound D2 (337 mg; 0.936 mmol) was dissolved in 15 mL of dry dichlormcthane.
1.228 mL of triethylamine, 258 mg of hydroxybenzotriazole, 445.7 mg of macrolide
M4 (0.936 mmol) and 1.331g l-(3-dimethylaminopropyl)-3-ethylcarbodiimidc
hydrochloride were added to the solution. The reaction mixture was stirred at room
temperature for 24 hours. The solvent was evaporated under reduced pressure. The
product obtained was purified on a silica gel column, eluent
CHCl3:MeOH:NH4OH=6:1:0.1. 490 mg of compound 4 was obtained; MS (m/z):
819.7 [MH]+. TR (KBr) cm-1: 3423, 2969, 2919, 2850, 2819, 2779, 1719, 1701, 1655,
1642, 1561, 1523, 1460, 1375, 1347, 1263, 1212, 1161, 1098, 1071, 1040, 959, 939,
888.
Example 5
Compound 5: (I: M = M4. D = D4)
446 mg of D4 (1.28 mmol) acid was dissolved in 15 mL of dry dichloromethane in a
flow of argon. 1.68 mL of triethylamine, 353.2 mg of hydroxybenzotriazole, 610.2 mg
of macrolide M4 (1.281 mmol) and 1.822 g of l-(3- dimethylaminopropyI)-3-
ethylcarbodiimide hydrochloride were added to the solution. The reaction mixture
was stirred at room temperature for 24 hours. The solvent was evaporated under
reduced pressure. The mixture obtained was purified on a silica gel column, eluent
CHCl3:MeOH:NH4OH=6:1:0.1. 516 mg of compound 5 was obtained; MS {m/z):
807.5 [MHf. IR (KBr) cm-1: 3414, 2936, 2874, 2129, 1703, 1655, 1560, 1541, 1535,
1458, 1357, 1322, 1238, 11S6, 1162, 1120, 1092, 1049, 998, 964, 936, 897, 871, 753,
703.
Example 6
Compound 6: (I; M = M4, D = D7)

Compound D7 (570 mg; 0.57 mmol) was dissolved in 20 mL of dimethylformamide.
0.755 mL of diisopropylethylamine and 154 mg (2 eq) of 1-hydroxybenzotriazole
were added. Subsequently, compound M4 (271 mg; 0,57 mmol) and l-(3-
dimethylarnmopropyl)-3-ethylcarbodiimide hydrochloride (391 mg, 4 eq) were added.
The reaction mixture was stirred for 24 hours at 100 °C under reflux in an inert
atmosphere. The solvent was then evaporated, and the compound was purified on a
silica gel column in the solvent system CHC13: MeOH:NH4OH = 6:1:0,1. 220 mg of
compound 6 was isolated; MS {m/z): 897.5 [MH]+.
Example 7
Conmound 7: a: M = M4. D = D10)
Indomethacin D10 (165.2 mg; 0.4618 mmol) was dissolved in 20 mL of
dichlormethane. 0.501 mL (3.602 mmol) of triethylamine and 124.8 mg (0.9236
mmol) of
1-hydroxybenzotriazole were added. Subsequently, compound M4 (220 mg; 0.4618
mmol) and l-(3- dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (317 mg,
1.8472 mmol) were added. The reaction mixture was stirred for 24 hours at room
temperature in an inert atmosphere. The solvent was then evaporated, and the
compound was purified on a silica gel column in the solvent system CHCI3:
MeOH:NH4OH = 6:1:0,1. 190 mg of compound 7 was isolated; MS (m/z):
816.4[MH]+. IR (KBr) cm-1: 3422, 2972, 2935, 2876, 1655, 1560, 1542, 1535, 1478,
1458, 1400, 1372, 1352, 1323, 1290, 1260, 1226, 1179, 1150, 1090, 1053, 1037,
1015, 958, 926, 911, 833, 804, 755, 664 .
Example 8
Compound 8: (I: M = M5. D = D5)
Compound D5 (32.6 mg; 0.09 mmol) was dissolved in 5 mL of dry DMF in a flow of
argon. The solution was cooled to -10 °C and then 1,1-carbonyldiimidazole (30 mg;
0.18 mmol) dissolved in 3 mL of dry DMF was added. The reaction mixture was
stirred overnight at the temperature of -5 °C. Subsequently, compound M5 (43 mg;
0.09 mmol) dissolved in 3 mL of dry DMF was added. The reaction mixture was
heated at 100 °C for two days. DMF was evaporated under reduced pressure, and the
residue was purified on a silica gel column, eluent CHCl3:MeOH:NH4OH=6:l:0,l. 22
mg of compound 8 was obtained; MS (m/z): 822.6[MH] .
Example 9
Compound 9: (I: M = M5. P = D10)

Indomethacin D10 (32.1 mg; 0.09 mmol) was dissolved in dry DMF (5mL), in a flow
of argon. The solution was cooled to -10 °C and then 1,1-carbonyldiimidazole (30
mg; 0.18 mmol) dissolved in 3 mL of dry DMF was added. The reaction mixture was
stirred overnight at the temperature of -5 °C. Subsequently, compound M5 (43 mg;
0.09 mmol) dissolved in 3 mL of dry DMF was added. The reaction mixture was
heated at 100 °C for two days. DMF was evaporated under reduced pressure, and the
residue was purified on a silica gel column, eluent CHCl3:MeOH:NH4OH=6:1:0,1. 25
mg of compound 9 was obtained; MS (m/z): 817.7[MH]+.
Example 10
Compound 10: (1; M = M4, P = D6)

115 mg of D6 acid (0.29 mmol) was dissolved in 15 mL of dry dichloromethane,
under flow of argon. 0.38 mL of triethylamine, 80 mg of hydroxybenzotriazole, 138
mg of macrolide M4 (0.29 mmol) and 235 mg of l-(3- dimethylaminopropyl)-3-
ethylcarbodiimide hydrochloride were added to the solution. The reaction mixture
was stirred at room temperature for 24 hours. The solvent was evaporated under
reduced pressure, and the residue was purified on a silica gel column, eluent
CHCl3:Me0H:NH40H=6:1:0.1. 70 mg of compound 10 was obtained; MS (m/z):
857.8 [MH]1.
Example 11
Compound 11: (I: M = M4. D = D8)
Compound D8 (100 mg; 0.25 mmol) was dissolved in 5 mL of dry dicblormethane in
a flow of argon. Subsequently, 0.12 mL of triethylamine, 69.6 mg of
hydroxybenzotriazole, 120.1 mg of macrolide M4 (0.25 mmol) and 204.5 mg of l-(3-
dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride were added into the
solution. The reaction mixture was stirred at room temperature overnight. The solvent
was evaporated under reduced pressure. The mixture obtained was purified on a silica
gel column, eluent CHCl3:MeOH:NH4OH=6:1:0.1. 70 mg of compound 11 was
obtained; MS (m/z): 855.4 [MH]+. 1R (KBr) cm-1: 3422, 2963, 2930, 2875, 2855,
1734, 1718, 1693, 1665, 1624, 1544, 1459, 1376, 1262, 1205, 1167, 1093, 1049,
1030, 958, 901, 864, 802, 737, 702.
Example 12
Compound 12: (I; M = M4. D = D9)

Compound D9 (100 mg; 0.30 mmol) was dissolved in 5 mL of dry dichlormethane in
a flow of argon. Subsequently, 0.394 mL of triethylamine, 83 mg of
hydroxybenzotriazole, 143.3 mg of macrolide M4 (0.30 mmol) and 244 mg of l-(3-
dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride were added into the
solution. The reaction mixture was stirred at room temperature overnight. The solvent
was evaporated under reduced pressure. The mixture obtained was purified on a silica
gel column, eluent CHCl3:MeOH:NH4OH=6:l:0.1. 107.5 mg of compound 12 was
obtained; MS (m/z): 791.6 [MH]+. IR (KBr) cm-1: 3440, 3367, 2967, 2938, 2877,
1706, 1668, 1656, 1619, 1545, 1532, 1510, 1459, 1379, 1367, 1351, 1273, 1257,
1239, 1185, 1163, 1087., 1057, 1033, 973, 957, 930, 897, 869, 812, 736, 704.
Example 13
Compound 13: (I; M = M4. D = D11)

Compound D11 (82 mg; 0.29 mmol) was dissolved in 5 mL of dry dichlorniethane in
a flow of argon. Subsequently, 0.380 mL of triethylamine, 80 mg of
hydroxybenzotriazole, 138 mg of macrolide M4 (0.29 mmol) and 235 mg of l-(3-
dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride were added into the
solution. The reaction mixture was stirred at room temperature overnight. The solvent
was evaporated under reduced pressure. The mixture obtained was purified on a silica
gel column, eluent CHCl3:MeOH:NH4OH=90:9:1.5. 112 mg of compound 13 was
obtained; MS (m/z): 740.4 [MH]+.
Example 14
Compound 14: (I; M = M4, D = D12)
Compound D12 (86 mg; 0.29 mmol) was dissolved in 5 raL of dry dichlonnetliane in
a flow of argon. Subsequently, 0.38 mL of triethylamine, 80 mg of
hydroxybenzotriazole, 138 mg of macrolide M4 (0.29 mmol) and 235 mg of l-(3-
dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride were added into the
solution. The reaction mixture was stirred at room temperature overnight. The solvent
was evaporated under reduced pressure. The mixture obtained was purified on a silica
gel column, eluent CHCl3:MeOH:NH4OH=90:9:1.5. 100 mg of compound 14 was
obtained; MS (m/z): 755.4 [MH]+.
A solution of theophyllinc (1,80 g, 10 rnmol), methyl acrylate (30 mL), and tBuOH
(0,96 mL, 10 mmol) in THF (200 mL) was treated with KOtBu (56,1 mg, 0,5 mmol),
heated at 130°C for 24 h, cooled, diluted with CH2C12 and washed with H2O. The
organic layer was dried over Na2SO4, evaporated and purified on a silica gel column
in the solvent system CH2Cl2:MeOH:NH4OH = 6:1:0,1. 1.4 g of the compound D13a
was obtained.
MS (m/z): 267.3 [MH]+
2-methoxycarbonylethyltheophylline (D13)

A solution of D13a (717 mg, 2,70 mmol) in THF was treated with solution of LiOH
(226,6 mg, 5,40 mmol) in water (5 mL) and stirred vigorouslyfor 5 min. HC1 (1.0 N, 8
mL) was added, followed by additional water (10 mL). The THF was removed under
vaccum and the resulting solid was isolated by filtration to give 450 mg of D13.
MS (m/z): 253.3 [MH]+
A solution of D13 (187 mg; 0.744 mmole) in 10 mL of dichloromethane was
treated with 0.828 mL of triethylamme and 201 mg of 1-hydroxybenzotriazole.
Compound M4 (354.4 mg; 0.744 mmole) and l-(3-dimethylaminopropyl)-3-ethyl-
carbodiimide hydrochloride (511 mg) were added. The reaction mixture was stirred at
room temperature in an inert atmosphere for 24 h. The solvent was then evaporated
and the compound purified on a silica gel column in the solvent system CHCI3:
MeOH:NH4OH = 6:1:0.1. 200 mg of compound D15 was isolated. MS (m/z): 711,9
[MH]+ . IR(cm-1/KBr: 3450, 3111, 2974, 2877, 1706, 1659, 1604, 1550, 1475, 1459,
1409, 1376, 1353, 1240, 1225, 1184, 1164, 1140, 1089, 1053, 1035, 976, 958, 929,
898, 850, 810, 751, 706, 666, 621.
Example 16:
Compound 18
In a solution of compound Ml (1 g, 2,384 mmol) and N,N-diisopropylethylamine
(4,054 ml, 23,84 mmol) in 60 ml acetonitrile N-(4-bromobutyl)-phthalimide (6,726 g
; 23,84 mmol) was added. The reaction mixture was stirred at 80°C for 38 hours.
After evaporation of the solvent, mixture was diluted with EtOAc and water. The
organic layer was separated and dried over Na2SO4. The solvent was evaporated
under reduced pressure and the obtained mixture was purified on a silica gel column,
eluent CH2Cl2:MeOH:NH4OH = 90:8:1. 580 mg of the compound 16 was obtained.
MS (m/z): 621,80 [MH]+. IR(cm-1)KBr: 3483, 3061, 2973, 2937, 2876, 1773, 1713,
1612, 1467, 1439, 1398, 1372, 1356, 1267, 1174, 1137, 1089, 1053, 999, 958, 933,
902,863,809,721,623.
In a solution of compound 16 (250 mg, 0.403 mmol) in 25 ml methanol hydrazine
hydrate (0,043 ml, 0,886 mmol) was added. Reaction mixture was stirred at 65°C for
3 hours. After evaporation of the solvent, mixture was diluted with EtOAc and water.
The organic layer was dried over Na2SO4. The solvent was evaporated under reduced
pressure and obtained mixture was purified on a silica gel column, eluent
CH2Cl2:MeOH:NH4OH = 6:1:0,1. 151 mg of the compound 17 was obtained. MS
(m/z): 491,66 [MH]+. IR(cm-1)/KBr: 3415, 2974, 2937, 2876, 1720, 1599, 1459, 1376,
1352, 1308, 1268, 1176, 1139, 1090, 1055, 1038,958,900,850,810,737,705,671.
Indomethacin D10 (73 mg; 0.204 mmole) was dissolved in 10 mL of dry
dichloromethane. Triethylamine (0.222 mL) and 55 mg of 1-hydroxybenzotriazole
were added and then the compound 17 (100 mg; 0.204 mmole) and l-(3-
dimethylaminopropyl)-3-ethyl-carbodiimide hydrochloride (156 mg). The reaction
mixture was stirred in an inert atmosphere at room temperature for 24 h. The solvent
was then evaporated under reduced pressure and the compound was purified on a
silica gel column, eluent CH2Cl2:MeOH:NH4OH = 90:9:1.5. 140 mg of compound 18
was obtained; MS (m/z): 830,91 [MH]+. IR(cm-1)/KBr: 3417, 3087, 2972, 2935, 2876,
1709, 1681, 1658, 1596, 1529, 1478, 1457, 1400, 1372, 1357, 1322, 1289, 1261,
1226, 1179, 1150, 1090, 1054, 1037, 1015, 958, 926, 912, 833, 805, 755, 736, 702,
664.
In a solution of compound Ml (2 g; 4,767 mmol) and N,N-diisopropylethylaminc
(8,10 ml; 47,67 mmol) in acetonitrile (80 ml) 6-bromohexanenitrile (6,32 ml; 47,67
mmol) was added. Reaction mixture was stirred at 80°C for 21 hours. After
evaporation of the solvent, mixture was diluted with dichlormethane and water. The
organic layer was dried over Na2SO4. The solvent was then evaporated under reduced
pressure and the compound was purified on a silica gel column, eluent
CH2Cl2:MeOH:NH4OH = 90:9:1.5. 532 mg of the compound 19 was obtained. MS
{m/z)\ 515,70 [MH]+. IR(cm-1)/KBr: 3444, 2973, 2937, 2875, 2247 (ON), 1712,
1637, 1459, 1375, 1352, 1307, 1265, 1179, 1139, 1090, 1052, 1004, 958, 901, 860,
810,773,750,705,670.
The macrolide 19 (532 mg; 1.034 mmole) was dissolved in 25 mL of absolute ethanol
and hydrogenated in a reactor with the catalyst PtO2 (53 mg) under pressure of 40 atm
of H2 for 24 hours. The reaction mixture was filtered and the solvent was evaporated
under reduced pressure. 463 mg of the mixture was obtained. The mixture was
purified on a silica gel column, eluent CH2Cl2:MeOH:NH4OH=6:1:0.1 ; 180 mg of
amine 21 was obtained. MS (m/z): 519.74 [MH]+.
Indomethacin D10 (62 mg; 0.174 mmole) was dissolved in 10 mL of dry
dichloromethane. Triethylamine (0.189 mL) , 47 mg of 1 -hydroxybenzotriazole , the
compound 21 (90 mg; 0.174 mmole) and l-(3-dimethylaminopropyl)-3-ethyl-
carbodiimide hydrochloride (133 mg) were added. The reaction mixture was stirred
in an inert atmosphere at room temperature for 24 h. The solvent was then evaporated
under reduced pressure and the compound was purified on a silica gel column in the
solvent system CH2Cl2:MeOH:NH4OH = 90:8:1. 105 mg of compound 22 was
obtained; MS (m/z): 858.81 [MH]+.
Desoxymethasone acid D5 (63 mg; 0,174 mmole) was dissolved in 10 mL of dry
dichloromethanc. Triethylamine (0,189 mL) , 47 mg of 1-hydroxybenzolriazole,
compound 21 (90 mg; 0.174 mmole) and l-(3-dimethylaminopropyl)-3-ethyl-
carbodiimide hydrochloride (133 mg) were added. The reaction mixture was stirred
in an inert atmosphere at room temperature for 24 h. The solvent was then evaporated
under reduced pressure and the compound was purified on a silica gel column in the
solvent system CH2Cl2:MeOH:NH4OH = 90:8:1. 98 mg of compound 23 was
obtained; MS (m/z): 863,77 [MH].
WE CLAIM;
1. Macrolide conjugate-steroid derived compounds of Formula I:
wherein
M represents the macrolide subunit of the substructure II:
wherein
R1, R2 , R3, R4 and R5 are, chosen independently of each other, from the group
consisting of hydrogen C1-C4alkyl, C1-C10alkanoyl, C1-C10alkoxycarbonyl, C6-
C14arylmethoxycarbonyl, C6-C14aroyl, C6-C14arylalkyl, C1-C10alkylsilyl and C1-
C10alkylsily lalkoxyalkyl;
Rn represents the covalent link with X1 of the chain L;
L represents the chain of the substructure III:
-X1-(CH2)m-Q-(CH2)n-X2-
III
wherein
X1 is -CH2- or -C(O)-;
X2 is -NH- or -O-;
Q is -NH- or -CH2-;
symbols m and n, independently, are whole numbers from 0 to 4;
with the proviso that if Q=NH, n cannot be 0;
D represents a steroid subunit of the substructure IV:
wherein
Ra, Rb, are chosen independently of each other from the group conisting of hydrogen
and halogen;
Rf is chosen from the group consisting of hydrogen, hydroxyl group, halogen or forms
a carbonyl group C=O with the carbon atom to which it is linked;
Rc is a covalent link with X2 of the chain L;
Rd and Re, are chosen independently from the group consisting of hydrogen, hydroxy,
methyl, C1-C4alkoxy or together with the pertaining C-atoms represent 1,3-dioxolane
ring which can be additionally mono or di-substituted with C1-C10alkyl or C2-
C10alkenyl; and
Rj is chosen from the group consisting of hydrogen and chlorine;
or pharmaceutically acceptable salt or solvate of the foregoing.
2. A compound according to claim 1 wherein R1, R2, R3, R4 and R5 are each
independently chosen from the group consisting of hydrogen and
C1-C4alkyl.
3. The compound as claimed in claim 1 wherein R1, R2, R3, R4 and R5 are chosen
independently from the group consisting of hydrogen and methyl.
4. The compound as claimed in claim 1 wherein in the chain of the substructure
III: -X1-(CH2)m-Q-(CH2)n-X2-5 X1 represents CH2 and X2 represents NH.
5. The compound as claimed in claim 4 wherein m=l, n=l and Q represents CH2.
6. A compound as claimed in claim 1 wherein substructure IV is chosen from the
group consisting of
The compound as claimed in claim 6 wherein substructure IV is
8. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
9. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
10. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
11. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
12. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
13. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
14. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
15. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
16. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
17. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
18. A compound as claimed in claim 1 having the structure
or a pharmaceutically acceptable salt or solvate thereof.
19. A pharmaceutical composition comprising a compound or pharmaceutically
acceptable salt or solvate thereof as claimed in claims 1 to 18 as well as
pharmaceutically acceptable diluent or carrier.
Dated this 5th day of October, 2005.
The present invention relates to macrolide conjugate-steroid derived compounds of
Formula I:
wherein
D, L and M are as defined in the specification.

Documents:


« Previous Patent
Next Patent »
Patent Number 224730
Indian Patent Application Number 01968/KOLNP/2005
PG Journal Number 43/2008
Publication Date 24-Oct-2008
Grant Date 22-Oct-2008
Date of Filing 05-Oct-2005
Name of Patentee GLAXOSMITHKLINE ISTRAZIVACKI CENTAR ZAGREB D.O.O.
Applicant Address A CROATION COMPANY OF PRILAZ BARUNA FILIPOVICA 29, 10000 ZAGREB, CROATIA.
Inventors:
# Inventor's Name Inventor's Address
1 MERCEP MLADEN MAJSTORA RADONJE 10, ZAGREB 10000
2 MESIC MILAN SLAVENSKOG 8, ZAGREB 10000
3 TOMASKOVIC LINDA LASCINSKA 119, ZAGREB 10000
4 MARKOVIC STRIBOR LANCAREVA 1, ZAGREB 10000
5 HRVACIC BOSKA MEDVESCAK 72, ZAGREB 10000
6 MAKARUHA ORESTA SREBRNJAK 5, ZAGREB 10000
7 POLJAK VISNJA POLJICA 29, ZADAR 23000
PCT International Classification Number C07J 1/00
PCT International Application Number PCT/IB2004/001235
PCT International Filing date 2004-04-23
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 P20030324 2003-04-24 Croatia