Indian Patents. 225188:HISTONE DEACETYLASE INHIBITORS OF NOVEL BENZAMIDE DERIVATIVES WITH POTENT DIFFERENTIATION AND ANTI-PROLIFERATION ACTIVITY

Title of Invention	HISTONE DEACETYLASE INHIBITORS OF NOVEL BENZAMIDE DERIVATIVES WITH POTENT DIFFERENTIATION AND ANTI-PROLIFERATION ACTIVITY
Abstract	The present invention is relates to the preparation and pharmaceutical uses of novel benzamide derivative as define to the specification of formulas (I) as histone deaccrylass inhanition (HDACT) their preparation and the method of using these compound or thir pharmaceutically acceptable salt in the treatment of cell peoliferative diseses, e.g. cancer and psoriasis.

Full Text	WO2004/071400 PCT/IB2004/000401 1 HISTONE DE ACETYLASE INHIBITORS OF NOVEL BENZAMIDE BEJUVAITVE5 WITH POTENT DIFFERENTIATION AND ANTl-FROLTFERATION ACTIVITY Priority is indicated herein from U.S, Provisional Application Set. No. 60/447,915, filed February 14,2003- FIELD OF THE INVENTION The present invention relates to the preparation and use of novel beuzamids derivatives as histone deacctylase inbibitors for treatments of differentiation- and/or proliferation-related disorders such as cancer and psoriasis. BACKGROUND OF THE INVENTION Aberrant expression of genes plays significant roles in pathogenesis or pathological alterations in cancer, endotrine-related disorders, immuue/inflammatory diseases, genetic diseases, and neurological diseases, The human genome is packaged into chicmatin that consists of DNA, hiatones and non-histone proteins- Chromatin structure is an important factor in determining whether a particular gene is expressed or cot. In general, condensed chromatin mediates tanscriptional repression, whereas transcriptic-nally active genes are in areas of open chromatin. Nuclcosomes form the basic repeating unit of chromatin, and consist of DNA wrapped around a histone octomer that is formed by four histone partners namely an H3-H4 tetramer and two H2A-H2B dimmers. Histone H1 acts like a linker to stabilize the higher-order folding by electrostatic neutralization of the linker DNA segments through a positively charged carboxy-terminsl domain. Therefore, the dynamic higker-order stnueture of nucleosomes defines distinct levels of chromatin organization and consequently, gene activation. Ricky W, Johnstone, "Histone deacetylase inhibitors; novel drugs for the treatment of cancer". Nature Reviews -Drug Discovey 2002, I; 287. The capacity of WO2004/071400 PCT/IB2004/000401 2 histon octomer to compact DNA is infhrencsd by a number of post-translational modifications that occur on the N-tetramal histone tails. One modification involves the reversible acetylation and deacetylation of the epsilon-amino group of lysine moieties found within the histono tails. The net level of acetylation of N-terminal histone tails is controlled by the activities of two families of enzymes, the histone acetyltransfcrasea (HATs) and histons deatetylasca (HDACs). In addition to HATs and HDACs, other factors also participate in determination of chromatin structure including methyl-CpG-binding protein and adenosine triphosphate-depedent chromatin/reinodeling complexes -that can directly recruit HDAC3, which leads to repression of gene activation (see review Current Opinion in Oncology 2001, 13:477-483). The identification of coactivator complexes that possess intrinsic HAT activity strongly supports the connection between histone acetylation and transcriptional activation. Similarly, transcriptional represser complexes have been shown to recruit HDACs to the promoter of target genes (Bioassays 1998 20:615). Sequence-specific transcription factors, such as nuclear hormone receptor superfamily, cyclic adenosine 3', 5'-monophasphate-related enhancer binding protein (CREB), and signal transducer and activator of transcription-1 (STAT-1), interact with distinct coactivitors and corepressors inside the complex of transcriptional machinery in a. DNA-context and tissus-context selective fashion, resulting in selective regulartion of gene expression networks. These regulatory networks govern homeostasis of our body's physiological functions and perturbation of those networks causes disorders and/or profoundly affects progression of diseases. Therefore, modulation of complex interactions of transcription machincfy provides novel intervention strategies for the treatments of cancer, endocrine-related disorders, immune/inflaunrnatory diseases, genetic diseases, and neurodegeneration (Karzus, E-, et al., Transcription Factor-spccific Requirements for WO2004/071400 PCT/IB2004/000401 3 Coactivator and Their Acetyltrnnsferase Functions Science 1998, 279: 703-707; McKenna, NJ and B.W. O'Malley, Combinatorial Control of Gene Expression by Nuclear Receptors and Coregulators, Cell 2002,108(4):465-474; Pazin, M.J and J.T, Kadonaga, Whatis Up and Down with Histone Dsacetylation and Transcription? Cell 1997, 89(3}:325-328; Zhong, H., R.E, Voll, and S. Ghosh, Phosphorylation of NF-B p65 by PKA Stimulates Transcriptional Activity by Promoting a Novel Bivalent Interaction with the Coactivator CBP/p300. Molecular Cell 1998, 1(5);651-671; Steffan IS. st al., Histoue deacetylase inbibitors arrest polyglutamine-dependent neurodegeneration in Divsophila, Nature 2001 413:691-694; HDAC inhibitor VX-563 from Vertex Pharnacouticals proceeds for genetic disordera, 2002 EDGAR online News, US20020115716A1, WO0056153A1). For instance, cell development and difierentiation are governed by the hierarchical order of sequsatial gene activation, which is controlled at the level of chromatin structure, Genetic alterations or mutations that cause constitutive activation of oncoproteins such as RAS, or inactivation of inmor suppressors such as p53, affect a myriad of molecular programs, including transcription. In addition, genetic abnormalities that result in improper targeting of HATs and HDACs ta certain loci, functional inactivntion of HATs overexpression of HDACs or epigenetic changes due to DKA hyper- and hyporaethylation, can shift balance between cell development and differential programs that often lead to turnor onset and progression (see review Current Opinion Genet Development 1999, 9: 40-48 and 175-184). Several human cancers have been associated with malfunctions in HAT and KDAC activity. One example is the translocadon of chromosomes 15 and 17 seen in the majority of acute promyelacytic leukemia (APL) patients. In APL, chromosomal translocations produce 5 fusion proteins that contain RARalpha, (promyelocytic leukaemia protein), and PLZF (promyelocytic zinc finger). These aberrant proteins bind to retinoic acid WO2004/071400 PCT/IB2004/000401 4 response elements, recruit HDACs with high affinity through enhanced binding for SMRT corepressor and are not responsive to retinoids, resulting in the constitutive repression of RAR-targeted genes (Oncogene 2001, 20:7204-7215). Retinold acid receptor (RAR) is a ligand-activated transcriptional modulator that is important for myeloid differentiation. RAR heterodimerized with its partner RXR binds to retinoid acid response element, located in promoter region of target genes, and in the absence of retinoids, represses transcription by recruiting SIN3/HDAC through NCOR and SMRT compressors. Addition of ligand releases the HDAC complexes from RAR/RXR, and allows subssquent binding of HATs, such as TIF2 and CBP, to activate transcription. Therefore, the coordinated activation and repression of genes that contain functional retinoid acid response elements is essential to myeloid cell differentiation. Furthermore, addition of HDAC inhibitors can restore sensitivity of APL calls to retinoid-induced myeloid cell differentiation, indicating that aberrant bistone deacetylation is a key process in leukaemogenesis. There ate reports that historic deacetylaaes, when overexpressed, silenco the expression of tumor suppressor genes that are natnral brakes against tumor growth. For example, p53, a critical regulator of cell proliferation, transmits signals to genes that control the cell cycle and apoptosis when cells ara under stress. The functions are principally controlled by the ability of p53 to bind to DNA with sequence-specificity and to activate transcription, Inactivation of this property of p53, mostly by mutations that occur in the central DNA-binding domain, often leads to malignancy. It bas been demonstrated that CBP/p300 can up-regulate p53 through core histone acetylation and p53 acetylation, (W. Gu and RG Roeder, Activation of p53 Sequence-Specific DNA Binding by Acetylation of the p53 C-Terminal Domain, Cell I997t 90(4); 595-606,) Conversely, mammnalian HDAC-1, HDAC-2, and HDAC-3 are shown to be capable of downregulating p53 function by deacetylation of both core bistone and p53 (Juan, L.-L, WO2004/071400 PCT/IB2004/000401 5 el al., Histane Deacetylases Specifically Down-regnlato p53-depeadent Gene Activation. The Journal of Biological Chemistry 2000,275(27): 20436-20443). These data show that inappropriate transcriptional repression mediated by HDACs is a common molecular mechanism that is used by oncoproteins, and alterations in chromatin structure can impinge on normal cellular differentiation, which, leads to tumor formation and otter hyperpniliferative disorders. Therefore, the inhibition of HDAC activity seems to be a rational therapeutic pathway for cancers and other hypeiprolifcrative diseases, Several classes of HDAC inhibitors have been identified, including (1) short-chain fatty acids, e.g. bntyrate and phenylbutyrate; (2) organic hydroxamic acids, e,g. suberaylanilide hydroxamic acid (SAHA) and trichostatin A (TSA); (3) cyclic tetrapeptides containing a 2-amino-8-oxo 9,10-expoxydecanoyl (AOE) moiety, e.g. tratpoxin and HC-toxin; (4) cyclic peptides without the AOE moiety, e.g. apicidin and FK228; and (5) benzamidss, e.g. MS-275 (BPO847992A1, US2002/0103192A1, WO02/26696Al, WO010/675A2, WO01/18171A2). Butyric acid acts as an inhibitor of cell proliferation and an inducer of cytodifferentiation due primarily to its activity of inhibiting histone deacetylase, (A. Nudelman and A. Rephaeli, Novel Mutual Prodrug of Retinoic and Butyric Acids win Enhanced Anticancar Activity. j. Med. Chem, 2000, 43(15): 2962-2966) Phenylbutyrate has been used as a single agent in the treatment of p-thalassemia, toxoplasmnosis, and mnlarie. It is also repotted to be successful in treating refractory APL in combination with RA (retinoid acid). (R.P, 'Warrell ct al., Therapeutic targeting of transcription in acuta promyelocytic leukemia by use of an inhibitor of histone deacetyiase, J, Nat! Cancer Tnst. 1998, 90(21): 1621-1625,) Another fetty acid, WO2004/071400 PCT/IB2004/000401 6 valproic acid, which is a potent anticonvulsant, mood stabilizer and tcratogen, is also a direct inhibitor of histont deacetylase, (C.J, Phiel et al., Histone Deacetylase Is a Direct Target ofValproic Acid, a Potent Anticohvulsant, Mood Stabilizer, and Teratogen. The Journal of Biological Chemistry 2001,276(39); 36734-36741; EP1170008Al). A set of benzamides was discovered to have HDAC inhibitory activity in the low rnicromolar range. A lead compound, MS-275, from this set of benzanrides is being tested by Milsui Chemicals, Inc. and it is the first HDAC inhibitor to demonstrate oral anticancer activity in animal models with no severe side effects. (A. Saito et al, A synthetic inhibitor of histone deacetylase, MS-27-275, with marked in vivo antitnmor activity against human tumors. Proceedings of the National Academy of Sciences of the Umted States of America I999t 96(6): 4592-4597; RP 0847992 AI). MS-275 is currently under clinical trials in the University of Maryland Greenebaum Cancer Center for leukemia patients and by the US. National Cancer Institute for advanced solid i tumors. (E.B. Levit, Clinical Triala in Leukemia focus on New Treatment Approaches. 2001 Release - University of Maiybind Medical News 2001 Maryland http//www.uinm.edu/news/releases/karp,html, A phase I Study of an Oral Histone Deacetylase Inhibitor, MS-275, in Refractory Solid turnors and Lymphornas. 2001, National Cancer Institute). However, there is still a need to discover new compounds with, improved profiles, such as stronger HDAC inhibitory activity, SUMMARY OF THE INVENTION: The current invention provides compounds that exhibit differentiation-inducing and proliferation-inhibiting effects and are useful as therapeutic treatment or improving j agents for disorders related to differentiation and/or proliferation, such as cancer and psorisis, in particular, they are highly effective against hematological malignancy and solid carcinoma. WO2004/071400 PCT/IB2004/000401 7 BRIEF DESCHUPTION OF THE FIGURES Figure 1 graphically demonstrates the transcriptional activation of varlous nuclear hotmone receptors by example HDAC inhibitors, i.e., Trichostatin A, MS-275 as well as an example compound of the present invention. DETAILED DESCRIPTION OF THE INVENTION Various publications are cited throughout the present application The contents of these publications and contents of documents cited in these publications an herein incorporated herem by reference. The present invention provides compounds represented by formula (1), or its stereoisomer, enantionuer, diastereomer, hydrate, or pharmaceutically acceptable salts thereof: wherin A is a phenyl or hetero group, optinally substiluted with1 to 4 suhstituents selected from the group consisting of a halogen atom a hydroxyl group, an amino group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons,an aminoaltyl group having 1 to 4 carbons, an alkylamino group having 1 to 4 cartons, an acyl group having 2 to 4 carbona , an acylamino group having 2 to 4 carbons, an alkythio group having 1 to 4 carbons, a WO2004/071400 PCT/IB2004/000401 8 perflnoroalkyl group having 1 to 4 carbons, a perfhuoroalkyloxy group having 1 to 4 carbons, a carboxyl group, an alkoxycarbony group having 1 to 4 carbons, a phenyl group and a heterocyclic group B is a phenyl or beterocyclic group, optionally substituted with1 to 3 substituents selected from the group consisting of a halogeu atom, a hydroxyl group, an amino group, a nitro group, a cyano group an alkyl group having I to 4 carbons, an alkcxy group hiviag 1 to 4 carbons, an aminoalkyl group having 1 to & 4 carbon an alkylamino group having 1 to 4 carbons, an acyl group having 2 to 4 carbons, an aeylamino group having 2 to 4 carbons an alkythi group having 1 to 4 carbons, a perfluoroalkyl group baring 1 lo 4 carbons, a perflianoroalkyloxy group having1 to 4 carbon, a carboxyl group an alkoxycarbonyl group having 1 to 4 carbons, a phenyl group and a heteocyclie group; Z is a bond, an optionally substituted alkylene having 1 to 4 carbons or a moiety having -O-, -S-, -NH-, -CO-, -CS-, -SO- or -SO2- which is linear cyclic or their combination; Y is a moiety having -CO, -CS-, -SO- or -SO2- which is linear, cyclic or their combination; and in which the distances between the centroid of ring B (Wl), the centroid of ring A (W2) and an oxygen or sulfur atom as a hydrogen bond acceptor in the moiety Y (W3) can, for example be as follows: Wl-W2.=6,0 to 12.0 A, Wl-W3=3.0 to 6.0 A, and W2-W3=4.0 to 8.0 A; preferably W1-W2=8.0 to 10.0 A, Wl-W3=3,0 to 5.0 A, W2-W3=5.0 to 8.0 A (compounds of the invention described herein, however, are not necessarily limited to these dimensions); R1 and R2 are independently a hydrogen or an optionally substituted alkyl having 1 to 4 carbons; or R1 and R2 may form a bond; R3 is a hydrogen or as optionally substituted alkyl having 1 to 4 carbons; R4 is a hydrogen atom, halogen atom, a hydroxyl group, an amino group, a nitro group, a WO2004/071400 PCT/IB2004/000401 9 cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylamino group having 1 to 4 carbons, an acyl group having 1 to 4 carbons, an acylamino group having 1 to 4 carbons an alkylthio group having I to 4 earbons, a perfluoroalkyl group haing 1 to 4 carbons, a perfluoroalkyloxy group having 1 to 4 carbons, a carboxy group or an alkoxycarbonyl group having 1 to 4 carbons. One of X1, X2, X3, or X4 is a halogen atom, a hydroxyl group, an amino group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylomio group having 1 to 4 carbons, an acyl group having 1 to 4 carbons, an acylamino group having 1 to A carbons, an alkylthio group having 1 to 4 carbons, a perfluoroalkyl group having 1 to 4 carbons, a pcrfluoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an alkoxyearbonyl group having 1 to 4 carbons, while the others of X1, X2, X3, or X4 independently are a hydrogen atom, a halogen atom a hydroxyl group, an amino group, a. nitro group, a cyano group, an alkyl group having 1 to 4 carbons, on alkoxy group having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylamino group having 1 to 4 carbons, an acyl group having 1 to 4 caxbons, an acylamino group having 1 to 4 carbons, an alkylthio graup having 1 to 4 carbons, a perfluoronlkyl group having' 1 to 4 carbons, a perflnoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an alkoxycarbonyl group having 1 to 4 carbons. In the above structural formula (1) and throughout the present specifications the following terms have the indicated meaning: The term "heterocyclyl" as used herein means a monovalent saturated or unsaturated group being monotyclic and containing one or more heteroatoms, such as pyrrolidine, pyrroline, pyrazoline, imidazolidine, imidazoline, piperidine, morpholine and the lite. WO2004/071400 PCT/IB2004/000401 10 The term 'halogen" as used herein means fluorine, chlorine, bromine or iodine. The term "alkyl having 1 to 4 carbons" as used herein includes methyl, ethyl, n-propyl, iso-propyl, butyl, iso-butyl, sec-butyl and lert-butyl, The term "altoxy having 1 to 4 carbons" as used herein includes methoxy, ethoxy, n-propoxy, isopropoxy, n-'butoxy, isobutoxy and the like. The term "aminoalkyl having 1 to 4 carbons" as used herein includes aminomethyl, 1-aminopropyl, 2-aminopropyl and the like. The tsm "alkylamino having 1 to 4 carbons" as used heieni includea N-methylamino, N-ethyiomino, N-isopropylamioo and the like. The tenrn "acyl having 2 to 4 carbons" as used herein includes acetyl, propionyl, butyryl, isobutyryl and the like. The term "acylamino having 2 to 4 carbons" as used herein includes acetylarnino propionylamino, butyrylamino, isobutyiytamino and the lite. The term "alkythio having 2 to 4 carbons" as used herein includes methyithro ethylthio, propytnio and the like. The term "perflioroalkyl having 2 to 4 carbons" as used hercin includes trifluaromethyl, pentafluormehyl and the like. The term "pcrtfluoroalkyloxy having 2 to 4 carbons" as used herein includes trifluoromcthoxy, peatifluoroethoxy and the like. The term "alkylene having 1 to 4 carbone" as used herein includes methylene, ethylene and the like. The term "ring centroid" used in definition of the spatial configuration may be defined as an average of X, Y and Z axes of the ring-forming atoms. The compounds of this invention are prepared as described below: (a) A compound represented by formula (II) is condensed with a compound WO2004/071400 PCT/IB2004/000401 11 wherein A, Z, Y, B, R1 and R2 are as defined above; R5 is a moiety having -C(=Q)OH (Q is an oxygen or sulfur atom) or a moiety having -NH2;R6 is a moiety haying -NH2 when R5 is a bmoiety having -C(=Q)OH (Q ia -an exygen or sulfur atom) and a koiety having -C(=Q)OH (Q is an oxygen or sulfur atom) when R5 is a moiety having -NH2. (b) A compound represmted by formula {IV) is condensed with a compound represented. by formula (V) to give the compound of this invention wherein R.3, R4, X1, X2, X3 and X4 aro as defined above. the above condensation reactions (a) and (b) are conducted using a peptide condensing agent such as dicyclohexylcarbodimide, N,N'-carbonyldiimidazole, diphcayl WO2004/071400 PCT/IB2004/000401 12 phosphoric azide, diethylphosphnrylcyanide, etc. The reaction may be conducted at 0 to 80°C for 4 to 72 hours. Solvents which may be used are normal solvents such as benzene, toluene, tetrahydrofuran, dioxane, dichloromethane, chloroform, N, K-dimethylformunide, etc. If necessary, a base such as sodium hydroxide, triethylamiae and pyridine or an acid such as hydrochloric acid, acetic acid and brifluoroacctic acid may be added to the reaction system. The compound of this invention and the intermediate represented by formula (I) may be purified or isolated by the conventional separation method such as extraction, tecrystallization, column chromatography and the like. The novel compounds of this invention have differentiation-inducing effects and thus one useful as therapeutic treatment or improving agents related to differentiation and/or proliferation-related disorders such as cancer and psoriasis. In particular, they are highly effective as carcinoatatic agents to hematological malignancy and solid carcinoma. The active ingredient of this invention "useful as a drug may be used in ths form of a general pharmaceutical composition. The pharmaceutical composition may bo in the forms normally employed, such as tablets, capsules, powders, syrups, solutions, suspensions, aerosols, and the like, may contain flavourants, sweeteners, etc. in suitable solids or liquid earners or diluents, or in suitable sterile media to form injectable solutions or suspensions. Such composition typically wntalns from 1 to 70%, preferably 5 to 50% by weight of active compound, the remainder of the composition being pharmaccutically acceptable carriers, diluents or solvents on salt solutions. The compounds of this invention are clinically administered to' mammals, including WO2004/071400 PCT/IB2004/000401 13 man and animala, via oral, nasal, trausdermal, pulmonary, or pnrenteral routes. Administration by the oral route is preferred, being more convenient and avoiding the possible pain and irritation of injection. By either route, the dosage is in he range of about 0.0001 to about 200 rng/kg body weight per day administered singly or as a divided dose. However the optimal dosage far the individual subject being treated will be determined by the person responsible for treatment, generally smaller doses being administened initially and thereafter increments made to determine the most suitable dosage. The following examples are given as specific illustrations of the invention. It should be understood, however, that the invention is not limited to the specific details set forth in the examples, All parts and percentages in the examples, as well as in the remainder of the specification are by weight unless otherwise specified Further, any range of number recited in the specification or paragraphs hereinafter describing or chaiming variousaspects of the invention, sutch as that representing a particular set of properties, units of measure, conditions, physical states or percentages is intended to literally incorporate expressly herein by reference or otherwise, any number falling within such range, including any subset of numbers or ranges subsumed within any range so recited The term "about" when used as a modifier for, or in conjanotion with, a variable, is intended to convey that the numbers and ranges disclosed herein are flexible and that practice of the present invention by those skilled in the art using temperatures, concentrations, amounts, contents, carbon numbers, and properties that are outside of the range or different: from a single value, will achieve the deaircd result. WO2004/071400 PCT/IB2004/000401 14 To a suspension of 0,33 g (2.01 mmol) of N, N'-carbonyldiimidazole in tetrahydrofunan (10 ml) is added drop-wise a solution of 0.30 g (2.01 mmol) of 3-pyridineacrylic acid at 0 0C. Then, the mixture is stirred at room temperature for 3 bouts and added drop-wise to a separately prepared 2.0 ml (2.00 mmol) of IN aqueous sodium hydroxids solution including 0.30 % (2.00 mmol) of 4-aminomethylbenzoic acid, followed by stirring at room temperature for 8 hours. The reaction mixture is evaporated under vacuum, To the residue is added a saturated solution of sodium chloride (2 ml), then the mixture is ncutralized with concentrated hydrochloric acid to pH 5. The deposited white solid is collected by filtration, washed with ice-water, end then dried to give the title compound (0.46 g, 82%). SUMS calod for C16H14N2O3: 282.2988. Found: 282.2990. MA catcd for C16H14N2O3 C,68.07%; H, 5.00%; N, 9.92. Found: C, 68.21%; H, 5.03%; N, 9.90%. WO2004/071400 PCT/IB2004/000401 15 TO a. suspension of 0.29 g (1.78 mmol) of N, N'-carbonyldiirnidazole in tetrahydrofunan (15 ml) is added 0.50 g (1.73 mmol) of 4-[N-(Pyridh-3-ylacryloyl)aminome thyl] benzoic acid, followed by stirring at 450 C for 1 hour. After cooling, the reaction mixture is added to a separately prepared tetrahydrofunan (10 ml) solution including 0,28 g (2.22 mmol) of 4-fluoro- 1,2-phemylenediamine and 0,20 g (I.7S mmol) of trifluoroacetic acid at room temperature. After reaction at room temperature for 24 hours, the deposited white solid is collected by filtration, washed with tetrahydrofunan, and then dried to give the title compound (0.40 g, 57%). 'H NMR (300 MHz, DMSO-ds): Sppm: 4.49 (2H, d), 4.84 (20, bes), 6.60 (1H, t), 6.80 (2H m), 6.96 (1H, t), 7.18 (1H, d), 7.42 {2H, d), 7.52 (1H, d), 7.95 (2H, d), 8.02 (1H, d), 8.56 (1H, d), 8,72 (1H, br. t), 8.78(1H, s), 9.60 (1H, brs). IR (KBr) cm1: 3310, 1655, 1631, 1524, 1305t 750. HRMS calcd for C22H19N4O2F: 390-4170. Formd: 390.417Z MA. calcd for C22H19N4O2F: C, 67.68%; H, 4.40%; N 14.35. Found: C, 67.52%; H24.38%; N, 14.42%. To a suspension of 033 g (2.01 mmol) of N, N'-carbonyldiimidazole in tetrahydrofunan (10 ml) is added drop-wise a solution of 0.30 g (2.01 mmol) of cianamic acid at 0 0C. Then, the mixture is stirred at room temperature for 3 hours and added drop-wise to a separately prepared 2.0 ml (2.00 mmol) of IN aqueous sodium hydrorids solution including 0.30 g (2.00 mmol) of 4-aminomethylbenzoic acid, followed by stirring at room temperature for 8 hours. The reaction mixture is WO2004/071400 PCT/IB2004/000401 16 evaporated under vacuum. To the residue is added a saturated solution of sodium chloride (2 ml), then the mixture is neutralized with concentrated hydrochloric acid to pH 7. The deposited whits solid is collected by filtration, washed with ice-water, and then dried to give the title compound (0.51 g, 91%). HRMS calcd for C17H15NO3: 281.3242. Found; 281.3240. MA calcd for C17H15NO3:C, 72,58%; H, 5.58%; N, 4.98. Found: C,72.42%;H,5.37%;N. 487%. To a suspension of 0,29 g (1,78 mmol) of M, N'-carbonyldiimidazole in retrahydrofunan (15 ml) is added 050 g (1.78 mmo) of 4-[N-cinnamoylaminomethyl]berzoic acid, followed by stining at 45°C for 1 hour. After cooling, the reaction mixture is added to a separately prepared tetrahydrofunan (10 ml) solution including 0.23 g (2.22 mmol) of 4-fluoro-l2-pheaylenediamina and 0,20 g (1.78 mmol) of trifluoroacetic acid at room temperature. After reaction at room tempetature for 16 hours the deposited white solid is collected by filtration, washed with tetrahydrofunan, and then dried to give the title compound (0.45 g, 64%). 'HNMR (300 MHz, DMSO-ds): Sppm: 4.42 (2H, d), 4.92 (2H, brs), 6.62 (1H, t), 6.78 (2H, m), 7.41 (1H,t), 732 (5H, m), 7,54 (5H, m), 8,76 (1H, brt), 9.58 (1H, br.e) IR (KBr) cm1: 3306, 1618, 1517, 1308, 745, HRMS calcd for C23H20N3O2: 389,4292, Found; 339.4294- MA caicd for C23H20N3O2:C, 70.94%; H, 5.18%; N, 10.79- Found; C, WO2004/071400 PCT/IB2004/000401 17 The inhibitory effects of M3-275 and compounds CS02100055 and CS02100019 on HDAC were tested by a HDAC colorrmetric activity assay kit (BIOMOL Research Laboratories, PA, USA) according to the instructions from the manufacture: Briefly, the tested compounds at different concentrations were added to 96-well plates, then mixed with extract from HeLa cella containing HDAC activity provided by the manufacturer. HDAC reactions were initiated by adding substrate. 10 minutes later the reactions were stopped by addition of Color De Lys Developer. Microplates were read in a plate reader at 405 m Inhibition of HDAC activity was calculated following the instructions. The testing results are listed in Table 1. IS Growth inhibition teats were earned out by MTS method. Approximately 72 hours before the viability assay, cells were seeded into 96-well platea at 5-10´103 cellwell (according to the growth rate of individual cell lines used). 24 horns later, the tested compounds at different concentrations were added, and the cells were cultured for 43 hours, then.added 20 ul/well of CellTiter 96 AQueous One Solution Reagent containing tetrazolium compound (Promega) into each well MTS was subsequently added to the culture medium. After incubation of the plates for 2 hours at about 37°C, the absorbannce at 490 nm was recorded by a 96-well plate leadet Cell viability was calculated by Atreatment. /Acontrol x 100% (A represents the absoibance recorded at 490mm). The concentration that inhibited cell growth by 50% over the control was detennincd as GISO- All of the compounds -were dissolved in DMSO and were added to the culture at a 1:1000 dilution to give a final DMSO concentration of sasayed in duplicate, and each ehperiment was repeated at least three times. the testing results are summarized in Table 2. WO2004/071400 PCT/IB2004/000401 19 Transcription activation of mclear hormone receptors by N-(2-arnino-5-flupropheny)-4 [N-(Pyridin-3-ylacryloyl) aminomethyl] benzamide (Compound CS02100055), N-(2-aminopheeny)-4- [N'-(pyridin-3-ylmethohycarbony) aminomcthyl]benzamide (MS-275, EP0847992) and Trictostatin A (TS A). Transcription activation of several nuclear hormone receptors by tested WO2004/071400 PCT/IB2004/000401 20 compounds, as indicated in Figure 1, was carried out by reporter assay experiments. Briefly, U2OS cells were seeded in 96-wcll plates the day before transfection to give a confiuency of 50-80%- cells were transfected with one of the expressioa plasrmds containing cDNAs coding either glucocorticoid recepter (GR), peroxisome proliferator activated receptor 7 (PPARy, estrogen receptor  (ER), or estrogen receptor (J (ER ), in combination with retinoid X receptor  (RXR ., and their corresponding Iuciferase reporter plasmids usiag FuGene6 traasfection reagent according to the munufacturers instructions (Ruche), Colls were allowed to express protein for 24 hours followed by addition of individual compounds or the vehicle (DMSO). 24 hours later cells were harvested, and the luoiferase assays were performed using flue luciferase assay kit according to the manufacturer's instructions (Promega). To normalize the data from the luciferase assays, B-galactosidase activity from transfected cells was measured using a kit (Promega) as instructed by the manufacturer. Response elemenrs for individual unclear receptors wera as following: CR (5'-GATCTTGTACAGG ATGTTCTCTAGCGATGTACAGGATGTTCTCTAGCGATG TACAGGATG1TCTCTAG-3') (SEQ ID NO. 1), PPAR (5"CGCGTTCCTTTCCGAACGTGACCTTTGTCCTGGTCCCCTTTTGCT-3') (SEQ ID NO. 2) and ER (5'-TCGAGTCAGGTCACAGTGACCTGATC-3') (SEQ ID NO. 3). The testing results are surmmarized in Figure 1 FIG I shows transcription activation of nuclear hormone receptors by different HDAC inhibitors Trichostatjn A, MS-275 and CS2100055. Experiments were carried out as described above. ID stands for corrcsponding Ligacds for eath receptor, and CS55 for CS2100055 in each panel of the figure. Concentrations of tested compounds in all experiments were TSA 0.2 OM, MS-275 I uM, and CS55 1 uM. Dexamethaacne (0,1 uM), Rosiglitazone (10 uM), and E2 (0.01 uM) were used as ligands for GR, PPARy, and ER, respectively. Threa independent experiments were performed and the results from a representative WO2004/071400 PCT/IB2004/000401 21 experiment were shown in Figure 1. WO2004/071400 PCT/IB2004/000401 22 or its stereoisomer enantiomer, diastercomer, hydrate, or a pharmacetically acceptable salt; wherein A is a phenyl or heterocydic gpoup., optionally substituted with 1 to 4 substituents selected from the group consisting of a balogea atom, a hydroxyl group, an amino group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoalkyl group having1 to 4 carbons, an alkylamino group having 1 to 4 carbons, an acyl group having 2 to 4 cartbons, an acytemino group having 2 to 4 carbons, an alkythio group having 1 to 4 carbons, a perfluoroalkyl group having 1 to 4 carbons, a perfluorcalkyloxy group having 1 to 4 carbons, a carboxy group alkoxycarbonyl group having 1 to 4 carbons, a phenyl group; and a heterocyclic group; B is a phenyl or heterocyclic group, optionally substittited with 1 to 3 substituents selected from the group consisting of a halogen atom, a hydroxyl group, an amino groups a nitro group, a cyano group, an aikyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoalky group having 1 to 4 carbones, an alkylamino group having 1 to 4 carbons, an acyl group having 2 to 4 carbons, an acylamino group having 2 to 4 carbons, an alkythio group having 1 to 4 carbons, 3 perfluoroalkyl group WO2004/071400 PCT/IB2004/000401 23 having 1 to 4 carbons, a perfluoroalkyloxy group having 1 to 4 cartons,a carboxyl group, an alkoxycaihonyl group having 1 to 4 carbons, a phenyl group and a heterocyclic group; Z is a bond, an optionally substituted alkylenc having 1 to 4 carbons or a moiety having -O-, -S-, -NH-, -CO-, -CS-, -SO- or -SO2 vbicb is linear, cyclic or their combination; Y is a moiety having -CO-, -CS-, -SO- or -SO1 which is linear, cyclic or a combination thereof; and in Which the distances'between the centrold of ring B (Wl), the centroid of ring A.(W2) and an oxygpn or sulfur atom as hydrogen bond acceptor in the moietyY (W3) are: Wl-W2= about 6.0 to about 12.0 A, Wl-W3= about 3.0 to about 6.0 A, and W2-W3= about 4.0 to about 8.0 A, respectively; or Wl-W2= about 8.0 to about 10.0 A, W1-W3-about 3,0 to about 5.0 A, W2-W3- about 5.0 to about 8.0 A, respectively; R1 and R2 are independently a hydrogen or an optionally substituted alkcyl having 3 to 4 carbons; or R1 and K2 may form a bond; R3 is a hydrogen or an optionally substitited alkyl having 1 to 4 carbons; R2 is a hydrogen atom, halogen atom, a hydroxyl group, an atnino group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoalkyl dM group havins 1 to 4 carbons, an alkylamino group having 1 to 4 carbons an acyl group having 1 to 4 carbons,an acylamino group having1 to 4 carbons, an alkylthio group having 1 to 4 carbons a perfluornalkyl group having 1 to 4 carbon, a perfluoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an alkoxycarbonyl group having J to 4 carbons; and One of X1, X2, X3, or X4 is a halogen atom, a hydroxyl group, an amiuo group, a nitro group, a eyano group, an alkyl group haying I to 4 carbons, an alkoxy group WO2004/071400 PCT/IB2004/000401 24 having 1 to 4 carbons, an aminoalkyl group haying 1 to 4 carbons, an alkylamino group having 1 to 4 carbone, an acyl group having 1 to 4 carbons an acylamino group having 1 to 4 carbons, an alkylthio group having 1 to 4 carbons, a perfluoroalkyl group having 1 to 4 carbons a perfluoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an alkoxycarbonyl group having 1 to 4 carbons, while the othera of X1, X2, X3, or X4 independently are a hydrogen atom, a halogen atom, a hydroxyl group, an amino group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbonc an alkylamino group having 1 to 4 carbons, an acyl group having 1 to 4 carbona, an acylamino group having 1 to 4 carbons, an alkylthio group having 1 to 4 carbons, a perfluoroallkyl group having 1 to 4 carbons, a pcrfluproalkyloxy group having 1 to 4 carbons, a carboxyl group or an alkoxycarbonyl group having 1 to 4 carbons. or its stereoisomer, enantiomer diastsreonmer, hydrate, or a phamaceutically acceptable salt; wherein A is a phenyl of heterocyclic group, optionally substituted with 1 to 4 subatituents selected from the group consisting of a halogen atom, 4 hydiuxyl group, an amino group, a nitro group, a eyano group, an alkyl group having 1 to 4 carbone, an alkoxy group having 1 to 4 carbons, an aminoatkyl group having 1 to 4 carbons, an alkyiamino group having 1 to 4 carbons an acyl group having 2 to 4 carbons, an acylamino group having 1to 4 carbone ,an alkythio group having1 to 4 carbons, a perfluoroaltyl group having 1 to 4 carbons, a perfluoroalkyloxy group having 1 to 4 WO2004/071400 PCT/IB2004/000401 25 carbons a eatboxyl groups an alkoxycarbonyl group having 1 to 4 carbons, a phenyl group and a heterocyclic group; B is a phenyl or heterocyclic group, optionally substituted with1 to 3 substitnents selected from the group consisting of a halogen atom, a hydroxyl group, an amino group, a nitro group, a cyano group, an alkyl group haying 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylamino group having 1 to 4 carbons, an acyl group having 2 to 4 carbons, an acylamino group hiving 2 to 4 carbons, an alkythio group having 1 to 4 carbons, a perfluoroalkyl group having 1 to 4 carbons, a parfluoroslkybxy group having 1 to 4 carbons, a carboxyl group, an alkoxycarbonyl group having 1 to 4 carbons, a phenyl group and a heterocyclic group; Z it a bond, an optionally substituted alkylene having 1 to 4 carbons or a moiety having -O-, -S-, -NH-, -CO, -CS-t -SO- or -SO2- which is lincar,cyclic or their Combination; Y is a moiety having -CO-, -CS-, -SO- or -SO2- which is linear, cyclic or a Combination thereof; and in Which the distances between the centroid of ring B (Wl) the centoid of ring A (W) and an oxygen or sulfur atom as a hydrogen bond acceptor in the moietyY (W3) is: Wl-W2= about 6.0 to about 120 A, Wl-W3= about 3.0 to about 6.0 A, and W2-W3= about 4.0 to about 8.0 A, rsspectively; or Wl-W2= about 3.0 to about 10.0 A, Wl-W3= about: 3.0 to about 5.0 A, W2-W3= about 5,0 to about 8.0 A, respectively; and R1 and R.2 are independently a hydrogen or ao optionally substituted alkyl having 1 to 4 carbons Or R1 and R2 may form bond. 3. A process for tile preparation of a compound according to claim 1 or its stereoisomer, enantiomer, diastereomer, hydrate or pharmaceutically aceptable salt thereof comprising the steps of: WO2004/071400 PCT/IB2004/000401 26 (a) condensing a Compound represented by formula (II) with a compound repassentsd by formula (TO) to yield a compound represented by formula (IV); R5 is a moiety having -C(=Q)OH wherein Q is an oxygen or sulfur atom, or R5 is a moiety having -NH2; R6 is a moiety having -NH2 when R5 is a moiety having -C(=Q)OH wherein Q is an ixygenor sulfur atom, or a moiety having -C(=Q)OH wherein Q is an oxygen or sulfur atom when R5 is a moiety having wherein One of X1, X2 X3, or X4 is a halogen atom, a hydroxyl group, an amirio (b) condensing the compound represented by formula (TV) with a compound represented by formula (V) to give the compound of formula (1}. WO2004/071400 PCT/IB2004/000401 27 group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylamino group having 1 to 4 carbons, an acyl group having J to 4 carbons, an acylamino group having 1 to A carbons, au alkylthio group having 1 to 4 carbons, a perfluoroalkyl group having1 to 4 carbons, a perflnoroalkyloxy group having 1 to A carbons, a carboxyl group or an alkoxycarbonyl group having 1 to 4 carbons, and the other of X1, X3, X3, or X4 independently are a hydrogen atom, a halogen atom, a hydroxyl group, an amino group, a nitro group, a cyano group an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4 carbons, an aminoatkyl group having 1 to 4 carbons, an alkyl amino group having 1 to 4 carbons, an acyl group having 1 to 4 carbons, an acylamino group having 1 to 4 carbons, an alkylthio group having1 to 4 carbons, a perfluoroalkyl group having 1 to 4 carbons, a perfluoroalltyloxy group having 1 to 4 carbons, a carboxyl group or an alkoxycarbonyl group having 1 to 4 carbons; R3 is a hydrogen or an optionally substituted alkyl having 1 to A carbons, and R4 is a hydrogen atom, halogen atom, a hydroxyl group, an amino group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons an alkoxy group having 1 to 4 carbons an aminoalkyl group having 1 to.4 carbons, an alkylamino group having 1 to 4 carbons, an acyl gpoup having 1 to 4 carbons, an acylamino group having 1 to 4 carbons, an alkylthio group having 1 to 4 carbons, a perfluoroalkyl group having 1 ro 4 carbons, a perfluoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an alkoxycarbonyl group having 1 to 4 carbons, 4. The proeoss according to claim 3, wherein the condensation reactions of steps (a) and (b) are canted out using a peptide condensing agent. 5. The process according to claim 4, wherein said pepticte condensing agent is dicyclohexylcarbodiimide, N,N'-carbonyldiimidazole, diphenyl phosphoric azide, or WO2004/071400 PCT/IB2004/000401 28 diethylphosphorylcyamide. 6. The process of claim 3, wherein said condensation reactions of steps (a) and (b) are conducted at a temperature from about 00C to about 800C. 7. A phamaceutical composition useful as a therapeutic and/or improving agent for differentiation and/or proliferation-related disorders comprising an effective amount of a compound according to claim 1 and at least one pharmaceutically acceptable exipient, carrier or diluent 8- The pharmaceutical composition of claim 7, wherein said proliferation-related disorder is selected from the group consisting essentially of psoriasis, a hematological malignancy and a solid carcinoma. 9. A dosage form unit of the pharmaceutical composition of claim 7 comprising an amount within the range of about 0,0001 to about 200 mg of said compound, 10. A pharmaceutical composition according to claim 7 for administration by me oral, nasal, transdermal pulmonary; of parenteral route. 11. A method. of treating cell proliferative diseases comprising administering to a subject in need therreof an effective amount of a compound of cliam 1 12 A method according to claim 11, wherein said cell proliferative disease is selected from the group consisting essentially of a malignant tumor and psoriasis. 13, The method according to claim 11, wherein the effective amount of the compound is within the range of about 0.0001 to about 200mg/kg dody weight per day- WO2004/071400 PCT/IB2004/000401 39 14. A method of treating a cell profilerative disease comprising administering to a subject in need thereof an effective amount of a compound according to claim 1 in combination with an active pharmacentical chemotherapeutic compound or methyl transferase inhibitor formulated with at least one pharnaceutically acceptable excipient, carrier or dilueat 15. The method of claim 14. wherein said cell preliferative disease is selected from the group consisting essentially of a maligraant tumro and psoriasis 16. A. pharmaceutical composition for activating nuclear receptors comprising an effective amount of a compound according to claim 1 and at least one a pharmaceutically acceptable excipient, earrier or diluent 11. A, dasege form unit of the phannaceutioal composition of claim16 comprising an amount within the range of about 0.0001 to about 200 me of the compound. 18. A pharmaceutical composition according to claim 16 for administration by the oral, nasal, trsusderrnal, pulmonary, or parenteral ronte. 19. A method of treatment or prevention of a condition mediated by a nuclear receptor comprising administering to a subject in nesd thereof an effective amount of a compound of claim 1. 20. A method of treatment or prevention of a condition mediated by abnorrally low activity of a nuclear receptor comprising administering to a subject in need thereof an effective amount of a compound according to claim 1. WO2004/071400 PCT/IB2004/000401 30 21- A method according to claim. 19, lwherein.thecondition is selected from the group consisting essentially of an endocrinc-related disorder, an immune system or inflammatory disorder, a genetic disorder, and neurodegeneration 22. A method according to claim 20, wherein the condition is selected from the group consisting essentially of an endocrine-related disorder an irumune system or inflammatory disorder, a genetic disorder, and neurodeneration. 23. The method according to claim 19, wherein the effective amount of the compound is within the range of about 0.0001 to about 200mg/kg body weight per day. 24. the method according to claim 20, wherein the effective amount of the compound is within the range of abort 0.0001 to about 200mg/kg body weight per day The present invention is relates to the preparation and pharmaceutical uses of novel benzamide derivative as define to the specification of formulas (I) as histone deaccrylass inhanition (HDACT) their preparation and the method of using these compound or thir pharmaceutically acceptable salt in the treatment of cell peoliferative diseses, e.g. cancer and psoriasis.

Full Text

WO2004/071400 PCT/IB2004/000401
1
HISTONE DE ACETYLASE INHIBITORS OF NOVEL BENZAMIDE
BEJUVAITVE5 WITH POTENT DIFFERENTIATION AND
ANTl-FROLTFERATION ACTIVITY
Priority is indicated herein from U.S, Provisional Application Set. No. 60/447,915, filed
February 14,2003-
FIELD OF THE INVENTION
The present invention relates to the preparation and use of novel beuzamids derivatives
as histone deacctylase inbibitors for treatments of differentiation- and/or
proliferation-related disorders such as cancer and psoriasis.
BACKGROUND OF THE INVENTION
Aberrant expression of genes plays significant roles in pathogenesis or pathological
alterations in cancer, endotrine-related disorders, immuue/inflammatory diseases,
genetic diseases, and neurological diseases, The human genome is packaged into
chicmatin that consists of DNA, hiatones and non-histone proteins- Chromatin structure
is an important factor in determining whether a particular gene is expressed or cot. In
general, condensed chromatin mediates tanscriptional repression, whereas
transcriptic-nally active genes are in areas of open chromatin. Nuclcosomes form the
basic repeating unit of chromatin, and consist of DNA wrapped around a histone
octomer that is formed by four histone partners namely an H3-H4 tetramer and two
H2A-H2B dimmers. Histone H1 acts like a linker to stabilize the higher-order folding
by electrostatic neutralization of the linker DNA segments through a positively charged
carboxy-terminsl domain. Therefore, the dynamic higker-order stnueture of
nucleosomes defines distinct levels of chromatin organization and consequently, gene
activation. Ricky W, Johnstone, "Histone deacetylase inhibitors; novel drugs for the
treatment of cancer". Nature Reviews -Drug Discovey 2002, I; 287. The capacity of

WO2004/071400 PCT/IB2004/000401
2
histon octomer to compact DNA is infhrencsd by a number of post-translational
modifications that occur on the N-tetramal histone tails. One modification involves the
reversible acetylation and deacetylation of the epsilon-amino group of lysine moieties
found within the histono tails. The net level of acetylation of N-terminal histone tails is
controlled by the activities of two families of enzymes, the histone acetyltransfcrasea
(HATs) and histons deatetylasca (HDACs). In addition to HATs and HDACs, other
factors also participate in determination of chromatin structure including
methyl-CpG-binding protein and adenosine triphosphate-depedent
chromatin/reinodeling complexes -that can directly recruit HDAC3, which leads to
repression of gene activation (see review Current Opinion in Oncology 2001,
13:477-483).
The identification of coactivator complexes that possess intrinsic HAT activity strongly
supports the connection between histone acetylation and transcriptional activation.
Similarly, transcriptional represser complexes have been shown to recruit HDACs to
the promoter of target genes (Bioassays 1998 20:615). Sequence-specific transcription
factors, such as nuclear hormone receptor superfamily, cyclic adenosine 3',
5'-monophasphate-related enhancer binding protein (CREB), and signal transducer and
activator of transcription-1 (STAT-1), interact with distinct coactivitors and
corepressors inside the complex of transcriptional machinery in a. DNA-context and
tissus-context selective fashion, resulting in selective regulartion of gene expression
networks. These regulatory networks govern homeostasis of our body's physiological
functions and perturbation of those networks causes disorders and/or profoundly affects
progression of diseases. Therefore, modulation of complex interactions of transcription
machincfy provides novel intervention strategies for the treatments of cancer,
endocrine-related disorders, immune/inflaunrnatory diseases, genetic diseases, and
neurodegeneration (Karzus, E-, et al., Transcription Factor-spccific Requirements for

WO2004/071400 PCT/IB2004/000401
3
Coactivator and Their Acetyltrnnsferase Functions Science 1998, 279: 703-707;
McKenna, NJ and B.W. O'Malley, Combinatorial Control of Gene Expression by
Nuclear Receptors and Coregulators, Cell 2002,108(4):465-474; Pazin, M.J and
J.T, Kadonaga, Whatis Up and Down with Histone Dsacetylation and Transcription?
Cell 1997, 89(3}:325-328; Zhong, H., R.E, Voll, and S. Ghosh, Phosphorylation of
NF-B p65 by PKA Stimulates Transcriptional Activity by Promoting a Novel Bivalent
Interaction with the Coactivator CBP/p300. Molecular Cell 1998, 1(5);651-671; Steffan
IS. st al., Histoue deacetylase inbibitors arrest polyglutamine-dependent
neurodegeneration in Divsophila, Nature 2001 413:691-694; HDAC inhibitor VX-563
from Vertex Pharnacouticals proceeds for genetic disordera, 2002 EDGAR online
News, US20020115716A1, WO0056153A1).
For instance, cell development and difierentiation are governed by the hierarchical
order of sequsatial gene activation, which is controlled at the level of chromatin
structure, Genetic alterations or mutations that cause constitutive activation of
oncoproteins such as RAS, or inactivation of inmor suppressors such as p53, affect a
myriad of molecular programs, including transcription. In addition, genetic
abnormalities that result in improper targeting of HATs and HDACs ta certain loci,
functional inactivntion of HATs overexpression of HDACs or epigenetic changes due
to DKA hyper- and hyporaethylation, can shift balance between cell development and
differential programs that often lead to turnor onset and progression (see review
Current Opinion Genet Development 1999, 9: 40-48 and 175-184). Several human
cancers have been associated with malfunctions in HAT and KDAC activity. One
example is the translocadon of chromosomes 15 and 17 seen in the majority of acute
promyelacytic leukemia (APL) patients. In APL, chromosomal translocations produce
5 fusion proteins that contain RARalpha, (promyelocytic leukaemia protein), and
PLZF (promyelocytic zinc finger). These aberrant proteins bind to retinoic acid

WO2004/071400 PCT/IB2004/000401
4
response elements, recruit HDACs with high affinity through enhanced binding for
SMRT corepressor and are not responsive to retinoids, resulting in the constitutive
repression of RAR-targeted genes (Oncogene 2001, 20:7204-7215). Retinold acid
receptor (RAR) is a ligand-activated transcriptional modulator that is important for
myeloid differentiation. RAR heterodimerized with its partner RXR binds to retinoid
acid response element, located in promoter region of target genes, and in the absence of
retinoids, represses transcription by recruiting SIN3/HDAC through NCOR and SMRT
compressors. Addition of ligand releases the HDAC complexes from RAR/RXR, and
allows subssquent binding of HATs, such as TIF2 and CBP, to activate transcription.
Therefore, the coordinated activation and repression of genes that contain functional
retinoid acid response elements is essential to myeloid cell differentiation. Furthermore,
addition of HDAC inhibitors can restore sensitivity of APL calls to retinoid-induced
myeloid cell differentiation, indicating that aberrant bistone deacetylation is a key
process in leukaemogenesis.
There ate reports that historic deacetylaaes, when overexpressed, silenco the expression
of tumor suppressor genes that are natnral brakes against tumor growth. For example,
p53, a critical regulator of cell proliferation, transmits signals to genes that control the
cell cycle and apoptosis when cells ara under stress. The functions are principally
controlled by the ability of p53 to bind to DNA with sequence-specificity and to
activate transcription, Inactivation of this property of p53, mostly by mutations that
occur in the central DNA-binding domain, often leads to malignancy. It bas been
demonstrated that CBP/p300 can up-regulate p53 through core histone acetylation and
p53 acetylation, (W. Gu and RG Roeder, Activation of p53 Sequence-Specific DNA
Binding by Acetylation of the p53 C-Terminal Domain, Cell I997t 90(4); 595-606,)
Conversely, mammnalian HDAC-1, HDAC-2, and HDAC-3 are shown to be capable of
downregulating p53 function by deacetylation of both core bistone and p53 (Juan, L.-L,

WO2004/071400 PCT/IB2004/000401
5
el al., Histane Deacetylases Specifically Down-regnlato p53-depeadent Gene
Activation. The Journal of Biological Chemistry 2000,275(27): 20436-20443).
These data show that inappropriate transcriptional repression mediated by HDACs is a
common molecular mechanism that is used by oncoproteins, and alterations in
chromatin structure can impinge on normal cellular differentiation, which, leads to
tumor formation and otter hyperpniliferative disorders. Therefore, the inhibition of
HDAC activity seems to be a rational therapeutic pathway for cancers and other
hypeiprolifcrative diseases,
Several classes of HDAC inhibitors have been identified, including (1) short-chain fatty
acids, e.g. bntyrate and phenylbutyrate; (2) organic hydroxamic acids, e,g.
suberaylanilide hydroxamic acid (SAHA) and trichostatin A (TSA); (3) cyclic
tetrapeptides containing a 2-amino-8-oxo 9,10-expoxydecanoyl (AOE) moiety, e.g.
tratpoxin and HC-toxin; (4) cyclic peptides without the AOE moiety, e.g. apicidin and
FK228; and (5) benzamidss, e.g. MS-275 (BPO847992A1, US2002/0103192A1,
WO02/26696Al, WO010/675A2, WO01/18171A2).
Butyric acid acts as an inhibitor of cell proliferation and an inducer of
cytodifferentiation due primarily to its activity of inhibiting histone deacetylase, (A.
Nudelman and A. Rephaeli, Novel Mutual Prodrug of Retinoic and Butyric Acids win
Enhanced Anticancar Activity. j. Med. Chem, 2000, 43(15): 2962-2966)
Phenylbutyrate has been used as a single agent in the treatment of p-thalassemia,
toxoplasmnosis, and mnlarie. It is also repotted to be successful in treating refractory
APL in combination with RA (retinoid acid). (R.P, 'Warrell ct al., Therapeutic targeting
of transcription in acuta promyelocytic leukemia by use of an inhibitor of histone
deacetyiase, J, Nat! Cancer Tnst. 1998, 90(21): 1621-1625,) Another fetty acid,

WO2004/071400 PCT/IB2004/000401
6
valproic acid, which is a potent anticonvulsant, mood stabilizer and tcratogen, is also a
direct inhibitor of histont deacetylase, (C.J, Phiel et al., Histone Deacetylase Is a Direct
Target ofValproic Acid, a Potent Anticohvulsant, Mood Stabilizer, and Teratogen. The
Journal of Biological Chemistry 2001,276(39); 36734-36741; EP1170008Al).
A set of benzamides was discovered to have HDAC inhibitory activity in the low
rnicromolar range. A lead compound, MS-275, from this set of benzanrides is being
tested by Milsui Chemicals, Inc. and it is the first HDAC inhibitor to demonstrate oral
anticancer activity in animal models with no severe side effects. (A. Saito et al, A
synthetic inhibitor of histone deacetylase, MS-27-275, with marked in vivo antitnmor
activity against human tumors. Proceedings of the National Academy of Sciences of the
Umted States of America I999t 96(6): 4592-4597; RP 0847992 AI). MS-275 is
currently under clinical trials in the University of Maryland Greenebaum Cancer Center
for leukemia patients and by the US. National Cancer Institute for advanced solid
i tumors. (E.B. Levit, Clinical Triala in Leukemia focus on New Treatment Approaches.
2001 Release - University of Maiybind Medical News 2001 Maryland
http//www.uinm.edu/news/releases/karp,html, A phase I Study of an Oral Histone
Deacetylase Inhibitor, MS-275, in Refractory Solid turnors and Lymphornas. 2001,
National Cancer Institute). However, there is still a need to discover new compounds
with, improved profiles, such as stronger HDAC inhibitory activity,
SUMMARY OF THE INVENTION:
The current invention provides compounds that exhibit differentiation-inducing and
proliferation-inhibiting effects and are useful as therapeutic treatment or improving
j agents for disorders related to differentiation and/or proliferation, such as cancer and
psorisis, in particular, they are highly effective against hematological malignancy and
solid carcinoma.

WO2004/071400 PCT/IB2004/000401
7
BRIEF DESCHUPTION OF THE FIGURES
Figure 1 graphically demonstrates the transcriptional activation of varlous nuclear
hotmone receptors by example HDAC inhibitors, i.e., Trichostatin A, MS-275 as well
as an example compound of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
Various publications are cited throughout the present application The contents of
these publications and contents of documents cited in these publications an herein
incorporated herem by reference.
The present invention provides compounds represented by formula (1), or its
stereoisomer, enantionuer, diastereomer, hydrate, or pharmaceutically acceptable salts
thereof:

wherin A is a phenyl or hetero group, optinally substiluted with1 to 4
suhstituents selected from the group consisting of a halogen atom a hydroxyl group, an
amino group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an
alkoxy group having 1 to 4 carbons,an aminoaltyl group having 1 to 4 carbons, an
alkylamino group having 1 to 4 cartons, an acyl group having 2 to 4 carbona , an
acylamino group having 2 to 4 carbons, an alkythio group having 1 to 4 carbons, a

WO2004/071400 PCT/IB2004/000401
8
perflnoroalkyl group having 1 to 4 carbons, a perfhuoroalkyloxy group having 1 to 4
carbons, a carboxyl group, an alkoxycarbony group having 1 to 4 carbons, a phenyl
group and a heterocyclic group
B is a phenyl or beterocyclic group, optionally substituted with1 to 3 substituents
selected from the group consisting of a halogeu atom, a hydroxyl group, an amino
group, a nitro group, a cyano group an alkyl group having I to 4 carbons, an alkcxy
group hiviag 1 to 4 carbons, an aminoalkyl group having 1 to & 4 carbon an alkylamino
group having 1 to 4 carbons, an acyl group having 2 to 4 carbons, an aeylamino group
having 2 to 4 carbons an alkythi group having 1 to 4 carbons, a perfluoroalkyl group
baring 1 lo 4 carbons, a perflianoroalkyloxy group having1 to 4 carbon, a carboxyl
group an alkoxycarbonyl group having 1 to 4 carbons, a phenyl group and a
heteocyclie group;
Z is a bond, an optionally substituted alkylene having 1 to 4 carbons or a moiety
having -O-, -S-, -NH-, -CO-, -CS-, -SO- or -SO2- which is linear cyclic or their
combination;
Y is a moiety having -CO, -CS-, -SO- or -SO2- which is linear, cyclic or their
combination; and in which the distances between the centroid of ring B (Wl), the
centroid of ring A (W2) and an oxygen or sulfur atom as a hydrogen bond acceptor in
the moiety Y (W3) can, for example be as follows: Wl-W2.=6,0 to 12.0 A,
Wl-W3=3.0 to 6.0 A, and W2-W3=4.0 to 8.0 A; preferably W1-W2=8.0 to 10.0 A,
Wl-W3=3,0 to 5.0 A, W2-W3=5.0 to 8.0 A (compounds of the invention described
herein, however, are not necessarily limited to these dimensions);
R1 and R2 are independently a hydrogen or an optionally substituted alkyl having 1
to 4 carbons; or R1 and R2 may form a bond;
R3 is a hydrogen or as optionally substituted alkyl having 1 to 4 carbons; R4 is a
hydrogen atom, halogen atom, a hydroxyl group, an amino group, a nitro group, a

WO2004/071400 PCT/IB2004/000401
9
cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1 to 4
carbons, an aminoalkyl group having 1 to 4 carbons, an alkylamino group having 1 to 4
carbons, an acyl group having 1 to 4 carbons, an acylamino group having 1 to 4 carbons
an alkylthio group having I to 4 earbons, a perfluoroalkyl group haing 1 to 4 carbons,
a perfluoroalkyloxy group having 1 to 4 carbons, a carboxy group or an
alkoxycarbonyl group having 1 to 4 carbons.
One of X1, X2, X3, or X4 is a halogen atom, a hydroxyl group, an amino group, a
nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group
having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylomio group
having 1 to 4 carbons, an acyl group having 1 to 4 carbons, an acylamino group having
1 to A carbons, an alkylthio group having 1 to 4 carbons, a perfluoroalkyl group having
1 to 4 carbons, a pcrfluoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an
alkoxyearbonyl group having 1 to 4 carbons, while the others of X1, X2, X3, or X4
independently are a hydrogen atom, a halogen atom a hydroxyl group, an amino group,
a. nitro group, a cyano group, an alkyl group having 1 to 4 carbons, on alkoxy group
having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylamino group
having 1 to 4 carbons, an acyl group having 1 to 4 caxbons, an acylamino group having
1 to 4 carbons, an alkylthio graup having 1 to 4 carbons, a perfluoronlkyl group having'
1 to 4 carbons, a perflnoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an
alkoxycarbonyl group having 1 to 4 carbons.
In the above structural formula (1) and throughout the present specifications the
following terms have the indicated meaning:
The term "heterocyclyl" as used herein means a monovalent saturated or
unsaturated group being monotyclic and containing one or more heteroatoms, such as
pyrrolidine, pyrroline, pyrazoline, imidazolidine, imidazoline, piperidine, morpholine
and the lite.

WO2004/071400 PCT/IB2004/000401
10
The term 'halogen" as used herein means fluorine, chlorine, bromine or iodine.
The term "alkyl having 1 to 4 carbons" as used herein includes methyl, ethyl,
n-propyl, iso-propyl, butyl, iso-butyl, sec-butyl and lert-butyl,
The term "altoxy having 1 to 4 carbons" as used herein includes methoxy, ethoxy,
n-propoxy, isopropoxy, n-'butoxy, isobutoxy and the like.
The term "aminoalkyl having 1 to 4 carbons" as used herein includes aminomethyl,
1-aminopropyl, 2-aminopropyl and the like.
The tsm "alkylamino having 1 to 4 carbons" as used heieni includea
N-methylamino, N-ethyiomino, N-isopropylamioo and the like.
The tenrn "acyl having 2 to 4 carbons" as used herein includes acetyl, propionyl,
butyryl, isobutyryl and the like.
The term "acylamino having 2 to 4 carbons" as used herein includes acetylarnino
propionylamino, butyrylamino, isobutyiytamino and the lite.
The term "alkythio having 2 to 4 carbons" as used herein includes methyithro
ethylthio, propytnio and the like.
The term "perflioroalkyl having 2 to 4 carbons" as used hercin includes
trifluaromethyl, pentafluormehyl and the like.
The term "pcrtfluoroalkyloxy having 2 to 4 carbons" as used herein includes
trifluoromcthoxy, peatifluoroethoxy and the like.
The term "alkylene having 1 to 4 carbone" as used herein includes methylene,
ethylene and the like.
The term "ring centroid" used in definition of the spatial configuration may be
defined as an average of X, Y and Z axes of the ring-forming atoms.
The compounds of this invention are prepared as described below:
(a) A compound represented by formula (II) is condensed with a compound

WO2004/071400 PCT/IB2004/000401
11

wherein A, Z, Y, B, R1 and R2 are as defined above; R5 is a moiety having -C(=Q)OH
(Q is an oxygen or sulfur atom) or a moiety having -NH2;R6 is a moiety haying -NH2
when R5 is a bmoiety having -C(=Q)OH (Q ia -an exygen or sulfur atom) and a koiety
having -C(=Q)OH (Q is an oxygen or sulfur atom) when R5 is a moiety having -NH2.
(b) A compound represmted by formula {IV) is condensed with a compound
represented. by formula (V) to give the compound of this invention

wherein R.3, R4, X1, X2, X3 and X4 aro as defined above.
the above condensation reactions (a) and (b) are conducted using a peptide condensing
agent such as dicyclohexylcarbodimide, N,N'-carbonyldiimidazole, diphcayl

WO2004/071400 PCT/IB2004/000401
12
phosphoric azide, diethylphosphnrylcyanide, etc.
The reaction may be conducted at 0 to 80°C for 4 to 72 hours. Solvents which may
be used are normal solvents such as benzene, toluene, tetrahydrofuran, dioxane,
dichloromethane, chloroform, N, K-dimethylformunide, etc. If necessary, a base such
as sodium hydroxide, triethylamiae and pyridine or an acid such as hydrochloric acid,
acetic acid and brifluoroacctic acid may be added to the reaction system.
The compound of this invention and the intermediate represented by formula (I) may
be purified or isolated by the conventional separation method such as extraction,
tecrystallization, column chromatography and the like.
The novel compounds of this invention have differentiation-inducing effects and thus
one useful as therapeutic treatment or improving agents related to differentiation and/or
proliferation-related disorders such as cancer and psoriasis. In particular, they are
highly effective as carcinoatatic agents to hematological malignancy and solid
carcinoma.
The active ingredient of this invention "useful as a drug may be used in ths form of a
general pharmaceutical composition. The pharmaceutical composition may bo in the
forms normally employed, such as tablets, capsules, powders, syrups, solutions,
suspensions, aerosols, and the like, may contain flavourants, sweeteners, etc. in suitable
solids or liquid earners or diluents, or in suitable sterile media to form injectable
solutions or suspensions. Such composition typically wntalns from 1 to 70%,
preferably 5 to 50% by weight of active compound, the remainder of the composition
being pharmaccutically acceptable carriers, diluents or solvents on salt solutions.
The compounds of this invention are clinically administered to' mammals, including

WO2004/071400 PCT/IB2004/000401
13
man and animala, via oral, nasal, trausdermal, pulmonary, or pnrenteral routes.
Administration by the oral route is preferred, being more convenient and avoiding the
possible pain and irritation of injection. By either route, the dosage is in he range of
about 0.0001 to about 200 rng/kg body weight per day administered singly or as a
divided dose. However the optimal dosage far the individual subject being treated will
be determined by the person responsible for treatment, generally smaller doses being
administened initially and thereafter increments made to determine the most suitable
dosage.
The following examples are given as specific illustrations of the invention. It should
be understood, however, that the invention is not limited to the specific details set forth
in the examples, All parts and percentages in the examples, as well as in the
remainder of the specification are by weight unless otherwise specified
Further, any range of number recited in the specification or paragraphs hereinafter
describing or chaiming variousaspects of the invention, sutch as that representing a
particular set of properties, units of measure, conditions, physical states or percentages
is intended to literally incorporate expressly herein by reference or otherwise, any
number falling within such range, including any subset of numbers or ranges subsumed
within any range so recited The term "about" when used as a modifier for, or in
conjanotion with, a variable, is intended to convey that the numbers and ranges
disclosed herein are flexible and that practice of the present invention by those skilled
in the art using temperatures, concentrations, amounts, contents, carbon numbers, and
properties that are outside of the range or different: from a single value, will achieve the
deaircd result.

WO2004/071400 PCT/IB2004/000401
14

To a suspension of 0,33 g (2.01 mmol) of N, N'-carbonyldiimidazole in
tetrahydrofunan (10 ml) is added drop-wise a solution of 0.30 g (2.01 mmol) of
3-pyridineacrylic acid at 0 0C. Then, the mixture is stirred at room temperature for 3
bouts and added drop-wise to a separately prepared 2.0 ml (2.00 mmol) of IN aqueous
sodium hydroxids solution including 0.30 % (2.00 mmol) of 4-aminomethylbenzoic acid,
followed by stirring at room temperature for 8 hours. The reaction mixture is
evaporated under vacuum, To the residue is added a saturated solution of sodium
chloride (2 ml), then the mixture is ncutralized with concentrated hydrochloric acid to
pH 5. The deposited white solid is collected by filtration, washed with ice-water, end
then dried to give the title compound (0.46 g, 82%). SUMS calod for C16H14N2O3:
282.2988. Found: 282.2990. MA catcd for C16H14N2O3 C,68.07%; H, 5.00%; N, 9.92.
Found: C, 68.21%; H, 5.03%; N, 9.90%.

WO2004/071400 PCT/IB2004/000401
15
TO a. suspension of 0.29 g (1.78 mmol) of N, N'-carbonyldiirnidazole in
tetrahydrofunan (15 ml) is added 0.50 g (1.73 mmol) of
4-[N-(Pyridh-3-ylacryloyl)aminome thyl] benzoic acid, followed by stirring at 450 C for
1 hour. After cooling, the reaction mixture is added to a separately prepared
tetrahydrofunan (10 ml) solution including 0,28 g (2.22 mmol) of 4-fluoro-
1,2-phemylenediamine and 0,20 g (I.7S mmol) of trifluoroacetic acid at room
temperature. After reaction at room temperature for 24 hours, the deposited white solid
is collected by filtration, washed with tetrahydrofunan, and then dried to give the title
compound (0.40 g, 57%). 'H NMR (300 MHz, DMSO-ds): Sppm: 4.49 (2H, d), 4.84
(20, bes), 6.60 (1H, t), 6.80 (2H m), 6.96 (1H, t), 7.18 (1H, d), 7.42 {2H, d), 7.52 (1H,
d), 7.95 (2H, d), 8.02 (1H, d), 8.56 (1H, d), 8,72 (1H, br. t), 8.78(1H, s), 9.60 (1H, brs).
IR (KBr) cm1: 3310, 1655, 1631, 1524, 1305t 750. HRMS calcd for C22H19N4O2F:
390-4170. Formd: 390.417Z MA. calcd for C22H19N4O2F: C, 67.68%; H, 4.40%; N
14.35. Found: C, 67.52%; H24.38%; N, 14.42%.

To a suspension of 033 g (2.01 mmol) of N, N'-carbonyldiimidazole in
tetrahydrofunan (10 ml) is added drop-wise a solution of 0.30 g (2.01 mmol) of
cianamic acid at 0 0C. Then, the mixture is stirred at room temperature for 3 hours and
added drop-wise to a separately prepared 2.0 ml (2.00 mmol) of IN aqueous sodium
hydrorids solution including 0.30 g (2.00 mmol) of 4-aminomethylbenzoic acid,
followed by stirring at room temperature for 8 hours. The reaction mixture is

WO2004/071400 PCT/IB2004/000401
16
evaporated under vacuum. To the residue is added a saturated solution of sodium
chloride (2 ml), then the mixture is neutralized with concentrated hydrochloric acid to
pH 7. The deposited whits solid is collected by filtration, washed with ice-water, and
then dried to give the title compound (0.51 g, 91%). HRMS calcd for C17H15NO3:
281.3242. Found; 281.3240. MA calcd for C17H15NO3:C, 72,58%; H, 5.58%; N, 4.98.
Found: C,72.42%;H,5.37%;N. 487%.

To a suspension of 0,29 g (1,78 mmol) of M, N'-carbonyldiimidazole in
retrahydrofunan (15 ml) is added 050 g (1.78 mmo) of
4-[N-cinnamoylaminomethyl]berzoic acid, followed by stining at 45°C for 1 hour.
After cooling, the reaction mixture is added to a separately prepared tetrahydrofunan
(10 ml) solution including 0.23 g (2.22 mmol) of 4-fluoro-l2-pheaylenediamina and
0,20 g (1.78 mmol) of trifluoroacetic acid at room temperature. After reaction at room
tempetature for 16 hours the deposited white solid is collected by filtration, washed
with tetrahydrofunan, and then dried to give the title compound (0.45 g, 64%). 'HNMR
(300 MHz, DMSO-ds): Sppm: 4.42 (2H, d), 4.92 (2H, brs), 6.62 (1H, t), 6.78 (2H, m),
7.41 (1H,t), 732 (5H, m), 7,54 (5H, m), 8,76 (1H, brt), 9.58 (1H, br.e) IR (KBr) cm1:
3306, 1618, 1517, 1308, 745, HRMS calcd for C23H20N3O2: 389,4292, Found;
339.4294- MA caicd for C23H20N3O2:C, 70.94%; H, 5.18%; N, 10.79- Found; C,

WO2004/071400 PCT/IB2004/000401
17

The inhibitory effects of M3-275 and compounds CS02100055 and CS02100019 on
HDAC were tested by a HDAC colorrmetric activity assay kit (BIOMOL Research
Laboratories, PA, USA) according to the instructions from the manufacture: Briefly,
the tested compounds at different concentrations were added to 96-well plates, then
mixed with extract from HeLa cella containing HDAC activity provided by the
manufacturer. HDAC reactions were initiated by adding substrate. 10 minutes later the
reactions were stopped by addition of Color De Lys Developer. Microplates were read
in a plate reader at 405 m Inhibition of HDAC activity was calculated following the
instructions. The testing results are listed in Table 1.

IS

Growth inhibition teats were earned out by MTS method. Approximately 72 hours
before the viability assay, cells were seeded into 96-well platea at 5-10´103 cellwell
(according to the growth rate of individual cell lines used). 24 horns later, the tested
compounds at different concentrations were added, and the cells were cultured for 43
hours, then.added 20 ul/well of CellTiter 96 AQueous One Solution Reagent containing
tetrazolium compound (Promega) into each well MTS was subsequently added to the
culture medium. After incubation of the plates for 2 hours at about 37°C, the
absorbannce at 490 nm was recorded by a 96-well plate leadet Cell viability was
calculated by Atreatment. /Acontrol x 100% (A represents the absoibance recorded at 490mm).
The concentration that inhibited cell growth by 50% over the control was detennincd as
GISO- All of the compounds -were dissolved in DMSO and were added to the culture at a
1:1000 dilution to give a final DMSO concentration of sasayed in duplicate, and each ehperiment was repeated at least three times. the
testing results are summarized in Table 2.

WO2004/071400 PCT/IB2004/000401
19

Transcription activation of mclear hormone receptors by
N-(2-arnino-5-flupropheny)-4 [N-(Pyridin-3-ylacryloyl) aminomethyl] benzamide
(Compound CS02100055), N-(2-aminopheeny)-4- [N'-(pyridin-3-ylmethohycarbony)
aminomcthyl]benzamide (MS-275, EP0847992) and Trictostatin A (TS A).
Transcription activation of several nuclear hormone receptors by tested

WO2004/071400 PCT/IB2004/000401
20
compounds, as indicated in Figure 1, was carried out by reporter assay experiments.
Briefly, U2OS cells were seeded in 96-wcll plates the day before transfection to give a
confiuency of 50-80%- cells were transfected with one of the expressioa plasrmds
containing cDNAs coding either glucocorticoid recepter (GR), peroxisome proliferator
activated receptor 7 (PPARy, estrogen receptor  (ER), or estrogen receptor (J (ER ),
in combination with retinoid X receptor  (RXR ., and their corresponding Iuciferase
reporter plasmids usiag FuGene6 traasfection reagent according to the munufacturers
instructions (Ruche), Colls were allowed to express protein for 24 hours followed by
addition of individual compounds or the vehicle (DMSO). 24 hours later cells were
harvested, and the luoiferase assays were performed using flue luciferase assay kit
according to the manufacturer's instructions (Promega). To normalize the data from the
luciferase assays, B-galactosidase activity from transfected cells was measured using a
kit (Promega) as instructed by the manufacturer. Response elemenrs for individual
unclear receptors wera as following: CR
(5'-GATCTTGTACAGG ATGTTCTCTAGCGATGTACAGGATGTTCTCTAGCGATG
TACAGGATG1TCTCTAG-3') (SEQ ID NO. 1), PPAR
(5"CGCGTTCCTTTCCGAACGTGACCTTTGTCCTGGTCCCCTTTTGCT-3') (SEQ
ID NO. 2) and ER (5'-TCGAGTCAGGTCACAGTGACCTGATC-3') (SEQ ID NO. 3).
The testing results are surmmarized in Figure 1 FIG I shows transcription activation
of nuclear hormone receptors by different HDAC inhibitors Trichostatjn A, MS-275
and CS2100055. Experiments were carried out as described above. ID stands for
corrcsponding Ligacds for eath receptor, and CS55 for CS2100055 in each panel of the
figure. Concentrations of tested compounds in all experiments were TSA 0.2 OM,
MS-275 I uM, and CS55 1 uM. Dexamethaacne (0,1 uM), Rosiglitazone (10 uM), and
E2 (0.01 uM) were used as ligands for GR, PPARy, and ER, respectively. Threa
independent experiments were performed and the results from a representative

WO2004/071400 PCT/IB2004/000401
21
experiment were shown in Figure 1.

WO2004/071400 PCT/IB2004/000401
22

or its stereoisomer enantiomer, diastercomer, hydrate, or a pharmacetically acceptable
salt;
wherein A is a phenyl or heterocydic gpoup., optionally substituted with 1 to 4
substituents selected from the group consisting of a balogea atom, a hydroxyl group, an
amino group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an
alkoxy group having 1 to 4 carbons, an aminoalkyl group having1 to 4 carbons, an
alkylamino group having 1 to 4 carbons, an acyl group having 2 to 4 cartbons, an
acytemino group having 2 to 4 carbons, an alkythio group having 1 to 4 carbons, a
perfluoroalkyl group having 1 to 4 carbons, a perfluorcalkyloxy group having 1 to 4
carbons, a carboxy group alkoxycarbonyl group having 1 to 4 carbons, a phenyl
group; and a heterocyclic group;
B is a phenyl or heterocyclic group, optionally substittited with 1 to 3 substituents
selected from the group consisting of a halogen atom, a hydroxyl group, an amino
groups a nitro group, a cyano group, an aikyl group having 1 to 4 carbons, an alkoxy
group having 1 to 4 carbons, an aminoalky group having 1 to 4 carbones, an alkylamino
group having 1 to 4 carbons, an acyl group having 2 to 4 carbons, an acylamino group
having 2 to 4 carbons, an alkythio group having 1 to 4 carbons, 3 perfluoroalkyl group

WO2004/071400 PCT/IB2004/000401
23
having 1 to 4 carbons, a perfluoroalkyloxy group having 1 to 4 cartons,a carboxyl
group, an alkoxycaihonyl group having 1 to 4 carbons, a phenyl group and a
heterocyclic group;
Z is a bond, an optionally substituted alkylenc having 1 to 4 carbons or a moiety
having -O-, -S-, -NH-, -CO-, -CS-, -SO- or -SO2 vbicb is linear, cyclic or their
combination;
Y is a moiety having -CO-, -CS-, -SO- or -SO1 which is linear, cyclic or a
combination thereof; and in Which the distances'between the centrold of ring B (Wl),
the centroid of ring A.(W2) and an oxygpn or sulfur atom as hydrogen bond acceptor
in the moietyY (W3) are: Wl-W2= about 6.0 to about 12.0 A, Wl-W3= about 3.0 to
about 6.0 A, and W2-W3= about 4.0 to about 8.0 A, respectively; or Wl-W2= about
8.0 to about 10.0 A, W1-W3-about 3,0 to about 5.0 A, W2-W3- about 5.0 to about 8.0
A, respectively;
R1 and R2 are independently a hydrogen or an optionally substituted alkcyl having 3
to 4 carbons; or R1 and K2 may form a bond;
R3 is a hydrogen or an optionally substitited alkyl having 1 to 4 carbons;
R2 is a hydrogen atom, halogen atom, a hydroxyl group, an atnino group, a nitro
group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group having 1
to 4 carbons, an aminoalkyl dM group havins 1 to 4 carbons, an alkylamino group having 1
to 4 carbons an acyl group having 1 to 4 carbons,an acylamino group having1 to 4
carbons, an alkylthio group having 1 to 4 carbons a perfluornalkyl group having 1 to 4
carbon, a perfluoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an
alkoxycarbonyl group having J to 4 carbons; and
One of X1, X2, X3, or X4 is a halogen atom, a hydroxyl group, an amiuo group, a
nitro group, a eyano group, an alkyl group haying I to 4 carbons, an alkoxy group

WO2004/071400 PCT/IB2004/000401
24
having 1 to 4 carbons, an aminoalkyl group haying 1 to 4 carbons, an alkylamino group
having 1 to 4 carbone, an acyl group having 1 to 4 carbons an acylamino group having
1 to 4 carbons, an alkylthio group having 1 to 4 carbons, a perfluoroalkyl group having
1 to 4 carbons a perfluoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an
alkoxycarbonyl group having 1 to 4 carbons, while the othera of X1, X2, X3, or X4
independently are a hydrogen atom, a halogen atom, a hydroxyl group, an amino group,
a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy group
having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbonc an alkylamino group
having 1 to 4 carbons, an acyl group having 1 to 4 carbona, an acylamino group having
1 to 4 carbons, an alkylthio group having 1 to 4 carbons, a perfluoroallkyl group having
1 to 4 carbons, a pcrfluproalkyloxy group having 1 to 4 carbons, a carboxyl group or an
alkoxycarbonyl group having 1 to 4 carbons.

or its stereoisomer, enantiomer diastsreonmer, hydrate, or a phamaceutically acceptable
salt;
wherein A is a phenyl of heterocyclic group, optionally substituted with 1 to 4
subatituents selected from the group consisting of a halogen atom, 4 hydiuxyl group, an
amino group, a nitro group, a eyano group, an alkyl group having 1 to 4 carbone, an
alkoxy group having 1 to 4 carbons, an aminoatkyl group having 1 to 4 carbons, an
alkyiamino group having 1 to 4 carbons an acyl group having 2 to 4 carbons, an
acylamino group having 1to 4 carbone ,an alkythio group having1 to 4 carbons, a
perfluoroaltyl group having 1 to 4 carbons, a perfluoroalkyloxy group having 1 to 4

WO2004/071400 PCT/IB2004/000401
25
carbons a eatboxyl groups an alkoxycarbonyl group having 1 to 4 carbons, a phenyl
group and a heterocyclic group;
B is a phenyl or heterocyclic group, optionally substituted with1 to 3 substitnents
selected from the group consisting of a halogen atom, a hydroxyl group, an amino
group, a nitro group, a cyano group, an alkyl group haying 1 to 4 carbons, an alkoxy
group having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylamino
group having 1 to 4 carbons, an acyl group having 2 to 4 carbons, an acylamino group
hiving 2 to 4 carbons, an alkythio group having 1 to 4 carbons, a perfluoroalkyl group
having 1 to 4 carbons, a parfluoroslkybxy group having 1 to 4 carbons, a carboxyl
group, an alkoxycarbonyl group having 1 to 4 carbons, a phenyl group and a
heterocyclic group;
Z it a bond, an optionally substituted alkylene having 1 to 4 carbons or a moiety
having -O-, -S-, -NH-, -CO, -CS-t -SO- or -SO2- which is lincar,cyclic or their
Combination;
Y is a moiety having -CO-, -CS-, -SO- or -SO2- which is linear, cyclic or a
Combination thereof; and in Which the distances between the centroid of ring B (Wl)
the centoid of ring A (W) and an oxygen or sulfur atom as a hydrogen bond acceptor
in the moietyY (W3) is: Wl-W2= about 6.0 to about 120 A, Wl-W3= about 3.0 to
about 6.0 A, and W2-W3= about 4.0 to about 8.0 A, rsspectively; or Wl-W2= about
3.0 to about 10.0 A, Wl-W3= about: 3.0 to about 5.0 A, W2-W3= about 5,0 to about 8.0
A, respectively; and
R1 and R.2 are independently a hydrogen or ao optionally substituted alkyl having 1
to 4 carbons Or R1 and R2 may form bond.
3. A process for tile preparation of a compound according to claim 1 or its
stereoisomer, enantiomer, diastereomer, hydrate or pharmaceutically aceptable salt
thereof comprising the steps of:

WO2004/071400 PCT/IB2004/000401
26

(a) condensing a Compound represented by formula (II) with a compound
repassentsd by formula (TO) to yield a compound represented by formula (IV);

R5 is a moiety having -C(=Q)OH wherein Q is an oxygen or sulfur atom, or R5
is a moiety having -NH2; R6 is a moiety having -NH2 when R5 is a moiety
having -C(=Q)OH wherein Q is an ixygenor sulfur atom, or a moiety having
-C(=Q)OH wherein Q is an oxygen or sulfur atom when R5 is a moiety having
wherein One of X1, X2 X3, or X4 is a halogen atom, a hydroxyl group, an amirio
(b) condensing the compound represented by formula (TV) with a compound
represented by formula (V) to give the compound of formula (1}.

WO2004/071400 PCT/IB2004/000401
27
group, a nitro group, a cyano group, an alkyl group having 1 to 4 carbons, an alkoxy
group having 1 to 4 carbons, an aminoalkyl group having 1 to 4 carbons, an alkylamino
group having 1 to 4 carbons, an acyl group having J to 4 carbons, an acylamino group
having 1 to A carbons, au alkylthio group having 1 to 4 carbons, a perfluoroalkyl group
having1 to 4 carbons, a perflnoroalkyloxy group having 1 to A carbons, a carboxyl
group or an alkoxycarbonyl group having 1 to 4 carbons, and the other of X1, X3, X3, or
X4 independently are a hydrogen atom, a halogen atom, a hydroxyl group, an amino
group, a nitro group, a cyano group an alkyl group having 1 to 4 carbons, an alkoxy
group having 1 to 4 carbons, an aminoatkyl group having 1 to 4 carbons, an alkyl amino
group having 1 to 4 carbons, an acyl group having 1 to 4 carbons, an acylamino group
having 1 to 4 carbons, an alkylthio group having1 to 4 carbons, a perfluoroalkyl group
having 1 to 4 carbons, a perfluoroalltyloxy group having 1 to 4 carbons, a carboxyl
group or an alkoxycarbonyl group having 1 to 4 carbons;
R3 is a hydrogen or an optionally substituted alkyl having 1 to A carbons, and
R4 is a hydrogen atom, halogen atom, a hydroxyl group, an amino group, a nitro
group, a cyano group, an alkyl group having 1 to 4 carbons an alkoxy group having 1
to 4 carbons an aminoalkyl group having 1 to.4 carbons, an alkylamino group having 1
to 4 carbons, an acyl gpoup having 1 to 4 carbons, an acylamino group having 1 to 4
carbons, an alkylthio group having 1 to 4 carbons, a perfluoroalkyl group having 1 ro 4
carbons, a perfluoroalkyloxy group having 1 to 4 carbons, a carboxyl group or an
alkoxycarbonyl group having 1 to 4 carbons,
4. The proeoss according to claim 3, wherein the condensation reactions of steps (a)
and (b) are canted out using a peptide condensing agent.
5. The process according to claim 4, wherein said pepticte condensing agent is
dicyclohexylcarbodiimide, N,N'-carbonyldiimidazole, diphenyl phosphoric azide, or

WO2004/071400 PCT/IB2004/000401
28
diethylphosphorylcyamide.
6. The process of claim 3, wherein said condensation reactions of steps (a) and (b) are
conducted at a temperature from about 00C to about 800C.
7. A phamaceutical composition useful as a therapeutic and/or improving agent for
differentiation and/or proliferation-related disorders comprising an effective amount of
a compound according to claim 1 and at least one pharmaceutically acceptable
exipient, carrier or diluent
8- The pharmaceutical composition of claim 7, wherein said proliferation-related
disorder is selected from the group consisting essentially of psoriasis, a hematological
malignancy and a solid carcinoma.
9. A dosage form unit of the pharmaceutical composition of claim 7 comprising an
amount within the range of about 0,0001 to about 200 mg of said compound,
10. A pharmaceutical composition according to claim 7 for administration by me oral,
nasal, transdermal pulmonary; of parenteral route.
11. A method. of treating cell proliferative diseases comprising administering to a
subject in need therreof an effective amount of a compound of cliam 1
12 A method according to claim 11, wherein said cell proliferative disease is selected
from the group consisting essentially of a malignant tumor and psoriasis.
13, The method according to claim 11, wherein the effective amount of the compound
is within the range of about 0.0001 to about 200mg/kg dody weight per day-

WO2004/071400 PCT/IB2004/000401
39
14. A method of treating a cell profilerative disease comprising administering to a
subject in need thereof an effective amount of a compound according to claim 1 in
combination with an active pharmacentical chemotherapeutic compound or methyl
transferase inhibitor formulated with at least one pharnaceutically acceptable excipient,
carrier or dilueat
15. The method of claim 14. wherein said cell preliferative disease is selected from the
group consisting essentially of a maligraant tumro and psoriasis
16. A. pharmaceutical composition for activating nuclear receptors comprising an
effective amount of a compound according to claim 1 and at least one a
pharmaceutically acceptable excipient, earrier or diluent
11. A, dasege form unit of the phannaceutioal composition of claim16 comprising an
amount within the range of about 0.0001 to about 200 me of the compound.
18. A pharmaceutical composition according to claim 16 for administration by the
oral, nasal, trsusderrnal, pulmonary, or parenteral ronte.
19. A method of treatment or prevention of a condition mediated by a nuclear receptor
comprising administering to a subject in nesd thereof an effective amount of a
compound of claim 1.
20. A method of treatment or prevention of a condition mediated by abnorrally low
activity of a nuclear receptor comprising administering to a subject in need thereof an
effective amount of a compound according to claim 1.

WO2004/071400 PCT/IB2004/000401
30
21- A method according to claim. 19, lwherein.thecondition is selected from the group
consisting essentially of an endocrinc-related disorder, an immune system or
inflammatory disorder, a genetic disorder, and neurodegeneration
22. A method according to claim 20, wherein the condition is selected from the group
consisting essentially of an endocrine-related disorder an irumune system or
inflammatory disorder, a genetic disorder, and neurodeneration.
23. The method according to claim 19, wherein the effective amount of the compound
is within the range of about 0.0001 to about 200mg/kg body weight per day.
24. the method according to claim 20, wherein the effective amount of the compound
is within the range of abort 0.0001 to about 200mg/kg body weight per day

The present invention is relates to the preparation and pharmaceutical uses of novel benzamide derivative as define
to the specification of formulas (I) as histone deaccrylass inhanition (HDACT) their preparation and the method of using these
compound or thir pharmaceutically acceptable salt in the treatment of cell peoliferative diseses, e.g. cancer and psoriasis.

Documents:

01354-kolnp-2005-abstract.pdf

01354-kolnp-2005-claims.pdf

01354-kolnp-2005-description complete.pdf

01354-kolnp-2005-drawings.pdf

01354-kolnp-2005-form 1.pdf

01354-kolnp-2005-form 3.pdf

01354-kolnp-2005-form 5.pdf

01354-kolnp-2005-international publication.pdf

abstract-01354-kolnp-2005.jpg

« Previous Patent

Next Patent »

Patent Number

225188

Indian Patent Application Number

01354/KOLNP/2005

PG Journal Number

45/2008

Publication Date

07-Nov-2008

Grant Date

05-Nov-2008

Date of Filing

13-Jul-2005

Name of Patentee

SHENZHEN CHIPSCREEN BIOCIENCES LTD.

Applicant Address

RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA

Inventors:

#	Inventor's Name	Inventor's Address
1	LU XIAN-PING	RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA
2	LI ZHIBIN	RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA
3	XIE AIHUA	RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA
4	LI BOYU	RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA
5	NING ZHIQIANG	RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA
6	SHAN SONG	RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA
7	DENG TUO	RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA
8	HU WEIMING	RESEARACH INSTITUTE OF TSINGHUA UNIVERSITY, SUITE C301, P.O. BOX 28, HIGH-TECH INDUSTRIAL PARK NANSHAN DISTRICT, SHENZHEN, GUANGDONG 518057, CHINA
9

PCT International Classification Number

C07D 213/56

PCT International Application Number

PCT/IB2004/000401

PCT International Filing date

2004-02-09

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1	60/447,915	2003-02-14	U.S.A.
2	10/770,035	2004-02-02	U.S.A.