Title of Invention	OLIGONUCLEOTIDE ANALOGUES
Abstract	The present invention relates to an oligomer comprising at least one nucleoside analogue (hereinafter termed"LNA")of the general formula I wherein the substituents are as described in the description.

Full Text

OLIGONUCLEOTIDE ANALOGUES FIELD OF THE INVENTION The present invention relates to the field of bi- and tricyclic nucleoside analogues and to the synthesis of such nucleoside analogues which are useful in the formation of synthetic oligonucleotides capable of forming nucleobase specific duplexes and triplexes with single stranded and double stranded nucleic acids. These complexes exhibit higher thermostability than the corresponding complexes formed with normal nucleic acids. The invention also relates to the field of bi- and tricyclic nucleoside analogues and the synthesis of such nucleosides which may be used as therapeutic drugs or which may be incorporated by template dependent nucleic acid polymerases. BACKGROUND OF THE INVENTION Synthetic oligonucleotides are widely used compounds in disparate fields such as molecular biology and DNA-based diagnostics and therapeutics. In therapeutics, e.g., oligonucleotides have been used successfully to block translation in vivo of specific mRNAs thereby preventing the synthesis of proteins which are harmful to the cell/organism. This concept of oligonucleotide mediated blocking of translation is known as the "antisense" approach. Mechanistically, the hybridising oligonucleotide is thought to elicit its effect by either creating a physical block to the translation process or by recruiting cellular enzymes that specifically degrades the mRNA part of the duplex (RNAseH). More recently, oligoribonucleotides and oligodeoxyribo-nucleotides and analogues thereof which combine RNAse catalytic activity with the ability to sequence specifically interact with a complementary RNA target (ribozymes) have attracted much interest as antisense probes. Thus far ribozymes have been reported to be effective in cell cultures against both viral targets and oncogenes. To completely prevent the synthesis of a given protein by the antisense approach it is necessary to block/destroy all mRNAs that encode for that particular protein and in many cases the number of these mRNA are fairly large. Typically, the mRNAs that encode a particular protein are transcribed from a single or a few genes. Hence, by targeting the gene ("antigene" approach) rather than its mRNA products it should be possible to either block production of its cognate protein more efficiently or to achieve a significant reduction in the amount of oligonucleotides necessary to elicit the desired effect. To block transcription, the oligonucleotide must be able to hybridise sequence specifically to double stranded DNA. In 1953 Watson.and Crick showed that deoxyribo nucleic acid (DNA) is composed of two strands (Nature, 1953, 171, 737) which are held together in a helical configuration by hydrogen bonds formed between opposing complementary nucleobases in the two strands. The four nucleobases, commonly found in DNA are guanine (G) , adenine (A), thymine (T) and cytosine (C) of which the G nucleobase pairs with C, and the A nucleobase pairs with T. In RNA the nucleobase thymine is replaced by the nucleobase uracil (U) which similarly to the T nucleobase pairs with A. The chemical groups in the nucleobases that participate in standard duplex formation constitute the Watson-Crick fase. In 1959, Hoogsteen showed that the purine nucleobases (G and A) in addition to their Watson-Crick face have a Hoogsteen face that can be recognised from the outside of a duplex, and used to bind pyrimidine oligonucleotides via hydrogen bonding, thereby forming a triple helix structure. Although making the "antigene" approach conceptually feasible the practical usefulness of triple helix forming oligomers is currently limited by several factors including the requirement for homopurine sequence motifs in the target gene and a need for unphysiologically high ionic strength and low pH to stabilise the complex. Finally, the use of oligonucleotides known as aptamers are being actively investigated. This promising new class of therapeutic oligonucleotides are developed in-vitro to specifically bind to a given target with high affinity, such as for example ligand receptors. Their binding characteristics are likely a reflection of the ability of oligonucleotides to form three dimensional structures held together by intramolecular nucleobase pairing. In chemotherapy of numerous viral infections and cancers, nucleosides and nucleoside analogues have proven effective. LNA nucleosides are potentially useful as such nucleoside based drugs. Various types of double-stranded RNAs inhibit the growth of several types of cancers. Duplexes involving one or more LNA oligonucleotide(s) are potentially useful as such double-stranded drugs. As another application of potential therapeutic utility is the use of strand invading LNA oligonucleotides as activators of RNA transcription (M0llegaard, N. E.; Buchardt, 0.; Egholm, M.; Nielsen, P. E. Proc. Natl. Acad. Sci. U.S.A. 1994, 91, 3892). In molecular biology, oligonucleotides are routinely used for a variety of purposes such as for example (i) as hybridisation probes in the capture, identification and quantification of target nucleic acids (ii) as affinity probes in the purification of target nucleic acids (iii) as primers in sequencing reactions and target amplification processes such as the polymerase chain reaction (PCR) (iv) to clone and mutate nucleic acids and (vi) as building blocks in the assembly of macromolecular structures. Diagnostics utilises many of the oligonucleotide based techniques mentioned above in particular those that lend themselves to easy automation and facilitate reproducible results with high sensitivity. The objective in this field is to use oligonucleotide based techniques as a means to, for example (i) tests humans, animals and food for the presence of pathogenic micro-organisms (ii) to test for genetic predisposition to a disease (iii) to identify inherited and acquired genetic disorders, (iv) to link biological deposits to suspects in crime trials and (v) to validate the presence"of micro-organisms involved in the production of foods and beverages. To be useful in the extensive range of different applications outlined above, oligonucleotides have to satisfy a large number of different requirements. In antisense therapeutics, for instance, a useful oligonucleotide must be able to penetrate the cell membrane, have good resistance to extra- and intracellular nucleases and have the ability to recruit endogenous enzymes like RNAseH. In DNA-based diagnostics and molecular biology other properties are important such as, e.g., the ability of oligonucleotides to act as efficient substrates for a wide range of different enzymes evolved to act on natural nucleic acids, such as e.g. polymerases, kinases, ligases and phosphatases. The fundamental property of oligonucleotides, however, which underlies all uses is their ability to recognise and hybridise sequence specifically to complementary single stranded nucleic acids emplying either Watson-Crick hydrogen bonding (A-T and G-C) or other hydrogen bonding schemes such as the Hoogsteen mode. There are two important terms (affinity and specificity) that are commonly used to characterise the hybridisation properties of a given oligonucleotide. Affinity is a measure of the binding strength of the oligonucleotide to its complementary target sequence (expressed as the thermostability (Tm) of the duplex) . Each nucleobase pair in the duplex adds to the thermostability and thus affinity increases with increasing size (No. of nucleobases) of the oligonucleotide. Specificity is a measure of the ability of the oligonucleotide to discriminate between a fully complementary and a mismatched target sequence. In other words, specificity is a measure of the loss of affinity (expressed as ATm) associated with mismatched nucleobase pairs in the target. At constant oligonucleotide size the specificity increases with increasing number of mismatches between the oligonucleotide and its targets (i.e. the percentage of mismatches increases). Conversely, specificity decreases when the size of the oligonucleotide is increased at a constant number of mismatches (i.e. the percentage of mismatches decreases). Stated another way, an increase in the affinity of an oligonucleotide occurs at the expense of specificity and vice-versa. This property of oligonucleotides creates a number of problems for their practical use. In lengthy diagnostic procedures, for instance, the oligonucleotide needs to have both high affinity to secure adequate sensitivity of the test and high specificity to avoid false positive results. Likewise, an oligonucleotide used as antisense probes needs to have both high affinity for its target mRNA to efficiently impair its translation and high specificity to avoid the unintentional blocking of the expression of other proteins. With enzymatic reactions, like, e.g., PCR amplification, the affinity of the oligonucleotide primer must be high enough for the primer/target duplex to be stable in the temperature range where the enzymes exhibits activity, and specificity needs to be high enough to ensure that only the correct target sequence is amplified. Given the shortcomings of natural oligonucleotides, new approaches for enhancing specificity and affinity would be highly useful for DNA-based therapeutics, diagnostics and for molecular biology techniques in general. It is known that oligonucleotides undergo a conformational transition in the course of hybridising to a target sequence, from the relatively random coil structure of the single stranded state to the ordered structure of the duplex state. Hence, it ought to be possible to enhance the hybridisation properties of an oligonucleotide for its target sequence by restricting the conformational freedom of its single stranded state to resemble its bound state. In pursuit of compounds that could induce such conformational restrictions in oligonucleotides several bicyclic and tricyclic nucleoside analogues (Figure 1) have been synthesised, incorporated into oligonucleotide and oligonucleotide analogues and tested for their hybridisation and other properties. Bicyclo[3.3.0] nucleosides (bcDNA) with an additional C-3',C-5'-ethano-bridge (A and B) have been synthesised with all five nucleobases* (G, A, T, C and U) whereas (C) has been synthesised only with T and A nucleobases (M. Tarkoy, M. Bolli, B. Schweizer and C. Leumann, Helv. Chim. Acta, 1993, 76, 481; Tarkoy and C. Leumann, Angew. Chem. t Int. Ed. Engl., 1993, 32, 1432; M. Egli, P. Lubini, M. Dobler and C. Leumann, J. Am. Chem.Soc, 1993, 115, 5855; M. Tark6y, M. Bolli and C. Leumann, Helv. Chim. Acta, 1994, 77, 716; M. Bolli and C. Leumann, Angew. Chem., Int. Ed. Engl., 1995, 34, 694; M. Bolli, P. Lubini and C. Leumann, Helv. Chim. Acta, 1995, 78, 2077; J. C. Litten, C. Epple and C. Leumann, Bioorg. Med. Chem. Lett., 1995, 5, 1231; J. C. Litten and C. Leumann, Helv. Chim. Acta, 1996, 79, 1129; M. Bolli, J. C. Litten, R. Schultz and C, Leumann, Chem. Biol., 1996, 3, 197; M. Bolli, H. U. Trafelet and C. Leumann, Nucleic Acids Res., 1996, 24, 4660). DNA oligonucleotides containing a few, or being entirely composed, of these analogues are in most cases able to form Watson-Crick bonded duplexes with complementary DNA and RNA oligonucleotides. The thermostability of the resulting duplexes, however, is either distinctly lower (C), moderately lower (A) or comparable to (B) the stability of the natural DNA and RNA counterparts. All bcDNA oligomers exhibited a pronounced increase in sensitivity to the ionic strength of the hybridisation media compared to the natural counterparts. The cc-bicyclo-DNA (B) is more stable towards the 3 '-exonuclease snake venom phosphordiesterase than the p-bicyclo-DNA (A) which is only moderately more stable than unmodified oligonucleotides. Bicarbocyclo[3 .1.0] nucleosides with an additional C-1',CS6'- or C-6',C-4'-methano-bridge on a cyclopentane ring (D and E, respectively) have been synthesised with all five nucleobases (T, A, G, C and U). Only the T-analogues, however, have been incorporated into oligomers. Incorporation of one or ten nucleoside-analogues of D in a mixed poly-pyrimidine DNA oligonucleotide resulted in a substantial decrease in the affinity towards both DNA and RNA oligonucleotides compared to the unmodified reference oligonucleotide. The decrease was more pronounced with ssDNA than with ssRNA. Incorporation of one oligonucleoside analogue of E in two different poly-pyrimidine DNA oligonucleotides induced modest increases in T's of 0.8 °C and 2.1 °C for duplexes towards ssRNA compared with unmodified reference duplexes. When ten T-analogues were incorporated into a 15mer oligonucleotide containing exclusively phosphorothioate internucleoside linkages, the Tn against the complementary RNA oligonucleotide was increased approximately 1.3 °C per modification compared to the same unmodified phosphorothioate sequence. Contrary to the control sequence the oligonucleotide containing the bicyclic nucleoside E failed to mediate RNAseH cleavage. The hybridisation properties of oligonucleotides containing the G, A, C and U-analogues of E have not been reported. Also, the chemistry of this analogue does not lend itself to further intensive investigations on completely modified oligonucleotides (K.-H. Altmann, R. Kesselring, E. Francotte and G. Rihs, Tetrahedron Lett., 1994, 35, 2331; K.-H. Altmann, R. Imwinkelried, R. Kesselring and G. Rihs, Tetrahedron Lett., 1994, 35, 7625; V. E, Marquez, M. A. Siddiqui, A. Ezzitouni, P. Russ, J. Wang, R. W. Wagner and M. D. Matteucci, J. Med. Chem., 1996, 39, 3739; A. Ezzitouni and V. E. Marquez, J. Chem. Soc.f Perkin Trans. 1, 1997, 1073). A bicyclo[3.3.0] nucleoside containing an additional C-2',C-3'-dioxalane ring has been synthesised as a dimer with an unmodified nucleoside where the additional ring is part of the internucleoside linkage replacing a natural phosphordiester linkage (F). This analogue was only synthesised as either thymine-thymine or thymine-5-methylcytosine blocks. A 15-mer polypyrimidine sequence containing seven of these dimeric blocks and having alternating phosphordiester- and riboacetal-linkages, exhibited a substantially decreased Tm against complementary ssRNA compared to a control sequence with exclusively natural phosphordiester internucleoside linkages (R. J. Jones, S. Swaminathan, J. F. Mi1lagan, S. Wadwani, B. S♦ Froehler and M. Matteucci, J. Am. Chem. Soc, 1993, 115, 9816). The two dimers (G and H) with additional C-2',C-3'-dioxane rings forming bicyclic(4.3.0]-systems in acetal-type A internucleoside linkages have been synthesised as T-T dimers and incorporated once in the middle of 12mer polypyrimidine oligonucleotides. Oligonucleotides containing either G or H both formed significantly less stable duplexes with complementary ssRNA and ssDNA compared with the unmodified control oligonucleotide (J. Wang and M. D. Matteucci, Bioorg. Med. Chem. Lett., 1997, 7, 229). Dimers containing a bicyclo[3.1.0]nucleoside with a C-2',C-3'-methano bridge as part of amide- and sulfonamide-type (I and J) internucleoside linkages have been synthesised and incorporated into oligonucleotides. Oligonucleotides containing one ore more of these analogues showed a significant reduction in Tm compared to unmodified natural oligonucleotide references (C. G. Yannopoulus, W. Q. Zhou, P. Nower, D. Peoch, Y. S. Sanghvi and G. Just, Synlett, 1997, 378) . A trimer with formacetal internucleoside linkages and a bicyclo[3.3.0] glucose-derived nucleoside analogue in the middle (K) has been synthesised and connected to the 3'-end of an oligonucleotide. The Tm against complementary ssRNA was decreased by 4 °C, compared to a control sequence, and by 1.5 °C compared to a sequence containing two 2',5'-formacetal linkages in the 3'-end (C. G. Yannopoulus, W.Q. Zhou, P. Nower, D. Peoch, Y. S. Sanghvi and G. Just, Synlett, 1997, 378). Very recently oligomers composed of tricyclic nucleoside-analogues (L) have been reported to show increased duplex stability compared to natural DNA (R. Steffens and C. Leumann (Poster SB-B4), Chimia, 1997, 51, 436). Furthermore, the synthesis of 2'-0,4'-C-methyleneuridine and -cytidine have recently been reported (Obika, S. et al. , Tetrahedron Lett., 28, No. 50, pp 8735-8738), however, no affinity data was shown. Three bicyclic ([4.3.0] and [3.3.0]) nucleosides with an additional C-2',C-3 '-connected six- (M and N) or five-membered ring (O) have been synthesised as the T-analogues. The bicyclic nucleosides M and N have been incorporated once and twice into 14-mer oligo-T sequences. The Tn's against complementary ssRNA and saDNA were decreased by 6-10 °C per modification compared to unmodified control sequences. Fully modified oligonucleotides of analogue 0 exhibited an increased Tm of approximately 1.0 °C per modification against the complementary RNA oligonucleotide compared to the control DNA oligonucleotide. Also, the fully modified sequence was substantially more stable towards snake-venom phosphor-diesterase hydrolysis than the unmodified control sequence. Partly modified oligonucleotides in which up to four analogues of 0 were incorporated, however, were less thermostable than the corresponding unmodified oligonucleotides. All oligonucleotides containing analogue 0 (both fully and partly modified) showed a substantial decrease in thermostability against complementary DNA oligonucleotides compared to the unmodified oligonucleotides (P. Nielsen, H. M. Pfundheller, J. Wengel, Chem. Commun., 1997, 826; P. Nielsen, H. M. Pfundheller, J. Wengel, XII International Roundtable: Nucleosides, Nucleotides and Their Biological Applications; La Jolla, California, September 15-19, 1996; Poster PPI 43). An attempt to make the bicyclic uridine nucleoside analogue Q planned to contain an additional 0-2.' ,C-4'- five-membered ring, starting from 4'-C-hydroxymethyl nucleoside P, failed (K. D. Nielsen, Specialerapport (Odense University, Denmark), 1995) . Until now the pursuit of conformationally restricted nucleosides useful in the formation of synthetic oligonucleotides with significantly improved hybridisation characteristics has met with little success. In the majority of cases, oligonucleotides containing these analogues form less stable duplexes with complementary nucleic acids compared to the unmodified oligonucleotides. In other cases, where moderate improvement in duplex stability is observed, this relates only to either a DNA or an RNA target, or it relates to fully but not partly modified oligonucleotides or vice versa. An appraisal of most of the reported analogues are further complicated by the lack of data on analogues with G, A and C nucleobases and lack of data indicating the specificity and mode of hybridisation. In many cases, synthesis of the reported monomer analogues is very complex while in other cases the synthesis of fully modified oligonucleotides is incompatible with the widely used phosphoramidite chemistry standard. BRIEF DESCRIPTION OF THE INVENTION The present invention relates to oligomers comprising at least one nucleoside analogue (hereinafter termed "LNA") of the general formula I wherein X is selected from -0-, -S-, -N(RN*)-, -C(R6R6*)-, -0- C(RW, -C(R6R6VO-, -S~C(R7R7V, -C(R*R*VS-, -N(RNVC(R7R7V, -C(R6R6VN(RNV, and -C (R6R6*) -C (R7R7*) -; B is selected from hydrogen, hydroxy, optionally substituted C,_ 4-alkoxy, optionally substituted C^-alkyl, optionally substituted C^-acyloxy, nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; P designates the radical position for an internucleoside linkage to a succeeding monomer, or a 5'-terminal group, such internucleoside linkage or 5'-terminal group optionally including the substituent R5; one of the substituents R2, R2', RJ, and R3> is a group P* which designates an internucleoside linkage to a preceding monomer, or a 3'-terminal group; one or two pairs of non-geminal substituents selected from the present substituents of R1', R4, Rs, R5', R6, R7, R7, RN, RM, and the ones of R2, R2, RJ, and RJ, not designating P' each designates a biradical consisting of 1-8 groups/atoms selected from -C(RaRb)-, -C (Ra) =C (Ra) -, -C(Ra)=N-/ -0-, -Si(Ra)2-, -S-, -SO2-, -N(R)-, and >C=Z, wherein Z is selected from -0-, -S-, and -N(Rd)-, and Ra and Rb each is independently selected from hydrogen, optionally substituted Cl_l2-alkyl/ optionally substituted C2_I2-alk"enyl, optionally substituted C2,12-alkynyl, hydroxy, C1-12-alkoxy, C2_12-alkenyloxy/ carboxy, C1-12-alkoxycarbonyl, CW2-alkylcarbonyl, forrnyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbony1, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di (C1-6-alkyl)amino, carbamoyl, mono- and di (C^-alkyl) -amino-carbonyl, amino-C1_6-alkyl-aminocarbonyl, mono- and di (C1-6-alkyl) amino-C1-6-alkyl-aminocarbonyl, C^-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C^6-alkylsulphonyloxy, nitro, azido, sulphanyl, C^-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents Ra and Rbtogether may designate optionally substituted methylene (=CH2) , and wherein two non-geminal or geminal substitutents selected from Ra, Rb, and any of the substituents R1*, R2, R2, R3, R3, R4, R5, R5, R6 and R6' R7, and R7' which are present and not involved in P, P1 or the biradical(s) together may form an associated biradical selected from biradicals of the same kind as defined before; said pair(s) of non-geminal substituents thereby forming a mono- or bicyclic entity together with (i) the atoms to which said non-geminal, substituents are bound and (ii) any intervening atoms; and each of the substituents R1', R2, R2, R3, R4, R5, R5, R* and Rv, R7, and'R7' which are present and not involved in P, P' or the biradical(s), is independently selected from hydrogen, optionally substituted C1-12-alkyl, optionally substituted C2_12-alkenyl, optionally substituted C2,12-alkynyl, hydroxy, C^^-alkoxy, C2_12-alkenyloxy, carboxy, ClM2-alkoxycarbonyl, C,.l2-: Beskrivelse/JT/2 8-07-98 alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryl-oxy, heteroarylcarbonyl, amino, mono- and di (C1-6-alkyl)amino, carbamoyl, mono- and di (C1-6-alkyl) -amino-carbonyl, amino-Cj1-6-alkyl-aminocarbonyl, mono- and di (C1-6-alkyl) amino-C,1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene, or together may form a spiro biradical consisting of a 1-5 carbon atom(s) alkylene chain which is optionally interrupted and/or terminated by one or more heteroatoms/groups selected from -0-, -S-, and -(NRN)-where RN is selected from hydrogen and C1-6-alkyl, and where two adjacent (non-geminal) substituents may designate an additional bond resulting in a double bond; and RN, when present and not involved in a biradical, is selected from hydrogen and C1_A-alkyl;' and basic salts and acid addition salts thereof; with the proviso that, (i) R2 and R3 do not together designate a biradical selected from -0-CH2-CH2- and -0-CH2-CH2-CH2- when LNA is a bicyclic nucleoside analogue; (ii) R3 and R5 do not together designate a biradical selected from -CH2-CH2-, -0-CH2-, when LNA is a bicyclic nucleoside analogue; (iii) RJ, R5, and R5* do not together designate a triradical -CH2-CH(-)-CH2- when LNA is a tricyclic nucleoside analogue; (iv) R1'and R6' do not together designate a biradical -CH2- when LNA is a bicyclic nucleoside analogue; and (v) R4' and Rb' do not together designate a biradical -CH2- when LNA is a bicyclic nucleoside analogue. The present invention furthermore relates to nucleoside analogues (hereinafter LNAs) of the general formula II wherein the substituent B is selected from nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; X is selected from -0-, -S-, -N(RN*)-, and -C(R6R6*)-; one of the substituents R2, R2, R3, and RJ' is a group Q*; each of Q and Q* is independently selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, Prot-O-, Act-O-, mercapto, Prot-S-, Act-S-, C1-6-alkylthio, amino, Prot-N(RH) -, Act-N(RH)-, mono- or di (Cj_6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyl, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, triphosphate, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, hydroxymethyl, Prot-0-CH2-, Act-0~CH2-, aminomethyl, Prot-N(RH) -CH2-, Act-N(RH) -CH2-, carboxymethyl, sulphonomethyl, where Prot is a protection group for -OH, -SH, and -NH(RH), respectively, Act is an activation group for -OH, -SH, and -NH(RH)/ respectively, and RH is selected from hydrogen and Cj_6-alkyl; (i) R and R together designate a biradical selected from -0-, -(CR*R*)r+stl-, -(CR*R')r-0-(CR'R')s-, - (CR'R') ,.-S- (CR'R' ) ,-, -(CR,R')r-N(R')-(CR,R').-/ -0- (CR'R*) r„-0- , -S- (CR'R' ) _-0- , -0-(CR'R')r.,-S-, -N(R')-(CR'R')„,-0-, -0-(CR'R") ,.,S-N(R*)-, -S-(CR'R')„.-S-, -N(R')-(CR'R'),.3-N(R')-, -N(R")-(CR"R')143-S-/ and -S-(CR'R') -N(R')-; I ♦ S (ii) R and RJ together designate a biradical selected from -0-, -(CR'R")M-, -(CR'R')r-0-(CR,R")s-, - (CR'R' ) ,.-S- (CR'R" ),- , and"- (CR'R")r-N(R') - (CR-R'),-; (m) R and R together designate a biradical selected from 3 -0-, -(CR'R')r+,-, -(CR'R')r-0-(CR'R'),-, - (CR'R" ) r-S- (CR'R') s- , and -(CR'R') -N(R') - (CR'R') -; (iv) R and R4' together designate a biradical selected from -(CR'R')r-0-(CR'R')s-, -(CR'R')r-S-(CR,R'),-, and -(CR'R'),.- N(R')-(CR'R') -; (v) R and R5 together designate a biradical selected from -(CR-R')r-0-(CR'R') -, -(CRV) -S-(CR'R') -, and -(CR'R') - N(R')-(CR'R') -; or S (vi) R and R4' together designate a biradical selected from -(CR'R') -0-(CR'R') -, -(CR'R') -S-(CR'R') -, and -(CRR) -N(R')-(CR"R') -; ' 1 ' 9 ' (vn) R and R together designate a biradical selected from -(CRV)-O-(CR'R') -, -(CR'R') -S-(CR'R') -, and -(CR'R-)-N(R')-(CR'R") -; wherein each R' is independently selected from hydrogen, halogen, azido, cyano, nitro, hydroxy, mercapto, amino, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and/or two adjacent (non-geminal) R' may together designate a double bond, and each of r and s is 0-3 with the proviso that the sum r+s is 1-4; each of the substituents R1', R2, R2, R3, R4, R5, and R5, which are not involved in Q, Q' or the biradical, is independently selected from hydrogen, optionally substituted C1-61-6-alkyl, optionally substituted C2_12-alkenyl, optionally substituted C2_12-alkynyl, hydroxy, C1_12-alkoxy, C2,12-alkenyloxy, carboxy, C,_12-alkoxycarbonyl, C1_12-alkylcarbonyl, f ormyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di (C1-6-alkyl) amino, carbamoyl, mono- and di (C1-6-alkyl) -amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1_h-, alkyl) amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene, or together may form a spiro biradical consisting of a 1-5 carbon atom(s) alkylene chain which is optionally interrupted and/or terminated by one or more heteroatoms/groups selected from -0-, -S-, and -(NRN)~ where RN is selected from hydrogen and Ct_4-alkyl, and where two adjacent (non-geminal) substituents may designate an additional bond resulting in a double bond; and RN, when present and not involved in a biradical, is selected from hydrogen and C1-6-alkyl; and basic salts and acid addition salts thereof; with the first proviso that, (i) R2 and RJ do not together designate a biradical selected from -0-CH2-CH2- and -0-CH2-CH2-CH2-; and (ii) R' and R5 do not together designate a biradical selected from -CH2-CH2-, -0-CH2-, and -O-Si (iPr)2-0-Si fPr) 2-0- ; and with the second proviso that any chemical group (including any nucleobase), which is reactive under the conditions prevailing in oligonucleotide synthesis, is optionally functional group protected. The present invention also relates to the use of the nucleoside analogues (LNAs) for the preparation of oligomers, and the use of the oligomers as well as the nucleoside analogues (LNAs) in diagnostics and in therapy. DETAILED DESCRIPTION OF THE INVENTION When used herein, the term "LNA" (Locked Nucleoside Analogues) refers to the bi and tri-cyclic nucleoside analogues of the invention, either incorporated in the oligomer of the invention or as discrete chemical species. The term "monomeric LNA" specifically refers to the latter case. Interesting applications of the oligomers and LNAs The present invention discloses the surprising finding that various novel derivatives of bicyclic nucleoside monomers (LNAs) when incorporated into oligonucleotides dramatically increase the affinity of these modified oligonucleotides for both complementary ssDNA and ssRNA compared to the unmodified oligonucleotides. It further discloses the surprising finding that both fully and partly LNA modified oligonucleotides display greatly enhanced hybridisation properties for their complementary nucleic acid sequences. Depending on the application, the use of these LNAs thus offer the intriguing possibility to either greatly increase the affinity of a standard oligonucleotide without compromising specificity (constant size of oligonucleotide) or significantly increase the specificity without compromising affinity (reduction in the size of the oligonucleotide). The present invention also discloses the unexpected finding that LNA modified oligonucleotides, in addition to greatly enhanced hybridisation properties, display many of the useful physicochemical properties of normal DNA and RNA oligonucleotides. Examples given herein include excellent solubility, a response of LNA modified oligonucleotides to salts like sodium chloride and tetramethylammonium chloride which mimic that of the unmodified oligonucleotides, the ability of LNA modified oligonucleotides to act as primers for a variety of polymerases, the ability of LNA modified nucleotides to act as primers in a target amplification reaction using a thermostable DNA polymerase, the ability of LNA modified oligonucleotides to act as a substrate for T4 polynucleotide kinase, the ability of biotinylated LNAs to sequence specifically capture PCR amplicons onto a streptavidin coated solid surface, the ability of immobilised LNA modified oligonucleotides to sequence specifically capture amplicons and the ability of LNA modified oligonucleotides to sequence specifically target double-stranded DNA by strand invasion. Hence, it is apparent to one of ordinary skills in the art that these novel nucleoside analogues are extremely useful tools to improve the performance in general of oligonucleotide based techniques in therapeutics, diagnostics and molecular biology. An object of the present invention is to provide monomeric LNAs according to the invention which can be incorporated into oligonucleotides using procedures and equipment well known to one skilled in the art of oligonucleotide synthesis. Another object of the present invention is to provide fully or partly LNA modified oligonucleotides (oligomers) that are able to hybridise in a sequence specific manner to complementary oligonucleotides forming either duplexes or triplexes of substantially higher affinity than the corresponding complexes formed by unmodified oligonucleotides. Another object of the present invention is to use LNAs to enhance the specificity of normal oligonucleotides without compromising affinity. This can be achieved by reducing the size (and therefore affinity) of the normal oligonucleotide to an extent that equals the gain in affinity resulting from the incorporation of LNAs. Another object of the present invention is to provide fully or partly modified oligonucleotides containing both LNAs, normal nucleosides and other nucleoside analogues. A further object of the present invention is to exploit the high affinity of LNAs to create modified oligonucleotides of extreme affinity that are capable of binding to their target sequences in a dsDNA molecule by way of "strand displacement". A further object of the invention is to provide different classes of LNAs which, when incorporated into oligonucleotides, differ in their affinity towards their complementary nucleosides. In accordance with the invention this can be achieved b1-6 either substituting the normal nucleobases G, A, T, C and U with derivatives having, for example, altered hydrogen bonding possibilities or by using LNAs that differ in their backbone structure. The availability of such different LNAs facilitates exquisite tuning of the affinity of modified oligonucleotides. Another object of the present invention is to provide LNA modified oligonucleotides which are more resistant to nucleases than their unmodified counterparts. Another object of the present invention is to provide LNA modified oligonucleotides which can recruit RNAseH. An additional object of the present invention is to provide LNAs that can act as substrates for DNA and RNA polymerases thereby allowing the analogues to be either incorporated into a growing nucleic acid chain or to act as chain terminators. A further object of the present invention is to provide LNAs that can act as therapeutic agents. Many examples of therapeutic nucleoside analogues are known and similar derivatives of the nucleoside analogues disclosed herein can be synthesised using the procedures known from the literature (E. De Clercq, J. Med. Chem. 1995, 38, 2491; P. Herdewijn and E. De Clercq: Classical Antiviral Agents and Design og New Antiviral Agents. In: A Textbook of Drug Design and Development; Eds. P. Krogsgaard-Larsen, T. Liljefors and U. Madsen; Harwood Academic Publishers, Amsterdam, 1996, p. 425; I. K. Larsen: Anticancer Agents.In: A Textbook of Drug Design and Development; Eds. P. Krogsgaard-Larsen, T. Liljefors and U. Madsen; Harwood Academic Publishers, Amsterdam, 1996, p. 460). Double-stranded RNA has been demonstrated to posses anti-viral activty and tumour suppressing activity (Sharp et al., Eur. J. Biochem. 230(1): 97-103, 1995, Lengyel-P. et al., Proc. Natl. Acad. Sci. U.S.A., 90(13): 5893-5, 1993, and Laurent-Crawford et al., AIDS Res. Hum. Retroviruses, 8(2): 285-90, 1992. ), It is likely that double stranded LNAs may mimic the effect of therapeutically active double stranded RNAs and accordingly such double stranded LNAs has a potential as therapeutic drugs. When used herein, the term "natural nucleic acid" refers to nucleic acids in the broadest sense, like for instance nucleic acids present in intact cells of any origin or vira or nucleic acids released from such sources by chemical or physical means or nucleic acids derived from such primary sources by way of amplification. The natural nucleic acid may be single, double or partly double stranded, and may be a relatively pure species or a mixture of different nucleic acids. It may also be a component of a crude biological sample containing other nucleic acids and other cellular components. On the other hand, the term "synthetic nucleic acids" refers to any nucleic acid produced by chemical synthesis. Definition of oligomers and nucleoside analogues As mentioned above, the present invention i.a. relates to novel oligomers (oligonucleotides) comprising one or more bi-, tri-, or polycyclic nucleoside analogues (hereinafter termed "LNA"). It has been found that the incorporation of such LNAs in place of, or as a supplement to, e.g., known nucleosides confer interesting and highly useful properties to an oligonucleotide. Bi- and tricyclic, especially bicyclic, LNAs seem especially interesting within the scope of the present invention. Each of the possible LNAs incorporated in an oligomer (oligonucleotide) has the general formula I wherein X is selected from -0- (the furanose motif), -S-, -N(RN') -, -C(RV) -, -0-C(R7R7') -, -C(RbR6') -0-, -S-C(RV') -, -C(RV)-S-, -N(RN')-C(R7R7')-, -C(R6R6VN(RNV, and -C(RW- C(R7R1')-/ where R6, R6', R7, R7', and RN' are as defined further below. Thus, the LNAs incorporated in the oligomer may comprise an either 5- or 6-membered ring as an essential part of the bi-, tri-, or polycyclic structure. It is believed that 5-membered rings (X = -0-, -S-, -N(RN')-, -C(R6R')-) are especially interesting in that they are able to occupy essentially the same conformations (however locked by the introduction of one or more biradicals (see below)) as the native furanose ring of a naturally occurring nucleoside. Among the possible 5-membered rings, the situations where X designates -0-, -S-, and -N(RN')-seem especially interesting, and the situation where X is -O-appears to be particularly interesting. The substituent B may designate a group which, when the oligomer is complexing with DNA or RNA, is able to interact (e.g. by hydrogen bonding or covalent bonding or electronic interaction) with DNA or RNA, especially nucleobases of DNA or RNA. Alternatively, the substituent B may designate a group which acts as a label or a reporter, or the substituent B may designate a group (e.g. hydrogen) which is expected to have little or no interactions with DNA or RNA. Thus, the substituent B is preferably selected from hydrogen, hydroxy, optionally substituted C1-6-alkoxy, optionally substituted Cj_4-alkyl, optionally substituted C1-6-acyloxy, nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands. In the present context, the terms "nucleobase" covers naturally occurring nucleobases as well as non-naturally occurring nucleobases. It should be clear to the person skilled in the art that various nucleobases which previously have been considered "non-naturally occurring" have subsequently been found in nature. Thus, "nucleobase" includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Illustrative examples of nucleobases are adenine, guanine, thymine, rytosine, uracil, purine, xanthine, diaminopurine, 8- oxo-N -methyladenine, 7-deazaxanthine, 7-deazaguanine, N4, N4-ethanocytosin, Nb, N6-ethano-2 , 6-diaminopurine, 5-methylcytosine, 5- (C3-C6) -alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridin, isocytosine, isoguanin, inosine and the "non-naturally occurring11 nucleobases described in Benner et al. , U.S• Pat No. 5,432,272. The term "nucleobase" is intended to cover every and all of these examples as well as analogues and tautomers thereof. Especially interesting nucleobases are adenine, guanine, thymine, cytosine, and uracil, which are considered as the naturally occurring nucleobases in relation to therapeutic and diagnostic application in humans. When used herein, the term "DNA intercalator" means a group which can intercalate into a DNA or RNA helix, duplex or triplex. Examples of functional parts of DNA intercalators are acridines, anthracene, quinones such as anthraquinone, indole, quinoline, isoquinoline, dihydroquinones, anthracyclines, tetracyclines, methylene blue, anthracyclinone, psoralens, coumarins, ethidium-halides, dynemicin, metal complexes such as 1,10-phenanthroline-copper, tris(4,7-diphenyl-l,10-phenanthroline)ruthenium-cobalt-enediynes such as calcheamicin, porphyrins, distamycin, netropcin, viologen, daunomycin. Especially interesting examples are acridines, quinones such as anthraquinone, methylene blue, psoralens, coumarins, and ethidium-halides . In the present context, the term "photochemically active groups" covers compounds which are able to undergo chemical reactions upon irradiation with light. Illustrative examples of functional groups hereof are quinones, especially 6-methyl-l,4-naphtoquinqne, anthraquinone, naphtoquinone, and 1,4-dimethyl-anthraquinone, diazirines, aromatic azides, benzophenones, psoralens, diazo compounds, and diazirino compounds. In the present context "thermochemically reactive group" is defined as a functional group which is able to undergo thermochemically-induced covalent bond formation with other groups. Illustrative examples of functional parts thermochemically reactive groups are carboxylic acids, carboxylic acid esters such as activated esters, carboxylic acid halides such as acid fluorides, acid chlorides, acid bromide, and acid iodides, carboxylic acid azides, carboxylic acid hydrazides, sulfonic acids, sulfonic acid esters, sulfonic acid halides, semicarbazides, thiosemicarbazides, aldehydes, ketones, primary alkohols, secondary alkohols, tertiary alkohols, phenols, alkyl halides, thiols, disulphides, primary amines, secondary amines, tertiary amines, hydrazines, epoxides, maleimides, and boronic acid derivatives. In the present context, the term "chelating group" means a molecule that contains more than one binding site and frequently binds to another molecule, atom or ion through more than one binding site at the same time. Examples of functional parts of chelating groups are iminodiacetic acid, nitrilotriacetic acid, ethylenediamine tetraacetic acid (EDTA), aminophosphonic acid, etc. In the present context, the term "reporter group" means a group which is detectable either by itself or as a part of an detection series. Examples of functional parts of reporter groups are biotin, digoxigenin, fluorescent groups (groups which are able to absorb electromagnetic radiation, e.g. light or X-rays, of a certain wavelength, and which subsequently reemits the energy absorbed as radiation of longer wavelength; illustrative examples are dansyl (5-~ dimethylamino)-1-naphthalenesulfonyl), DOXYL (N-oxyl- 4,4-dimethyloxazolidine), PROXYL (N-oxyl-2,2,5,5-tetramethylpyrrolidine), TEMPO (N-oxyl-2,2,6,6-tetra- methylpiperidine) , dinitrophenyl, acridines, coumarins, Cy3 and Cy5 (trademarks for Biological Detection Systems, Inc.), erytrosine, coumaric acid, umbelliferone, texas red, rhodamine, tetramethyl rhodamine, Rox, 7-nitrobenzo-2-oxa-1-diazole (NBD), pyrene, fluorescein, Europium, Ruthenium, Samarium, and other rare earth metals), radioisotopic labels, chemiluminescence labels (labels that are detectable via the emission of light during a chemical reaction), spin labels (a free radical (e.g. substituted organic nitroxides) or other paramagnetic probes (e.g. Cu2+, Mg2+) bound to a biological molecule being detectable by the use of electron spin resonance spectroscopy) , enzymes (such as peroxidases, alkaline phosphatases, p-galactosidases, and glycose oxidases) , antigens, antibodies, haptens (groups which are able to combine with an antibody, but which cannot initiate an immune response by itself, such as peptides and steroid hormones) , carrier systems for cell membrane penetration such as: fatty acid residues, steroid moieties (chlolesteryl), vitamin A, vitamin D, vitamin E, folic acid peptides for specific receptors, groups for mediating endocytose, epidermal growth factor (EGF), bradykinin, and platelet derived growth factor (PDGF). Especially interesting examples are biotin, fluorescein, Texas Red, rhodamine, dinitrophenyl, digoxigenin, Ruthenium, Europium, Cy5, Cy3, etc. In the present context "ligand" means something which binds. Ligands can comprise functional groups such as: aromatic groups (such as benzene, pyridine, naphtalene, anthracene, and phenanthrene), heteroaromatic groups (such as thiophene, furan, tetrahydrofuran, pyridine, dioxane, and pyrimidine), carhoxylic acids, carboxylic acid esters, carhoxylic acid halides, carboxylic acid azides, carboxylic acid hydrazides, sulfonic acids, sulfonic acid esters, sulfonic acid halides, semicarbazides, thiosemicarbazides, aldehydes, ketones, primary alcohols, secondary alcohols, tertiary alcohols, phenols, alkyl halides, thiols, disulphides, primary amines, secondary amines, tertiary amines, hydrazines, epoxides, maleimides, Cj-C1-6 alkyl groups optionally interrupted or terminated with one or more heteroatoms such as oxygen atoms, nitrogen atoms, and/or sulphur atoms, optionally containing aromatic or mono/polyunsaturated hydrocarbons, polyoxyethylene such as polyethylene glycol, oligo/polyamides such as poly-p-alanine, polyglycine, polylysine, peptides, oligo/polysaccharides, oligo/polyphosphates, toxins, antibiotics, cell poisons, and steroids, and also "affinity ligands", i.e. functional groups or biomolecules that have a specific affinity for sites on particular proteins, antibodies, poly- and oligosaccharides, and other biomolecules. It will be clear for the person skilled in the art that the above-mentioned specific examples under DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands correspond to the "active/functional" part of the groups in question. For the person skilled in the art it is furthermore clear that DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands nre typically represented in the form M-K- where M is the "active/functional" part of the group in question and where K is a spacer through which the "active/functional" part is attached to the 5- or 6-membered ring. Thus, it should be understood that the group B, in the case where B is selected from DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, has the form M-K-, where M is the "active/functional" part of the DNA intercalator, photochemically active group, thermochemically active group, helating group, reporter group, and ligand, respectively, and /here K is an optional spacer comprising 1-50 atoms, preferably 1-30 atoms, in particular 1-15 atoms, between the 5- or 6~ membered ring and the "active/functional" part. In the present context, the term "spacer" means a thermochemically and photochemically non-active distance-making group and is used to join two or more different moieties of the types defined above. Spacers are selected with respect to their hydrophobic/hydrophilie character and length in order to optimise the accessibility and binding (e.g. see Hermanson et. al., "Immobilized Affinity Ligand Techniques", Academic Press, San Diego, California (1992), p. 137-ff) . Generally, the length of the spacers are less than or about 400 A, in some applications preferably less than 100 A. The spacer, thus, comprises a chain of carbon atoms optionally interrupted or terminated with one or more heteroatoms, such as oxygen atoms, nitrogen atoms, and/or sulphur atoms. Thus, the spacer K may comprise one or more amide, ester, amino, ether, and/or thioether functionalities, and optionally aromatic or mono/polyunsaturated hydrocarbons, polyoxyethylene such as polyethylene glycol, oligo/polyamides such as poly-p-alanine, polyglycine, polylysine, and peptides in general, oligosaccharides, oligo/polyphosphates. Moreover the spacer may consist of combined units thereof. The length of the spacer may vary, taking into consideration the desired or necessary positioning and spatial orientation of the "active/functional" part of the group in question in relation to the 5- or 6-membered ring. In one embodiment of the present invention, K designates a single bond so that the "active/functional" part of the group in question is attached directly to the 5- or 6-membered ring. In the oligomers of the present invention (formula I), P designates the radical position for an internucleoside linkage to a succeeding monomer, or a 5'-terminal group. The first possibility applies when the LNA in question is not the 5'-terminal "monomer", whereas the latter possibility applies when the LNA in question is the 5'-terminal "monomer". It should be understood (which also will be clear from the definition of internucleoside linkage and 5'-terminal group further below) that such an internucleoside linkage or 5-terminal group may include the substituent R5 (or equally applicable: the substituent R5') thereby forming a double bond to the group P. (5'-Terminal refers to the position corresponding to the 5l carbon atom of a ribose moiety in a nucleoside.) On the other hand, an internucleoside linkage to a preceding monomer or a 3 '-terminal group (P') may originate from the positions defined by one of the substituents R2, R2, RJ, and RJ, preferably from the positions defined by one of the substituents RJ and RJ'. Analogously, the first possibility applies where the LNA in question is not the 3'-terminal "monomer", whereas the latter possibility applies when the LNA in question is the 3'-terminal "monomer". (3'-Terminal refers to the position corresponding to the 3' carbon atom of a ribose moiety in a nucleoside.) In the present context, the term "monomer" relates to naturally occurring nucleosides, non-naturally occurring nucleosides, PNAs, etc. as well as LNAs. Thus, the term "succeeding monomer" relates to the neighbouring monomer in the 5•-terminal direction and the "preceding monomer" relates to the neighbouring monomer in the 3'-terminal direction. Such succeeding and preceding monomers, seen from the position of an LNA monomer, may be naturally occurring nucleosides or non-naturally occurring nucleosides, or even further LNA monomers. Consequently, in the present context (as can be derived from the definitions above), the term "oligomer" means an oligonucleotide modified by the incorporation of one or more LNA(s) . The crucial part of the present invention is the presence of one or more rings fused to the 5- or 6-membered ring illustrated with the general formula I. Thus, one or two pairs of non-geminal substituents selected from the present substituents of R1', R4', R5, R5', Rb, R6', R7, R7, RN', and the ones of R, R2', R1, and R3" not designating P' each designates a biradical consisting of 1-8 groups/atoms independently selected from -C(R'Rb)-, ~C (Ra) =C (R') -, -C(Ra)=N-, -0-, -Si(Ra)r, -S-, -S02-, -N(Ra) -, and >C=Z. (The term "present" indicates that the existence of some of the substituents, i.e. R6, R6, R7, R7', RN, is dependent on whether X includes such substituents.) In the groups constituting the biradical(s), Z is selected from -0-, -S-, and -N(Ra)-, and Ra and Rb each is independently selected from hydrogen, optionally substituted C1-61-6-alkyl, optionally substituted C2_12-alkenyl, optionally substituted C2_12-alkynyl, hydroxy, C1-61-6-alkoxy, C2_l2-alkenyloxy, carboxy, Cul2-alkoxycarbonyl, C1-61-6-alkylcarbonyl, f ormyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di (C1-6-alkyl) amino, carbamoyl, mono- and di (C1-6-alkyl) -amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di (C1-6-alkyl) amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, Cj.6-alkanoyloxy, sulphono, C1-6-alkylsulphony loxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands (where the latter groups may include a spacer as defined for the substituent B), where aryl and heteroaryl may be optionally substituted. Moreover, two geminal substituents Ra and Rb together may designate optionally substituted methylene (=CH2 optionally substituted one or two times with substituents as defined as optional substituents for aryl), and two non-geminal or geminal substituents selected from R , R, and any of the substituents R!, R2, R2', R, R3, R4, R5, R5, R6 and R6, R7, and R7' which are present and not involved in P, P' or the biradical(s) may together form an associated biradical selected from biradicals of the same kind as defined before. It will be clear that each of the pair(s) of non-geminal substituents thereby forms a mono- or bicyclic entity together with (i) the atoms to which the non-geminal substituents are bound and (ii) any intervening atoms. It is believed that biradicals which are bound to the ring atoms of the 5- or 6-membered rings are preferred in that inclusion of the substituents R5 and Rs' may cause an undesired sterical interaction with internucleoside linkage. Thus, it is preferred that the one or two pairs of non-geminal substituents, which are constituting one or two biradical(s), respectively, are selected from the present substituents of R', R4, R6, R6, R7, R7, RN, and the ones of R2, R2, R3, and R3' not designating P'. Preferably, the LNAs incorporated in the oligomers comprise only one biradical constituted by a pair of (two) non-geminal substituents. This being said, it should be understood (especially with due consideration of the known bi- and tricyclic nucleoside analogues - see "Background of the Invention") that the present invention does not relate to oligomers comprising the following bi- or tricyclic nucleosides analogues (except where combined with one or more of the novel LNAs defined herein): (i) R2 and R3 together designate a biradical selected from -0-CH2-CH2- and -0-CH2-CH2-CH2- when LNA is a bicyclic nucleoside analogue; (ii) R3 and R5 together designate a biradical selected from -CH2-CH2-, -0-CH2-, when LNA is a bicyclic nucleoside analogue; (iii) R3, R5, and R5' together designate a triradical -CH2-CH(- )-CH2- when LNA is a tricyclic nucleoside analogue; (iv) Rl' and R6' together designate a biradical -CH2- when LNA is a bicyclic nucleoside analogue; or (v) R4' and R6' together designate a biradical -CH2- when LNA is a bicyclic nucleoside analogue. In the present context, i.e. in the present description and claims, the orientation of the biradicals are so that the left-hand side represents the substituent with the lowest number and the right-hand side represents the substituent with the highest number, thus, when R3 and R5 together designate a biradical "-0-CH2-", it is understood that the oxygen atom represents R, thus the oxygen atom is e.g. attached to the position of R3, and the methylene group represents R5. Considering the numerous interesting possibilities for the structure of the biradical(s) in LNA(s) incorporated in oligomers according to the invention, it is believed that the biradical(s) constituted by pair(s) of non-geminal substituents preferably is/are selected from - (CR'R') r-Y- (CR'R') s-, ~(CRR)r~Y-(CR'R")S-Y-, -Y-(CR-R')M-Y-, -Y-(CR'R')r-Y-(CRV)s-, -(CRR)ttl-, -Y-, -Y-Y-, wherein each Y is independently selected from -0-, -S-, -Si(R)r/ -N(R')-, >C=0, -C(=0)-N(R')-, and -N(R') -C (=0) -, each R' is independently selected from hydrogen, halogen, azido, cyano, nitro, hydroxy, mercapto, amino, mono- or di(C1-66-alkyl)amino, optionally substituted C1-6g-alkoxy, optionally substituted C1-6-alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and/or two adjacent (non-geminal) R' may together designate a double bond; and each of r and s is 0-4 with the proviso that the sum r+s is 1-5. Particularly interesting situations are those wherein each biradical is independently selected from -Y-, - (CR'R')r+8-, -(CR'R') -Y-(CR'R') -, and ~Y-(CR'RY -Y-, wherein and each of r and s is 0-3 with the proviso that the sum r+s is 1-4. Considering the positioning of the biradical in the LNA(s), it is believed (based on the preliminary findings (see the examples)) that the following situations are especially interesting, namely where: R2' and R4' together designate a biradical selected from -Y-, -(CR'R1)1-6.-/ - (CR'R') -Y-(CR'R') -, and -Y- (CR'R') r+a-Y-; R2 and R3 together designate a biradical selected from -Y-, -(CR'R') -, - (CR'R') -Y- (CRV) -, and -Y-(CR'R') r+s-Y-; R2' and R3 together designate a biradical selected from -Y-, -s+,-» -(CR'R') .-Y-(CR'R') -, and -Y- (CR'R-),. -Y-; R1' and R4' together i s i + s designate a biradical selected from -Y'-, - (CRR ) r+s+1-, -(CRR ),-y-ICRR').-, and -Y-(CR'R') -NR'-; or where R1' and R2' together designate a biradical selected from -Y-, -(CR'R') -, -(CR'R') -Y-(CR'R')S-, and -Y-(CR'R') r+g-Y-; wherein each of r and s is 0-3 with the proviso that the sum r+s is 1-4, and where Y' is selected from -NR'-C(=0)- and -C(=0)-NR'-. Particularly interesting oligomers are those wherein one of the following criteria applies for at least one LNA in an oligomer; R2" and R4' together designate a biradical selected from -0-, -S-, -N(R')-, -(CR'R')1-6-, -(CR'R,-0-(CR'R')S-, - (CR'R')r~S-(CR'R') s-, -(CR'R')r-N(R-)-(CRtR'),-/ -0-(CRV)r+s-0-, -S- (CR'R') r+s-0-, -0-(CR'R,+S-S-, -N(RV(CR'R,+S-0-, -0-(CR'R')r+g-N(RV, -S- (CRR) r+s-S-, -N(R')-(CR'R,+S-N(R')-, -N(R')-(CRR')r+s-S-, and -S- (CR'R') r+s-N(R')-; R2 and R3 together designate a biradical selected from -0-, -(CR'R')r+s-, -(CR'R')r-0-(CR'R-),-, - (CR'R')r-S-(CR'R') ,-, and - (CR'R4)r-N(R') - (CR'R')s-; R2' and R3 together designate a biradical selected from -0-, -(CR'R'L -, - (CR'R') -0-(CR'R') -, -{CR'R') -S-(CR'R') -, and -(CR'R') -N(R') - (CR'R') -; R3 and R4' together designate a biradical selected from - (CR'R') r-0- (CR'R') s-, -(CR'R')r-S-(CR'R')a-, and -(CR'R-)r-N(Ri).-(CR'Ri)#-; R3 and R5 together designate a biradical selected from - (CR'R') r-0- (CR'R") S-, -(CR4R')r-S-(CR'R'),-, and - (CR'R') r-N(R') - (CR'R') 3- ; R1' and R4' together designate a biradical selected from - {CR'R')r-0-{CR'R')s-, -(CR-R4)r-S-(CR'R').-, and - (CR'R-)r-N(R') - (CR'R'),-; or Rl' and R2' together designate a biradical selected from - (CR'R')r-0- (CR'R')s-, -(CR'R') -S-(CRV) -, and - (CRV) -N(R') - (CRV) -; wherein each of r and s is 0-3 with the proviso that the sum r+s is 1-4, and where X is selected from -0-, -S-, and -N(RH)- where RH designates hydrogen or C1-6-alkyl. It is furthermore preferred that one R' is selected from hydrogen, hydroxy, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and any remaining substituents R' are hydrogen. Preferably, a group R' in the biradical of at least one LNA is selected from DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands (where the latter groups may include a spacer as defined for the substituent B). With respect to the substituents Rl, R2, R2, RJ, R4, R5, R5', Rb and Rb', R7, and R7', which are present and not involved in P, P' or the biradical(s), these are independently selected from hydrogen, optionally substituted Cw2~alkyl, optionally substituted C2_12-alkenyl, optionally substituted C2_I2-alkynyl, hydroxy, C1-6-alkoxy, C2.12-alkenyloxy, carboxy, CU12-alkoxycarbonyl, C1-61-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di (Cj.g-alkyl) amino, carbamoyl, mono- and di (Cx_6-alkyl) -amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di (Ct_6-alkyl) amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alky lthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands (where the latter groups may include a spacer as defined for the substituent B), where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene, or together may form a spiro biradical consisting of a 1-5 carbon atom(s) alkylene chain which is optionally interrupted and/or terminated by one or more heteroatoms/groups selected from -0-, -S-, and -(NRN)~ where RN is selected from hydrogen and C1-6-alkyl, and where two adjacent (non-geminal) substituents may designate an additional bond resulting in a double bond; and RN, when present and not involved in a biradical, is selected from hydrogen and Ct_4-alkyl. Preferably, each of the substituents R1', R2, R2, R3, R3, R4 , R5, R5', Rfa, Rfa, R7, and R7' of the LNA(s) , which are present and not involved in P, p' or the biradical (s) , is independently selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, hydroxy, C1-6-alkoxy, C2.h-alkenyloxy, carboxy, C1-6-alkoxycarbonyl, C,_6-alkylcarbonyl, formyl, amino, mono- and di (C,.6-alkyl) amino, carbamoyl, mono- and di (C1-6-alkyl) -amino-carbonyl, C1-6-alkyl-carbonylamino, carbamido, azido, C1-66-alkanoyloxy, sulphono, sulphanyl, C1-6-alkylthio, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and halogen, where two geminal substituents together may designate oxo, and where RN, when present and not involved in a biradical, is selected from hydrogen and CU4-alkyl. In a preferred embodiment of the present invention, X is selected from -0-, -S-, and -NRN'-, and each of the substituents Rl, R2, R2, RJ, R3, R4, R5, R5, R6, R6, R?, and R7' of the LNA(s) , which are present and not involved in P, P' or the biradical(s), designate hydrogen. In a further embodiment of the present invention, R2' and R4' of an LNA incorporated into an oligomer together designate a biradical. Preferably, X is 0, R2 selected from hydrogen, hydroxy, and optionally substituted C1-6-alkoxy, and R1', R3, R5, and R5' designate hydrogen, and, more specifically, the biradical is selected from -0-, - (CH2)0-l-O- (CH2) 1-63-f -(CH2)0_j-S-tCH,)1-6-, -(CH2)0.1-N(RN)-(CH2)1_J-, and - (CH2) 2_r . In another embodiment of the present invention, R2 and R3 of an LNA incorporated into an oligomer together designate a biradical. Preferably, X is 0, R2' is selected from hydrogen, hydroxy, and optionally substituted C1-6-alkoxy, and R1', R4', R5, and R5' designate hydrogen, and, more specifically, the biradical is selected from - (CH2) 1-6-0- (CH2) U3- and -(CH1-61-6-. In a further embodiment of the present invention, R and R of an LNA incorporated into an oligomer together designate a biradical. Preferably, X is 0, R2 is selected from hydrogen, hydroxy, and optionally substituted C,_6-alkoxy, and R1 , R4 , R , and R5' designate hydrogen, and, more specifically, the biradical is selected from - (CH2) O.j-0- (CH2),__,- and -(CH2)2.4-. In a further embodiment of the present invention, RJ and R of an LNA incorporated into an oligomer together designate a biradical. Preferably, X is 0, R2' selected from hydrogen, hydroxy, and optionally substituted C1-6-alkoxy, and R1', R2, R5, and R5' designate hydrogen, and, more specifically, the biradical is - (CH2)0,2-O- (CH2) 0_2- . In a further embodiment of the present invention, R3 and R5' of an LNA incorporated into an oligomer together designate a biradical. Preferably, X is 0, R2' selected from hydrogen, hydroxy, and optionally substituted C1-6-alkoxy, and R1', R2, R4, and R5 designate hydrogen, and, more specifically, the biradical is selected from -0- (CHR') 2_3- and - (CHR') 1-6-0- (CHR') 0_3- . In a further embodiment of the present invention, R1" and R4' of an LNA incorporated into an oligomer together designate a biradical. Preferably, X is 0, R2' selected from hydrogen, hydroxy, and optionally substituted C1-6-alkoxy, and R , R , R , and R5' designate hydrogen, and, more specifically, the biradical is - (CH2) 0_2-O-(CH2) 0_2-. For these interesting embodiments, it is preferred that the LNA(s) has/have the general formula la. As it will be evident from the general formula I (LNA(s) in an oligomer) (and the general formula II (monomeric LNA) - see below) and the definitions associated therewith, there may be one or several asymmetric carbon atoms present in the oligomers (and monomeric LNAs) depending on the nature of the substituents and possible biradicals, cf. below. The oligomers prepared according to the method of the invention, as well as the oligomers per se, are intended to include all stereoisomers arising from the presence of any and all isomers of the individual monomer fragments as well as mixtures thereof, including racemic mixtures. When considering the 5- or 6-membered ring, it is, however, believed that certain stereochemical configurations will be especially interesting, e.g. the following where the wavy lines represent the possibility of both diastereomers arising from the interchange of the two substituents in question. An especially interesting stereoisomeric representation is the case where the LNA(s) has/have the following formula la In these cases, as well as generally, R3' preferably designates P . The oligomers according to the invention typically comprise 1-10000 LNA(s) of the general formula I (or of the more detailed general formula la) and 0-10000 nucleosides selected from naturally occurring nucleosides and nucleoside analogues. The sum of the number of nucleosides and the number of LNA(s) is at least 2, preferably at least 3, such as in the range of 2-15000, preferably in the range of 2-100, such as 3-100, in particular in the range of 2-50, such as 3-50. Preferably at least one LNA comprises a nucleobase as the, substituent B. In the present context, the term "nucleoside" means a glycoside of a heterocyclic base. The term "nucleoside" is used broadly as to include non-naturally occurring nucleosides, naturally occurring nucleosides as well as other nucleoside analogues. Ilustrative examples of nucleosides are ribonucleosides comprising a ribose moiety as well as deoxyribonuclesides comprising a deoxyribose moiety. With respect to the bases of such nucleosides, it should be understood that this may be any of the naturally occurring bases, e.g. adenine, guanine, cytosine, thymine, and uracil, as well as any modified variants thereof or any possible unnatural bases. When considering the definitions and the known nucleosides (naturally occurring and non-naturally occurring) and nucleoside analogues (including known bi- and tricyclic analogues), it is clear that an oligomer may comprise one or more LNA(s) (which may be identical or different both with respect to the selection of substituent and with respect to selection of biradical) and one or more nucleosides and/or nucleoside analogues. In the present context "oligonucleotide" means a successive chain of nucleosides connected via internucleoside linkages, however, it should be understood that a nucleobase in one or more nucleotide units (monomers) in an oligomer (oligonucleotide) may have been modified with a substituent B as defined above. The oligomers may be linear, branched or cyclic. In the case of a branched oligomer, the branching points may be located in a nucleoside, in an internucleoside linkage or, in an intriguing embodiment, in an LNA. It is believed that in the latter case, the substituents R2, R2, R3, and RJ' may designate two groups P' each designating an internucleoside linkage to a preceding monomer, in particular, one of R2 and R2' designate P and one or Rj and R3' designate a further P'. As mentioned above, the LNA(s) of an oligomer are connected with other monomers via an internucleoside linkage. In the present context, the term "internucleoside linkage" means-a uncage consisting of 2 to 4, preferably 3, groups/atoms selected from -CH2-, -0-, -S-, -NRH-, >C=0, >C=NRH, >C=S, -Si(R')2-, -SO-, -S(0)2-, -P(0)2-, -PO(BH3)-, -P(0,S)-, -P(S)2~, -PO(R')-, -PO(OCH3)-, and -PO(NHRH)-, where RH is selected form hydrogen and C1-6-alkyl, and R' ' is selected from C1-6-alkyl and phenyl. Illustrative examples of such internucleoside linkages are -CH2-CH2-CH2- -CH2-CO-CH2- -CH2-CHOH-CH2- -0-CH2-0-, -0-CH2-CH2-, -0-CH2-CH= (including R5 when used as a linkage to a succeeding monomer) , -CH2-CH2-0-, -NRH-CH2-CH2-, -CH2-CH2-NRH-, -CH2-NRH-CH2-, -0-CH2-CH2-NRH-, -NRH-CO-0-, -NRH-CO-NRH-, -NRH-CS-NRH-, -NRH-C(=NRH)-NRH-, -NRH-CO-CH2-NRH-, -0-C0-0-, -0-C0-CH2-0-, -O-CHj-CO-0-, -CH2-CO-NRH-, -0-CO-NR"-, -NRH-CO-CH2- , -0-CH2-CO-NRH-, -0-CH2-CH2-NRH-7 -CH=N-0-, -CH2-NRH-0-, -CH2-0-N= (including R5 when used as a linkage to a succeeding monomer) , -CH2-0-NRH-, -CO-NRH-CH2-, -CH2-NRH-0-, -CH2-NRH-CO-, -0-NRH-CH2-, -0-NRH-, -0-CH2-S-, -S-CH2-0-, -CH2-CH2-S-, -0-CH2-CH2-S-, -S-CH2-CH= (including R5 when used as a linkage to a succeeding monomer), -S-CH2-CH2-, -S-CH2-CH2-0-, -S-CH2-CH2-S-, -CH2-S-CH2-, -CH2-SO-CH2-, -CH2-S02-CH2-, -0-S0-0-, -0-S(0)2-0-, -0-S (0) 2-CH2-, -0-S(0)2-NRH-, -NRH-S(0)2-CH2-, -0-S (0) 2-CH2-, -0-P(0)2-0-, -0-P(0,S)-0-, -0-P(S)2-0-, -S-P(0)2-0-, -S-P(0,S)-0-, -S-P(S)2-0-, -0-P(0)2-S-, -0-P(0,S)-S-, -0-P(S)2-S-, -S-P(0)2-S-, -S-P(0,S)-S-, -S-P(S)2-S-, -0-PO(R' ' )-0-, -0-PO(OCHJ)-0-, -0-P0(0CH2CH3)-0-, -0-PO(OCH2CH2S-R)-0-, -O-PO (BH3) -0-, -0-PO(NHRN)-0-, -0-P(0)2-NRH-, -NRH-P(0)2-0-, -0-P(0,NRH)-0-, -CH2-P (0) 2-0-, -0-P(0)2-CH2-r and -0-Si(R' ' )2-0-; among which -CH2-CO-NRH-, -CH2-NRH-0-, -S-CH2-0-, -0-P(0)2-0-, -0-P(0,S)-0-, -0-P(S)2-0-, -NRH-P(0)2-0-, -0-P(0,NRH)-0-, -0-PO(R' ' )-0-, -0-P0 (CH3)-0-, and-O-PO(NHRN)-0-, where RH is selected form hydrogen and C,.4-alkyl, and R1 ' is selected from C1-6-alkyl and phenyl, are especially preferred. Further illustrative examples are given in Mesmaeker et. al., Current Opinion in Structural Biology 1995, 5, 343-355. The left-hand side of the internucleoside linkage is bound to the 5- or 6-membered ring as substituent P", whereas the right-hand side is bound to the 5"-position of a preceding monomer. It is also clear from the above that the group P may also designate a 5'-terminal group in the case where the LNA in question is the 5'-terminal monomer. Examples of such 5'-terminal groups are hydrogen, hydroxy, optionally substituted C1-6-alkyl, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkylcarbonyloxy, optionally substituted aryloxy, monophosphate, diphosphate, triphosphate, and -W-A', wherein W is selected from -0-, -S-, and -N(RH)- where RH is selected from hydrogen and CU6-alkyl, and where A' is selected from DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands (where the latter groups may include a spacer as defined for the substituent B). In the present description and claims, the terms "monophosphate", "diphosphate", and "triphosphate" mean groups of the formula: -0-P(0)2-0~, -0-P (0) 2-0-P (0) 2-0~, and -0-P(0)2-0-P (0) 2-0-P (0) 2-0~, respectively. Analogously, the group P' may designate a 3'-terminal group in the case where the LNA in question is the 3'-terminal monomer. Examples of such 3'-terminal groups are hydrogen, hydroxy, optionally substituted Cj_6-alkoxy, optionally substituted Chalky lcarbonyloxy, optionally substituted aryloxy, and -W-A', wherein W is selected from -0-, -S-, and -N(RH)- where RH is selected from hydrogen and C1-6-alkyl, and where A' is selected from DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands (where the latter groups may include a spacer as defined for the substituent B). In a preferred embodiment of the present invention, the oligomer has the following formula V: G-[Nu-L]n(0)-{[LNA-L]m(q)-[Nu-L]n(q)}q-G' V wherein q is 1-50; each of n(0), .., n(q) is independently 0-10000; each of m(l), .., m(q) is independently 1-10000; with the proviso that the sum of n(0), .., n(q) and m(l), , ., m(q) is 2-11-6000; G designates a 5'-terminal group;each Nu independently designates a nucleoside selected from naturally occurring nucleosides and nucleoside analogues; each LNA independently designates a nucleoside analogue; each L independently designates an internucleoside linkage between two groups selected from Nu and LNA, or L together with G' designates a 3'-terminal group; and each LNA-L independently designates a nucleoside analogue of the general formula I as defined above, or preferably of the general formula la as defined above. In another embodiment of the present invention, the oligomer further comprises a PNA mono- or oligomer segment of the formula wherein B is a defined above for the formula I, AASC designates hydrogen or an amino acid side chain, t is 1-5, and w is 1-50. In the present context, the term "amino acid side chain" means a group bound to the a-atom of an a-amino acids, i.e. corresponding to the a-amino acid in question without the glycine moiety, preferably an either naturally occurring or a readily available a-amino acid. Illustrative examples are hydrogen (glycine itself), deuterium (deuterated glycine), methyl (alanine), cyanomethyl (p-cyano-alanin), ethyl, 1-propyl (norvaline), 2-propyl (valine), 2-methyl-l-propyl (leucine), 2-hydroxy-2-methyl-1 -propyl ((3-hydroxy-leucine) , 1 -butyl (norleucine), 2-butyl (isoleucine), methylthioethyl (methionine), benzyl (phenylalanine), p-amino-benzyl (p-amino-phenylalanine), p-iodo-benzyl (p-iodo-phenylalanine), p-fluoro-benzyl (p-fluoro-phenylalahine), p-bromo-benzyl (p-bromo--phenylalanine), p-chloro-benzyl (p-chloro-phenylalanine), p- nitro-benzyl (p-nitro-phenylalanine), 3-pyridylmethyl (P~(3- pyridyl)-alanine), 3,5-diiodo-4-hydroxy-benzyl (3,5-diiodo-tyrosine) , 3, 5-_dibromo-4-hydroxy-benzyl (3, 5-dibromo-tyrosine) , 3,5-dichloro-4-hydroxy-benzyl (3, 5-dichloro-tyrosine), 3,5-difluoro-4-hydroxy-benzyl (3, 5-difluoro-tyrosine), 4-methoxy- benzyl (O-methyl-tyrosin) , 2-naphtylmethyl (|3—(2-naphtyl) - alanin), 1-naphtylmethyl (p-(l-naphtyl)-alanin), 3-indolylmethyl (tryptophan), hydroxymethyl (serine), 1-hydroxyethyl (threonine), mercaptomethyl (cysteine), 2-mercapto-2-propyl (penicillamine)t 4-hydroxybenzyl (tyrosine), aminocarbonylmethyl (asparagine), 2-aminocarbonylethyl (glutamine), carboxymethyl (aspartic acid), 2-carboxyethyl (glutamic acid), aminomethyl (a,p-diaminopropionic acid), 2- aminoethyl (a/Y-diaminobutyric acid), 3-amino-propyl (ornithine), 4-amino-l-butyl (lysine), 3-guanidino-l-propyl (arginine), and 4-imidazolylmethyl (histidine). PNA mono- or oligomer segment may be incorporated in a oligomer as described in EP 0672677 A2. The oligomers of the present invention are also intended to cover chimeric oligomers. "Chimeric oligomers" means two or more oligomers with monomers of different origin joined either directly or via a spacer. Illustrative examples of such oligomers are peptides, PNA-oligomers, oligomers containing LNA's, and oligonucleotide oligomers. Apart from the oligomers defined above, the present invention also provides monomeric LNAs useful, e.g., in the preparation of oligomers, as substrates for, e.g., nucleic acid polymerases, polynucleotid kinases, terminal transferases, and as therapeutical agents, see further below. The monomeric LNAs correspond in the overall structure (especially with respect to the possible biradicals) to the LNAs defined as constituents in oligomers, however with respect to the groups P and P, the monomeric LNAs differ slightly as will be explained below. Furthermore, the monomeric LNAs may comprise functional group protecting groups, especially in the cases where the monomeric LNAs are to be incorporated into oligomers by chemical synthesis. An interesting subgroup of the possible monomeric LNAs comprises bicyclic nucleoside analogues (LNAs) of the general formula II wherein the substituent B is selected from nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; X is selected from -0-, -S-, -N(RN')~, and -C(R6R6')-, preferably from -0-, -S-, and -N(RN')-; one of the substituents R2, R2, R, and R3' is a group Q'; each of Q and Q' is independently selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, Prot-O-, Act-O-, mercapto, Prot-S-, Act-S-, C1-6-alkylthio, amino, Prot-N(RH) -, Act-N{RH)-, mono- or di (C1-6-alkyl)amino, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2,6-alkynyl, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, triphosphate, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, hydroxymethyl, Prot-0-CH2-, Act-0-CH2-, aminomethyl, Prot-N(RH) -CH2-, Act-N(RH) -CH2-, carboxymethyl, sulphonomethyl, where Prot is a protection group for -OH, -SH, and -NH(RH), respectively, Act is an activation group for -OH, -SH, and -NH(RH), respectively, and RH is selected from hydrogen and Cj1-6-alkyl; R2" and R4' together designate a biradical selected from -0-, ~S-, -N(R')-, -(CR'R')its+r, -(CRtR')r0-(CR'R')3-, - (CR'R' ) , -S- (CR'R-) g- , -(CR,R')I-N(R')-(CR'R')S-/ -0-(CRR')I+8-0-, -S- (CR'R' ) r+s-0- , -0- (CR'R')I+S-S-, ~N(R") -(CR'R'J1-6-O-, -O-(CR'R')IVS-N(R')-, -S-(CR,R')1+,- S-, -N(R')-(CR'R')rts-N(R')-, -N(R') - (CR'R') „,-S-, and -S- (CR'R' ) „,-N(R')-; R2 and R3 together designate a biradical selected from -0-, -(CR'R')rts-, -(CR'R')r-0-(CR'R')s-, - (CR'R') r-S- (CR'R'),-, and -(CR"R')r-N(R') -(CR'R').-; R2' and RJ together designate a biradical selected from -0-, -(CR'R') -, - (CR'R')-O-(CR'R') -, -(CR'R") ,-S-(CR'R').-, and - (CR'R') r-N(R') - (CR'R'),-; R3 and R4" together designate a biradical selected from - (CR'R')V-0- (CR"R")S-, -(CR'R') -S-(CR'R') -, and -(CR"R')-N(R,)-(CR"R') -; R3 and Rs together designate a biradical selected from - (CR'R') -0- (CRR) -, -(CR'R') -S-(CR'R') -, and - (CR'R') -N(R') - (CR'R') -; R1' and R4' together designate a biradical selected from - (CR'R') -0- (CR'R') - r s , -(CR'R') -S-(CR'R') -, and - (CR'R') -N(R') - (CR'R') -; or R1" and R2' £ 5 IT 5 together designate a biradical selected from - (CR'R')r-0- (CR'R')S-, -(CR-R') -S-(CR'R') -, and - (CR'R')-N(R') - (CRV) -; wherein R' is as defined above for the oligomers; and each of the substituents R1', R2, R2', R3, R4', R5, and R5', which are not involved in Q, Q' or the biradical, are as defined above for the oligomers. The monomeric LNAs also comprise basic salts and acid addition salts thereof. Furthermore, it should be understood that any chemical group (including any nucleobase), which is reactive under the conditions prevailing in chemical oligonucleotide synthesis, is optionally functional group protected as known in the art. It should furthermore be understood, with due consideration of the known bicyclic nucleoside analogues, that R2 and R3 do not together designate a biradical selected from -0-CH2-CH2- and -0-CH2-CH2-CH2-; and R3 and R5 do not together designate a biradical selected from -CH2-CH2-, -0-CH2-, and -0-Si (lPr) 2-0-Si {'Pr) 2~0- . As mentioned above, any chemical group which is reactive under the conditions prevailing in oligonucleotide synthesis, is optionally functional group protected. This means that groups such as hydroxy, amino, carboxy, sulphono, and mercapto groups, as well as nucleobases, of a monomeric LNA are optionally functional group protected. Protection (and deprotection), is performed by methods known to the person skilled in the art (see, e.g. , Greene, T. W. and Wuts, P. G. M. , "Protective Groups in Organic Synthesis", 2nd ed., John Wiley, N.Y. (1991), and M.J. Gait, Oligonucleotide Synthesis, IRL Press, 1984) . Illustrative examples of hydroxy protection groups are optionally substituted trityl, such as 4,4'-dimethoxytrityl (DMT), 4-monomethoxytrityl (MMT), and trityl, optionally substituted 9-(9-phenyl)xanthenyl (pixyl), optionally substituted ethoxycarbonyloxy, p-phenylazophenyloxycarbonyloxy, tetraahydropyranyl (thp), 9-fluorenylmethoxycarbonyl (Fmoc), methoxytetrahydropyranyl (mthp), silyloxy such as tri-methylsilyl (IMS), triisopropylsilyl (TIPS), tert-butyl-dimethylsilyl (TBDMS), triethylsilyl, and phenyldimethylsilyl, benzyloxycarbonyl or substituted benzyloxycarbonyl ethers such as 2-bromo benzyloxycarbonyl, tert-butylethers, alkyl ethers such as methyl ether, acetals (including two hydroxy groups), acyloxy such as acetyl or halogen substituted acetyls, e.g. chloroacetyl or fluoroacetyl, isobutyryl, pivaloyl, benzoyl and substituted benzoyls, methoxymethyl (MOM), benzyl ethers or substituted benzyl ethers such as 2,6-dichlorobenzyl (2,6-Cl2Bzl). Alternatively, the hydroxy group may be protected by attachment to a solid support optionally through a linker. Illustrative examples of amino protection groups are Fmoc (fluorenylmethoxycarbonyl), BOC (tert-butyloxycarbonyl), trifluoroacetyl, allyloxycarbonyl (alloc, AOC), benzyloxycarbonyl (Z, Cbz), substitued benzyloxycarbonyls such as 2-chloro benzyloxycarbonyl ((2-C1Z), monomethoxytrityl (MMT) , dimethoxytrityl (DMT), phthaloyl, and 9-(9-phenyl)xanthenyl (pixyl). Illustrative examples of carboxy protection groups are allyl esters, methyl esters, ethyl esters, 2-cyanoethylesters, trimethylsilylethylesters, benzyl esters (Obzl), 2-adamantyl esters (0-2-Ada), cyclohexyl esters (OcHex), 1,3-oxazolines, oxazoler, 1,3-oxazolidines, amides or hydrazides. Illustrative examples of mercapto protecting groups are trityl (Trt), acetamidomethyl (acm), trimethylacetamidomethyl (Tacm), 2,4,6-trimethoxybenzyl (Tmob), tert-butylsulfenyl (StBu), 9-fluorenylmethyl (Fm), 3-nitro-2-pyridinesulfenyl (Npys), and 4-methylbenzyl (Meb). Furthermore, it may be necessary or desirable to protect any nucleobase included in an monomeric LNA, especially when the monomeric LNA is to be incorporated in an oligomer according to the invention. In the present context, the term "protected nucleobases" means that the nucleobase in question is carrying a protection group selected among the groups which are well-known for a man skilled in the art (see e.g. Protocols for Oligonucleotides and Analogs, vol 20, (Sudhir Agrawal, ed.), Humana Press, 1993, Totowa, NJ; S. L. Beaucage and R. P. Iyer, Tetrahedron, 19 93, 49, 6123; S. L. Beaucage and R. P. Iyer, Tetrahedron, 1992, 48, 2223; and E. Uhlmann and A. Peyman, Chem. Rev., 90, 543.) . Illustrative examples are benzoyl, isobutyryl, tert-butyl, tert-butyloxycarbonyl, 4-chloro-benzyloxycarbonyl, 9-fluorenylmethyl, 9-fluorenylmethyloxycarbonyl, 4- methoxybenzoyl, 4-methoxytriphenylmethyl, optionally substituted triazolo, p-toluenesulphonyl, optionally substituted sulphonyl, isopropyl, optionally substituted amidines, optionally substituted trityl, phenoxyacetyl, optionally substituted acyl, pixyl, tetrahydropyranyl, optionally substituted silyl ethers, and 4- methoxybenzyloxycarbonyl. Chapter 1 in "Protocols for oligonucleotide conjugates1', Methods in Molecular Biology, vol 26, (Sudhir Agrawal, ed. ) , Humana Press, 19 93, Totowa, NJ. and s. L. Beaucage and R. P. Iyer, Tetrahedron, 1992, 48, 2223 disclose further suitable examples. In a preferred embodiment, the group B in a monomeric LNA is preferably selected from nucleobases and protected nucleobases. In an embodiment of the monomeric LNAs according to the present invention, one of Q and Q', preferably Q', designates a group selected from Act-0-, Act-S-, Act-N(RH)-, Act-0-CH2-, Act-S-CH2-, Act-N(RH) -CH2-, and the other of Q and Q, preferably Q, designates a group selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, Prot-O-, mercapto, Prot-S-, C,_6-alkylthio, amino, Prot-N(RH)-, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C{_6-alkyl, optionally substituted C2_6-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyl, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, triphosphate, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, hydroxyrnethyl, Prot-0-CH2-, aminomethyl, Prot-N(RH) -CH2-, carboxymethyl, sulphonomethyl, and RH is selected from hydrogen and Cj1-6-alkyl. In the case described above, the group Prot designates a protecting group for -OH, -SH, and -NH(RH), respectively. Such protection groups are selected from the same as defined above for hydroxy protection groups, mercapto protection group, and amino protection groups, respectively, however taking into consideration the need for a stable and reversible protection group. However, it is preferred that any protection group for -OH is selected from optionally substituted trityl, such as dimethoxytrityl (DMT), monomethoxytrityl (MMT), and trityl, and 9-(9-phenyl)xanthenyl (pixyl), optionally substituted, tetrahydropyranyl (thp) (further suitable hydroxy protection groups for phosphoramidite oligonucleotide synthesis are described in Agrawal, ed. "Protocols for Oligonucleotide Conjugates"; Methods in Molecular Biology, vol. 26, Humana Press, Totowa, NJ (19 94) and Protocols for Oligonucleotides and Analogs, vol 20, (Sudhir Agrawal, ed.), Humana Press, 1993, Totowa, NJ), or protected as acetal; that any protection group for -SH is selected from trityl, such as dimethoxytrityl (DMT), monomethoxytrityl (MMT), and trityl, and 9-(9-phenyl)xanthenyl (pixyl), optionally substituted, tetrahydropyranyl (thp) (further suitable mercapto protection groups for phosphoramidite oligonucleotide synthesis are also described in Agrawal (see above); and that any protecting group for -NH(RH) is selected from trityl, such as dimethoxytrityl (DMT), monomethoxytrityl (MMT), and trityl, and 9-(9-phenyl)xanthenyl (pixyl), optionally substituted, tetrahydropyranyl (thp) (further suitable amino protection groups for phosphoramidite oligonucleotide synthesis are also described in Agrawal (see above). In the embodiment above, as well as for any monomeric LNAs defined herein, Act designates an activation group for -OH, -SH, and -NH(RH), respectively. Such activation groups are, e.g., selected from optionally substituted O-phosphoramidite, optionally substituted O-phosphortriester, optionally substituted O-phosphordiester, optionally substituted H-phosphonate, and optionally substituted phosphordiester. In the present context, the term "phosphoramidite" means a group of the formula -P (0RX) -N(Ry)2, wherein Rx designates an optionally substituted alkyl group, e.g. methyl, 2-cyanoethyl, or benzyl, and each of Ry designate optionally substituted alkyl groups, e.g. ethyl or isopropyl, or the group -N(Ry)2 forms a morpholino group (-N(CH2CH2)20) . R' preferably designates 2-cyanoethyl and the two Ry are preferably identical and designate isopropyl. Thus, an especially relevant phosphoramidite is N,N-diisopropyl-0-(2-cyanoethyl)phosphoramidite. It should be understood that the protecting groups used herein for a single monomeric LNA or several monomeric LNAs may be selected so that when this/these LNA(s) are incorporated in an oligomer according to the invention, it will be possible to perform either a simultaneous deprotection or a sequential deprotection of the functional groups. The latter situation opens for the possibility of regioselectively introducing one or several "active/functional" groups such as DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where such groups may be attached via a spacer as described above. In a preferred embodiment, Q is selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, Prot-O-, mercapto, Prot-S-, C1-6-alkylthio, amino, Prot-N(RH) -, mono- or di (C1-6-alkyl) amino, optionally substituted C,_6-alkoxy, optionally substituted C,_6-alkyl, optionally substituted C2,6-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyl, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, triphosphate, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, hydroxymethyl, Prot-0-CH2-, aminomethyl, Prot-N(RH) -CH2-, carboxymethyl, sulphonomethyl, where Prot is a protection group for -OH, -SH, and -NH(RH), respectively, and RH is selected from hydrogen and CN6-alkyl; and Q is selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, Act-O-, mercapto, Act-S-, Cj_6-alkylthio, amino, Act-N(RH) -, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C1Hi-alkyl, optionally substituted C2_6-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyl, optionally substituted C2_6-alkynyloxy, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, where Act is an activation group for -OH, -SH, and -NH(RH), respectively, and RH is selected from hydrogen and C1-6-alkyl. The monomeric LNAs of the general formula II may, as the LNAs incorporated into oligomers, represent various stereoisomers. Thus, the stereochemical variants described above for the LNAs incorporated into oligomers are believed to be equally applicable in the case of monomeric LNAs (however, it should be noted that P should then be replaced with Q). In a preferred embodiment of the present invention, the nonomeric LNA has the general formula Ila wherein the substituents are defined as above. Furthermore, with respect to the definitions of substituents, biradicals, R', etc. the same preferred embodiments as defined above for the oligomer according to the invention also apply in the case of monomeric LNAs. In a particularly interesting embodiment of the monomeric LNAs of the present invention, B designates a nucleobase, X is -O-, R2' and R4' together designate a biradical selected from -(CHJ0_j-0-(CH2)I.J-, -(CH2)0_1-S-(CH2)I„3-, and - (CH2) 0.1-N(RH) - (CH2) {_r where RM is selected from hydrogen and C1-6-alkyl, Q designates Prot-O-, RJ' is Q' which designates Act-OH, and R1', R2, R3, R5, and R5' each designate hydrogen. In a further particularly interesting embodiment of the monomeric LNAs of the present invention, B designates a nucleobase, X is -0-, R2' and R4' together designate a biradical selected from - (CE2) O_r0~ (CH2) 1-3-, - (CH2) 0.rS- (CH2) }_r, and -(CH2)0. ,-N(RN) - (CH2) 1-3- where RN is selected from hydrogen and C1-6-alkyl, Q is selected from hydroxy, mercapto, C1-6-alkylthio, amino, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, and triphosphate, R3' is Q' which is selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, mercapto, C1_6-alkylthio, amino, mono- or di (C,_(i-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkyl, optionally substituted C2_h-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C21-6-alkynyl, and optionally substituted Chalky nyloxy, R3 is selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2.()-alkenyl, and optionally substituted C2_6-alkynyl, and R', R2, R5, and R5' each designate hydrogen. In a further particularly interesting embodiment of the monomeric LNAs of the present invention, B designates a nucleobase, X is -0-, R2 and RJ together designate a biradical selected from - (CH2) 0.1-O-CH=CH-/ - (CH2) 1-6-S-CI1-6CH-, and -(CH2)0_r N(RN)-CH=CH- where RN is selected from hydrogen and C1-6-alkyl, Q is selected from hydroxy, mercapto, C1-6-alkylthio, amino, mono-or di (C1-6-alkyl) amino, optionally substituted Cj_6-alkoxy, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, and triphosphate, RJ' is Q' which is selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, mercapto, C1-6-alkylthio, amino, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C,_6-alkyl, optionally substituted C,_6-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyl, and optionally substituted C2_6-alkynyloxy, and R1', R2", R4', R5, and R5' each designate hydrogen. One aspect of the invention is to provide various derivatives of LNAs for solid-phase and/or solution phase incorporation into the oligomer. As an illustrative example, three monomers suitable for incorporation of (IS,3R,4R, 7S)-7-hydroxy-l-hydroxymethyl-3-(thymin-1-yl)-2,5-dioxabicyclo[2.2.1]heptane using the phosphoramidite approach, the phosphortriester approach, and the Jf-phosphonate approach, respectively, are (1R,3R, 4R, 7S)-1 -(2-Cyanoethoxy(diisopropylamino)phosphinoxy)-1-(4,4'-dimethoxytrityloxymethyl)-3-(thymin-1-yl)-2,5-dioxabicyclo [2 .2.1]heptane, [1R,3R,4R, 7S)-7-hydroxy-l-(4,4'-dimethoxy-trityloxymethyl)-3-(thymin-1-yl)-2,5-dioxabicyclo[2.2.1]-heptane-7-0-(2-chlorophenylphosphate), and (1R,3R,4R, 7S)-7-hydroxy-1-(4,4'-dimethoxytrityloxymethyl)-3-(thymin-1-yl)-2,5-dioxabicyclo[2.2.1]heptane-7-0-(tf-phosphonate). Furthermore, the analogues where the methyleneoxy biradical of the monomers is substituted with a methylenethio, a methyleneamino, or a 1,2-ethylene biradical are also expected to constitute particularly interesting variants within the present invention. In a particularly interesting embodiment, the present invention relates to an oligomer comprising at least one LNA of the general formula la wherein X is -0-; B is selected from nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; P designates the radical position for an internucleoside linkage to a succeeding monomer, or a 5'-terminal group, such internucleoside linkage or 5'-terminal group optionally including the substituent R5; R3' is a group P' which designates an internucleoside linkage to a preceding monomer, or a 3'-terminal group; R and R together designate a biradical selected from -0-, -S, -N(R')-, -(CR-R') .-, - (CR'R') -0- (CR'R') -, -(CR'R")r-S-(CR,R')s-, -(CR'R')r-N(R')-(CR'R')s-, -0- (CR'R') „.-0-, -S-(CR'R')i+s-0-, -0-(CR"R')rts-S-, -N(R")-(CR'R')rts-0-, -0-(CR'R') „.-N(R")-, -S-(CR,R")r+s-S-, -N(R')-(CR'R')I.+S-N(R")-, -N(R') - (CR'R') „.-S-, and -S- (CR'R'),. -N(R") -; wherein each R is independently selected from hydrogen, halogen, azido, cyano, nitro, hydroxy, mercapto, amino, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and/or two adjacent (non-geminal) R' may together designate a double bond, and each of r and s is 0-3 with the proviso that the sum r+s is 1-4; each of the substituents R1', R2, R3, R5, and R5' is independently selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, hydroxy, C1-6-alkoxy, C2_6-alkenyloxy, carboxy, Cj_6-alkoxycarbonyl, C1-6-alkylcarbonyl, formyl, amino, mono- and di (C,_(j-alkyl) amino, carbamoyl, mono- and di (C,.6-alkyl) -amino-carbonyl, C1-6-alkyl-carbonylamino, carbamido, azido, C,1-6-alkanoyloxy, sulphono, sulphanyl, C1-6-alkylthio, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and halogen, where two geminal substituents together may designate o1-6co; and basic salts and acid addition salts thereof. In particular, one R' is selected from hydrogen, hydroxy, optionally substituted C1-6-alkoxy, optionally substituted C,_6-i alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and any remaining substituents R' are hydrogen. Especially, the biradical is selected from -0-, -(CH2)0_1-O-(CH2)l„J-, -(CH2)0„1-S-(CH2)1„J-, - (CH2) 0„rN(RN) - (CH2) 1-6- , and -(CH2)2.4-. In a further particularly interesting embodiment, the present invention relates to an LNA of the general formula Ila wherein X is -0-; B is selected from nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; RJ' is a group Q'; each of Q and Q' is independently selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, Prot-O-, Act-O-, mercapto, Prot-S-, Act-S-, C1-6-alkylthio, amino, Prot-N(RH)-, Act-N(RH)-, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C,_6-alkyl, optionally substituted C2_6-alkenyl, optionally substituted C2_b-alkenyloxy, optionally substituted C2_6-alkynyl, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, triphosphate, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, hydroxymethyl, Prot-0-CH2~, Act-0~CH2-, aminomethyl, Prot-N(RH) -CH2-, Act-N(RH) ~CH2~, carboxymethyl, sulphonomethyl, where Prot is a protection group for -OH, -SH, and -NH(RH), respectively, Act is an activation group for -OH, -SH, and -NH(RH), respectively, and RH is selected from hydrogen and C1-6-alkyl; R2' and R4' together designate a biradical selected from -0-, -S, -N(R)-, -(CR'R'),_,-, -(CR'R')r-0-(CR'R')g-, - (CR'R' ) t -S- (CR'R' ) s- , -(CR'R'),- where each of R9 and Rh independently designates optionally substituted1-6C1-6-alkyl, optionally substituted C2_6-alkenyl, optionally substituted aryl, or optionally substituted heteroaryl). Pharmaceutically acceptable salts are, e.g., those described in Remington's Pharmaceutical Sciences, 17. Ed. Alfonso R. Gennaro (Ed.), Mack Publishing Company, Easton, PA, U.S.A., 1985 and more recent editions and in Encyclopedia of Pharmaceutical Technology. Thus, the term "an acid addition salt or a basic salt thereof" used herein is intended to comprise such salts. Furthermore, the oligomers and LNAs as well as any intermediates or starting materials therefor may also be present in hydrate form. Preparation of monomers In a preferred embodiment, nucleosides containing an additional 2 ' -O, 4 ' -C-linked ring were synthesised by the following procedure: Synthesis of a number of 4'-C-hydroxymethyl nucleosides have been reported earlier (R. D. Youssefyeh, J. P. H. Verheyden and J. G. Moffatt, J. Org. Chem., 1979, 44, 1301; G. H. Jones, M. Taniguchi, D. Tegg and J. G. Moffatt, J. Org. Chem., 1979, 44, 1309; C. O-Yang, H. Y. Wu, E. B. Fraser-Smith and K. A. M. Walker, Tetrahedron Lett., 1992, 33, 37; H. Thrane, J. Fensholdt, M. Regner and J. Wengel, Tetrahedron, 1995, 51, 10389; K. D. Nielsen, F. Kirpekar, P. Roepstorff and J. Wengel, Bioorg. Med. Chem., 1995, 3, 1493). For exemplification of synthesis of 2'-O,4'-C-linked bicyclic nucleosides we chose a strategy starting from 4'-C-hydroxymethyl furanose derivative 31. Benzylation, acetylation, and acetolysis followed by another acetylation afforded furanose 33, a key intermediate for nucleoside coupling. Stereoselective reaction with silylated thymine afforded compound 34 which was deacetylated to give nucleoside diol 35. Tosylation followed by base-induced ring closure afforded the 2'-O, 4'-C-linked bicyclic nucleoside derivative 36. Debenzylation yielded the unprotected bicyclic nucleoside analogue 37 which was transformed into the 5'-O-4,4'-dimethoxytrityl protected analogue 38 and subsequently into the phosphoramidite derivative 3 9 for oligonucleotide synthesis. A similar procedure has been used for synthesis of the corresponding uracil, adenine, cytosine and guanine nucleosides as exemplified in the example section. This coupling method is only one of several possible as will be apparent for a person skilled in the art. A strategy starting from a preformed nucleoside is also possible. Thus, for example, conversion of uridine derivative 62 to derivative 44 was successfully accomplished by tosylation, deisopropy-lidination and base-induced ring-closure. As another example, conversion of nucleoside 67 into nucleoside 61B has been accomplished as depicted in Scheme 11 (examples 64D-64I). Conversion of the bicyclic thymine nucleoside 37 into the corresponding 5-methyl-cytosine nucleoside 65 by known reaction type using triazole and P0C13 followed by treatment by ammonia. A similar procedure should be applicable for the synthesis of 57C from 44. As another example of possible strategies, coupling of precyclised furanose derivatives already containing an additional ring with nucleobase derivatives is possible. Such a strategy would in addition allow preparation of the corresponding a-nucleoside analogues. When coupling with a protected methyl furanoside of 4-C,2-Q-methylidine-D-ribofuranose, we obtained mainly a ringopened product. However, coupling of 1-0-acetylk furanose 207 or thiophenyl furanose 212 yielded success fully LNA nucleosides with the a-anomers as one product. Incorporation of such a-LNA nucleosides will be possible using the standard oligomerisation techniques (as for the LNA oligomers containing Z) yielding a-LNA oligomers. In addition, a synthetic strategy performing nucleoside coupling jsing a 4'-C-hydroxymethyl furanose already activated for ring closure (e.g. by containing a mesyl or tosyl group at the 4'-C-lydroxymethyl group), is possible as exemplified by conversion :>f furanose 78 to nucleotide 79 followed by deprotection and ring closure to give 36. Chemical or enzymatic trans-jlycosylation or anomerisation of appropriate furanose lerivatives or nuleosides are yet other possible synthetic strategies. These and other related strategies allow for synthesis of bicyclic nucleosides containing other nucleobases or analogues thereof by either coupling with these nucleobases or analogues, or starting from preformed nucleoside derivatives as in examples 62-64. The described examples are meant to be illustrative for the procedures and examples of this invention. The structures of the synthesised compounds were verified using ID or 2D NMR techniques, e.g. NOE experiments. An additional embodiment of the present invention is to provide bicyclic nucleosides containing additional rings of different sizes and of different chemical structures. From the methods described it is obvious for a person skilled in the art of organic synthesis that cyclisation of other nucleosides is possible using similar procedures, also of nucleosides containing different C-branches. Regarding rings of different chemical structures it is clear that using similar procedures or procedures well-established in the field of organic chemistry, synthesis of for example thio analogues of the exemplified oxo analogues is possible as is the synthesis of the corresponding amino analogues (using for example nucleophilic substitution reactions or reductive alkylations. In the example section, synthesis of the amino LNA analogues 72-74F are described. Conversion of 74, 74D and 76 into standard building blocks for oligomerisation was possible by 5'-0-DMT protection and 3'-O-phosphitylation following the standard procedures. For the amino LNA analogue, protection of the 2'-amino functionality is needed for oligomerisation. Such protection can be accomplished using standard amino group protection techniques like, e.g., Fmoc, trifluoroacetyl or BOC. Alternatively, the N-alkyl group (e.g. benzyl, methyl, ethyl, propyl or functionalized alkyl) can be kept on during nucleoside transformations and oligomerisation. In scheme 12 and 12A, strategies using N-trifluoroacetyl and N-methyl derivatives are shown. As outlined in Scheme 13 and in Examples 64N-1 to 64N-6, conversion of nucleoside 75 into the 2'-thio-LNA nucleoside analogue 76D has been successfully performed as tias the subsequent syntheses of the phosphoramidite derivative 76F. Compound 76F has the required structure for automated synthesis of 2'-thio-LNA oligonucleotides. The synthesis of the N-trifluoroacetyl 2'-amino-LNA synthon 74A has the required structure for automated synthesis of 2'-amino-LNA oligonucleotides. Preparation of oligomers Linear-, branched- (M. Grotli and B. S. Sproat, J. Chem. Soc, Chem. Commun., 1995, 495; R. H. E. Hudson and M. J. Damha, J. Am. Chem. Soc, 1993, 115, 2119; M. Von Buren, G. V. Petersen, K. Rasmussen, G. Brandenburg, J. Wengel and F. Kirpekar, Tetrahedron, 1995, 51, 8491) and circular- (G. Prakash and E. T. Kool, J. Am. Chem. Soc, 1992, 114, 3523) Oligo- and polynucleotides of the invention may be produced using the polymerisation techniques of nucleic acid chemistry well known to a person of ordinary skill in the art of organic chemistry. Phosphoramidite chemistry (S. L. Beaucage and R. P. Iyer, Tetrahedron, 1993, 49, 6123; S. L. Beaucage and R. P. Iyer, Tetrahedron, 1992, 48, 2223) was used, but e.g. H-phosphonate chemistry, phosphortriester chemistry or enzymatic synthesis could also be used. Generally, standard coupling conditions and the phosphoramidite approach was used, but for some monomers of the invention longer coupling time, and/or repeated couplings with fresh reagents, and/or use of more concentrated coupling reagents were used. As another possibility, activators more active than lH-tetrazole could also be used to increase the rate of the coupling reaction. An all-phosphorothioate LNA oligomer (Table 7) was synthesised using standard procedures. Thus, by exchanging the normal, e.g. iodine/pyridine/H20, oxidation used for synthesis of phosphordiester oligomers with an oxidation using Beaucage's reagent (commercially available), the phosphorthioate LNA oligomer was efficiently synthesised (stepwise coupling yields >= 98%). The 2'-amino-LNA and 2'methylamino-LNA oligonucleotides (Table 9) were efficiently synthesised (step-wise coupling yields > 98%) using amidites 74A and 74F as described above for LNA oligonucleotides. The 2'-thio-LNA oligonucleotides (Table 8) were efficiently synthesised using amidite 76F using the standard phosphoramidite procedures as described above for LNA oligonucleotides. After synthesis of the desired sequence, work up was done using standard conditions (cleavage from solid support and removal of protection groups using 30% ammonia for 55 °C for 5 h). Purification of LNA oligonucleotides was done using disposable reversed phase purification cartridges and/or reversed phase HPLC and/or precipitation from ethanol or butanol. Capillary gel electrophoresis, reversed phase HPLC and MALDI-MS was used to verify the purity of the synthesised oligonucleotide analogues, and to verify that the desired number of bicyclic nucleoside analogues of the invention were incorporated as contemplated. Synthesis of the corresponding cytosine, guanine, and adenine 2'-thio and 2'-amino LNA nucleosides can be accomplished using strategies analogous to those shown in Schemes 12, 12A and 13, Alternative, the stereochemisity around C-2' can be inverted before cyclisations either by using a conveniently configurated, e.g, an arabino-configurated, furanose synthon, or by inverting the configuration around C-2' carbon atom starting from a ribo-configurated nucleoside/furanose. Subsequent activation of the 2'~(3-OH, e.g. by tosylation, double nucleophilic substitution as in the urasil/thymine example described above, could furnish the desired bicyclic 21-thio-LNA or 2'-amino-LNA nucleosides. The thus obtained properly protected cytosine, guanine, and adenine analogues can be prepared for oligomerisation using the standard reactions (DMT-protection and phosphitylation) as described above for other examples. Applications In a preferred embodiment LNA modified oligonucleotides capable of performing "strand displacement" are exploited in the development of novel pharmaceutical drugs based on the "antigene" approach. In contrast to oligonucleotides capable of making triple helices, such "strand displacement" oligonucleotides allow any sequence in a dsDNA to be targeted and at physiological ionic strength and pH. The "strand displacing" oligonucleotides can also oe usea advantageous±y m the antisense approach in cases where the RNA target sequence is inaccessible due to intramolecular hydrogen bonds. Such intramolecular structures may occur in mRNAs and can cause significant problems when attempting to "shut down" the translation of the mRNA by the antisense approach. Other classes of cellular RNAs, like for instance tRNAs, rRNAs snRNAs and scRNAs, contain intramolecular structures that are important for their function. These classes of highly structured RNAs do not encode proteins but rather (in the form of RNA/protein particles) participate in a range of cellular functions such as mRNA splicing, polyadenylation, translation, editing, maintaining chromosome integrity, etc.. Due to their high degree of structure, that impairs or even prevent normal oligonucleotides from hybridising efficiently, these classes of RNAs has so far not attracted interest as antisense targets. The use of high affinity LNA monomers should facilitate the construction of antisense probes of sufficient thermostability to hybridise effectively to such target RNAs' Therefore, in a preferred embodiment, LNA is used to confer sufficient affinity to the oligonucleotide to allow it to hybridise to these RNA classes thereby modulating the qualitative and/or quantitative function of the particles in which the RNAs are found. The term "strand displacement" relates to a process whereby an oligonucleotide binds to its complementary target sequence in a double stranded DNA or RNA so as to displace the other strand from said target strand. Several diagnostic and molecular biology procedures have been developed that utilise panels of different oligonucleotides to simultaneously analyse a target nucleic acid for the presence of a plethora of possible mutations. Typically, the oligonucleotide panels are immobilised in a predetermined pattern on a solid support such that the presence of a particular mutation in the target nucleic acid can be revealed by the position on the solid support where it hybridises. One important prerequisite for the successful use of panels of different oligonucleotides in the analysis of nucleic acids is that they are all specific for their particular target sequence under the single applied hybridisation condition. Since the affinity of standard oligonucleotides for their complementary target sequences depend heavily on their sequence and size this criteria has been difficult to fulfil so far. Another important factor influencing the function of an oligonucleotide array is the affinity and specificity of the individual probes were high affinity facilitates high sensitivity of the assay and high specificity facilitates unambigous results. In a preferred embodiment, therefore, LNAs are used as a means to increase affinity and/or specificity of the probes and as a means to equalise the affinity of different oligonucleotides for their complementary sequences. As disclosed herein such affinity modulation can be accomplished by, e.g., replacing selected nucleosides in the oligonucleotide with an LNA carrying a similar nucleobase. As further shown herein, different classes of LNAs exhibit different affinities for their complementary nucleosides. For instance, the 2-3 bridged LNA with the T-nucleobase exhibits less affinity for the A-nucleoside than the corresponding 2-4 bridged LNA. Hence, the use of different classes of LNAs offers an additional level for fine-tuning the affinity of a oligonucleotide. In another preferred embodiment the high affinity and specificity of LNA modified oligonucleotides is exploited in the sequence specific capture and purification of natural or synthetic nucleic acids. In one aspect, the natural or synthetic nucleic acids are contacted with the LNA modified oligonucleotide immobilised on a solid surface. In this case lybridisation and capture occurs simultaneously. The captured lucleic acids may be, for instance, detected, characterised, juantified or amplified directly on the surface by a variety of methods well known in the art or it may be released from the surface, before such characterisation or amplification occurs, )y subjecting the immobilised, modified oligonucleotide and raptured nucleic acid to dehybridising conditions, such as for example heat or by using buffers of low ionic strength. The ;olid support may be chosen from a wide range of polymer materials such as for instance polypropylene, polystyrene, polycarbonate or polyethylene and it may take a variety of forms such as for instance a tube, a micro-titer plate, a bead, or a filter. The LNA modified oligonucleotide may be immobilised to the solid support via its 51 or 3' end (or via the terminus of linkers attached to the 5' or 3' end) by a variety of chemical or photochemical methods usually employed in the immobilisation of oligonucleotides or by non-covalent coupling such as for instance via binding of a biotinylated LNA modified oligo to immobilised streptavidin. One preferred method for immobilising LNA modified oligonucleotides on different solid supports is photochemical using a photochemically active anthraquinone covalently attached to the 5' or 3' end of the modified oligonucleotide (optionally via linkers) as described in (WO 96/31557) . In another aspect the LNA modified oligonucleotide carries a ligand covalently attached to either the 5' or 3' end. In this case the LNA modified oligonucleotide is contacted with the natural or synthetic nucleic acids in solution whereafter the hybrids formed are captured onto a solid support carrying molecules that can specifically bind the ligand. In still another aspect, LNA modified oligonucleotides capable of performing "strand displacement" are used in the capture of natural and synthetic nucleic acids without prior denaturation. Such modified oligonucleotides are particularly useful in cases where the target sequence is difficult or impossible to access by normal oligonucleotides due to the rapid formation of stable intramolecular structures. Examples of nucleic acids containing such structures are rRNA, tRNA, snRNA and scRNA. In another preferred embodiment, LNA modified oligonucleotides designed with the purpose of high specificity are used as primers in the sequencing of nucleic acids and as primers in any of the several well known amplification reactions, such as the PCR reaction. As shown herein, the design of the LNA modified oligonucleotides determines whether it will sustain a exponential or linear target amplification. The products of the amplification reaction can be analysed by a variety of methods applicable Co the analysis of amplification products generated with normal DNA primers. In the particular case where the LNA modified oligo primers are designed to sustain a linear amplification the resulting amplicons will carry single stranded ends that can be targeted by complementary probes without denaturation. Such ends could for instance be used to capture amplicons by other complementary LNA modified oligos attached to a solid surface. In recent years, novel classes of probes that can be used in for example real-time detection of amplicons generated by target amplification reactions have been invented. One such class of probes have been termed "Molecular Beacons". These probes are synthesised as partly self-complementary oligonucleotides containing a fluorophor at one end and a quencher molecule at the other end. When free in solution the probe folds up into a hairpin structure (guided by the self-complimentary regions) which positions the quencher in sufficient closeness to the fluorophor to quench its fluorescent signal. Upon hybridisation to its target nucleic acid, the hairpin opens thereby separating the fluorophor and quencher and giving off a fluorescent signal. Another class of probes have been termed "Tagman probes". These probes also contain a fluorophor and a quencher molecule. Contrary to the Molecular Beacons, however, the quenchers ability to quench the fluorescent signal from the fluorophor is maintained after hybridisation of the probe to its target sequence. Instead, the fluorescent signal is generated after hybridisation by physical detachment of either the quencher or fluorophor from the probe by the action of the 5'exonuxlease activity of a polymerase which has initiated synthesis from a primer located 5' to the binding site of the Tagman probe. High affinity for the target site is an important feature in both types of probes and consequently such probes tends to be fairly large (typically 30 to 40 mers). As a result, significant problems are encountered in the production ofA high quality probes. In a preferred embodiment, therefore, LNA is used to improve production and subsequent performance of Tagman probes and Molecular Beacons by reducing their size whilst retaining the required affinity . In a preferred embodiment LNAs are used to construct new affinity pairs (either fully or partially modified oligonucleotides). The affinity constants can easily be adjusted over a wide range, a vast number of affinity pairs can be designed and synthesised. One part of the affinity pair can be attached to the molecule of interest (e'g. proteins, amplicons, enzymes, polysaccharides, antibodies, haptens, peptides, PNA, etc.) by standard methods, while the other part of the affinity pair can be attached to e.g. a solid support such as beads, membranes, micro-titer plates, tubes, etc. The solid support may be chosen from a wide range of polymer materials such as for instance polypropylene, polystyrene, polycarbonate or polyethylene. The affinity pairs may be use in selective isolation, purification, capture and detection of a diversity of the target molecules mentioned above. The principle of capturing an LNA-tagged molecule by ways of interaction with another complementary LNA oligo (either fully or partially modified) can be used to create an infinite niomber of novel affinity pairs. In another preferred embodiment the high affinity and specificity of LNA modified oligos are exploited in the construction of probes useful in in-situ hybridisation. For instance, LNA could be used to reduce the size of traditional DNA probes whilst maintaining the required affinity thereby increasing the kinetics of the probe. The ability of LNA modified oligos to "strand invade" double stranded nucleic acid structures are also of considerable advantage in in-situ hybridisation. In another preferred embodiment, LNA modified oligonucleotides to be used in antisense therapeutics are designed with the dual purpose of high affinity and ability to recruit RNAseH. This can be achieved by, for instance, having LNA segments flanking an unmodified central DNA segment. An additional embodiment of the present invention is to furnish procedures for oligonucleotide analogues containing LNA linked by non-natural internucleoside linkages. For example, synthesis of the corresponding phosphorothioate or phosphoramidate analogues is possible using strategies well-established in the field of oligonucleotide chemistry (Protocols for Oligonucleotides and Analogs, vol 20, (Sudhir Agrawal, ed.), Humana Press, 1993, Totowa, NJ; S. L. Beaucage and R. P. Iyer, Tetrahedron, 1993, 49, 6123; S. L. Beaucage and R. P. Iyer, Tetrahedron, 1992, 48, 2223; E. Uhlmann and A. Peyman, Chem. Rev., 90, 543). The present invention also provides the use of LNA modified oligonucleotides in nucleic acid based therapeutic, diagnostics and molecular biology. The LNA modified oligonucleotides can be used in the detection, identification, capture, characterisation, quantification and fragmentation of natural or synthetic nucleic acids, and as blocking agents for translation and transcription in vivo and in vitro. In many cases it will be of interest to attach various molecules to LNA modified oligonucleotides. Such molecules may be attached to either end of the oligonucleotide or they may be attached at one or more internal positions. Alternatively, they may be attached to the oligonucleotide via spacers attached to the 5' or 3' end. Representative groups of such molecules are DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands. Generally all methods for labelling unmodified DNA and RNA oligonucleotides with these molecules can also be used to label LNA modified oligonucleotides. Likewise, all methods used for detecting labelled oligonucleotides generally apply to the corresponding labelled, LNA modified oligonucleotides. EXPERIMENTAL General All reagents were obtained from commercial suppliers and were used without further purification. After drying any organic phase using Na2S04/ filtration was performed. The silica gel (0.040-0.063 mm) used for column chromatography was purchased from Merck. NMR spectra were recorded at 300 MHz or 250 MHz for !H NMR and 62.9 MHz for 13C NMR and at 202.33 MHz for J1P NMR. 8- Values are in ppm relative to tetramethylsilane as internal standard (aH NMR and 13C NMR) and relative to 85% H3P04 as external standard (J1P NMR) . Assignments of NMR peaks are given according to standard nucleoside nomenclature. EI mass spectra, FAB mass spectra and Plasma Desorption mass spectra were recorded to gain information on the molecular weight of synthesized compounds. Oligonucleotide analogues were synthesised using the phosphoramidite methodology. Purification of 5'-0-DMT-ON or 5'-O-DMT-OFF oligonucleotide analogues was accomplished using disposable reversed phase chromatography cartridges or reversed phase HPLC. Matrix-assisted laser desorption mass spectra were obtained to verify the molecular weight and monomer composition of representative oligonucleotide samples. Capillary gel electrophoresis was performed to verify the purity of selected oligonucleotide samples. The specific descriptions below are accompanied by Schemes 1-18, Figure 2-22, and Tables 1-8. Example 1 3-C-Allyl-l,2-0-isopropylidene-a-I?-ribofuranose (0A) . Method 1: A solution of 5-O-t-butyldimethylsilyl-l,2-O-isopropylidene- α-U-ribofuran-3-ulose (Y. Yoshimura, T. Sano, A. Matsuda and T. Ueda, Chem. Pharm. Bull., 1988, 36, 162) (17.8 g, 58.9 mmol) in anhydrous THF (980 cm3) was stirred at 0 °C and 1 M allylmagnesium bromide in anhydrous ether (13 0 cm3, 13 0 mmol) was added dropwise. After stirring for 2 h, a saturated aqueous solution of ammonium chloride (800 cm3) was added and the mixture was extracted with dichloromethane (3 x 400 cm3) . The organic phase was washed with brine (3 x 450 cmJ) and dried (Na2S04) • The solvent was removed under reduced pressure and the residue was dissolved in anhydrous THF (700 cmJ) . A 1.1 M solution of tetrabutylammonium fluoride in THF (54.4 cm3, 59.8 mmol) was added and the mixture was stirred at room temperature for 1 h and evaporated to dryness. The residue was dissolved in dichloromethane (1700 cm3) and was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 500 cm3) and dried (Na2S04). The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give furanose 0A as a white solid material (9.42 g, 69%). Method 2: Furanose 0A was analogously synthesized from 5- O-t-butyldiphenylsilyl-1,2-0-isopropylidene-a-D-ribofuran-3- ulose (T. F. Tarn and B. Fraser-Reid, J. Chem. Soc, Chem. Commun., 1980, 556) (9.5 g, 22.2 mmol) using: anhydrous THF (425 cm3) ; a 1 M solution of allylmagnesium bromide in anhydrous ether (130 cm3, 130 mmol); a saturated aqueous solution of ammonium chloride (490 cm3) ; ether for extraction (350 + 2 x 160 cm3); brine (2 x 160 cm3); a 1.1 M solution of tetrabutylammonium fluoride in THF (22.3 cm3, 24.6 mmol); anhydrous THF (400 cm3) ; dichloromethane (1400 cm3) ; a saturated aqueous solution of sodium hydrogencarbonate (3 x 500 cm3) ; brine (500 cm3) and (Na2S04) . SH ( (CD3)2SO) 5.84 (1 H, m, 2' -H) , 5.65 (1 H, d, J 3.8, 1-H), 5.12 (1H, d, J 6.1, 3'-HJ, 5.06 (1H, br s, 3'-Hb), 4.76 (1H, s, 3-OH) , 4.64 (1H, t, J 5.4, 5-OH) , 4.16 (1 H, d, J 3.8, 2-H) , 3.84 14.3, l'-Hb), 1.46 (3 H, s, CH3) , 1.25- (3 H, s, CH3) . Sc (CDC13) 133.5 (C-21), 117.9 (C-3'), 110.8 (C(CH3)2), 102.9 (C-l) , 82.6, 81.0, 77.7 (C-2, C-3, C-4), 59.4 (C-5), 36.4 (C-l1)/ 26.4, 26.3 (CH3) (Found: C, 57.4; H, 8.0; CnHie05 requires C, 57.4; H, 7.9%) . Example 2 3-C-Allyl-3?, 5-di-0-benzyl-l,2-0-isopropylidene- v/v) as eluent to give compound 0B as an oil (14.5 g, 86%). 5H (CDC13) 7.39-7.21 (10H, m, Bn), 5.92 (1 H, m, 2'-H), 5.71 (1 H, d, J 3.8, 1-H) , 5.17-5.09 (2 H, m, 3'-Ha, 3 ' -Hb) , 4.67 (2 H, m, Bn), 4.60 (1 H, d, J 12.2, Bn), 4.52 (1H, d, J 12.1, Bn), 4.43 (1 H, m, 4-H), 4.42 (1 H, d, J 3.8, 2-H), 3.73 (1 H, dd, J 3.2, 10.8, 5-HJ, 3.66 (1 H, dd, J" 7.4, 10.8, 5-Hb) , 2.50 (1 H, dd, J 7.7, 14.9, l'-HJ, 2.39 (1H, dd, J 6.5, 14.9, 1' -Hb) , 1.60 (3 H, s, CH3), 1.34 (3 H, s, CH3) . 5C (CDC13) 138.7, 138.1 (Bn) , 132.6 (C-21), 128.3, 128.2, 127.7, 127.5, 127.4, 127.4 (Bn), 118.5 (C-3'), 112.6 (C(CH,)a), 104.1 (C-l), 86.5, 82.1, 80.4 (C-2, C-3, C-4), 73.4, 68.6 (Bn), 67.0 (C-5), 35.8 (C-l1), 26.8, 26.6 (CH3) . FAB-MS m/z 433 [M+Na]+ (Found: C, 73.4; H, 7.4; C25HJ0O5 requires C, 73.2; H, 7.4%). Example 3 S-C-Allyl-l1-6-di-O-acetyl-S1-6S-di-O-benzyl-JD-ribofuranose (0C) . A solution of furanose 0B (12.42 g, 3 0.3 mmol) in 80% aqueous acetic acid (150 cm3) was stirred at 90 °C for 3 h. The solvent was removed under reduced pressure and the residue was coevaporated with ethanol (3 x 75 cm3) , toluene (3 x 75 cm3) and anhydrous pyridine (2 x 75 cm3) and redissolved in anhydrous pyridine (60 cm3) . Acetic anhydride (46 cm3) was added and the solution was stirred at room temperature for 48 h. A mixture of ice and water (300 cm3) was added and the resulting mixture was extracted with dichloromethane (2 x 300 cm3) . The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 200 cmJ) and dried (Na2S04) . The solvent was evaporated and the residue was purified using silica gel column chromatography with petroleum ether/ethyl acetate (4:1, v/v) as eluent to give the anomeric mixture 0C ((3:0C - 2:1) as an oil (13.3 g, 97%) . Sc (CDC13) 169.7, 169.6 (C=0), 138.7, 138.4, 137.7, 137.6 (Bn), 132.4, 132.2 (C-2 ' ), 128.4 128.4, 128.2, 128.2, 127.8, 127.7, 127.7, 127.6, 127.3, 127.3, 126.9, 126.8 (Bn), 118.5 (C-3'), 99.4, 93.5 (C-l), 84.8, 83.7, 83.2, 82.0, 79.1, 75.5 (C-2, C-3, C-4), 73.7, 73.5, 69.3, 68.7 (Bn), 66.1 (C-5), 35.5, 34.9 (C-l), 21.1, 21.0, 20.7, 20.6 (CH3) (Found: C, 68.7; H, 6.7; C26H30O7 requires C, 68.8; H, 6.6%). Example 4 l-(2-0-Acetyl-3-C-allyl-3/5-di-0-benzyl-β-D ribofuranosyl)thymine (1). To a stirred solution of the anomeric mixture 0C (p:a - 2:1, 11.8 g, 26.0 mmol) (P. Nielsen, H. M. Pfundheller and J. Wengel, Chem. Commun., 1997, 825; P. Nielsen, H. M. Pfundheller, C. E. Olsen and J. Wengel, J. Chem. Soc, Perkixx Trans. 1, 1997, in the press) and thymine (6.55 g, 52.0 mmol) in anhydrous acetonitrile (250 cm3) was added NfO-bis (trimethylsilyDacetamide (44.9 cm3, 182 mmol) . The reaction mixture was stirred at reflux for 1 h and cooled to 0 °C. Trimethylsilyl triflate (8.00 cm3, 44.0 mmol) was added dropwise and the solution was stirred at room temperature for 12 h. An ice-cold saturated aqueous solution of sodium hydrogencarbonate (270 cm3) was added and the mixture was extracted with dichloromethane (3 x 125 cm3) . The organic phase was washed with saturated aqueous solutions of sodium hydrogencarbonate (2 x 125 cm3) and brine (2 x 125 cm3) and dried (Na2S04). The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give nucleoside 1 as a white solid material (11.6 g, 86%) . 0H (CDC13) 8.64 (1 H, br s, NH) , 7.75 (1 H, d, J 1.1, 6-H) , 7.41-7.25 (10 H, m, Bn) , 6.43 (1 H, d, J 8.2, l'-H), 5.88 (1H, m, 2' '-H) / 5.66 (1 H, d, J" 8.2, 2'-H) , 5.12 (1 H, s, 3 ' '-H ) , 5.07 (1 H, dd, J 1.5, 8.5, 3' '-H„) , 4.85 (1 H, d, J 11.2, Bn) , i 4.64 (2 H, s, Bn) , 4.63 (1 H, d, J 11.2, Bn) , 4.33 (1 H, br s, 4'-H), 3.81 (1 H, dd, J 2.7, 11.1, 5'-HJ, 3.65 (1 H, m, 5' -Hb) , 2.81-2.65 (2 H, m, l'-Ha, 1 ' ' -Hb) , 2.08 (3 H, s, COCH3) , 1.52 (3 H, d, J 0.8, CH3) . 8C (CDC13) 170.1 (C=0), 163.6 (C-4), 150.9 (C-2), 138.1, 136.6 (Bn), 136.0 (C-6), 131.6 (C-2'), 128.8, 128.4, 128.3, 127.6, 127.5, 127.1 (Bn), 118.5 (C-3'), 111.1 (C-5), 84.2, 83.4, 83.1, 77.4 (C-l, C-2', C-3', C-41), 73.6, 69.2 (Bn), 65.6 (C-51), 33.7 (C-l'), 20.8 (COCH3) , 11.9 (CH3) (Found: C, 66.8; H, 6.3; N, 5.1. C29H32N207 requires C, 66.9; H, 6.2; N, 5.4%). Example 5 l-(3-C-Allyl-3,5-di-0-benzyl-P-Z?-ribofuranosyl)thymine (2). To a stirred solution of nucleoside 1 (11.6 g, 22.3 mmol) in methanol (110 cm3) was added sodium methoxide (3.03 g, 55,5 mmol). The reaction mixture was stirred at room temperature for 16 h and neutralized with dilute hydrochloric acid. The solvent was partly evaporated and the residue was dissolved in dichloromethane (2 x 400 cm3) . The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 250 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure to give 2 as a white solid material (10.1 g, 95%). SH (CDC13) 8.77 (1 H, br s , NH) , 7.58 (1 H , d, J 1.2, 6- H), 7.41-7.25 (10 H, m, Bn), 6.14 (1H, m, 2'-H), 6.12 (1 H, d, J" 7.8, l'-H) , 5.23 (1 H, m, 3' ' -Ha) , 5.17 (1 H, br s, 3 ' '-Hb) , 4.68 (1 H, d, J 10.8, Bn), 4.59 (2 H, s, Bn), 4.55 (1 H, d, J 10.9, Bn), 4.39 (1 H, br s, 4'-H), 4.26 (1 H, dd J 7.8, 10.7, 2'-H), 3.84 (1 H, dd, J 3.1, 11.0, 5'-HJ, 3.58 (1H, dd, J 1.4, 11.0, 5'-Hb), 3.04 (1 H, d, J 10.8, 2'-OH), 2.82-2.78 (2 H, m, l'-Ha, l'-Hb), 1.51 (3 H, d, J 1.0, CH3) . Sc (CDC13) 163.5 (C-4), 151.1 (C-2), 137.3, 136.7 (Bn), 136.0 (C-6), 132.1 (C-2'), 128.8, 128.5, 128.3, 127.9, 127.6 (Bn), 118.4 (C-31'), 111.1 (C-5), 87.4, 82.6, 81.1, 79.3 (C-l', C-2', C-3', C-4'), 73.7, 69.8 (Bn), 64.7 (C-51), 35.1 (C-l'), 11.9 (CH,) . (Found: C, 67.8; H, 6.1; N, 5.5. C27HJ0N2O6 requires C, 67.8; H, 6.3; N, 5.9%). Example 6 l-(3-C-Allyl-3,5-di-0-benzyl-2-O-methylsulfonyl-β-D- ribofuranosyl)thymine (3). To a stirred solution of nucleoside 2 (3.50 g, 7.31 mmol) in anhydrous pyridine (23 cm3) at 0 °C was added methylsulphonyl chloride (1.69 cm3, 21.89 mmol). The reaction mixture was stirred for 1 h at room temperature, water (100 cm3) was added and extraction was performed using dichloromethane (3 x 150 cm3) . The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 2 00 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue purified by silica gel column chromatography using dichloromethane/methanol (99:1) as eluent to give 3 as a white solid material (3.64 g, 89%) . 8H (CDC13) 8.95 (1 H, br s , NH) , 7.71 (1 H , d, J 1.1, 6-H) , 7.39-7.25 (10 H, m, Bn), 6.52 (1 H, d, J 8.0, l'-H), 5.90 (1H, m, 2'-H), 5.34 (1 H, d, J- 7.9, 2'-H), 5,20-5.09 (2 H, m, 3 ' '-Ha, 3 ' ' -Hb) , 4.91 (1 H, d, J 11.2, Bn), 4.68 (1 H, d, J 11.3, Bn), 4.64 (2 H, s, Bn), 4.33 (1 H, br s, 4'-H), 3.81 (1 H, dd, J 2.5, 11.1, 5'-Hj, 3.73 (1 H, dd, J 1.1, 11.1, 5' -Hb) , 3.08 (1H, dd, J 5.5, 5.7, l-'-HJ, 2.99 (3 H, s, CH3) , 2.68 (1 H, m, 1 ' -Hb) , 1.51 (3 H, d, J 0.8, CH3) . 8C (CDC13) 163.4 (C-4) , 150.8 (C-2), 137.9, 136.3 (Bn), 135.5 (C-6), 131.0 (C-2'1), 128.8, 128.3, 127.5, 127.2 (Bn), 119.3 (C-3'■), 111.6 (C-5), 84.1, 83.6, 82.4, 82.2 (C-l', C-2', C-3', C-4«), 73.7, 68.9 (Bn), 66.2 (C-5'), 38.7 (CH3), 33.0 (C-l1'), 11.9 (CH3) (Found: C, 60.5; H, 5.8; N, 4.9. C28H32N208S requires C, 60.4; H, 5.8; N, 5.0%). Example 7 l-O-C-Allyl-S/S-di-O-benzyl-β-D-arabinofuranosyDthymine (4) . A solution of nucleoside 3 (3.59 g, 6.45 mmol) in ethanol (72 cm3), water (72 cm3) and 1 M aqueous sodium hydroxide (20.6 cm3) was stirred under reflux for 18 h. After neutralization with dilute hydrochloric acid, the solvent was removed under reduced pressure and the residue was dissolved in dichloromethane (3 x 150 cm3). The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 200 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give 4 as a white solid material (2.32 g, 74%). SH (CDC13) 7.60 (1 H , d, J" 1.2, 6-H) , 7.50-7.23 (10 H, m, Bn), 6.22 (1 H, d, J 2.9, 1'-H), 5.80 (1H, m, 2,,-H)/ 5.15-5.08 (2 H, m, 3'-Ha, 3 ' '-Hb) , 4.86-4.33 (6 H, m, 2 x Bn, 2'-H, 4'-H) , 3.82-3.71 (2 H, m, 5'-Ha, 5'-Hb), 2.72 (1 H, m, l'-Ha), 2.52 (1 H, dd, J7.6, 16.1, 1'- Hb) , 1.70 (3 H, d, J" 0.9, CH3) . 1-6(CDCl,) 165.1 (C-4) , 150.4 (C-2), 138.4, 136.8 (Bn), 137.7 (C-6), 132.3 (C-2'), 128.77 128.4, 128.3, 128.0, 127.9, 127.6 (Bn), 118.5, (C-3'), 107.8 (C-5), 88.0, 87.8, 83.7 (C-l', C-3 ' , C-4'), 73.7, 72.9, 69.4 (Bn, C-2'), 64.7 (C-5'), 31.1 (C-l ' ' ) , 12.4 (CH3) (Found: C, 67.5; H, 6.3; N, 5.3. C27H30N2O6,0.25H20 requires C, 67.1; H, 6.4; N, 5.8%) . Example 8 1-(3,5-Di-0-benzyl-3-C- (2-hydroxyethyl) -β-D-arabino- furanosyl)thymine (5). To a stirred solution of nucleoside 4 (2.26 g, 4.68 mmol) in THF (12 cm3) and water (12 cm3) was added sodium periodate (3,04 g, 14.2 mmol) and a 2,5% solution of osmium tetraoxide in tert-butanol (w/w, 0.603 cm3, 40 (Jmol) . The solution was stirred at room temperature for 45 min. Water (25 cm3) was added and the solution was extracted with dichloromethane (2 x 50 cm3) . The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 30 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was redissolved in THF (12 cm3) and water (12 cm3) . The mixture was stirred at room temperature and sodium boronhydride (182 mg, 4.71 mmol) was added. After stirring for 1.5 h, water (25 cm3) was added and the solution was extracted with dichloromethane (2 x 50 cm3) . The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3x30 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give 5 as a white solid material (1.13 g, 49%), NH), 7.47 (1 H , d, J 1.1, 6-H), 7.38-7.25 (10 H, m, Bn) , 6.22 (1 H, d, J 3.4, l'-H), 4.62 (2 H, s, Bn) , 4.60 (1 H, m, 4'-H), 4.46 (2 H, s, Bn) , 4.35 (1H, dd, J 3.4, 7.5, 2'-H), 3.83-3.73 (4 H, m, 2 x 5'-H, 2 x 2'-H), 2.67 (1 H, br s, OH), 2.07-2.01 (2 H, m, 2 x. I1 '-H) , 1.77 (3 H, d, J" 0.5, CH3) . Sc (CDCIJ 164.3 (C-4), 150.3 (C-2), 137.6, 137.4 (Bn, C-6), 136.7 (Bn) , 128.6, 128.4, 128.2, 127.8, 127.6, 127.3, 127.1 (Bn), 108.4 (C-5), 88.0, 87.7, 81.6, 74.7 (C-l, C-2•, C-3', C-4'), 73.7, 69.6 (Bn), 64.6 (C-51), 57.7 (C-2"), 28.6 (C-l'), 12.4 (CH3) . FAB-MS m/z 483 [M+H], 505 [M+Na]+ (Found: C, 63.6; H, 6.2; N, 5.4. C26H30N2O7,0.5H2O requires C, 63.5; H 6.4; N, 5.7%). Example 9 (25, 5R, 6R, 8R) -5-Hydroxy-6- (hydroxymethyl) -8- (thymin-1-yl) -2,7-dioxabicyclo[3.3.0]octane (6). A solution of nucleoside 5 (1.08 g, 2.20 mmol) in anhydrous pyridine (5.0 cm3) was stirred at 0 °C and a solution of p-toluenesulphonyl chloride (462 mg, 2.47 mmol) in anhydrous pyridine (2.0 cm3) was added dropwise. After stirring at room temperature for 20 h and addition of a mixture of water and ice (70 cm3) , extraction was performed with dichloromethane (2 x 75 cm3) . The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 50 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give an intermediate which after evaporation was dissolved in anhydrous DMF (4,0 cm3). The solution was added dropwise to a stirred suspension of 60% sodium hydride (203 mg, 4.94 mmol) in anhydrous DMF (4.0 cm3) at 0 °C. The mixture was stirred for 18 h and water (20 cm3) was added. After neutralisation with hydrochloric acid, dichloromethane (75 cm3) was added. The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 50 cm3) and dried ethanol (10.0 cm3} was stirred at room temperature and 20% palladium hydroxide over carbon (400 mg) was added. The mixture was degassed with argon and placed in a hydrogen atmosphere. After stirring for 2 h the mixture was directly purified by silica gel column chromatography using dichloromethane/methanol (97:3, v/v) as eluent to give 6 as a white solid material (444 mg, 82%). 5H ((CD,)2SO) 11.3 (1 H, br s, NH) , 7.36 (1 H, d, J 1.1, 6-H), 5.80 (1 H, d, J 4.3, l'-H), 5.61 (1 H, s, OH), 4.86 (1 H, m, 5'-HJ , 3.89 (1 H, d, J 4.2, 2'-H), 3.85 (1 H, m, 2' '-. Ha), 3.83-3.64 (3 H, m, 4'-H, 5' -Hb, 2 ' '-Hb) , 2.14 (1 H, m, 1'- HJ, 1.81 (1 H, m, l'-Hb), 1.78 (3 H, d, J 1.0, CH3) . 8C (CD3OD) 166.7 (C-4), 152.2 (C-2), 139.7 (C-6), 110.1 (C-5), 89.4, 89.1, 85.5, 85.2 (C-l1, C-2', C-3', C-4')/ 71.4 (C-21'), 61.6 (C-51), 37.0 (C-l11), 12.7 (CH3) (Found: C, 47.4; H, 5.7; N, 9.0. C12H16N206,H20 requires C, 47.7; H, 6.0; N, 9.3%). Example 10 (IS, 5R, 6Rr 8R) -6- (4,4' -Dimethoxytrityloxymethyl) -5-hydroxy-8-(thymin-l-yl)-2,7-dioxabicyclo[3.3.0]nonane (7). A solution of nucleoside 6 (310 mg, 1.09 mmol) in anhydrous pyridine (2.5 cm3) was stirred at room temperature and 4,4•-dimethoxytrityl chloride (593 mg, 1.83 mmol) was added. After stirring for 3 h, additional 4,4'-dimethoxytrityl chloride (100 mg, 0.310 mmol) was added. After stirring for another 2 h, methanol (0.5 cm3) was added and the mixture was evaporated. The residue was dissolved in dichloromethane (5 cm3) and washed with an aqueous saturated solution of sodium hydrogencarbonate (3x5 cm3) . The organic phase was dried (Na2S04) and evaporated under reduced pressure. The residue was purified by silica gel column chromatography with dichloromethane/methanol (99:1, v/v) as eluent to give 7 as a white solid material (618 mg, 97%) . (CDCI3) 9.04 (1 H, br s, NH), 7.47-7.16 (10 H, m, 6-H, DMT), 6.86-6.82 (4 H, m, DMT), 6.06 (1 H, d, J 4.1, l'-H), 4.35 (1 H, d, J 4.1, 2'-H), 4.03 (1 H, m, 4'-H), 3.89 (1 H, m, 2' '-HJ , 3.79 (6 H, s, 2 x OCH3) , 3.61 (1 H, m, 5!-Ha), 3.32-3.26 (2H, m, 5'-Hb, 2,,-Hb), 1.94-1.69 (2 H, m, l'-Ha/ l'-Hb,), 1.89 (3 H, s, CK3) . Sc (CDC13) 163.4 (C-4), 158.6 (DMT), 150.1 (C-2), 144.3 (DMT), 137.2. (C-6), 135.6, 135.3, 129.9, 129.9, 128.9, 126.1, 127.9, 126.9, 125.2, 113.2 (DMT), 109.3 (C-5), 88.7, 87.3, 86.9, 83.5, .,81.0 (DMT, C-l , 02 ' , C-3 ! , C-41), 69.7 (C-2'1), 62.1 (C-5'), 55.1 (OCH3), 36.5 (C-l'), 12.5 (CH3) . Example 11 (IS, 5R, 6R, 8R) -5- (2-Cyanoethoxy{diisopropylamiixo)phosphinoxy) -6-(4,4 ■ -dimethoxytrityloxymethyl) -8-(thymin-l-yl) -2,7- dioxabicyclo[3»3.0]nonane (8). A solution of nucleoside 7 (436 mg, 0.743 mmol) in anhydrous dichloromethane (2.2 cm3) and diisopropylethylamine (0.62 cm3) was stirred at room temperature and 2-cyamoethyl N,W-diisopropylphosphoramido-chloridite (0.33 cm3, 1.46 mmol) was added. After stirring for 1.5 h, methanol (0.4 cm3) and ethyl acetate (5 cm3) were added and the mixture was washed with aqueous saturated solutions of sodium hydrogencarbonate (3x5 cm3) and brine (3x5 cm3) . The organic phase was dried (Na2S04) and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/triethylamine (97:3, v/v) as eluent, the solvents were evaporated to give an oil which was dissolved in toluene (1 cm3) and precipitation from hexane at -30 °C to give 8 as a solid white material (517 mg, 88%) . 8P (CDCI3) 142.0, 141.9. Example 12 1-(3,5-Di-0-benzyl-3-C- (2-hydroxyethyl)-p-D-ribofuranosyl)- thymine (9). To a stirred solution of nucleoside 2 (1.00 g, 2.09 mmol) in THF (5.4 cm3) and water (5.4 cm3) was added sodium periodate (1.34 g, 6.27 mmol) and a 2.5% solution of osmium tetraoxide in tert-butanol (w/w, 0.265 cm3, 19 fimol) . The solution was stirred at room temperature for 45 min. Water (25 cm3) was added and the solution was extracted with dichloromethane (2 x 50 cm3) . The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 3 0 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was redissolved in THF (5.4 cmJ) and water (5.4 cm3) . The mixture was stirred at room temperature and sodium boronhydride (79 mg, 2.08 mmol) was added. After stirring for 1.5 h, water (25 cm3) was added and the solution was extracted with dichloromethane (2 x 50 cm3) . The organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3x30 cm3) and dried (Na2SOJ . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give nucleoside 9 as a white solid material (488 mg, 48%) . 9.14 (1 H, br s , NH) , 7.60 (1 H , d, J" 1.1, 6-H) , 7.40-7.22 (10 H, m, Bn), 6.25 (1 H, d, J 7.7, 1'-H), 4.59 (1 H, d, J 7.1 Bn) , 4.49 (1 H, d, J 7.1 Bn) , 4.39-3.30 (m, 8H, 4'-H, 2 ' -H, Bn, 5'-Ha, 5'-Hb, 2'-Ha, 2'-Hb), 2.23-2.00 (2 H, m, 1 ' ' -Ha, 1 ' '-Hb) , 1.49 (3 H, d, J" 0.7, CH3) . Sc (CDC13) 163.5 (C-4), 151.2 (C-2), 137.1, 136.5 (Bn), 135.7 (C-6), 128.7, 128.5, 128.2, 127.8, 127.6, 127.2 (Bn), 111.3 (C-5), 87.0, 82.7, 81.1, 78.3 (C-1',C-2', C-3', C-4'), 73.7, 69.6 (Bn), 64.4 (C-51), 57.0 (C-2'), 32.4 (C-l'1), 11.8 (CH3) (Found: C, 63.9; H, 6.3; N, 5.4. C2(,H30N2O7,0.25H2O requires C, 64.1; H 6.3; N, 5.75%). Example 13 l-[3-C-(2-0-t-Butyldimethylsilyloxyethyl)-3,5-di-0-benzyl-p-D- ribofuranosyl]thymine (10). A mixture of nucleoside 9 (1.80 g, 3.4 mmol) and t-butyldimethylsilyl chloride (0.585 g, 3.9 mmol) was dissolved in anhydrous pyridine (20 cm3) . After 2 h at room temperature the reaction mixture was evaporated to dryness, twice co-evaporated with toluene (2 x 10 cm3) and re-dissolved in dichloromethane (150 cm3) . The solution was washed with a saturated aqueous solution of sodium hydrocarbonate (2 x 50 cm3) and evaporated to give a foam. This material was purified by preparative silica-gel HPLC using gradient elution (0-3% methanol in dichloromethane, v/v) to give nucleoside 10 as a white solid material (1.86 g, 92%). 8H (CDC13) 7.61 (1H, d, J 1.1, 6-H), 7.35-7.20 (10H, m, Bn), 6.27 (1H, d, J 1.9, l'-H), 4.65-4.40 (4H, m, Bn, 2'-H), 4.37 (1H, s, Bn), 4.28 (1H, t, J 7.9, 4'-H), 4.35 - 3.55 (4H, m, 2 ' ' -Ha, 2 ' ' -Hb, 5 ' -Ha, 5 ' -Hb) , 2.30-2.05 (2H, m, l'-Ha, 1 ■ ' -Hb) , 1.46 (3H, s, 5-CH3) , 0.90 (9H, m, CHrC-Si) , 0.08 (6H, m, CH3-Si). 8C (CDC13) 163.6 (C-6), 151.0 (C-2), 137.5, 136.6, 135.8 (C-5, Bn), 128.3, 128.1, 127.8, 127.2, 127.1, 126.8, 126.7 (Bn), 110.7 (C-4), 86.8, 82.5, 81.6, 78.3 (C-l1, C-2', C-3', C-4'), 73.3, 69.8 (Bn), 64.46 (C-5'), 58.2 (C-2"), 32.9 (C-l"), 25.6, 25.4, 17.9, -3.9, -5.7 (TBDMS), 11.6 (CH3) . FAB'-MS: m/z 597.19 [M+H]% 619.18 [M+Na]' (Found: C, 64.2; H, 7.4; N, 4.2; CJ2H4407N2Si requires C, 64.4; H, 7.4; N, 4.7%). Example 14 l-[3-C-(2-t-Butyldimethylsilyloxyethyl)-3,5-di-0-benzyl-p-D- eryfchro-pentofuran-2-ulosyl]thymine (11) . A mixture nucleoside 10 (2.14 g, 3.59 mmol), 1.48 g (3.95 mmol) of pyridimium dichromate (1.48 g, 3.95) and activated 3A molecular sieves powder (4g) was suspended in anhydrous dichloromethane (80 cm3) . After cooling the mixture to -10 °C, acetic anhydride (10 cm3, 98 mmol) was added dropwise under vigorous stirring. The suspension was allowed to warm to room temperature and stirring was continued for 1.5 h whereupon the reaction was quenched by addition of triethylamine (20 cm3) . The mixture was diluted with dichloromethane to 3 00 cm3 and was washed with water (2 x 2 00 cm3) . The organic phase was evaporated, and the residue purified by flash silica-gel chromatography using a gradient of 1.0, 1.2, 1.3, 1.4, 1.5% methanol in dichloromethane (v/v, total volume 250 cm3 each) to give nucleoside 11 (1.89 g, 84.4%) as a white solid material. 8H (CDC13) 7.35-7.20 (11H, m, Bn, 6-H) , 6.40 (1H, s, l'-H), 4.57 (1H, s, Bn) , 4.52 (1H, s, Bn) , 4.46 (1H, d, J" 11.0, Bn) , 4.29 (1H, d, J 11.0, Bn) , 4.07 (1H, dd, J' 0.5, 2.2, 4'-H), 3.95-3.70 (4H, m, 2'-Ha, 2'-Hb, 5'-Ha, 5'-Hb), 2.05 (1H, m, 1"-HJ, 2.42 (1H, m, 1"-Hb), 1.42 (3H, d, J 1.1, 5-CH3), 0.86 (9H, s, CH3-C-Si) , 0.01 (6H, s, CH3- Si). 8C (CDCI3) 202.6 (C-2'), 163.7 (C-4), 151.2 (C-2), 137.7, 136.6, 136.5 (Bn, C-6), 128.7, 128.5, 128.2, 128.1, 127.7, 126.4, 126.3 (Bn), 110.9 (C-5), 84.5, 81.3, 80.2 (C-l1, C-3', C-4'), 73.6, 70.4 (Bn) , 66.0 (C-5'), 57.6 (C-2"), 27.3 (C-1'), 25.9, 25.7, 18.2, -5.8, -5.9 (TBDMS), 11.7 (CH3) . FAB-MS m/z 595.14 [M+H]+ (Found: C, 64.1; H, 6.9; N, 4.5; C32H4207N2Si requires C, 64.6; H, 7.1; N, 4.7%). Example 15 (IS, 5R, 6R, 8R) -l-Hydroxy-5-benzyloxy-6-benzyloxymethyl-8-(thymin-1-yl)-2,7-dioxabicyclo[3.3.0]octane (12). Compound 11 (1.80 g, 30.3 mmol) was dissolved in 0.5% HC1 in methanol (w/w, 2 0 cm) and the mixture was stirred for 30 min at room temperature-. After evaporation to dryness, the residue was dissolved in dichloromethane (100 cm3) and washed with a saturated aqueous solution of sodium hydrocarbonate (2 x 40 cm3). The organic phase was evaporated and the residue was purified by flash silica-gel chromatography eluting with 2% methanol in dichloromethane (v/v) to yield nucleoside 12 (1.35 g, 93.5%) as a white solid material. 5H (CDCl,) 7.37-7.27 (11H, m, Bn, 6-H), 5.87 (1H, s, l'-H), 4.71 (2H, s, Bn) , 4.64 (1H, d, J 12.0, Bn), 4.56 (1H, d, J 12.0, Bn), 4.36 (1H, t, J 5.7, 4'-H) , 4.16 (1H, m, 2'-HJ, 3.96 (1H, m, 2' '-Hb) , 3.74 (2H, m, 51-Ha, 5'-Hb), 2.35-2.15 (2H, m, 1"-H., 1"-Hb), 1.88 (3H, s, CH3) . 8C (CDC13) 163.7 (C-4), 151.4 (C-2), 137.8, 137.3, 136.7 (Bn, C-6), 128.5, 128.4, 128.0, 127.8, 127.5 (Bn), 109.9 (C-5), 108.6 (C-2'), 88.8, 87.1, 80.9 (C-l', C-3', C-4'), 73.6, 68.5, 68.1, 67.9 (C-5', C-2", Bn) , 30.9 (C-l'), 12.6 (CH3) . FAB-MS: m/z 481.03 [M+H], 503.02 [M+Na]+ (Found: C, 64.6; H, 5.8; N, 5.7; C26H2807N2 requires C, 65.0; H, 5.9; N, 5.8%). Example 16 (IS, 5R,6R,8R)-1,5-Dihydroxy-6-hydroxymethyl-8-(thymin-l-yl)-2,7-dioxa-bicyclo[3.3.0]octane (13). Compound 13 was successfully derived from compound 12 by the catalytic removing of benzyl protections in the same way as described for preparation of 6. Purification of 13 was fulfilled by column silica gel chromatography in gradient concentration from 6 to 14% of methanol in dichloromethane as eluent. Analytical amounts of compound 13 (up to 15 mg) were additionally purified by reverse-phase HPLC at column (10 x 250 mm) packed by Nucleosil C18 (10 |Llm) . Flow rate: 8 cm3/min; eluent: 0-10% acetonitrile in 60 min. Yield 82%. 8H (CD3OD) 7.44 (1H d, J" 1.2, 6-H), 5.83 (1H, s, l'-H), 4.10-3.80 (5H, m, 5'-Hd, 5'-Hb, 2"-H,, 2"-Hb, 4'-H), 2.39-2.25 (1H, m, 1"-HJ, 2.00-1.90 (1H, m, 1"-Hb), 1.87 (3H, d, J 1.2, CH3). 5C (CD3OD) 166.3 (C-4), 152.7 (C-2), 139.8 (C-6), 110.0, 109.6 (C-2',C-5), 87.8, 85.8, 84.6 (C-l1, C-3', C-4'), 68.8, 61.6 (C-5', C-2' ') , 35.6 (C-l'), 12.4 (CH,) . FAB-MS: m/z 301.03 [M+H]' (Found: C, 46.6; H, 5.7; N, 8.5; C12H1607N2 requires C, 48.0; H, 5.4; N, 9.3%). « Example 17 (25, 5R, 6R, 8R) -5-Benzyloxy-6-benzyloxymethyl-l-methoxy-8- (3-tf-methoxythymin-1 -yl) -2,7 -dioxabicyclo [3.3.0] octane (14), (IS, 5R, 6R, 8R) -5-Benzyloxy-6-benzyloxymethyl-l-hydroxy-8- (3-27-methoxythymin-1-yl) -2,7-dioxabicyclo[3 .3 .0]octane (15) and (IS, 5R, 6R, 8R) -5-Benzyloxy-6-benzyloxymethyl-l-methoxy-8-(thymin-l-yl)-2,7-dioxabicyclo[3.3.0]octane (16) . A mixture of compound 12 (1.04 g, 2.16 mmol) and sodium hydride (171 mg of a 60% suspention in mineral oil, 4.30 mmol) was dissolved in anhydrous dichloromethane (4 cm3) during 10 min under stirring. Methyl iodide (1 cm , 16 mmol) was added and the reaction mixture was incubated at 36 °C for 23 h. After evaporation, the residue was purified by silica gel column chromatography eluting with a gradient of 0.4-2.4% methanol in dichloromethane (v/v) to give products 14, 15 and 16 and starting material 12 (212 mg, 20.5%). Compound 14 (47 mg, 4.3%). 5H (CDC13) 7.25-7.37 (11H, m, Bn, 6-H), 6.15 (1H, s, I'll), 4.74 (1H, d, J 11.5, Bn), 4.67 (1H, d, J 11.3, Bn), 4.62 (1H, d, J 12.1, Bn), 4.55 (1H, d, J 11.9, Bn), 4.34 (1H, t, J 5.6, 4'-H), 3.99, (1H, m, 2,/-Ha)/ 4.22 (1H, m, 2/,-Hb), 3.72 (2H, m, 5'-H, 5'-H), 3.41 (3H, s, CH-O) , 3.35 (3H, s, CH-N3) , a cl J J 2.27 (1H, m, 1"-HJ, 2.41 (1H, m, l'-Hb), 1.93 (3H, s, 5-CH3) . 5C (CDCl1-6) 163.3 (C-4), 151.0 (C-2), 138.2, 137.3, 135.7 (Bn, C-6), 128.3, 128.2, 127.8, 127.6, 127.4, 126.9 (Bn), 111.8 (C-5), 108.5 (C-2'), 89.1, 84.8, 79.5 (C-l', C-3', C-4'), 73.5, 68.4, 68.2, 67.3 (Bn, C-5',C-2"), 50.8 (01,-0), 32.6 (C-l"), 27.9 (Cffj-N), 13.2 (CH3) . FAB-MS: m/z 508.88 [M+H]+ (Found: C, 65.7; H, 6.9; N, 4.8; C28H3207N2 requires C, 66.1; H, 6.3; N, 5.5%) . Compound 15 (97 mg, 9.1%). 5H (CDC13) 7.37-7.28 (11H, m, Bn, 6-H), 5.86 (1H, s, l'-H), 4.72 (2H, s, Bn), 4.64 (1H, d, J 11.9, Bn), 4.58 (1H, d, J 11.9, Bn), 4.37 (1H, t, J 5.6, 4'-H), 4.13 (1H, m, 2"-H), 3.93 (1H, m, 2' '-HJ , 3.75 (2H, m, 5'-H . 5'-Hb), 3.34 (1H, s, CH3-N) , 2.32-2.16 (2H, m, 1"-Ha, 1"-Hb), 1.93 (3H, s, CH3) . 5C (CDC1,) 163.2 (C-4), 151.9 (C-2), 137.5, 137.1, 134.0 (Bn, C-6), 128.4, 128.3, 128.1, 127.9 127.7, 127.6, 127.3 (Bn), 108.8, 108.5 (C-2', C-5), 88.7 (C-l'), 88.0, 31.0 (C-3', C-4'), 73.5, 68.3, 67.9, 67.7 (Bn, C-5', C-2'), 30.6 (C-l"), 27.8 (CffrN),13.2 (CH,) . FAB-MS m/z 495.28 [M+H]', 517.24 [M+Na], Compound 16 (665 mg, 62 .3%) .- 8H (CDCl,) 7.35- 7.25 (11H, m, Bn, 6-H) , 6.06 (1H, s, l'-H), 4.73 (1H, d, J 11.5, Bn), 4.66 (1H, d, J 11.3, Bn), 4.61 (1H, d, J 11.9, Bn) , 4.55 (1H, d, J 12.0, Bn), 4.34 (1H, t, J 5.6, 4'-H), 4.20 (1H, m, 2"-Ha), 3.98 (1H, m, 2"-Hb) , 3.72 (2H, m, 5'-Ha, 5'-Hb), 3.40 (3H, s, CH3-0) , 2.45-2.35 (1H, m, 1"-H„), 2.30-2.20 (1H, m, l'-Hb), 1.90 (3H, d, J 1.1, CHj) . 5C (CDC1,) 163.2 (C-4), 150.1 (C-2), 138.2, 137.9, 137.3 (Bn, C-6), 128.4, 128.2, i 127.8, 127.6 127.4, 127.1 (Bn), 110.8 (C-5), 109.3 (C-2'), 89.2, 84.2, 79.6 (C-l', C-3', C-4'), 73.6, 68.5, 68.3, 67.4 (Bn, C-5', C-2'), 50.8 (Cff,-0),32.6 (C-l"), 12.5 (CH3) . FAB-MS m/z 495.22 [M+H], 517.23 [M+Na]' (Found: C, 66.2; H, 7.2; N, 4.4; C27HJ0O7N2 requires C, 65.6; H, 6.1; N, 5.7%). Example 18 (IS, 5R, 6R, 8R) -5-Hydroxy-6-hydroxvmethyl-l-methoxy-8- (thymin-l-yl)-2,7-dioxabicyclo[3.3.0]octane (17). To a solution of nucleoside 16 (1.20 g, 2.43 mmol) in methanol (10 cm3) was added 20% palladium hydroxide over charcoal (250 mg) and the mixture was carefully degassed under reduced pressure. An atmosphere of hydrogen was applied and stirring was continued for 12 h. The catalyst was removed by filtration of the reaction mixture through a glass column (1x8 cm) packed with silica gel in methanol. The column was additionally washed with methanol (20 cm3). All fractions were collected, evaporated to dryness and co-evaporated with petroleum ether to yield a glass-like solid. This residue was purified by silica gel chromatography eluting with a gradient of 5-10% methanol in dichloromethane (v/v). The fractions containing the product were collected, combined and evaporated to dryness. The residue was dissolved in anhydrous methanol (5 cm3) and anhydrous benzene (100 cm3) was added. Lyophilisation yielded nucleoside 17 (0.61 g, 79%) as a white solid material. 8H (CD3OD) 7.45 (1H, s, 6-H), 5.93 (1H, s, l'-H), 4.15-3.81 (5H, m, 5'-Hd, 5'-Hb, 2"-Hi# 2"-Hb, 4'-H), 3.43 (3H, s, CHrO) , 2.47-2.40 (1H, m, 1"-HJ, 2.03-1.93 (1H, m, 1"-Hb), 1.92 (3H, s, CH,) . 8C (CDjOD) 164.1 (C-4), 150.1 (C-2), 138.3 (C-6), 109.6 (C-5), 108.3' (C- 2'), 84.4, 84.1, 82.4 (C-l', C-3', C-4'), 68.0, 59.5 (C-5',C-2'), 49.6 $CH3-0) , 34.0 (C-1")/ 10.5 (CH3) . FAB-MS m/z 315.13 [M+H], 337.09 [M+Na] + (Found: C, 49.9; H, 5.7; N, 8.2; CuH1807N2 requires C, 49.7; H, 5.8; N, 8.9%). Example 19 (1S,5R, 6R, 8R) -6-(4,4 ' -Dimethoxytrityloxymethyl) -5-hydroxy-l-methoxy-8-(thymin-l-yl)-2,7-dioxabicYClo[3.3.0]octane (18). A mixture of compound 17 (0.95 g, 3.03 mmol) and 4,4'-dimethoxy-trityl chloride (1.54 g, 4.77 mmol) was dissolved in anhydrous pyridine (20 cmJ) and stirred for 4 h at room temperature. The reaction mixture was evaporated to gie an oily residue which was co-evaporated with toluene (2 x 20 cm3) . Dichloromethane (50 cm3) and a saturated aqueous solution of sodium hydrogen-carbonate (50 cm3) were added, the organic phase was separated and evaporated, and the residue purified by silica gel HPLC (the residue was dissolved in the minimum amount of dichloromethane containing 0.5% triethylamine (v/v) and applied to the column equilibrated by the same solvent. The column was washed (ethylacetate:petroleum ether:triethylamine; 15:84 .5 : 0 .5 (v/v/v, 1000 cm3) and the product was eluted in a gradient of methanol (0-2%) in dichloromethane containing 0.5% of triethylamine (v/v/v) to give compound 18 (1.71 g, 92.8%) as white solid material. 5H(CDC13) 7.51-7.17 (10H, m, DMT, 6-H), 6.79-6.85 (4H, m, DMT), 6.04 (1H, s, l'-H), 4.12-3.98 (3H, m, 5'-Ha, 5'-Hb, 4'-H), 3.77 (6H, s, C#3-DMT) , 3.49 (3H, s, CHrO) , 3.45-3.32 (2H, m, 2"-Ha/ 2"-Hh), 2.11-2.01 (1H, m,l"-H), 1.94-1.87 (1H, m, 1"-Hb), 1.93 (3H, s, CH3) . 5C (CDC13) 164.2 (C-4), 158.6, 144.7, 135.7, 130.1, 128.2, 127.9, 126.8, 113.2 (DMT), 150.7 (C-2), 137.7 (C-6), 109.8, 109.7 (C-5, C-2'), 86.5, 85.3, 85.0, 81.4 (DMT, C-l', C-3', C-4'), 69.2, 62.4 (C-5', C-2'), 55.2 (Ctf,-DMT), 51.7 (CH,-0) , 35.5 (C-l"), 12.7 (CH3) . FAB-MS m/z 617.26 [M+H], 639.23 [M+Na]+ (Found: C, 66.4; H, 6.1; N, 4.2; C34HJ609N2 requires C, 66.2; H, 5.9; N, 4.5%). Example 20 (25, 5R, 6R, 8R) -5- (2-Cyanoethoxy(diisopropylamino)phosphinoxy) -6-(4,4 ' -dimethoxytrityloxymethyl) -l-methoxy-8- (thymin-1-yl) -2,7-dioxabicyclo[3.3,0]octane (19). Compound 19 (1.2 g, 1.95 mmol) was dissolved in anhydrous dichloromethane (10 cm3) . N,N-Diisopropylethylamine (1.35 cm3, 7.8 mmol) and 2-cyanoethyl-i,7, i,T-diisopropylphosphoramidochloridite (0.92 g, 3.9 mmol) were added under stirring at room temperature. After 72 h, the mixture was diluted to 100 cm3 by dichloromethane and.washed by a saturated aqueous solution of sodium hydrogencarbonate (50 cm3). The organic phase was evaporated and applied to silica gel HPLC purification using a gradient of eluent B (petroleum ether .-dichloromethane: ethyl acetate: pyridine; 45 :45 :10 : 0 . 5; v/v/v) in eluent A (petroleum ether:dichloromethane:pyridine; 50:50:0.5; v/v/v). The fractions containing the product were concentrated, co-evaporated with toluene (10 cm3) and dried under reduced pressure. The residue was dissolved in anhydrous benzene (20 cm3) and precipitated by addition of this solution into anhydrous petroleum ether (400 cm3) under stirring. The resulting white solid was isolated by filtration and dried to give compound 19 (0.96 g, 60.3%). 5P (CDC13) 142.64, 142.52. FAB-MS m/z 817.26 [M+H], 839.24 [M+Na]+ (Found: C, 62.8; H, 6.4; N, 6.9; CuH53O10N4P requires C, 63.2; H, 6.5; N, 6.9%). Example 21 l,2-0-Isopropylidene-3-C-vinyl-a-D-ribofuranose (20) . A solution of 5-0-t-butyldimethylsilyl-l,2-0-isopropylidene- erythro-pent-3-ulofuranose (Y. Yoshimura, T. Sano, A. Matsuda, T. Ueda, Chem. Pharm. Bull., 1988, 36, 162) (6.05 g, 0.020 mol) in anhydrous THF (250 cm3) was stirred at 0 °C and a 1 M solution of vinylmagnesium bromide in ether (44 cm3, 44 mmol) was added dropwise. The reaction mixture was stirred at room temperature for 2 h, whereupon saturated aqueous ammonium chloride (200 cm3) was added, and extraction was performed using dichloromethane (3 x 300 cm3) . The combined extract was washed with brine (3 x 250 cm3) and dried (Na2S04) . The solvent was removed and the residue was redissolved in anhydrous THF (22 5 cm3). To this mixture was added a 1 M solution of tetrabutylammonium fluoride in THF (22 cm3, 22 mmol), stirring at room temperature was continued for 20 min whereupon the mixture was .1-6evaporated under reduced pressure. The residue was dissolved in dichloromethane (500 cm3) and washed with a saturated solution of sodium hydrogencarbonate (2 x 200 cm3) . The aqueous phase was extracted using continuous extraction for 12 h and the combined extract was dried (Na2S04) and evaporated. The residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give furanose 20 as a white solid material (3.24 g, 75%). 8H (CDC1 3) 5.84 (1H, d, J 3.7, 1-H), 5.74 (1H, dd, J 11.0, 17.2, 1'-H), 5.52 (1H, dd, J 1.6, 17.1, 2'-H), 5.29 (1H, dd, J 1.3, 11.0, 2'-Hb), 4.21 (1H, d, J3.7, 2-H) , 3.98 (1H, t, J 5.7, 4-H) , 3.68-3.64 (2H, m, 5-H. 5-HJ , 2.88 (1H, s, 3-OH) , 1.99 (1H, t, J" 6.3, 5-OH), 1.60 (3H, s, CH3) , 1.35 (3H, s, CH3) . 8C (CDC1 3) 133.6 (C-l1), 116.2 (C-2'), 113.0 (C(CH3)2), 103.8 (C-l), 83.4, 82.4 (C-4, C-2), 79.6 (C-3), 61.3 (C-5) , 26.5, 26.4 (CH3) . Example 22 3,5-Di-O-benzYl-l,2-0-isopropYlidene-3-C-vinYl-a-D-ribo- furanose (21). A 60% suspension of sodium hydride (w/w, 1.78 g, 44.5 mmol) in anhydrous DMF (50 cm3) was stirred at 0 °C and a solution of furanose 20 (3.20 g, 14.8 mmol) in anhydrous DMF (35 cm3) was added dropwise over 3 0 min. The mixture was stirred at 50°C for 1 h and subsequently cooled to 0 °C. A solution of benzyl bromide (5.3 mL, 44.5 mmol) in anhydrous DMF (5.3 cm3) was added dropwise, and the mixture was stirred at room temperature for 20 h. The reaction mixture was evaporated and redissolved in dichloromethane (300 cm3), washed with saturated aqueous sodium hydrogencarbonate (3 x 200 cm3) and dried (Na2S04) . The solvents were removed under reduced pressureand the residue was purified by silica gel column chromatography using petroleum ether/ethylacetate (9:1, v/v) as eluent to give furanose 21 as a white solid material (5.36 g, 91%) . 8H (CDC1 3) 7.40-7.26 (10H, m, Bn) , 5.90 (1H, d, J 3.6, 1-H), 5.72 (1H, dd, J 11.1, 17.9, 1'-H), 5.41 (1H, dd, J 0.7, 11.1, 2'-Ha), 5.30 (1H, dd, J 0.5, 17.8, 2 ' -Hb) , 4.70-4.45 (6H, m, Bn, 2-H, 4-H), 3.69 (1H, dd, J 2.6, 10.8, 5-HJ , 3 .50 (1H, dd, J 7.9, 10.9, 5-HJ, 1.64 (3H, s, CH3) , 1.40 (3H, s, CH,) . 8C (CDC13) 138.6, 138.3 (Bn) , 134.5 (C-l'), 128.3-127.4 (Bn), 118.2 (C-2'J, 112.9 (C(CH3)2), 104.7 (C-l), 84.7, 81.1, 81.0 (C-2, C-3, C-4), 73.3 (C-5), 69.4, 67.0 (Bn) , 26.8, 26.6 (CH3) . Example 23 l1-6-Di-O-acetyl-S/S-di-O-benzyl-S-C-vinyl-a/P-D-ribofuranose (22). A solution of furanose 21 (4.40 g, 11.1 mmol) in 80% aqueous acetic acid (50 cm3) was stirred at 90 °C for 8 h. The solvents were removed and the residue was coevaporated with 99% ethanol (3 x 25 cm3), toluene (3 x 25 cm3) and anhydrous pyridine (2 x 25 cm3) and redissolved in anhydrous pyridine (20 cm3) . Acetic anhydride (17 cm3) was added and the solution was stirred at room temperature for 48 h. The reaction was quenched with ice-cold water (100 cm3) and extracted with dichloro-methane (2 x 10 0 cm3) . The combined extract was washed with saturated aqueous sodium hydrogencarbonate (3 x 100 cm3) and dried (Na2S04). The solvent was evaporated and the residue was purified by silica gel column chromatography using petroleum ether/ethylacetate (4:1/ v/v) as eluent to give furanose 22 as an oil (4.27 g, 87%, a:P~l:l). 5C (CDC13) 169.9, 169.8 (C=0), 139.0, 138.6, 138.0, 137.8 (Bn), 133.3, 132.4 (C-l'), 128.4-126.8 (Bn), 119.6,119.5 (C-2'), 99.5, 94.0 (C-l), 85.4, 85.0, 84.3, 83.6, 77.7, 73.6, 73.5, 73.3, 70.0, 69.2, 67.5, 67.2 (C-2, C-3, C-4, C-5, Bn), 21.0, 20.9, 20.6, 20.4 (CH3) . Example 24 l-(2-0-Acetyl-3,5-di-0-ben2yl-3-C-vinyl«p-D-ribofuranosyl)- thymine (23). To a stirred solution of compound 22 (4.24 g, 9.6 mmol) and thymine (2.43 g, 19.3 mmol) in anhydrous acetonitrile (100 cm3) was added N, O-bis (trimethylsilyl) acetamide (11.9 cmJ, 48.1 mmol). The reaction mixture was stirred at reflux for 30 min. After cooling to 0 °C, trimethylsilyl triflate (3.2 cmJ, 16.4 mmol) was added dropwise and the solution was stirred for 24 h at room temperature. The reaction was quenched with cold saturated aqueous sodium hydrogencarbonate (100 cm3) and the resulting mixture was extracted with dichloromethane (3 x 50 cm1). The combined extract was washed with saturated aqueous sodium hydrogencarbonate (2 x 50 cm3) and brine (2 x 50 cm3) and dried (Na2S04). The extract was evaporated under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give nucleoside 23 as a white foam (4.03 g, 83%). 8H(CDC13) 8.78 (IH, br s, NH) , 7.75 (IH, s, 6-H) , 7.38-7.26 (10 H, m, Bn) , 6.49 (IH, d, J 8.1, 1'-H), 5.99-5.88 (2H, m, 2 '-H and l'-H), 5.54-5.48 (2H, m, 2'-Ha, 2 ' '-Hb) , 4.91-4.50 (4H, m, Bn), 4.34 (IH, s, 4'-H), 3.80 (IH, m, 5' -H ) , 3.54 (IH, m, 5'- Hb) , 2.11 (3H, s, COCH3), 1.48 (3H, s, CH3) . 8C (CDC1 3) 170.1 (C=0), 163.8 (C-4), 151.0 (C-2), 138.9, 136.9 (Bn), 136.1 (C-6), 132.0 (C-l11), 128.7, 128.5, 128.2, 127.8, 127.7, 127.5, 127.5, 127.1 (Bn), 120.7 (C-21'), 111.3 (C-5), 85.4 (C-l1), 85.2 (C-3'), 84.3 (C-4'), 76.0 (C-21), 73.7 (C-51), 69.3, 67.6 (Bn) , 20.6 (COCH3), 11.7 (CH3) . Found: C, 66.3; H, 6.0; N, 5.1; C28H30N2O7 requires C, 66.4; H, 6.0; N, 5.5%. Example 25 l-(3,5-Di-0-benzyl-3-C-vinyl-p-D-ribofuranosyl)thymine (24). To a stirred solution of nucleoside 23 (3.90 g, 7.7 mmol) in anhydrous methanol (40 cm3) was added sodium methoxide (0.83 g, 15.4 mmol). The mixture was stirred at room temperature for 42 h and then neutralized with dilute aqueous hydrochloric acid. The mixture was extracted with dichloromethane (2 x 150 cm3) , and the combined extract was washed with saturated aqueous sodium hydrogencarbonate (3 x 100 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure to give nucleoside 24 as a white foam (3.48 g, 97%). 8H (CDC1 3) 8.89 (IH, br s, NH), 7.60 (IH, d, J 0.9, 6-H), 7.36-7.26 (10H, m, Bn), 6.23 (IH, d, J 7.8, l'-H), 5.98 (IH, dd, J 11.2, 17.7, 1'-H), 5.66 (IH, d, J 17.7, 2'-Hj, 5.55 (IH, d, J 11.5, 2 ' ' -Hb) , 4.75-4.37 (6H, m, 2'-H, 4'-H, Bn), 3.84 (IH, dd, J 2.7, 10.8, 5'-HJ , 3.58 (IH, d, J 11.2, 5'-Hb), 3.23 (IH, d, J 10.6, 2'-OH), 1.50 (3H, s, CH3) . 8C(CDC13) 163.7 (C-4), 151 3 (C-2), 138.0, 136.9 (Bn), 136.0 (C-6), 131.2 (C-l'), 128.8, 128.6, 128.3, 127.8, 127.7, 127.3 (Bn), 120.7 (C-211), 111.3 (C-5), 87.3 (C-l1), 84.6 (C-31), 81.4 (C-41), 78.0 (C-2'), 73.7 (C-5'), 70.0, 66.4 (Bn) , 11.8 (CH3) . Found: C, 66.8; H, 6.2; N, 5.9; C26H„N20, requires C, 67.2; H, 6.1; N, 6.0%. Example 26 l-(3,5-Di-07benzyl-2-0-methanesulfonyl-3-C-vinyl-p-D- ribofuranosyl)thymine (25). Nucleoside 24 (2.57 g, 5.53 mmol) was dissolved in anhydrous pyridine (18 cm3) and cooled to 0 °C. Methyanesulfonyl chloride (1.28 cm3, 16.6 mmol) was added dropwise and the mixture was stirred at room temperature for 3 0 min. The reaction was quenched with water (5 cm3) and the resulting mixture was extracted with dichloromethane (3 x 80 cm3). The combined extract was washed with saturated aqueous sodium hydrogencarbonate (3 x 120 cm3) and dried (Na2S04) . The solvent was evaporated under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give nucleoside 25 as a yellow foam (2.53 g, 84%). 8H (CDC1 3) 8.92 (1H, br s, NH), 7.71 (1H, d, J 1.4, 6-H), 7.41-7.28 (10H, m, Bn), 6.57 (1H, d, J 7.8, 1'-H), 5.99-5.61 (4H, m, 2'-H, 1'-H and 2"-H, 2 ' ' -Hb) , 4.86-4.50 (4H, m, Bn) , 4.37 (1H, dd, J 1.5, 2.4, 4'-H), 8.82 (1H, dd, J 2.6, 11.0, 5'-HJ , 3.55 (1H, dd, J 1.2, 11.0, 5'-Hb), 3.02 (3H, s, CH3) , 1.47 (3H, d, J 1.1, CH3) . 8C(CDC13) 163.7 (C-4), 151.5 (C-2), 138.7, 136.7 (Bn) , 135.7 (C-6), 130.9 (C-11'), 128.8, 128.5, 128.4, 127.6, 127.0 (Bn), 121.8 (C-2'), 111.9 (C-5), 85.1 (C-1'), 84.5 (C-3 ' ), 84.0 (C-4'), 80.7 (C-21), 73.7 (C-5')/ 69.2, 67.7 (Bn), 38.9 (CH3) , 11.8 (CH3) . Example 27 1-(3,5-Di-0-benzyl-3-C-vinyl-p-D-arabinofuranosyl) thymine (26) . A solution of nucleoside 25 (2.53 g, 4.66 mmol) in a mixture of ethanol (50 cm3) , water (50 cm3) and 1 M aqueous sodium hydroxide (15 cm3) was stirred under reflux for 16 h. The mixture was neutralised using dilute aqueous hydrochloric acid, the solvent was evaporated under reduced pressure, and the residue was extracted with dichloromethane (3 x 120 cm3) . The combined extract was washed with saturated aqueous sodium hydrogencarbonate (3 x 150 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/-methanol (99:1) as eluent to give 26 as a white foam (1.61 g, 74%). 5H(CDC1,) 9.89 (1H, br s, NH) , 7.50 (1H, d, J" 1.1, 6-H) , 7.41-7.26 (Bn), 6.28 (1H, d, J 2.8, l'-H), 6.05 (1H, dd, J 11.1, 17.9, l'-H), 5.58-5.50 (2H, m, 2'-Ha, 2 ' ' -Hb) , 4.98 (1H, d, J 9.0, 2'-OH), 4.64-4.31 (6H, m, 2'-H, 4'-H, Bn), 3.73 (2H, m, 5'-Ha, 5'-Hb), 1.73 (1H, d, J" 0.6, CH3) . 8C(CDC13) 165.1 (C-4), 150.5 (C-2), 138.4, 138.0, 136.7 (C-6, Bn) , 130.4 (C-l"), 128.8, 128.6, 128.5, 128.1, 128.0, 127.8 (Bn), 120.6 (C-2'1), 108.1 (C-5), 88.6 (C-l'), 87.9 (C-3'), 87.2 (C-4' ), 73.7 (C-2'), 71.8 (C-51), 69.7, 66.3 (Bn), 12.3 (CH3) . Found: C, 66.8; H, 6.2; N, 5.9; C26H28N206 requires C, 67.2; H, 6.1; N, 6.0. Example 28 l-(3, 5-Di-0-benzyl-3-C-hydroxymethyl-p-D-arabinofuranosyl) - thymine (27). To a solution of nucleoside 26 (2.00 g, 4.31 mmol) in a mixture of THF (15 cm3) and water (15 cmJ) was added sodium periodate (2.76 g, 12.9 mmol) and a 2.5% solution of osmium tetraoxide in fc-butanol (w/w, 0.54 cm3, 43 jlmol) . The reaction was stirred at room temperature for 18 h, quenched with water (50 cm3) , and the mixture was extracted with dichloromethane (2 x 100 cm3) . The combined extract was washed with saturated aqueous sodium hydrogen carbonate (3 x 75 cm3) , dried (Na2S04) and evaporated under reduced pressure. The residue was redissolved in a mixture of THF (15 cm3) and water (15 cm3), and sodium borohydride (488 mg, 12.9 mmol) was added. The reaction mixture was stirred at room temperature for 1 h, water (50 cm3) was added, and the mixture was extracted with dichloromethane (2 x 100 cm3) . The combined organic phase was washed with saturated aqueous sodium hydrogencarbonate (3 x 75 cm3) and dried (Na2S04) . The solvent was removed and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give nucleoside 27 as a white foam (732 mg, 36%). 8H (CDC1 3) 11.09 (1H, br s, NH), 7.41 (1H, d, J 1.0, 6-H), 7.38-7.26 (Bn), 6.16 (1H, d, J 2.6, l'-H), 5.12 (1H, d, J 5.4, 2'-OH), 4.66-4.29 (6H, m, 2'-H, 4'-H, Bn) , 4.02-3.96 (2H, m, l'-Ha, 1 ' '-Hb) , 3.90 (1H, dd, J 7.2, 9.7, 5'-H), 3.79 (1H, dd, J" 5.6, 9.7, 5 ' -Hb) , 2.49 (1H, t, J 6.4, l'-OH), 1.68 (3H, d, J 0.6, CH3) ; 8C (CDC1 ,) 166.1 (C-4), 150.6 (C-2), 139.0, 137.9, 137.0 (C-6, Bn), 128.7, 128.6, 128.4, 128.3, 128.0 (Bn), 107.5 (C-5), 88.2 (C-1'), 88.1 (£-3'), 84.2 (C-4'), 73.7 (C-51), 72.1 (C-21), 69.3, 65.4 (Bn), 58.6 (C-l' ' ) , 12.3 (CH3) . Example 29 (1R, 2R, 4R, 5S) -l-Benzyloxy»2-benzyloxymethyl-4- (thymin-1-yl) -3, 6-dioxabicyclo[3 .2.0]heptane (28). A solution of compound 27 (2.26 g, 4.83 mmol) in anhydrous pyridine (20 cm3) was stirred at -40 °C and a solution of methanesulphonyl chloride (0.482 cmJ, 4.83 mmol) in anhydrous pyridine (10 cm3) was added. The reaction mixture was stirred at room temperature for 17 h, water (5o cm3) was added, and the mixture was extracted with dichloromethane (2 x 100 cm3) . The combined organic phase was washed with saturated aqueous sodium hydrogencarbonate (3 x 100 cm3), dried (Na2S04) and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give an intermediate which after evaporation of the solvents was dissolved in anhydrous DMF (15 cm3) . This solution was added dropwise to a suspension of 60% sodium hydride (461 mg, 11.5 mmol) in anhydrous DMF (15 cm3) at 0 °C. The reaction was stirred at room temperature for 3 0 min, then quenched with water (60 cm3). After neutralization using dilute aqueous hydrochloric acid, the mixture was dissolved in dichloromethane (150 cm3), washed with saturated aqueous sodium hydrogencarbonate (3 x 100 cm3) and dried (Na2S04) . The solvents were evaporated and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give nucleoside 28 as a white foam (2.00 g, 93%). 8H (CDC1,) 9.13 (1H, br s, NH), 7.55 (1H, d, J 1.4, 6-H), 7.40-7.26 (Bn), 5.99 (1H, d, J 2.5, 1'-H), 5.30 (1H, d, J 2.7, 2'-H) , 4.88-4.57 (6H, m, l'-Ha, 1 ' ' -Hb, Bn) , 4.22-4.19 (1H, m, 4'-H), 3.92 (1H, dd, J" 6.2, 10.8, 5'-H), 3.82 (1H, dd, J 3 .7, 10.8, 5'-Hb), 1.91 (3H, d, J 1.3, CH3). 8C (CDC1 ,) 163.8 (C-4), 150.3 (C-2), 137.6 (C-6), 137.5, 137.0 (Bn), 128.7, 128.6, 128.2, 128.0, 127.8, 127.3 (Bn), 109.8 (C-5), 85.7 (C-3'), 84.1 (C-l'), 83.5 (C-4'), 79.7 (C-l'), 73.9 (C-2'), 73.6 (C-51), 68.6, 67.8 (Bn), 12.4 (CHJ. FAB ra/z 451 [M+H], 473 [M+Na-4 , Found: C, 66.3; H, 5.9; N, 6.1; C25H26N206 requires C, 66.7; H, 5.8; N, 6.2%. Example 30 (1R,2R, 4R, 5S) -l-Hydroxy-2-hydroxymethyl-4-(thymin-l-yl) -3, 6-dioxabicyclo[3.2.0]heptane (29). To a stirred solution of nucleoside 28 (180 mg, 0.40 mmol) in ethanol (3 cm3) was added 10% palladium hydroxide over carbon (90 mg). The mixture was degassed several times with argon and placed under a hydrogen atmosphere. The reaction mixture was stirred at room temperature for 6 h, then filtered through celite. The filtrate was evaporated under reduced pressure and the residue was purified by silica gel column chromatography using dichloro-methane/methanol (96:4, v/v) as eluent to give nucleoside 29 as a white solid material (92 mg, 86%). 8H (CD3OD) 7.79 (1H, d, J 1.2, 6-H), 5.91 (1H, d, J 2.5, l'-H), 4.96 (1H, d, J 2.5, 2X -H) , 4.92 (1H, d, J" 7.4, l'-H), 4.58 (1H, dd, J 0.9, 7.4, 1'-Hb) , 3-98 (1H, dd, J 7.3, 12.8, 5' -Ha) , 3.87-3.82 (2H, m, 4'-H, 5'-Hb), 3.34 (2H, s, 3 '-OH, 5'-OH), 1.87 (3H, d, J 1.3, CH3) . 8C (CD3OD) 166.5 (C-4), 152.1 (C-2), 140.1 (C-6), 110.1 (C-5), 91.2 (C-2'), 85.1 (C-l'), 84.0 (C-4'), 79.6 (C-3'), 78.6 (C-1' ' ) , 61.1 (C-51 ) , 12.3 (CH3) . Example 31 (1R, 2R, 4R, 5S) -1- (2-Cyanoethoxy(diisopropylamino)phosphinoxy) -2-(4,4 ' -dimethoxytrityloxymethyl) -4-(thymin-l-yl) -3, 6-dioxa-bicyclo[3.2.0]heptane (30). To a solution of diol 29 (250 mg, 0.925 mmol) in anhydrous pyridine (4 cm3) was added 4,4'-dimethoxytrityl chloride (376 mg, 1.11 mmol) and the mixture was stirred at room temperature for 18 h. The reaction was quenched with methanol (1.5 cm3) and the mixture was evaporated under reduced pressure. A solution of the residue in dichloromethane (30 cm3) was washed with saturated aqueous sodium hydrogencarbonate (3x20 cm3) , dried (Na2S04) and evaporated. The residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give an intermediate which was dissolved in anhydrous dichloromethane (7.0 cm3) . N, i,7-Diisopropylethylamine (0.64 cmJ, 3.70 mmol) followed by 2-cyanoethyl N, iV-diisopropylphosphor- amidochloridite (0.41 cm3, 1.85 itunol) were added and the mixture was1-6 stirred at room temperature for 25 h. The reaction was quenched with methanol (3 cm3) , and the mixture was dissolved in ethylacetate (70 cm3) , washed with saturated aqueous sodium hydrogencarbonate (3 x 50 cm3) and brine (3 x 50 cm3), dried (Na2S04) , and was evaporated under reduced pressure. The residue was purified by silica gel column chromatography using petroleum ether/dichloromethane/ethyl- acetate/triethylamine (100:45:45:10, v/v/v/v) as eluent. The residue obtained was dissolved in toluene (2 cm3) and precipitated under stirring from petroleum ether at -50°C. After evaporation of the solvents, the residue was coevaporated with anhydrous acetonitrile (4x5 cm3) to give 30 as a white foam (436 mg, 61%). 31P NMR (CDC1 3) 146.6. Example 32 3, 5-Di-0-benzyl-4-C-hydroxymethyl-l/2-0-isopropylidene-a-D-ribofuranose (31). To a solution of 3-0-benzyl-4-C~ hydroxymethyl-1,2-O-isopropylidene-oc-D-ribofuranose (R. D. Youssefyeh, J. P. H. Verheyden and J. G. Moffatt, J. Org. Chem., 1979, 44, 1301) (20.1 g, 0.064 mol) in anhydrous DMF (100 cm3) at -5 °C was added a suspension of NaH (60% in mineral oil (w/w), four portions during 1 h 30 min, total 2.85 g, 0.075 mol). Benzyl bromide (8.9 cm3, 0.075 mol) was added dropwise and stirring at room temperature was continued for 3 h whereupon ice-cold water (50 cm3) was added. The mixture was extracted with EtOAc (4 x 100 cm3) and the combined organic phase was dried (Na2S04). After evaporation, the residue was purified by silica gel column chromatography eluting with 5% EtOAc in petroleum ether (v/v) to yield compound 31 (18.5 g, 71%). 8C (CDC13) 138.0, 137.4, 128.5, 128.3, 128.0, 127.8, 127.6 (Bn), 113.5 (C(CH3)2), 104.4 (C-l), 86.5 (C-4), 78.8, 78.6 (Bn), 73.6, 72.6, 71.6 (C-2, C-3, C-5), 63.2, (C-l'), 26.7, 26.1 (CH3) . Example 33 4-C-(Acetoxymethyl)-3,5-di-0-benzyl-l/2-0-isopropylidene-a-D- ribofuranose (32). To a solution of furanose 31 (913 mg, 2.28 mmol) in anhydrous pyridine (4.5 cm3) was dropwise added acetic anhydride (1.08 cm3, 11.4 mmol) and the reaction mixture was stirred at room temperature for 3 h. The reaction was quenched by addition of ice-cold water (50 cm3) and extraction was performed with dichloromethane (3 x 50 cm3) . The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (2 x 50 cm3), dried (Na2S04) and concentrated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane as eluent to give compound 32 as a clear oil (911 mg, 90%) . 8H (CDC13) 7.34-7.25 (10 H, m, Bn), 5.77 (1 H, d, J 3.6, 1-H), 4.78-4.27 (8 H, m, Bn, H-5,, H-5h, H-3, H-2), 3.58 (1 H, d, J 10.3, H-1'J, 3.48 (1 H, d, J 10.5, H-1'J, 2.04 (3 H, s, COCHJ, 1.64 (3 H, s, CH3), 1.34 (3 H, s, CH3) . Sc (CDC13) 171.1 (C=0), 138.2, 137.9, 128.6, 128.1, 128.0, 128.0, 127,8 (Bn), 114.0 (C(CH3)2), 104.5 (C-l), 85.4 (C-4), 79.3, 78.6 (C-2, C-3), 73.7, 72.7, 71.2 (Bn, C-5), 64.9 (C-l'), 26.7, 26.3 (C(CH3)2), 21.0 (COCH3) . Found: C, 67.0; H, 6.5; C25H30O7,1/4H20 requires C, 67.2; H, 6.9%. Example 34 4-C-(Acetoxymethyl)-lr2-di-0-acetyl-3,5-di-0-benzyl-P-ribofuranose (33). A solution of furanose 32 (830 mg, 1.88 mmol) in 80% acetic acid (10 cm3) was stirred at 90 °C for 4 h. The solvent was removed under reduced pressure and the residue was coevaporated with ethanol (3x5 cm3) , toluene (3x5 cm3) and anhydrous pyridine (3x5 cm3) , and was redissolved in anhydrous pyridine (3.7 cm3). Acetic anhydride (2.85 cm3) was added and the solution was stirred for 72 h at room temperature. The solution was poured into ice-cold water (20 cmj) and the mixture was extracted with dichloromethane (2 x 20 cm3). The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (2 x 20 cm3) , iried (Na2S04) and concentrated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane as eluent to give 33 (p:Ot ~ 1:3) as an clear oil (789 mg, 86%). Sc (CDC13) 171.0, 170.3, 170.0, 169.3 (C=0) , 138.1, 137.6, 136.3, 128.9, 128.6, 128.2, 128.0, 128.0, 127.9, 127.7, 124.0 (Bn), 97.8, 97.8 (C-l), 87.0, 85.0, 78.9, 74.5, 74.4, 73.8, 73.6, 72.0, 71.8, 71.0, 70.9, 64.6, 64.4 (C-2, C-3, C-4, Bn, C-5, C-l'), 21.0, 20.8, 20.6 (COCH3) . Found: C, 64.2; H, 6.3; C26H30O9 requires C, 64.2; H, 6.2%. Example 35 l-(4-C-(Acetoxymethyl)-2-0-acetyl-3/5-di-0-ben2yl-J3-D- ribofuranosyl)thymine (34), To a stirred solution of the anomeric mixture 33 (736 mg, 1.51 mmol) and thymine (381 mg, 3.03 mmol) in anhydrous acetonitrile (14.5 cm3) was added NfO-bis (trimethylsilyl) acetamide (2.61 cm3, 10.6 mmol). The reaction mixture was stirred at reflux for 1 h, then cooled to 0 °C. Trimethylsilyl triflate (0.47 cm3, 2.56 mmol) was added dropwise under stirring and the solution was stirred at 65 °C for 2 h. The reaction was quenched with a cold saturated aqueous solution of sodium hydrogen carbonate (15 cm3) and extraction was performed with dichloromethane (3 x 10 cm3). The combined organic phase was washed with saturated aqueous solutions of sodium hydrogencarbonate (2 x 10 cm3) and brine (2 x 10 cm3) , and was dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give nucleoside 34 as a white solid material (639 mg, 76%). 8H (CDC13) 8.98 (1 H, br s, NH) , 7.39-7.26 (11 H, m, Bn, 6-H), 6.22 (1H, d, J 5.3, l'-H), 5.42 (1H, t, J 5.4, 2'-H), 4.63-4.43 (5H, m, 3'-H, Bn) , 4.41 (1 H, d, J 12.2, 5'-HJ , 4.17 (1 H, d, J 12.1, 5'-Hb) , 3.76 (1 H, d, J 10.2, 1' '-H J , 3.51 (1 H, d, J 10.4, l'-Hb), 2.09 (3H, s, COCH,) , 2.03 (3 H, s, COCH3), 1.53 (3 H, d, J 0.9, CH3) . 8C (CDC1,) 170.8, 170.4 (C=0), 163.9 (C-4), 150.6 (C-2), 137.4 (C-6) 137.4, 136.1, 128.9, 128.8, 128.4, 128.2, 127,9 (Bn), 111.7 (C-5), 87.2, 87.2, 86.1 (C-l', C-3', C-4'), 77.6 (C-2'), 74.8, 73.9, 71.1, 63.8 (Bn, C-l ' ' , C-51), 20.9, 20.8 (COCH3) , 12.0 (CH3). FAB-MS m/z 553 [M+H], Found: C, 62.7; H, 5.9; N, 4.7; C29HJ2N20, requires C, 63.0; H, 5.8; N, 5.1%. . Example 36 1-(3,5-Di-0-benzyl-4-C- (hydroxymethyl) -p-D-ribofuranosyl) - thymine (35). To a stirred solution of nucleoside 34 (553 mg, 1.05 mmol) in methanol (5.5 cm3) was added sodium methoxide (287 mg, 5.2.5 mmol). The reaction mixture was stirred at room temperature for 10 min, then neutralised with dilute hydrochloric acid. The solvent was partly evaporated and extraction was performed with dichloromethane (2 x 20 cm3) . The combined organic phase was washed with saturated aqueous sodium hydrogencarbonate (3 x 20 cm3) and was dried (Na2S04) . The solvent was removed under reduced pressure to give 35 as a white solid material (476 mg, 97%). 8H (CDC13) 7.47 (1 H, d, J 1.0 6-H), 7.36-7.22 (10 H, m, Bn), 6.07 (1 H, d, J 3.8, l'-H), 4.87 (1 H, d, J 11.7, Bn), 4.55 (1 H, d, J- 11.7, Bn) , 4.50-4.32 (4 H, m, Bn, 2'-H, 3 ' -H) , 3.84-3.53 (4 H, m, 5'-Ha, 5 '-Hb/ 1'- Ha, l'-Hb), 1.50 (3 H, d, J 1.1, CH3) . Sc (CDC13) 164.3 (C-4), 151.3 (C-2), 137.6 (C-6) 136.4, 136.3, 128.8, 128.6, 128.4, 128.3, 127,9 (Bn), 111.1 (C-5), 91.1, 91.0, 88.1 (C-l', C-3', C-4'), 77.4 (C-2'), 74.8, 73.8, 71.4, 63,2 (Bn, C-5', C-l'-'), 12.0 (CH3) . FAB-MS m/z 491 [M+Na], Found: C, 63.4; H, 6.0; N, 5.5; C25H28N207,1/4H20 requires C, 63.5; H, 6.1; N, 5.9%. Example 36A Intermediate 35A. A solution of nucleoside 35 (225 mg, 0.48 mmol) in anhydrous pyridine (1.3 cm3) was stirred at 0 °C and p-toluenesulphonyl chloride (118 mg, 0.62 mmol) was added in small portions. The solution was stirred at room temperature for 16 h and additional p-toluenesulphonyl chloride (36 mg, 0.19 mmol) was added. After stirring for another 4 h and addition of ice-cold water (15 cm3) , extraction was performed with dichloromethane (2 x 15 cm3) . The combined organic phase was washed with saturated aqueous sodium hydrogencarbonate (3 x 15 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give a intermediate 35A (140 mg, 47%) which was used without further purification in the next step. example j / (IS, 3R, 4R, 7J5) -7-Benzyloxy-l-benzyloxymethyl-3- (thymin-1-yl) -2,5-dioxabicyclo[2.2.1Jheptane (36). Intermediate 35A (159 mg, 0.256 mmol) was dissolved in anhydrous DMF (0.8 cmJ) . The solution was added dropwise to a stirred suspension of 60% sodium hydride in mineral oil (w/w, 32 mg, 0.80 mmol) in anhydrous DMF (0.8 cm3) at 0 °C. The mixture was stirred for 72 h and then concentrated under reduced pressure. The residue was dissolved in dichloromethane (10 cmJ) , washed with saturated aqueous sodium hydrogencarbonate (3x5 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give the bicyclic nucleoside 36 as a white solid material (65.7 mg, 57%). 8H (CDC13) 9.24 (1 H, br s, NH) , 7.49 (1 H, s, 6-H) , 7.37-7.26 (10 H, m, Bn), 5.65 (1 H, s, l'-H), 4.70-4.71 (5 H, m, Bn, 2'-H), 4.02-3.79 (5H, m, 3'-H, 5'-Ha, 5 '-Hb, l'-Ha, 1 • ' -Hb) , 1.63 (3 H, s, CH3). Sc (CDCI3) 164.3 (C-4) , 150.1 (C-2), 137.7, 137.1 (Bn), 135.0 (C-6), 128.8, 128.7, 128.4, 128.0, 127.9 (Bn), 110.4 (C-5), 87.5, 87.3 (C-l', C-3'), 76.7, 75.8, 73.9, 72.3, 72.1 (Bn, C-51, C-2', C-41), 64.5 (C-l' '), 12.3 (CH3) . FAB-MS m/z 451 [M+H]+. Example 38 (25,3R,4R,7S)-7-Hydroxy-l-hydroxymethyl-3-(thymin-1-yl)-2,5-dioxabicyclo[2.2.1]heptane (37). A solution of nucleoside 36 (97 mg, 0.215 mmol) in ethanol (1.5 cm3) was stirred at room temperature and 20% palladium hydroxide over carbon (50 mg) was added. The mixture was degassed several times with argon and placed in a hydrogen atmosphere with a baloon. After stirring for 4 h, the mixture was purified by silica gel column chromatography using dichloromethane-methanol (97:3, v/v) as eluent to give nucleoside 37 as a white solid material (57 mg, 98%). 8H ((CD1-6SO) 11.33 (1H, br s, NH) , 7.62 (1H, d, J 1.1 Hz, 6-H), 5.65 (1H, d, J 4.4 Hz, 3'-OH), 5.41 (1H, s, l'-H), 5.19 (1H, t, J" 5.6 Hz, 5'-OH), 4.11 (1H, s, 2 '-H) , 3.91 (1H, d, J 4.2 Hz, 3'-H), 3.82 (1H, d, J 7.7 Hz, 1 ' ' -HJ , 3.73 (1H, s, H'-5J , 3.76 (1H, s, 5'-Hb), 3.63 (1H, d, J" 7.7 Hz, 1 ' • -Hb) , 1.78 (3H, d, J 0.7 Hz, CH3) . 5C (CDCI3) 166.7 (C-4), 152.1 (C-2), 137.0 (C-6)., 110.9 (C-5), 90.5, 88.4 (C-l' , C-4'), 80.9, 72.5, 70.4 (C-21, C-3, C-5'), 57.7 (C-l ' ' ) , 12.6 (CH3) . EI-MS m/z 270 [M]+. Example 39 (1R,3R,4R, 7S) -l-(4,4'-Dimethoxytrityloxyiaethyl) -7-hydroxy-3-thymin-1-yl)-2,5-dioxabicyclo[2.2.1]heptane (38). To a solution of nucleoside 37 (1.2 g, 4.44 mmol) in anhydrous pyridine (5 cmJ) was added 4,4'-dimethoxytrityl chloride (2.37 g, 7.0 mmol) at 0°C. The solution was stirred at room temperature for 2 h whereupon the reaction was quenched with ice-cold water (10 cm3) and extracted with dichloromethane (3 x 15 cm3) . The combined organic phase was washed with saturated aqueous solutions of sodium hydrogen carbonate (3 x 10 cm3) , brine (2 x 10 cm3) and dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give nucleoside 38 as a white solid material (2.35 g, 93%). 8H (CDC13) 9.89 (1H, brs, NH) , 7.64 (1H, s, 6- H), 7.47-7.13 (9H, m, DMT), 6.96-6.80 (4H, m, DMT), 5.56 (1H, s, l'-H), 4.53 (1H, brs, 2'-H), 4.31 (1H, m, 3'-H), 4,04-3.75 (9H, m, 1"-Ha, 1"-Hb, 3'-OH, OCH3) , 3.50 (2H, br s, 5 '-Ha 5 ' - Hb), 1.65 (3H, s, CH3) . 8C(CDC13) 164.47 (C-4), 158.66 (DMT), 150.13 (C-2), 144.56, 135.46, 135.35, 134.78, 130.10, 129.14, 128.03, 127.79, 127.05 (C-6, DMT), 113.32, 113,14 (DMT), 110.36 (C-5), 89.17, 88.16, 87.05 (C-l', C-4', DMT), 79.36, 71.81, 70.25, 58.38 (C-2', C-3', C-5', C-l"), 55.22 (OCH1-6 , 12.57 (CH3) . FAB-MS m/z 595 [M+Na], 573 [M+H], Example 40 (1R,3R,4R, 7S) -7-(2-Cyanoethoxy(diisopropylamlno)posphinoxy)-1-(4,4' -dimethoxytrityloxymethyl) -3 - (thymin-1 -yl) -2, 5-dioxa-bicyclo[2.2,1]heptane (39), To a solution of nucleoside 38 (2.21 g, 3.86 mmol) in anhydrous dichloromethane (6 cmJ) was added N,N- diisopropylethylarnine (4 cm3) and 2~cyanoethyl N,N-diisopropylphosphoramidochloridite (1 cm3, 4.48 mmol) and stirring was continued for 1 h. MeOH (2 cmJ) was added, arid the mixture was diluted with ethyl acetate (10 cm3) and washed successively with saturated aqueous solutions of sodium hydrogencarbonate (3x5 cm3) and brine (3x5 cm3) and was dried (Na2S04) . The solvent was evaporated under reduced pressure, and the residue was purified by basic alumina column chromatography with dichloromethane/methanol (99:1, v/v) as eluent to give 39 as a white foam. This residue was dissolved in dichloromethane (2 cm3) and the product was precipitated from petroleum ether (100 cm3, cooled to -30°C) under vigorous stirring. The precipitate was collected by filtration, and was dried on to give nucleoside 39 as a white solid material (2.1 g, 70%). 8P(CDC13) 149.06, 148.74. FAB-MS m/z 795 [M+Na], 773 [M+H], Example 41 l-(2-0-Acetyl-4-C-acetoxymethyl-3,5-di-0-benzyl-P-D-ribo- furanosyl)uracil (40). To a stirred solution of the anomeric mixture 33 (3.0 g, 6.17 mmol) and uracil (1.04 g, 9.26 mmol) in anhydrous acetonitrile (65 cmJ) was added N, O-bis(trimethylsilyl) acetamide (9.16 cm3, 37.0 mmol). The reaction mixture was stirred for 1 h at room temperature and cooled to 0°C. Trimethylsilyl triflate (1.8 cm3, 10.0 mmol) was added dropwise and the solution was stirred at 60°C for 2 h. The reaction was quenched by addition of a saturated aqueous solution of sodium hydrogencarbonate (10 cm3) at 0°C and extraction was performed with dichloromethane (3 x 20 cm3) . The combined organic phase was washed with brine (2 x 20 cm3) and was dried (Na2S04) . The solvents were removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give nucleoside 40 as a white solid material (2.5 g, 75%). 5H (CDClj) 9.57 (1H, br s, NH) , 7.63 (1H, d, J 8.2, 6-H), 7.40-7.24 (10H, m, Bn), 6.18 (1H, d, J 4.5, l'-H), 5.39-5.32 (2H, m, 2'-H, 5-H) , 4.61 (1H, d, J 11.6, Bn) , 4.49-4.40 (5H, m, 3'-H, Bn, 1"-HJ , 4.37 (1H, d, J 12.3, 1"-Hb), 3.76 (1H, d, J 10.1, 5'-HJ , 3.49 (1H, d, J 10.1, 5'-Hb), 2.09 (s, 3H, COCH3), 2.04 (3H, s, COCH3) . 8c (CDC13) 170.47, 169.94 (C=0) , 163.32 (C-4), 150,30 (C-2), 140.24 (C-6), 137.15, 136.95, 128.65, 128.52, 128.32, 128.19, 128-02, 127.77 (Bn), 102.57 (C-5), 87.41, 86.14 (C-l', C-4'), 77.09, 74.84, 74.51, 73.75, 70.60, 63.73 (C-2', C-3', C-5', C-l', Bn), 20.79, 20.68 (COCH,) . FAB-MS m/z 53 9 [M], Example 42 1- (3, 5-Di-0-benzyl-4-C-hydroxymethyl-p-D-ribofuranosyl)uracil (41). To a stirred solution of nucleoside 40 (2.0 g, 3.7 mmol) in methanol (25 cm3) was added sodium methoxide (0.864 g, 95%, 16.0 mmol). The reaction mixture was stirred at room temperature for 10 min and neutralised with 20% aqueous hydrochloric acid. The solvent was partly evaporated and the residue was extracted with ethyl acetate (3 x 50 cm3) . The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 20 cm3) and was dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98.5:1.5, v/v) as eluent to give 41 as a white solid material (1.58 g, 95%). 8H (CDC13) 9.95 (1H, br s, NH), 7.69 (d, J 8.1, 6-H), 7.35-7.17 (10H, m, Bn) , 6.02 (1H, d, J 2.3, l'-H), 5.26 (1H, d, J 8.1, 5-H), 4.80 (1H, d, J 11.7, Bn), 4.47 (1H, d, J 11.7, Bn) , 4.45-4.24 (4H, m, Bn, 2'-H, 3'-H) , 3.81 (1H, d, J 11.9, 1"-H), 3.69 (2H, br s, 2'-OH, 1'- OH), 3.67 (2H, m, 5'-Ha/ 1"-Hb), 3.48 (1H, d, J 10.3, 5'-Hb). 8C (CDC13) 163.78 (C-4), 150.94 (C-2), 140.61 (C-6), 137.33, 137.22, 128.59, 128.18, 128.01 (Bn), 102.16 (C-5), 91.46, 88.36 (C-l', C-4'), 76.73, 74.66, 73.71, 73.29, 70.81, 62.81 (C-2', C-3', C-5', C-l", Bn) . FAB -MS m/z 455 [M+H] + . Example 42A Intermediate 42. A solution of nucleoside 41 (1.38 g, 3.0 mmol), anhydrous pyridine (2 cmJ) and anhydrous dichloromethane (6 cmJ) was stirred at -10°C and p-toluenesulfonyl chloride (0.648 g, 3.4 mmol) was added in small portions during 1 h. The solution was stirred at -10°C for 3 h. The reaction was quenched by addition of ice-cold water (10 cm3) and the mixture was extracted with dichloromethane (3 x 50 cm3) . The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 20 cm3) and was dried (Na2S04) . The solvent1-6 was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give intermediate 42 (0.9 g, 49%) which was used without further purification in the next step. Example 43 (IS, 3R, 4R, IS) -7-Benzyloxy-l-benzyloxymethyl-3- (uracil-1-yl) -2,5-dioxabicyclo[2.2.1]heptane (43). Compound 42 (0.7 g, 1.15 mmol) was dissolved in anhydrous DMF (3 cm3) and a 60% suspension of sodium hydride (w/w, 0.096 g, 24 mmol) was added in four portions during 10 min at 0°C, and the reaction mixture was stirred for 12 h. The reaction was quenched with methanol (10 cm3), and the solvents were removed under reduced pressure. The residue was dissolved in dichloromethane (20 cm), washed with saturated aqueous sodium hydrogencarbonate (3 x 6 cm ) and was dried (Na2S04). The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/ethanol (99:1, v/v) as eluent to give nucleoside 43 (0.30 g, 60%). SH (CDC13) 9.21 (1H, br s, NH), 7.70 (1H, d, J 8.2, 6-H), 7.37-7.24 (10H, m, Bn), 5.65 (1H, s, l'-H), 5.52 (1H, d, J 8.2, 5-H), 4.68-4.45 (5H, m, 2'-H, Bn), 4.02-3.55 (5H, m, 3 ' -H, 5'-Ha, 1' ' -Ha , 5'-Hb, 1"- Hb) . 8C (CDC13) 163.33 (C-4), 149.73 (C-2), 139.18 (C-6) , 137.46, 13 6.81, 128.58, 128.54, 128.21, 12 8.10, 127.79, 127.53 (Bn), 101.66 (C-5), 87.49, 87.33 (C-l', C-4'), 76.53, 75.71, 73.77, 72.33, 72.00, 64.35 (C-2', C-3' , C-5', C-l', Bn) . FAB-MS m/z 459 [M+Na] + . Example 44 (IS, 3R, 4R, 7S) »7-Hydroxy-l-hydroxymethyl»3- (uracil-1-yl) -2, 5-dioxabicyclo[2.2.l]heptane (44). To a solution of compound 43 (0.35 g, 0.8 mmol) in absolute ethanol (2 cm') was added 20% palladium hydroxide over carbon (0.37 g) and the mixture was degassed several times with hydrogen and stirred under the atmosphere of hydrogen for 4h. The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloramethane/methanol (9:1, v/v) as eluent to give nucleoside 44 as a white solid material (0.16 g, 78%). 5H (CD3OD) 7.88 (1H, d, J 8.1, 6-H), 5.69 (1H, d, J 8.1, 5-H), 5.55 (1H, s, l'-H), 4.28 (1H, s, 2'-H), 4.04 (1H, s, 3'-H), 3.96 (1H, d, J" 7.9, 1"-Ha), 3.91 (2H, s, 5'-H), 3.76 (1H, d, J 7.9, 1"-Hb). 8C (CD3OD) 172.95 (C-4), 151.82 (C-2), 141.17 (C-6), 101.97 (C-5), 90.52, 88.50 (C-l', C-4'), 80.88, 72.51, 70.50, 57.77 (C-2', C-3', C-5', C-l'). FAB-MS m/z 257 [M+H], Example 45 (1R, 3R, 4R, 7S) -1- (4,4 ' -Dimethoxytrityloxymethyl) -7-hydroxy-3-(uracil-1-yl)-2,5-dioxabicyclo[2.2.1]heptane (45) . To a solution of compound 43 (0.08 g, 0.31 mmol) in anhydrous pyridine (0.5 cm3) was added 4,4'-dimethoxytrityl chloride (0.2 03 g, 0.6 mmol) at 0°C and the mixture was stirred at room temperature for 2 h. The reaction was quenched with ice-cold water (10 cm3) and extracted with dichloromethane (3x4 cm3) . The combined organic phase was washed with saturated aqueous solutions of sodium hydrogencarbonate (3x3 cm3) and brine (2 x 3 cm3) and was dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98:2, v/v) as eluent to give nucleoside 45 as a white solid material (0.12 g, 69%). 8H (CDCI3) 9.25 (1H, br s, NH) , 7.93 (1H, d, J 7.2, 6-H), 7.50-7.15 (9H, m, DMT), 6.88-6.78 (4H, m, DMT), 5.63 (1H, s, l'-H), 5.59 (1H, d, J 8.0, 5-H), 4.48 (1H, s, 2'-H), 4.2 6 (1H, s, 3'-H), 3.88 (1H, d, J 8.1, 1'-H ) , 3.85-3.55 (7H, m, 1"-Hb, OCH3), 3.58-3.40 (2H, m, 5'-Ha, 5 '-Hb) . 8C (CDC13) 164.10 (C-4), 158.60 (DMT), 150.45 (C-2), 147.53 (DMT), 144.51 (C-6), 139.72, 135.49, 135.37, 130.20, 129.28, 128.09, 127.85, 127.07 (DMT), 113.39, 113.17 (DMT), 101.79 (C-5), 88.20, 87.10, 36.87 (C-l', C-4', DMT), 79.25, 71.79, 69.70, 58.13 (C-2', C-3', C-5', C-l'), 55.33 (OCH3). FAB-MS m/z 559 [M+H], Example 46 [1R,3R,4R, 7S)-7-(2-Cyanoethoxy(diisopropylamino)posphinoxy)-1-[4,4'-dimethoxytrityloxymethyl)-3-(uracil-1-yl)-2,5-dioxabi-:yclo[2.2 .l]heptane (46). To a solution of compound 45 (0J.07 g, 0.125 mmol) in anhydrous dichloromethane (2 cm3) was added N,N-diisopropylethylamine (0.1 cm3) and 2-cyanoethyl itf,W-diiso-propylphosphoramidochloridite (0 .07 cmJ, 0.32 mmol). After stirring for 1 h, the reaction was quenched with MeOH (2 cm3) , and the resulting mixture was diluted with ethyl acetate (5 cm3) and washed successively with saturated aqueous solutions of sodium hydrogencarbonate (3x2 cm3) and brine (3x2 cm3) , and was dried (Na2S04). The solvent was evaporated under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give a white foam. This foam was dissolved in dichloromethane (2 cm3) and the product was precipitated from petroleum ether (10 cm3, cooled to -3 0°C) under vigorous stirring. The precipitate was collected by filtration and was dried to give compound 45 as a white solid material (0.055 g, 58%). 8p (CDC13) 149.18, 149.02. Example 47 9-(2-0-Acetyl-4«C-acetyloxymethyl-3/5-di-0»ben2yl-p-I>-ribo- furanosyl)-2-N-isobutyrylguanine (47). To a stirred suspension of the anomeric mixture 33 (1.28 g, 5.6 mmol) and 2 —i,T— isobutyrylguanine (1.8 g, 3.7 mmol) in anhydrous dichloroethane (60 cm3) was added N, O-bis (trimethylsilyl) acetamide (4 cm3, 16.2 mmol). The reaction mixture was stirred at reflux for 1 h. Trimethylsilyl triflate (1.5 mL, 8.28 mmol) was added dropwise at 0 °C and the solution was stirred at reflux for 2 h. The reaction mixture was allowed to cool to room temperature during 1.5 h. After dilution to 250 cm3 by addition of dichloromethane, the mixture was washed with a saturated aqueous solution of sodium hydrogencarbonate (200 cm3) and water (250 cm3). The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using 1.25% (200 cm3) and 1.5% (750 cm3) of methanol in dichloromethane (v/v) as eluents to give 2.10 g (87%) of a white solid that according to 'H-NMR analysis consisted of three isomers (ratio: 12.5:2.5:1). The main product formed in that conditions is expected to be compound 47 (P. Garner, S. Ramakanth, J.Org.Chem. 1988, 53, 1294; H. Vorbruggen, K. Krolikiewiez, B. Bennua, Chem.Ber. 1981, 114, 1234) . The individual isomers were not isolated and mixture was used for next step. For main product 47: SH (CDC13) 12.25 (br s, NHCO) , 9.25 (br s, NH) , 7.91 (s, 8-H) 7.39-7.26 (m, Bn), 6.07 (d, J 4.6, l'-H), 5.80 (dd, J 5.8, J 4.7, 2'-H), 4.72 (d, J 5.9, 3'-H), 4.59-4.43 (m, Bn, l'-HJ, 4.16 (d, J 12.1, l'-Hb), 3.70 (d, J 10.1, 5'-Hj, 3.58 (d, J" 10.1, 5'-Hb), 2.65 (m, CHCO) , 2.05 (s, COCH3) , 2.01 (s, COCH3), 1.22 (d, J 6.7, CH3CH) , 1.20 (d, J7.0, CH3CH) . Sc (CDC13) 178.3 (COCH), 170.6, 179.8 (COCH3) , 155.8, 148.2, 147.6 (guanine), 137.6, 137.2 (guanine, Bn), 128.5, 128.4, 128.2, 128.1, 128.0, 127.8, 127.7 (Bn), 121.2 (guanine), 86.2, 86.0 (C-l, C-4'), 77.8 (C-3'), 74.9, 74.5, 73.7, 70.4 (Bn, C-2', C- 5'), 63.5 (C-l'1), 36.3 (COCH), 20.8, 20.6 (COCH3) , 19.0 (CH3CH) . For the mixture: FAB-MS m/z 648 [M+H], 670 [M+Na], Found: C, 60.8; H, 6.0; N, 10.4; C33H36N509 requires C, 61.3; H, 5.6; N, 10.8%. Example 48 9- (3,5-Di-0-benzyl~4-C-hydroxymethyl-P-D-ribofuranosyl) -2-N-isobutyrylguanine (48). A solution of the mixture containing compound 47 (2.10 g, 3.25 mmol) in THF/Pyridine/methanol (2:3:4, v/v/v) (40 cm3) was cooled to -10 °C and sodium methoxide (320 mg, 5.93 mmol) was added to the stirred solution. The reaction mixture was stirred at 10 °C for 3 0 min and neutralized with 2 cm3 of acetic acid. The solvent was evaporated under reduced pressure and the residue was twice extracted in a system of dichloromethane/water (2 x 100 cm3) . The organic fractions were combine and evaporated under reduced pressure. After co-evaporation with toluene, the residue was purified by silica gel column chromatography in a gradient (2-7 %) of methanol in dichloromethane (v/v) to give a white solid material (1.62 g, 89%). According to 'H-NMR it consisted of three isomers (ratio: 13.5:1.5:1). For main product 48: 5H (CD3OD) 8.07 (s, 8-H) 7.36-7.20 (m, Bn), 6.05 (d, J 3.9, l'-H), 4.81 (d, J 11.5, Bn) , 4.75 (m, 2 ' -H) , 4.56 (d, J" 11.5, Bn) , 4.51-4.43 (m, Bn, 3'-H), 3.83 (d, J" 11.7, 1"-HJ , 3.65 (d, J 11.7, l-'-HJ, 3.64 (d, J" 10.6, 5'-HJ, 3.57 (d, J" 10.3, 5' -HJ , 2.69 (m, CHCO), 1.20 (6 H, d, J 6.8, CH3CH) . (guanine, Bn) , 129.5, 129.4, 129.3, 129.2, 129.1, 129.0, 128.9, 128.8 (Bn),.,121.2 (guanine), 90.7, 89.6 (Ol ' , C-4'), 79.2 (C-3'), 75.8, 74.5, 74.3, 72.2 (Bn, C-2', C-5'), 63.1 (C-l'), 36.9 (COCH) , 19.4 (CH3CH) , 19.3 (CH3CH) . For the mixture: FAB-MS m/z 564 [M+H], Example 49 Intermediate 49. A solution of the mixture containing 48 (1.6 g, 2.85 mmol) in anhydrous pyridine (6 cm3) was stirred at -20 °C and p-toluenesulphonyl chloride (0.81 g, 4.27 mmol) was added. The solution was stirred for 1 h at -20 °C and for 2 h at -25 °C. Then the mixture was diluted to 100 cm3 by addition of dichloromethane and immediately washed with water (2 x 100 cm3). The organic phase was separated and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol as eluent (1-2%, v/v) to give intermediate 49 (980 mg). After elution of compound 49 from the column, the starting mixture containing 48 (510 mg, 32%) was eluted using 8% methanol in dichloromethane (v/v) as eluent. This material was concentrated, dried under reduced pressure and treated in the same manner as described above to give additionally 252 mg of the intermediate. This intermediate (1.23 g) was purified by silica gel HPLC (PrepPak Cartridge packed by Porasil, 15-20 ,xm, 125A, flow rate 60 cm3/min, eluent 0-4% of methanol in dichloromethane (v/v), 120 min). Fractions containing intermediate 49 were pooled and concentrated to give white solid (1.04 g, 51%). According to 1-6-NMR it consisted of two main products, namely isomers of l"-0 and 2' -O monotosylated derivatives in a ratio of ~ 2:1. FAB-MS m/z 718 [M+H], Found C, 60.4; H, 5.8; N, 9.3; C36H39N509S requires C, 60.2; H, 5.5; N, 9.8%. Example 50 (IS, 3R, 4R, 7S) -7-Benzyloxy-l-benzyloxymethyl-3- (2-N-isobutyrylguanin-9-yl)-2,5-dioxabicyclo[2.2,l]heptane (50) . To a solution of intermediate 49 (940 mg, 1.32 mmol) in anhydrous rHF (20 cm3) was added a 60% suspension of sodium hydride (w/w, 130 mg, 3.25 mmol) and the mixture was stirred for lh at room :emperature. Acetic acid (0.25 mL) was added and the mixture was concentrated under reduced pressure. The residue was dissolved in dichloromethane (100 cm3) and was washed with water (2 x 100 cm3) . The organic phase was separated and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using methanol/dichloromethane (1-1.5%, v/v) as eluent to give nucleoside 50 as a white solid material (451 nig, 57%). SH (CDC13) 12.25 (1H, br s, NHCO) , 10.12 (1H, br s, NH), 7.84 (1H, s, 8-H), 7.31-7.15 (10H, m, Bn), 5.72 (1H, s, l'-H), 4.60-4.46 (5H, m, Bn, 2'-H), 4.14 (1H, s, 3'-H), 4.02 (1H, d, J 7.9, 1"-Ha), 3.85 (1H, d, J 7.9, 1"-Hb), 3.78 (2H, s, 5'-H), 2.81 (1H, m, CHCO) , 1.24 (3H, d, J6.8, CH3CH) , 1.22 (3H, d, J" 6.4, CH3CH) . Sc (CDC13) 179.5 (COCH) , 155.6, 148.1, 147.3 (guanine), 137.3, 13 6.9, 13 6.0 (guanine, Bn), 128.4, 128.3, 127.9, 127.8, 127.5, 127.4 (Bn), 121.2 (guanine), 87.1, 86.2 (C-l, C-4'), 77.0 (C-3'), 73.6, 72.5, 72.1 (Bn, C-2', C-5'), 64.9 (C-l1'), 36.1 (COCH), 19.0 (CH3CH) , 18.9 (CH3CH) . FAB-MS m/z 546 [M+H] + . Found: C, 63.3; H, 5.9; N, 12.5; C29H30N5O6 requires C, 64.0; H, 5.6; N, 12.9%. Example 50A G1AQ. To a suspension of compound S8 (1.5g, 2.51 mmol), N2-isobutirylguanine (0.93 g, 4.06 mmol) in dry DCM (50 mL) was added BSA (N,0-bistrimethylsilylacetamide; 3.33 mL, 13.5 mmol) and the mixture was refluxed for 2 hrs. Catalyst TMSTf (trimethylsilyl triflate, 1.25 mL, 6.9 mmol) was then added to reaction mixture and refluxing was continuing for more 2 hrs. The mixture was allowed to cool to room temperature, diluted by 200 mL of DCM and washed by saturated aq. NaHC03 and water. Chromatography at silica gel column (1- 2.5 % of CH30H in DCM) yielded 1.05g (55%) of desired isomer G1AQ and 380 mg of isomers with higher mobility which was converted to G1AQ by repetition of the same procedure. G3. Ammonium hydroxide (12 mL of 25% aq.solution) was added to a solution of G1AQ (1.05 g in 12 mL of methanol) and the mixture was stirred for lhr at room temperature. After concentration the product was purified by silica gel column chromatography (1-3 % CH30H in DCM) to give 700 mg of white solid material. G4. 700 mg of G3 in dry THF (15 mL) was treated by NaH (225 mg of 60% suspension in mineral oil). 30 min later reaction was quenched by 1.25 mL of acetic acid and concentrated under reduced pressure. The residue was dissolved in DCM, washed by NaHC03 and water and purified by silica gel chromatography in gradient 0.5-3% methanol/DCM. Yield 400 mg (75%) of G4. G5. A mixture of G4 (400 mg) and 400 mg of 10% Pd on charcoal was suspended in 3 mL of methanol, degassed under reduced pressure and put under hydrogen atmosphere with a balloon. Reaction was completed in 1 week. Solvent was evaporated and residue applied at silica gel column. The product was eluted by 6-18 % of methanol/DCM as eluent. Yield 200 mg (75%). Example 51 (1S,3R,4R, 7S) -7-Hydroxy-l-hydroxymethyl-3-(2-W-isobutyryl-guanin-9-yl)-2,5-dioxabicyclo[2.2.l]heptane (51). A mixture of nucleoside 50 (717 mg, 1.31 mmol) and 10% palladium over carbon (500 mg) was suspended in methanol (8 cmJ) . The mixture was degassed several times under reduced pressure and placed under a hydrogen atmosphere. After stirring for 24 h the mixture was purified by silica gel column chromatography using methanol/-dichloromethane (8-20%, v/v) as eluent to give nucleoside 51 as a glass-like solid (440 mg, 92%). SH (CD3OD) 8.12 (1H, br s, 8-H), 5.86 (1H, s, l'-H), 4.50 (1H, s, 2'-H), 4.30 (1H, s, 3'-H), 4.05 (1H, d, J 8.0, l'-H), 3.95 (2H, s, 5'-H), 3.87 (1H, d, J 7.9, 1"-Hb), 2.74 (1H, m, CHCO) , 1.23 (6H, d, .7 6.9, CH3CH) . Sc (CD3OD, signals from the carbohydrate part) 90.2, 87.6 (C-l1, C-4'), 81.1 (C-3'), 72.9, 71.3 (C-2', C-5'), 58.2 (C-l"), 37.1 (COCH) , 19.5 (CH3CH) . FAB-MS m/z 366 [M+H], Example 52 (1R, 3R, 4R, 7S) -1 - (4,4 • -Dimethoxytrityloxymethy 1) -7 -hydroxy-3 - (2 -W-isobutyrylguanin-9-yl)-2,5-dioxabicyclo[2.2.1]heptane (52) . A mixture of compound 51 (440 mg, 1.21 mmol) and 4,4'-dimethoxy-trityl chloride (573 mg, 1.69 mmol) was dissolved in anhydrous pyridine (7 cm3) and was stirred at room temperature for 4 h. The mixture was evaporated under reduced pressure to give an oil. Extraction was performed in a system of dichloromethane/-water (1:1, v/v, 40 cm3). The organic phase was separated and concentrated to give a solution in a minimal volume of dichloromethane containing 0.5% of pyridine (v/v) which was applied to a silica gel column equilibrated by the same solvent. The product was eluted in gradient concentrations of methanol (0.6 - 2%, v/v) in dichloromethane containing 0,5% of pyridine (v/v) to give compound 52 as a white solid material (695 mg, 86%)- SH (CDC13) 12.17 (1H, br s, NHCO), 10.09 (1H, br s, NH), 7.87 (1H, s, 8-H), 7.42-6.72 (13H, m, DMT), 5.69 (1H, s, l'-H), 4.59 m, CHCO), 1.17 (6H, d, J 6.8, CH1-6CH) . 8C (CDC1,) 179.8 (COCH) , 158.8, 144.5, 135.6, 135.5, 130.1, 128.1, 127.7, 126,9, 113.2 (DMT), 155.8, 147.9, 147.5, 137.0, 120.8 (guanine), 87.6, 86.4, 86.1 (C-l', C-4', DMT), 79.7 (C-3'), 72.6, 71.4 (C-2', C-5'), 59.8 (C-l1'), 55.2 (DMT), 36.1 (COCH), 19.1, 18.8 (CH3CH) . FAB-MS m/z 668 [M+H], Example 53 (1R,3R,4R, 7S) -7-(2-Cyeuaoethoxy(diisopropylamiixo)phosphinoxy) -1-(4,4' -dimethoxytrityloxymethyl) -3- (2-tf-isopropyonylguanin-9-yl)-2,5-dioxabicyclo[2.2.1]heptaxie (53). Compound 52 (670 mg, 1.0 mmol) was dissolved in anhydrous dichloromethane (5 cm3) containing itf, i,T-diisopropylethylamine (0.38 cm3, 4 mmol). 2-Cyanoethyl-i,T,.W-diisopropylphosphoramidochloridite (0.36 cm3, 2.0 mmol) was added drop-wise with stirring. After 5 h, methanol (2 cm3) was added and the mixture was diluted to 100 cm3 by addition of dichloromethane and washed with a saturated aqueous solution of sodium hydrocarbonate (50 cm3) . The organic phase was separated and the solvent was removed by evaporation under reduced pressure. The residue was dissolved in the minimun amount of dichloromethane/petroleum ether (1:1, v/v) containing .0.5% pyridine (v/v) and was applied to a column packed with silica gel equilibrated by the same solvent mixture. The column was washed by dichloromethane/petroleum/-pyridine (75:25:0.5, v/v/v, 250 cm3) and the product was eluted using a gradient of methanol in dichloromethane (0-1%, v/v) containing 0.5% pyridine (v/v). The fractions containing the main product were evaporated and co-evaporated with toluene. The residue was dissolved in of anhydrous dichloromethane (5 cm) and precipitated in petroleum ether (100 cm3) to give compound 53 as a white solid material (558 mg, 64%) . Sp (CDC13) 148.17, 146.07. FAB-MS m/z 868 [M+l]+. Example 54 l-(2-0-Acetyl-4-C,-acetoxymethyl-3/5-di-0-benzyl-p-D-ribo- furanosyl)-4-N-Benzoylcytosine (54), To a stirred solution of the anomeric mixture 33 (4.0 g, 8.22 mmol) and 4-itf-benzoyl-cytosine (2.79 g, 13.0 mmol) was added N, O-bis(trimethylsilyl)-acetamide (8.16 cm3, 33.0 mmol). The reaction mixture was stirred for 1 h at room temperature and cooled to 0 °C. Trimethylsilyl triflate (3.0 cm3, 16.2 mmol) was added dropwise and the mixture was stirred at 60 °C for 2 h. Saturated aqueous solutions of sodium hydrogencarbonate (3 x 20 cm3) and brine (2 x 20 cm3) were successively added, and the separated organic phase was dried (Na2S04). The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as fluent to give compound 54 as a white solid material (3.9 g, 74%). 8H (CDC13), 8.28 (1H, d, J" 7.5, 6-H) , 7.94-7.90 (2H, m, 3z), 7.65-7.25 (13H, m, Bn, Bz) , 7.16 (1H, d, J 7.1, 5-H), 6.22 (1H, d, J" 2.8, l'-H), 5.51 (1H, dd, J 2.8, 5.8, 2'-H), 4.62 [lH, d, J" 11.6, Bn) , 4.51 (1H, d, c/12.3, l'-Ha), 4.49-4.34 ;4H, m, 3'-H, Bn), 4.21 (1H, d, J 12.3, 1' '-Hb) , 3.85 (1H, d, J .0.3, 5'-Ha), 3.47 (1H, d, J 10.3, 5'-Hb), 2.13 (3H, s, COCH3) , :.06 (3H, s, COCH,) . 8C (CDC13) 170.52, 169.61 (C=0) , 166.83, 62.27 (C-4, C=0), 154.26 (C-2), 145.26 (C-6), 137.25, 136.93, 33.18, 129.0, 128.75, 128.51, 128,45, 128.18, 128.10, 127.89, 27.71 (Bn, Bz), 96.58 (C-5), 89.42, 86.52 (C-l1, C-4'), 76.21, 75.10, 74.17, 73.70, 69.70, 63.97 (C-2•, C-3', Bn, C-5', C-1'), 20.82 (COCH.) . FAB-MS m/z 664 [M+Na], 642 [M+H] + . Found: C, 65,0; H, 5.7, N, 6.5; C35H35N309 requires C, 65.5; H, 5.5; N, 6.5%. Example 55 l-(3/5-Di-0-benzyl-4-C-hydroxymethyl-p-D-ribofuranosyl) -4-tf-benzoylcytosine (55). To a stirred solution of nucleoside 54 (3.4 g, 5.3 mmol) in methanol (20 cm3) was added sodium methoxide (0.663 g, 11.66 mmol). The reaction mixture was stirred at room temperature for 10 min and then neutralised with 20% aqueous hydrochloric acid. The solvent was partly evaporated and the residue was extracted with dichloromethane (3 x 50 cm3) . The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 20 cm3) and was dried (Na2S04) . The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (98.5:1.5, v/v) as eluent to give compound 55 as a white solid material (1.6 g, 54%). 8H (CDCI3) 9.95 (1H, br s, NH) , 8.33 (1H, d, J 7.4, 6-H), 7.98 (2H, m, Bz) , 7.60-7.12 (14H, m, Bn, Bz, 5-H) , 6.17 (1H, d, J 1.6, l'-H), 4.78 (1H, d, J 11.8, Bn), 4.48-4.27 (5H, m, Bn, 2 -H, 3'-H), 3.85 (1H, d, J' 11.8, 5'-Ha), 3.66-3.61 (2H, m, 5'-Hb, 1'-Ha), 3.47 (1H, d, J 10.4, 1' ' -Hb) . 8C (CDC13) 167.5, 162.31 (C-4, C=0), 155.36 (C-2), 145.34 (C-6) , 137.49, 137.08, 133.09, 133.01, 128.94, 128.67, 128.48, 128.30, 128.01, 127.90, 127.80 (Bn, Bz) , 96.53 (C-5), 93.97, 89.35 (C-l, C-4'), 76.06, 75.28, 73.70, 72.76, 70.26, 62.44 (C-2', C-3', Bn, C-5', C-l1'). FAB-MS m/z 558 [M+H]+. Example 56 Intermediate 56. A solution of nucleoside 55 (2.2 g, 3.94 mmol) in anhydrous tetrahydrofuran (60 cm3) was stirred at -20 °C and a suspension of 60% sodium hydride in mineral oil (w/w, 0.252 g, 6.3 0 mmol) was added in seven portions during 45 min. The solution was stirred for 15 min at -20 °C followed by addition of p-toluenesulfonyl chloride (0.901 g, 4.73 mmol) in small portions. The solution was stirred for 4 h at -20 °C. Additional sodium hydride (0.252 g, 6.30 mmol) and p- toluenesulfonyl chloride (0.751 g, 3.93 mmol) was added. The reaction mixture was kept at -2 0 °C for 48 h. The reaction was quenched by addition of ice-cold water (50 cm3) whereupon extraction was performed with dichloromethane (3x 60 cm3) . The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 20 cm3) and dried (Na2S04). The solvent was evaporated under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give the intermediate 56 (1.80 g, 64%). Example 57 (IS, 3R, 4R, 7S) -7-Benzyloxy-l-benzyloxymethyl-3- (4-tf-benzoyl-cytosin-l-yl)-2,5-dioxabicyclo[2.2.1]heptane (57) • Intermediate 56 (1.80 g, 2.52 mmol) was dissolved in anhydrous DMF (30.0 cm3) and a 60% suspension of sodium hydride in mineral oil (w/w, 0.16 g, 3.9 mmol) was added in five portions during 3 0 min at 0 °C. The reaction mixture was stirred for 36 h at room temperature. The reaction was quenched by adding ice-cold water (70 cm3) and the resulting mixture was extracted with dichloromethane (3 x 50 cm3) . The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3x30 cm3) and dried (Na2S04) . The solvents were removed under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (99.5:0.5, v/v) as eluent to give compound 57 as a white solid material (1.08 g, 79%). 8H (CDC13) 8.95 (1H, br s, NH), 8.20 (1H, d, J 7.5, 6-H) , 7.95-7.92 (2H, m, Bz) , 7.66-7.22 (14H, m, Bn, Bz, 5-H), 5.78 (1H, s, l'-H), 4.70-4.65 (3H, m, 2'-H, Bn), 4.60 (1H, d, J 11.6, Bn), 4.47 (1H, d, J 11.6, Bn), 4.05-3.78 (5H, m, 3'-H, 5'-Ha, 1' '-Ha, 5'-Hb, 1' ' -Hb) . 8C (CDC13) 167.0, 162.36 (C-4, C=0), 154.5 (C-2), 144.58 (C-6), 137.46, 136.93, 133.35, 132.93, 129.11, 128.67, 128.50, 128.16, 128.11, 127.68, 127.60 (Bn) , 96.35 (C-5), 88.38, 87.67 (C-l', C-4'), 76.14, 75.70, 73.79, 72.27, 72.09, 64.34 (Bn, C-5', C-1', C-2', C-3 ' ) . FAB-MS m/z 540 [M+H], Found: C, 68.0; H, 5.5, N, 7.5; C33 H29 N3,O1 requires C, 69.0; H, 5.4; N, 7.8%). Example 57A (IS, 3R,4Rf 7S)-7-Hydroxy-l-hydroxymethyl-3-(cytosin-1-yl)-2,5-dioxabicyclo[2.2.1]heptane (57A)• To a solution of nucleoside 57 (0.3 g, 0.55 mmol) in anhydrous methanol (22 cm3) were added 1/4-cyclohexadiene (5.0 cm3) and 10% palladium on carbon (0.314 g) . The mixture was stirred under reflux for 18 h. Additional 10% palladium on carbon (0.380 g) and 1,4-cyclohexadiene (5.5 cm3) were added and the mixture was refluxed for 54 h. The reaction mixture was filtered through a pad of silica gel which was subsequently washed with methanol (1500 cm3) . The combined filtrate was evaporated under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/methanol (92.5:7.5, v/v) as eluent to give compound 57A as a white solid material (0.051 g, 3 6%). 5H ((CDj1-6SO) 7.73 (1H, d, J 1.1, 6-H) , 7.12-7.20 (2H, br s, NH2) , 5.74 (1H, d, J 1.1, 5-H), 5.61 (1H, br s, 3'-OH), 5.39 (1H, s, 1' -H), 5.12 (1H, m, 5'-OH), 4.08 (1H, s, 2'-H), 3.80 (1H, d, J 1.1, l-'-HJ, 3.81 (1H, s, 3'-H), 3.74 (2H, m, 5'-Ha, 5 '-Hb) , 3.63 (1H, d, J 1.1, l'-Hb). 8c ((CD3)2SO) 165.66 (C-4), 154.58 (C-2), 139.68 (C-6), 93.19 (C-5), 88.42, 86.73 (C-l', C-4'), 78.87, 70.85, 68.32, 56.04 (C-2 , C-l' ', C-3', C-5'). FAB-MS m/z 256 [M+H], Example 57B Intermediate (57B). To nucleoside 57A (0.030 g, 0.11 mmol) suspended in anhydrous pyridine (2.0 cm3) was added trimethylsilyl chloride (0.14 cm3, 1.17 mmol) and stirring was continued for Ih at room temperature. Benzoyl chloride (0.07 cm3, 0.58 mmol) was added at 0 °C and the mixture was stirred for 2 h at room temperature. After cooling the reaction mixture to 0 °C, water (3.0 cm3) was added. After stirring for 5 min, an aqueous solution of ammonia (1.5 cm3, 32%, w/w) was added and stirring was continued for 3 0 min at room temperature. The mixture was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography using dichloromethane/methanol (97.5:2.5, v/v) as eluent to give intermediate 57B as white solid material (0.062 g ). Example 57C (1R, 3R, 4R, 7$) -1- (4,4' -Dimethoxytrityloxymethyl) -7-hydroxy-3- (4-tf-benzoylcytosine-1-yl) 2,5-dioxabicyclo[2.2.l]heptane (57C) . To a solution of intermediate 57B (0.042 g, 0.11 mmol) in anhydrous pyridine (1.5 cm3) was added 4, 4'-dimethoxytrityl chloride (0.06 g, 0.17 mmol). The reaction mixture was stirred at room temperature for 3.5 h, cooled to 0 °C, and a saturated aqueous solution of sodium hydrogencarbonate (2 0 cm3) was added. Extraction was performed using dichloromethane (3 x 10 cm3), the combined organic phase was dried (Na2S04) and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol/pyridine (98.0:1.5:0.5, v/v/v) as eluent to give nucleoside 57C as a white solid material (0.031g, -63% from 57A) . 8H (C5D5N) 12.32 (1H, br s, NHCO) , 8.75-7.06 (20H, m, DMT, Bz, H-5, H-6), 6.24 (1H, s, l'-H), 5.11 (1-H, s, 2'-H), 4.90 (1H, s, 3'-H), 4.38 (1H, d, J 7.6, 1'-HJ, 4.10 (1H, d, J 7.6, 1'-Hb), 4.02 (1H, d, J" 10.6, 5'-HJ, 3.87 (1H, d, J 10.6, 5'-Hb), 3.77, 3.76 (2 x 3H, 2 x s, 2 x OCH3). 5C (C5D5N) 169.00 (NHCO), 164.24 (C-2), 159.39 (DMT), 150.5, 145.62 (DMT), 144.31, 132.89, 130.82, 130.72, 129.09, 128.89, 128.60, 113.96 (DMT), 96.96 , 89.01, 87.18, 79.91, 72.56, 70.25 (C-5, C-l' , C-4 ' , C-2', C-l1-6C-S'), 59.51 (C-5'), 55.33 (OCH3) . FAB-MS m/z 662 [M+H]+. Example 57D (1R, 3R, 4R, 7S) -7- (2-Cynoethoxy(diisopropylamino)phosphinoxy) -1-(4,4 ' -dimethoxytrityloxymethyl) -3-(4-tf-benzoylcytosine-1-yl) -2,5-dioxabicyclo[2.2.1]heptane (57D). To a solution of nucleoside 57C (0.025 g, 0.03 mmol) in anhydrous dichloromethane (1.5 cm3) was added N,iV-diisopropylethylamine (0.03 cm3, 0.17 mmol) followed by dropwise addition of 2-cyanoethyl N,itf-diisopropylphosphoramidochloridite (0.02 cm3, 0.09 mmol). After stirring for 5h at room temperature, the reaction mixture was cooled to 0 °C, dichloromethane/pyridine (10.0 cm3, 99.5:0.5, v/v) was added, and washing was performed ising a saturated aqueous solution of sodium hydrogencarbonate (3x8 cm3) . The organic phase was separated, dried (Na2SQ4) and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol/pyridine (99.0:0.5:0.5, v/v/v) as eluent to give amidite 57D as a light yellow oil (0.038 g) . 8P (CDCI3) 147.93. Example 58 9-(2-0-Acetyl-4-C-acetyloxymethyl-3f 5-di-0-benzyl-p«D-ribofuranosyl) -6-Jtf-benzoyladenine (58) • To a stirred suspension of the anomeric mixture 33 (5.0 g, 10.3 mmol) and 6-N-benzoyladenine (3.76 g, 15.7 mmol) in anhydrous dichloromethane (200 cm3) was added N, O-bis (trimethylsilyl) acetamide (15.54 cm3, 61.8 mmol). The reaction mixture was stirred at reflux for 1 h and then cooled to room temperature. Trimethylsilyl triflate (7.0 cm3, 38.7 mmol) was added dropwise and the mixture was refluxed for 20 h. The reaction mixture was allowed to cool to room temperature and the volume of the mixture was reduced to 1/4 under reduced pressure. Dichloromethane (250 cm3) was added, and the solution was washed with a saturated aqueous solution of sodium hydrogencarbonate (3 x 50 cm3) and water (50 cm3) . The organic phase was dried (Na2S04) and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol (99.5:0.5, v/v) as eluent to give nucleoside 58 as white solid material (3.65 g, 52%). 8H (CDCI3) 9.25 (1H, br s, NH) , 8.71 (1H, s, 8-H) , 8.24 (1H, s, 2-H), 8.0 (2H, d, J 7.5, Bz), 7.60-7.23 (13H, m, Bn, Bz), 6.35 (1H, d, J 4.6, 1'-H), 5.99 (1H, dd, cJ4.9, 5.3, 2'-H) , 4.78 (1H, d, J" 5.6, 3 '-H) , 4.64-4.42 (5H, m, Bn, 1' ' -Ha ) , 4.25 (1H, d, J" 12.1, l'-Hb), 3.72 (1H, d, J 10.1, 5' -Ha) , 3.56 (1H, d, J 10.1, 5'-Hb), 2.07 (3H, s, COCH3) , 2.02 (3H, s, COCH3) . 5C (CDCI3) 170.42, 169.72 (COCH3) , 164.60 (NHCO) , 152.51 (C-6), 151.45 (C-2), 149.46 (C-4), 141.88 (C-8), 137.04, 137.00, 133.50, 132.60, 128.86, 128.66, 128.53, 128.41, 128.38, 128.18, 128.06, 127.91, 127.88, 127.79, 127.63, 123.26 (Bz, Bn, C-5), 86.38 (C-l'), 86.25 (C-4'), 77.74, 74.74, 74.44, 73.48 (C-21, C-3, 2 x Bn) , 70.11 (C-l' ' ), 63.42 (C-5'), 20.70, 20.54 (COCH3) . FAB-MS m/z 666 [M+H], Example 59 9- (3,5-Di-a-benzyl-4-C-hydroxymethyl-p-D-ribofuranosyl) -6-N- benzoyladenine (59). To a stirred solution of nucleoside 58 (4.18 g, 6.28 mmol) in methanol (50 cm3) was added sodium methoxide (0.75 g, 13.8 mmol) at 0 °C. The reaction mixture was stirred for 2 h, and ice was added. The mixture was neutralised using a 20% aqueous solution of HC1. Extraction was performed using dichloromethane (3 x 75 cm3) , the organic phase was separated, dried (Na2S04) and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol (98.5:1.5, v/v) as eluent to give nucleoside 59 as a white solid material (2.68 g, 73%). 8H (CDCI3) 9.42 (1H, br s, NH), 8.58 (1H, s, H-8), 8.16 (1H, s, 2-H) , 7.96 (2H, d, J 7.2, Bz) , 7.52-7.08 (13H, m, Bn, Bz), 6.18 (1H, d, J 2.5, l'-H), 4.85-4.38 (4H, m, Bn, 2'-H, 3'-H), 4.33 (2H, s, Bn) 3.90 (1H, d, J 11.9, 1' '-Ha) , 3.71 (1H, d, J 11.8, l'-Hb), 3.50-3.39 (2H, m, 5-H) . 5C (CDC13) 164.98 (NHCO) , 152.19 (C-6), 151.00 (C-2), 149.34 (C-4), 142.28 (C-8), 137.32, 137.25, 133.46, 132.70, 128.69, 128.49, 128.40, 128.11, 128.03, 127.94, 127.83, 127.62, (Bz, Bn) , 122.92 (C-5), 90.94, 88.75 (C-l, C-4'), 77.65, 74.08, 73.44, 73.20, 71.12, 62.39 (C-l'■, C-5', C-21, C-3', 2 x Bn) . FAB-MS m/z 582 [M+H], Found: C, 65.6; H, 5.5; N, 11.7; C32H31N506 requires C, 66.1; H, 5.4; N, 12.0%. Example 60 Intermediate 60. A solution of nucleoside 59 (2.43 g, 4.18 mmol) in anhydrous tetrahydrofuran (25 cm3) was stirred at -20 °C and a 60% suspension of sodium hydride in mineral oil (w/w, 0.28 g, 7.0 mmol) was added in four portions during 30 min. After stirring for 1 h, p-toluenesulfonyl chloride (1.34 g, 7.0 mmol) was added in small portions. The mixture was stirred at -10 °C for 15 h. Ice-cold water (50 cm3) was added and extraction was performed with dichloromethane (3 x 50 cm3) . The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (2 x 25 cm3) , dried (Na2S04) and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give the intermediate 60 (1.95 g) . ., Example 61 (IS, 3R, 4R, 7S) -7-Benzyloxy-l-benzyloxymethyl-3-(6-tf-benzoyl-adenin-9-yl) -2,5-dioxabicyclo [2'2.1]heptane (61) • Intermediate 60 (1.90 g) was dissolved in anhydrous DMF (20 cm3) and a 60% suspension of sodium hydride in mineral oil (w/w, 0.16 g, 3.87 mmol) was added in small portions at 0 °C. The mixture was stirred for 10 h at room temperature and then concentrated under reduced pressure. The residue was dissolved in dichloromethane (75 cm3) , washed with a saturated aqueous solution of sodium hydrogencarbonate (2 x 25 cm3) , dried (Na2S04) , and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give nucleoside 61 as white solid material (1.0 g, -44% from 59). 8H (CDC13) 8.71 (H, s, 8-H) , 8.23 (1H, s, 2-H), 8.02 (2H, m, J 7.0, Bz), 7.99-7.19 (13H, m, Bn, Bz), 6.08 (1H, s, l'-H), 4.78 (1H, s, 2'-H), 4.61-4.50 (4H, m, 2xBn), 4.24 (1H, s, 3'-H), 4.12 (1H, d, J 7.8, l-'-Hj, 4.00 (1H, d, J 7.9, l'-Hb), 3.85-3.78 (2H, m, 5'-Ha, 5' -Hb) . 8C (CDC13) 164.61 (NHCO), 152.32 (C-6), 150.61 (C-2), 149.35 (C-4), 140.67 (C-8), 137.24, 136.76, 133.33, 132.66, 128.68, 128.39, 128.29, 127.94, 127.77, 127.51 (Bn, Bz), 123.43 (C-5), 87.14, 86.52 (C-l', C-4-), 77.21, 76.77, 73.56, 72.57, 72.27, 64.65 (C-21, C-3, C-l1', 2 x Bn, C-5'). FAB-MS m/z 564 [M+H], Found: C, 66.2; H, 5.5; N, 11.4; C32H29N505 requires C, 66.2; H, 5.2; N, 12.4%. Example 61A (IS, 3R, 4R, 7S) -7-Hydroxy-l-hydroxymethyl-3- (adenin-9-yl) -2,5-dioxabicyclo[2.2.1]heptane (61A). To a stirred solution of nucleoside 61 (0.80 g, 1.42 mmol) in anhydrous dichloromethane (30 cin ) at -78 C was dropwise during 3 0 min added BC13 (1 M solution in hexane; 11.36 cm3, 11.36 mmol). The mixture was stirred for 4 h at -78 °C, additional BC13 (1M solution in hexane, 16.0 cm3, 16.0 mmol) was added drop wise, and the mixture was stirred at -78 °C for 3 h. Then temperature of the reaction mixture was raised slowly to room temperature and stirring was continued for 30 min. Methanol (25.0 cm3) wa$ added at -78 °C, and the mixture was stirred at room temperature for 12 h. The mixture was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography using dichloromethane/methanol (92:8, v/v) as eluent to give nucleoside 61A as a white solid material (0.332 g, 84%). 8H ((CD3)2SO) 8.22 (1H, s, 8-H) , 8.15 (1H, s, 2-H) , 7.33 (2H, s, NH2), 5.89 (1H, s, l'-H), 5.83 (1H, d, J4.2, 3'-OH), 5.14 (1H, t, J 5.9, 5'-OH), 4.14 (1H, s, 2'-H), 4.25 (1H, d, J 4.2, 3'-H), 3.92 (1H, d, J 7.8, l'-Ha), 3.81-3.41 (3H, m, 5'-Ha, 5'-Hb, l'-Hb). 8C ((CD3)2SO) 155.90 (C-6), 152.64 (C-2), 148.35 (C-4), 137.72 (C-8), 118.94 (C-5), 88.48, 85.17 (C-l, C-4'), 79.09, 71.34, 69.83, 56.51 (C-21, C-3', C-l' ' , C-5'). FAB-MS m/z 280 [M+H]+. Example 6IB (IS, 3R, 4R, 7S) -7-Hydroxy-l-hydroxymethyl-3- (6-tf-benzoyladenin-9-yl)-2,5-dioxabicyclo[2.2.13heptane (61B)• To a stirred solution of nucleoside 61A (0.32 g, 1.15 mmol) in anhydrous pyridine (1 cm3) was added trimethylsilyl chloride (0.73 cm3, 5.73 mmol) and the mixture was stirred at room temperature for 20 min. Benzoyl chloride (0.67 cm3, 5.73 mmol) was added at 0 °C, and the reaction mixture was stirred at room temperature for 2 h. The reaction mixture was cooled to 0 °C and ice-cold water (15.0 cm3) was added. After stirring for 5 min, a 32% (w/w) aqueous solution of ammonia (1.5 cm3) was added and the mixture was stirred for 30 min. The mixture was evaporated to dryness and the residue was dissolved in water (25 cm3) . After evaporation of the mixture under reduced pressure, the residue was purified by silica gel chromatography using dichloromethane/methanol (97:3, v/v) as eluent to give nucleoside 61B as a white solid material (0.55 g). FAB-MS m/z 384 [M+H], Example 61C (1R, 3R, 4R, 7S) -7-Hydroxy-l- (4,4 ' -dimethoxytrityloxymethyl) -3- (6-N-benzoyladenin-9-yl)-2,5-dioxabicyclo[2.2.1]heptane (61C). To a stirred solution of compound 61B (0.50 g) in anhydrous pyridine (20 cm3) was added 4,4'-dimethoxytrityl chloride (0.71 g, 2.09 mmol) and 4-dimethylamino pyridine (0.1 g). After stirring for 2 h at room temperature and for 1 h at 50 °C, the reaction mixture was cooled to 0 °C and a saturated aqueous solution of1-6sodium hydrogencarbonate (100 cm3) was added. After extraction using dichloromethane (3 x 50 cm3) , the combined organic phase was dried (Na2S04) and evaporated under reduced pressure. The residue was purified by silica gel column chromatography eluting with dichloromethane/methanol/pyridine (98.0:1.5:0.5) to give nucleoside 61C as a white solid material (0.36 g, -50% from 61A) . 5H (C5D5N) 12.52 (NHCO), 9.10 (2H, d, J 7.7, Bz), 8.88 (1H, s, 8-H), 8.50-7.11 (17H, m, DMT, Bz, 2-H) , 6.65 (1H, s, H-l'), 5.25 (2H, s, H-2 ' , H-3'), 4.71 (1H, d, J 7.8, l'-Ha), 4.56 (1H, d, J7.8, 1 ' ' -Hb) , 4.20 (1H, d, J 10.8, 5'-Ha), 4.07 (1H, d, J 10.8, 5 ' -Hb) , 3.82, 3.81 (2 x 3H, 2 x s, 2 x OCH3). 8C (C5D5N) 167.56 (NHCO) , 159.24 (C-6) , 152.50, 152.08, 151.81, 145.84, 141.45, 136.52, 136.28, 132.55, 130.76, 130.70, 129.32, 128.85, 128.76, 128.46, 127.38, 126.33 (DMT, Bz, C-2, C-4, C-8), 113.84 (C-5), 88.64, 87.20, 86.85, 80.52, 73.13, 72.16, 60.86 (C-l', C-4', DMT, C-2', C-3', C-l' ', C-5'), 55.24 (OCH3) . FAB-MS m/z 686 [M+H], Found: C, 68.3; H, 5.0; N, 9.7; C39H35N507 requires C, 68.3; H, 5.1; N, 10.2%). Example 6ID (22?,3R, 4R, 7S) -7- (2-Cynoethoxy(diisopropylamino)phosphinoxy) -1-(4,4' -dimethoxyt rityloxymethyl) -3- (6-W-benzoyladexiin-9-yl)-2,5-dioxabicyclo[2.2.1]heptane (61D). To a solution of compound 61C (190 mg, 0.277 mmol) in anhydrous dichloromethane (1.5 cm3) were added iV, N-diisopropylethylamine (0.16 cm3, 0.94 mmol) and 2-cyanoethyl N,2/-diisopropylphosphoramidochloridite (0.1 cm3, 0.42 mmol) at 0°C. The mixture was allowed to warm to room temperature and stirred for 5h. The solution was diluted by dichloromethane (50 cm3) , washed by a saturated aqueous solution of sodium hydrogencarbonate (2 x 30 cm3) and evaporated under reduced pressure. The products were isolated by silica gel HPLC (PrepPak cartridge, 25 x 100 mm, packed by Prep Nova-Pak® HR Silica 6|im 60A; gradient of solution B in solution A (from 0% to 15% during 25 min and from 15% to 100% during another 25 min, solution A: petroleum/dichloromethane/-pyridine, 60/39.6/0.4, v/v/v, solution B: ehylacetate. The fractions containing the two main products (retention times 30- 40 min) were jointed, concentrated under reduced pressure, co-evaporated with anhydrous toluene (2 x 40 cm3) and dried overnight in vacuo. The residue was dissolved in anhydrous dichloromethane (4 cm3) and precipitated by adding this solution anhydrous petroleum ether (80 cm3) under intensive stirring. The precipitate was collected by filtration, wash by petroleum ether (2 x 20 cm3) and dried under reduced pressure to give compound 61D (178 mg, 73%) as white solid material. 8P (CD3CN) 148,42, 147.93. Example 62 1- (2,3-0-isopropylidene-4-C-(4-toluenesulphonyloxymethyl) -p-D- ribofuranosyl)uridine (62). To a stirred solution of l-(2,3-0- isopropylidene-4 ' -C-hydroxymethyl-|3-D-ribof uranosyl) uridine (2.0 g, 6.4 mmol) (R. Youssefyeh, D. Tegg, J. P. H. Verheyden, G. H. Jones and J. G. Moffat, Tetrahedron Lett., 1977, 5, 435; G. H. Jones, M. Taniguchi, D. Tegg and J. G. Moffat, J, Org. Chem., 1979, 44, 1309) in anhydrous pyridine (28 cm3) was added p-toluenesulfonyl chloride (1.46 g, 7.3 mmol) dissolved in anhydrous pyridine (10 cm3) at -30 °C. After 30 min, the reaction mixture was allowed to reach room temperature and stirring was continued at room temperature for 12 h. The reaction was quenched with methanol (4 cm3), silica gel (2g) was added and the.solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography using a gradient of 0-3% methanol in dichloromethane (v/v) as eluent to give nucleoside 62 as a pale reddish solid material (1.8 g, 60%). 8H (CDC13) 9.80 (1H, br s, NH) , 7.80 (2H, d, J 8.3, Ts), 7.46 (1H, d, J" 8.1, 6-H) , 7.35 (2H, d, J' 8.01, Ts) , 5.72 (1H, d, J 8.0, 5-H), 5.54 (1H, d, J 3.5, l'-H), 5.08 (1H, dd, J 3.5, 6.4, 2'-H), 4.94 (1H, d, J 6.4, 3'-H), 4.18 (2H, s, l'-H), 3.82-3.70 (2H, m, 5'-H), 2.45 (3H, s, Ts), 1.46, 1.29 (6 H, s, CH3) . 8C (CDCI3) 163.6 (C-4), 150.4 (C-2), 145.2 (C-6) , 142.9, 132.5, 129.9, 128.0 (Ts), 114.7 (OCO), 102.6 (C-5), 94.9, 87.6, 83.9, 81.5 (C-4', Ol', C-3' , C-2'), 68.7, 63.5 (C-l', C-5'), 26.4, 24.7 (CH3) , 21.7 (Ts) . FAB-MS m/z 469 [M+H], Example 63 1- (4-C- (Tosyloxymethyl-p-D-ribofuranosyl)uridine (63) . Nucleoside 62 (1.33 g, 2.83 mmol) was dissolved in 80% acetic acid (25 cm3) and stirred at 80 °C for 3 h whereupon the solvent was removed under reduced pressure. The residue was coevaporated with ethanol (10 cm3) and purified by silica gel column chromatography using a gradient of 0-2% methanol in dichloromethane (v/v) as eluent to give nucleoside 63 as a white solid material (391 mg, 33%). 8H (CD3OD) 7.81 (1H, d, J 8.1, 6-H), 7.77 (1H, d, J 8.4, Ts), 7.40 (2H, d, J 8.6, Ts), 5.74 (1H, d, J 6.6, l'-H), 5.69 (1H, d, J 8.1, 5-H), 4.17-4.33 (2H, m, 2'-H, 3'-'), 3.67-3.62 (2H, m, l'-H), 3.26-3.20 (2H, m, 5'-H), 2.43 (3H, s, Ts) . 8C (CD3OD) 166.0 (C-4), 153.0 (C-2), 146.5 (C-6), 142.5, 130.9, 129,15 (Ts), 103.1 (C-5), 89.0, 87.2 (C-l, C-4'), 75.1, 72.7, 71.3, 63.8 (C-l', C-3', C-2', C-5'), 21.6 (Ts). Example 64 (IS,3R,4R,7S) -7-Hydroxy-l-hydroxymethyl«3-(uracil-1-yl)-2,5-dioxabicyclo[2.2.1]heptane (44). To a stirred solution of nucleoside 63 (64 mg, 0'14 mmol) in anhydrous DMF (2 cm3) was slowly added sodium hydride (8.4 mg, 21 mmol, 60% suspension in mineral oil, w/w) in anhydrous DMF (2 cm3) at 0 °C. The reaction mixture was then heated to 120 °C for 6 h. After quenching the reaction with water (2 cm3) , the solvents were removed under reduced pressure and the residue was purified by silica gel column chromatography using a gradient of 5-7% methanol in dichloromethane (v/v) as eluent to give nucleoside 44 as a white solid material (9 mg, 29%). NMR data were in agreement with those reported earlier for compound 44. Example 64A (lS,3R,4Rr 75)-7-Acetoxy-l-acetoxymethyl-3-(thymin-l-yl) -2,5-dioxabicyclo[2.2.1]heptane (64). To a stirred solution of nucleoside 37 (209.8 mg, 0.78 mmol) in anhydrous pyridine (2.5 cm3) was added acetic anhydride (0.3 cm3, 3.23 mmol) and a catalytic amount of N, itf-dimethylaminopyridine (5 mg). After stirring for 2 h, ethanol was added (4 cm3) and the mixture was evaporated under reduced pressure. The residue was redissolved in dichloromethane, washed with a saturated aqueous solution of sodium hydrogencarbonate (7 cm3) . The organic phase was dried (Na2S04), and evaporated under reduced pressure. The residue was purified by, silica gel column chromatography using dichloromethane/methanol (97:3, v/v) as eluent affording 64 as a white solid material (249 mg, 90%). 5C (CDC13) 169.59, 163.20, 149.50, 133.55, 110.64, 87.05, 85.38, 77.84, 71.70, 71.02, 58.60, 20.62, 20.53, 12.78. FAB-MS m/z 355 [M+H], Example 64B (IS, 3R, 4R, 7S) -l-Hydroxymethyl-3- (5-methyl-4-J7-benzoylcytosine-l-yl)-7-hydroxy-2,5-dioxabicyclo[2.2.1]heptane (65). To a solution of nucleoside 64 (232.7 mg, 0.66 mmol) in anhydrous acetonitrile (3 cm3) was added a solution of 1,2,4-triazole (42 0 mg, 6.1 mmol) and P0C13 (0.12 cm3, 1.3 mmol) in anhydrous acetonitrile (5 cm3) . The reaction mixture was cooled to 0 °C and anhydrous triethylamine (0.83 cm3) added, whereupon the mixture was kept for 90 min at room temperature. Triethylamine (0.54 cm3) and water (0.14 cm3) was added, and the reaction mixture was stirred for 10 min and evaporated under reduced pressure. The residue was dissolved in EtOAc and washed with a saturated aqueous solution of sodium hydrogencarbonate (2x9 cm3) and water (9 cm3) . The aqueous phase was extracted with dichloromethane (3x20 cm3) . The combined organic phase was evaporated under reduced pressure and the residue was redissolved in dioxane (4 cm3) , whereupon 32% aqueous ammonia (0.7 cm3) was added. After stirring for 3 h, the reaction mixture was evaporated under reduced pressure and coevaporated with anhydrous pyridine. The residue was dissolved in anhydrous pyridine (3.6 cm3) and benzoyl chloride (0.42 cm3, 3.6 mmol) was added. After stirring for 2 h, the reaction was quenched with water (1 cm3) and the reaction mixture was evaporated under reduced pressure. The residue was then redissolved in EtOAc and washed with water (3x7 cm3) . The organic phase was evaporated under reduced pressure, and the residue was dissolved in pyridine/methanol/water (13:6:1, v/v/v, 14 cm3) at 0 °C, and a 2M solution of NaOH in pyridine/methanol/water (13:6:1, v/v/v, 7 cm3) was added. After stirring for 2 0 min, the reaction mixture was neutralised using a 2M solution of HC1 in dioxane, and the reaction mixture was evaporated under reduced pressure. The residue was purified by silica column chromatography using dichloromethane/methanol (95:5, v/v) as eluent to give nucleoside 65 as a yellow foam (94.6 mg, 38%). 8H (CD3OD) 8.21 (1H, br, s), 8.02 (1H, m) , 7.84-7.9 (1H, m) , 7.41-7.58 (4H, m) , 5.61 (1H, s) , 4.36 (1H, s)., 4.10 (1H, s) , 5 3.98 (1H, d, J" 8.0), 3.94 (2H, s) , 3.78 (1H, d, J 7.9), 2.11 (3H, d, J 1.0). 8C (CD3OD, selected signals) 133.66, 132.90, 130.63, 129.50, 129.28, 128.65, 90.71, 88.86, 80.57, 72.47, 70.22, 57.53, 14.01. FAB-MS m/z 374 [M+H]+. ) Example 64C (1R, 3R,4R, 75)-l-(4/4'-Dimethoxytrityloxymethyl)-3-(5-methyl-4-1-6-benzoylcytosine-1-yl) -7-0- (2-cyanoethoxy(diisopropylamino) -phosphino)-2,5-dioxabicyclo[2.2,1]heptane (66). To a stirred solution of nucleoside 65 (82 mg, 0.22 mmol) in anhydrous pyridine (1.5 cm3) was added 4,4'-dimethoxytrityl chloride (80 mg, 0.24 mmol) and stirring was continued at room temperature for 12 h. Additional 4,4'-dimethoxytrityl chloride (80 mg, 0.24 mmol) was added, and stirring was continued for another 12 h. Methanol (0.5 cm3) was added and the reaction mixture was evaporated under reduced pressure. The residue was subjected to silica gel column chromatography using dichloromethane/-methanol/pyridine (98.5:1.0:0.5, v/v/v). The resulting intermediate (FAB-MS m/z 676) (50.2 mg) was coevaporated with anhydrous acetonitrile and dissolved in anhydrous dichloro-methane (0,62 cm3). N,N-Diisopropylethylamine was added (0.1 cm3) followed by addition of 2-cyanoethyl N,N-diisopropyl-phosphoramidochloridite (0.3 cm3, 0.11 mmol). After stirring for 3 h at room temperature, water (1 cm3) was added and the resulting mixture was diluted with ethylacetate (10 cm3) , washed with saturated aqueous solutions of sodium hydrogen-carbonate (3x6 cm3) and brine (3x6 cm3) . The organic phase was dried (Na2S04) and evaporated under reduced pressure. The residue was purified by silica gel column HPLC. Precipitation as described for 53 afforded compound 66 as a white solid material (29.5 mg, 0.03 mmol, 14%). 8P (CH3CN) 148.46, 147.49. Example 64D 9-(4-(Hydroxymethyl)-2,3-O-isopropylidene-p-D-ribofuranosyl)-6- W-benzoyladenine (67). A mixture of oxalyl chloride (0.93 mL, 10.75 mmol)'and dichloromethane (25 mL) was cooled to -70 °C. Dimethyl sulfoxide (1.7 mL, 22 mmol) was added drop-wise under intensive stirring. The mixture was stirred for 10 min at -70 °C and a solution of 9-(2,3-0-isopropylidene-p-L>-ribo- furanosyl) -6-iV-benzoyladenine (3.4 g, 8.27 mmol) in dimethyl-sulfoxide/dichloromethane (1:9 v/v, 20 mL) was added during 5 min. The mixture was stirred at -60 °C for 3 0 min. Triethyl- amine (7 mL, 50,3 mmol) was added and the mixture was allowed to warm to room temperature. The solution was diluted by dichloromethane (50 mL) and washed by water (3 x 100 mL). Water fractions were additionally washed by 100 mL of dichloromethane. The organic phase was concentrated to oily mass, co-evaporated with dioxane (50 mL) and re-dissolved in 3 0 mL of dioxane. 37% aq. formaldehyde (2.95 mL, 33.4 mmol) and 2M aq. NaOH (8.26 mL) were added; the mixture was stirred at room temperature for 10 min and cooled to 0 °C. Sodium borohydride (640 mg, 16.9 mmol) was added and the reaction mixture was allowed to warm to room temperature during 15 min. The reaction was quenched by addition of acetic acid (5 mL) and to the mixture was added dichloromethane and a saturated aqueous solution of sodium hydrogen carbonate (100 mL each). The organic phase was washed with water (100 mL), concentrated in vacuo and the p2roduct was isolated by column (2.5 x 25 cm) silica gel chromatography by the use of 2 - 3.2 % of methanol/dichloromethane (v/v) as eluent. Yield 1.85 g (50.7 %) of compound 67 as a white solid material. 8H (CDC13) 8.72 (1H, s), 8.14 (1H, s), 8.03-8.00 (2H, m) , 7.60-7.57 (1H, m), 7.56-7.46 (2H, m) , 6.00 (1H, d, J4.9), 5.35 (1H, dd, J'5.8, J""5.0), 5.13 (1H, d, J5.8), 3.87-3.78 (4H, m),, 1.65 (3H, s), 1.38 (3H, s). 8C (CDC13) 164.8, 152.2, 150.4, 150.2, 142.6, 133.3, 132.9, 128.8, 128.0, 124.1, 114.7, 93.3, 90.2, 83.8, 82.5, 65.3, 62.9, 27.3, 25.1. FAB-MS: m/z 442 [M+H]+, 464 [M+Na], Example 64 Dl Alternative synthesis of 67. To a solution of 2',3'-0-isopropylidenadenosine (15 g) in dry pyridine (250 mL) was added trimethylsily1 chloride (15.5 mL) . The reaction mixture was stirred at room temperature for 20 min and cooled to 0° C. Benzoyl chloride (17 mL) was added drop wise and the mixture was kept at ambient temperature for 2-3 h. Water (50 mL) and 25 % aq. ammonium hydroxide (100 mL) was added stirred for 3 h. Then the mixture was concentrated under reduced pressure, co-evaporated with toluene (2 x 200 mL) and DCM and saturated sodium hydrogencarbonate was added. The organic phase was evaporated to dryness to give a yellow solid. Recrystallisation from ethanol resulted in 12.5 g (ca 80 %) as a white solid intermediate material. Oxalyl chloride (4.68 mL) in dry DCM (120 mL) was cooled to -70° C. DMSO (8.5 mL) was added during intensive stirring. Later (10 min) a solution of the intermediate for which the synthesis is described above (17 g) in 1(1' DMSO/DCM (100 mL) added dropwise (20 min) . The temper at u re was allowed to increase to -50° C over a period of 30 min after which the reaction was quenched with triethylamine (35 mL). To the mixture was added DCM (2 00 ml) which was washed with water (3 x 200 mL). The intermediate was concentrated in vacuo , co-evaporated with dioxane, and re-dissolved in dioxane (120 mL). Formaldehyde (37 %) and 2 M aq. sodium hydroxide (40 mL) was added and the reaction mixture was stirred for 1 h. The mixture was neutralised with acetic acid (6 mL) and DCM (400 ml) and saturated sodium hydrogencarbonate (400 mL) was added. The organic phase was concentrated. The product 67 was purified by column chromatography (silica gel, 1.5 - 5.0 % methanol/ DCM). Yield 8.5 g (46 %) of 67. Example 64E 9-(2,3~0-Isopropylidene-4-(4'-toluenesulfonyloxymethyl)-P-D- ribofuranosyl)-6-N-benzoyladenine (68) and 9-(4-hydroxymethyl- 2,3-0-isopropylidene-5-0-(4■-toluenesulfonyl)-p-D-ribo~ furanosyl)-6-N-benzoyladenine. A mixture of compound 67 (1.95 q, 4.42 mmol) and p-toluenesul f onyl chloride (1.26 g, 6.61 mmol) was dissolved in 10 mL of anhydrous pyridine at 0 °C. The reaction mixture was stirred for 4 h and then diluted by dich1oromethane (100 mL), washed with water (2x100 mL) and concent rated under reduced pressure. The purification of the mixture by silica gel col urnn (2 .5 x 2 0 cm) chromatography i n a gradient (1-4%) of methanol in dichloromethane allowed isolation of starting material 67 (360 mg, 18.5 %) and two structural isomers, namely 68 (less polar isomer; 971 mg, 36.7 %) and 9-(4-hydroxymethyl-2 , 3-0-isopropylidene-5-0- (4 ' - toluenesulfonyl) -p-D-ribofuranosyl) -N6-benzoyladenine (more polar isomer; 352 mg, 13,1%) as white solid materials. 68: 8U (CDC1J 8.69 (1H, s), 8.11 (1H, s), 8.00 (2H, m), 7.79 (2H, m), 7.58-7.55 (1H, m) , 7.50-7.46 (2H, m), 7.34-7.32 (2H, m), 5.88 (1H, d, J4.9), 5.35 (1H, dd, J'5.8, J"5.0), 5.13 (1H, d, J5.8), 3.87-3.78 (4H, m) , 1.65 (3H, s), 1.38 (3H, s). 8C (CDCl1-6) 164.7, 152.0, 150.2, 150.1, 144.9, 142.5, 133.2, 132.7, 132.3, 129.6, 128.6, 127.9, 127.8, 123.9, 114.6, 93.1, 87.9, 83.4, 81.6, 68.3, 64.4, 27.1, 25.0, 21.5. FAB-MS: m/z 596 [M+H].+ Example 64F 9-(4-(4'-Toluenesulfonyloxymethyl)-p-D-ribofuranosyl)-6-N- benzoyladenine (69). A solution of compound 68 (940mg, 1.58 mmol) in 10 mL of 90 % aq. trifluoroacetic acid was kept for 30 min at room temperature and concentrated in vacuo to an oily-mass. After co-evaporation with methanol (2x20 mL) and toluene (20 mL) the mixture was purified by silica column (2 x 25 cm) chromatography in a gradient of methanol (2-5.0%) in dichloromethane as eluent to give compound 69 (825 mg, 94 %) as white solid material. 8H (methanol-d4) 8.67 (1H, s) , 8.53 (1H, s), 8.05 (2H, d, J7.7), 7.75 (2H, d, J8.2), 7.63 (1H, m), 7.53 (2H, m) , 7.32 (2H, d, J8.0), 5.94 (1H, d, J" 7.1), 4.92 (1H, dd, J'7.1, J"5.3), 4.41 (1H, d, J5.1), 4.38 (1H, d, J10.2), 4.28 (1H, d, J10.2), 3.80 (1H, d, J12.0), 3.68 (1H, d, J12.0), 2.35 (3H, s). 8C (methanol-d4) 168.2, 152.9, 150.8, 151.2, 146.4, 144.9, 134.7, 134.1, 134.0, 130.8, 129.7, 129.4, 129.1, 125.1, 90.0, 88.4, 75.3, 73.1, 71.1, 64.2, 21.6. FAB-MS: m/z 556 [M+H].+ Example 64G 9-(4-(4'-Toluenesulfonyloxymethyl)-3,5-0-(tetraisopropyl- disiloxa-1,3-diyl)-p-P-ribofuranosyl)-6-tf-benzoyladenine (70). To a solution of compound 69 (780 mg, 1.40 mmol) in anhydrous pyridine (7 mL) was added 1,3-dichloro-l,1,3,3- tetraisopropyl-disiloxane (500 |1L, 1.57 mmol) at 0 °C. After stirring for 2h at 0 °C additional 1,3-dichloro-l,1,3,3- tetraisopropyldi- siloxane (50 |1L, 0.16 mmol) was added. The reaction mixture was allowed to warm to room temperature, diluted by dichloromethane (100 mL) and washed by water (2 x 100 mL). The organic phase was concentrated, and the residue was purified by the use of preperative HPLC (PrepPak cartridge, Porasil 15-20 |im 125 A; eluent: 0-3% of methanol in dichloromethane (v/v) in 120 min; flow rate: 60 ml/min). Concentration in vacuo yielded 870 mg (78%) of compound 70 as a white solid material. 8H (CDC13) 8.65 (1H, s), 8.03(2H, m), 8.00 (1H, s), 7.83 (2H, d, J8.4), 7.58 (1H, m), 7.49 (2H, m), 7.34 (2H, d, J8.4), 5.87 (1H, s), 5.70 (1H, d, J6.2), 4.68 (1H, d, J6.2), 4.59 (1H, d, J10.8), 4.31 (1H, d, J11.0), 3.91 (2H, s), 2.45 (3H, s), 1.03-0.84 (28H, m). 8C (CDC13) 164.9, 152.2, 150.5, 150.0, 144.7, 142.9, 133.5, 132.9, 132.8, 129.7, 128.8, 128.1, 128.0, 123.6, 90.3, 85.3, 76.0, 75.0, 68.7, 65.2, 21.6, 17.5, 17.4, 17.2, 17.1, 17.0,16.9, 13.1, 13.0, 12.5,12.4. FAB-MS: m/z 798 [M+H].+ Example 64H 9-(2-0,4-C-Methylene-3,5-0- (tetraisopropyldisiloxa-1,3-diyl)-fj- D-ribofuranosyl)-6-tf-benzoyladenine (71), A solution of compound 70 (540 mg, 0.68 mmol) in anhydrous THF (20 mL) was cooled to 0 °C and sodium hydride (13 0 mg of 60% suspension in mineral oil, 3.25 mmol) was added under stirring. The reaction mixture was stirred for 3 0 min and then neutralised by addition of 750 |XL of acetic acid. Dichloromethane (50 mL) was added, the mixture was washed by a saturated aqueous solution of sodium hydrogen carbonate (2 x 50 mL) and concentrated under reduced pressure. The residue was applied to a silica gel column (2.5 x 25 cm) and the product was eluted in a gradient concentration (0.5 to 1.2 %) of methanol in dichloromethane as eluent to yield compound 71 (356 mg, 84 %) as a white foam. 5H (CDC13) 8.77 (1H, s), 8.28 (1H, s), 8.03(2H, m), 7.59 (1H, m), 7.50 (2H, m), 6.08 (1H, s), 4.86 (1H, s), 4.56 (1H, s), 4.14 (1H, d, J13.2), 4.06 (1H, d, J7.7), 3.97 (1H, d, J13.2), 3.89 (1H, d, J7.7), 1.12-0.95 (28H, m) . 8C (CDC13) 164.8, 152.6, 150.5, 149.6, 140.7, 133.6, 132.7, 128.7, 127.9, 123.1, 89.4, 86.5, 78.9, 71.7, 71.2, 56.7, 17.3, 17.1, 17.0,16.9, 16.8, 13.3, 13.1, 12.5,12.2. FAB-MS: m/z 626 [M+H].+ Example 641 7-Hydroxy-l-hydroxymethyl-3- (6-N-benzoyladenin-9-yl) -2,5-dioxabicyclo[2.2.1]heptane (61B)♦ Thiethylamine tris-hydro- fluoride (300 (XL, 1.84 mmol) was added to a solution of compound 71 (420 mg, 0.067 mmol) in anhydrous THF (7 mL) . The reaction mixture was kept at room temperature for 1 h and concentrated to an oil which was purified by silica gel column (2 x 25 cm) chromatography eluting with 4 - 10% of methanol in dichloromethane (v/v). Yield 232 mg (92 %) of compound 61B as a white solid material. NMR data were identical with those reported earlier for 61B. Example 64J 1- (3, 5-Di-0»benzyl-4-C- (p-toluenesulphonyloxymethyl) -2-O-p- toluenesulphonyl-p-D-ribofuranosyl)thymine (72). A solution of 1- (3, 5-di-0-benzyl-4-C- (hydroxymethyl) -P-D-ribofuranosyl) - thymine 35 (1.48 g, 3.16 mmol), i,7,i,r-dimethylaminopyridine (1.344 g, 0.011 mol) and p-toluenesulphonyl chloride (1.45 g, 7.6 mmol) in dichloromethane (20 ml) was stirred for 3 h at room temperature. The reaction mixture was diluted with dichloromethane (30 ml) and washed with saturated aqueous solutions of sodium hydrogen carbonate (3 x 20 ml) and sodium chloride (2 x 25 ml). The organic phase was dried (Na2S04) , filtered and evaporated under reduced pressure. The residue was subjected to silica gel column chromatography using methanol:dichloromethane (1:99, v/v) as eluent to give nucleoside 72 (1.95 g, 80%) as a white solid material. FAB-MS m/e 776. 5C (CDC13) 162.9, 149.8 (C-2, C-4), 145.8, 145.2 (2 x Ts), 136.9, 136.8 (2 x Bn), 134.3 (C-6), 132.1, 132.0, 130.0, 129.9, 129.0 128.9, 128.4, 128.3, 128.2, 128.0, 127.7 (2 x Ts, 2xBn), 111.2 (C-5), 85.3, 84.0 (C-l', C-4'), 78.9, 78.3, 75.2, 74.3, 72.7, 69.1 (C-2', C-3' , C-5', C-l", 2 x Bn) , 21.7 (2 x CH3), 11.9 (CH3) . Anal. Calcd. for C39H40N2S2Ou; C, 60.30; H, 5.19; N, 3.61. Found: C, 59.95; H, 5.11, N 3.81. Example 64K l-(2-Amino-2-1-6-benzyl-2-deoxy-3/5-di-0-ben2yl-2-W/4-C- methylene-p-P-ribofuranosyl)thymine (73) • A solution of 72 (8.6 g, 11.1 mol) in benzyl amine (10 ml) was stirred at 130°C for 36 h. The reaction mixture was directly subjected to silica gel column chromatography using methanol:dichloromethane (1:99, v/v) as eluent to give nucleoside 73 (1.79 g, 30%) as a white solid material. FAB-MS m/e 540. 8C (CDC13) 163.9, 149.8 (C-2, C- 4), 139.2, 137.6, 137.3 (3 x Bn), 135.6 (C-6), 128.5, 128.4, 128.3, 128.2, 128.0, 127.7, 127.0 (3 x Bn), 109.6 (C-5), 88.2, 86.3 (C-l', C-4'), 76.7, 73.8, 72.0, 66.0, 63.8, 57.9, 57.8 (C-2', C-3', C-5', C-l", 3 x Bn) , 12-.2 (CH3) . Anal. Calcd. for C32HJ3N3°5 x °-5 H20: c' 70.06; H, 6.25; N, 7.66. Found: C, 70.00; H, 6.06; N, 7.50. Example 64L I-(2-Amino-2-deoxy-2-27/4-C-methylene-p-U-ribofuranosyl) thymine (74). To a solution of nucleoside 73 (1.62 g, 0.003 mol) in ethanol (150 ml) was added 20% palladium hydroxide on carbon (3 g) and the .1-6suspension was stirred for 5 days under an atmosphere of hydrogen. The catalyst was filtered off (silica gel) and washed with methanol (20 ml). The combined filtrate was concentrated under reduced pressure to give a white precipitate which was filtered off and washed with methanolrdichloromethane (1:4, v/v) to give a monobenzylated intermediate (0.82 g, 76%). FAB-MS: m/e 360 (M+H)+. UC-NMR (DMSO-d6, 250MHz): 163.7, 149.8 (C-2, C-4), 138.2 (Bn), 134.9 (C-6), 128.2, 127.5, 127.4 (Bn), 107.8 (C-5), 87.8, 87.6 (C-l', C-47)/ 72.7, 68.9, 65.9, 61.7, 49.4 (C-2', C-3' , C-5', C-l", Bn) , 11.9 (CH3) . Anal. Calcd. for C18H21N305: C, 60.16; H, 5.89; N, 11.69. Found: C, 59.86; H, 5.61; N, 11.56. A mixture of this intermediate (0.1 g, 0.29 mmol), ammonium formate (0.085g, 1.35 mmol), 10% palladium on carbon (130 mg) in anhydrous methanol (7 ml) was heated under reflux for 2 h. The catalyst was filtered off (silica gel) and washed with methanol (15 ml) and the combined filtrate was concentrated to dryness under reduced pressure. The residue was subjected to silica gel column chromatography using methanol:dichloromethane (1:9, v/v) as eluent to give title compound 74 (0.053 g, 71%) as a white solid material. FAB -MS m/e 270. 8H (DMSO-d6) 11.29 (bs, 1H, NH) , 7.73 (d, 1H, J 1.1, 6-H), 5.31 (s, 1H, l'-H), 5.29 (brs, 1H, 3'-OH), 5.13 (m, 1H, 5'-OH), 3.81 (s, 1H, 3'-H), 3.69 (m, 2H, 5'-H), 3.23 (s, 1H, 2'-H), 2.88 (d, 1H, J" 9.8, 1"-Ha), 2.55 (d, 1H, J 9.8, 1"-Hb), 1.77 (d, 3H, J 0.8, CH3 ) . 8C (DMSO-d6) 164.0, 150.1 (C-2, C-4), 135.6 (C-6), 107.8 (C-5), 89.5, 87.9 (C-l', C-4'), 68.7, 61.9, 57.1, 49.4, (C-2', C-3', C-5', C- 1"). Anal. Calcd. for CnH15N305 x 0.5 H20: C, 47.48; H, 5.80; N, 15.10. Found: C, 47.54; H, 5.30; N, 14.79. > Alternative method for conversion of 73 to 74. To a solution of 73 (0.045 g, 0.0834 mmol) in methanol (6 ml) was added 10% Pd on carbon (0.118 g) and - in three portions during 3 h -ammonium formate (0.145 g, 0.0023 mol). The suspension was refluxed for 4.5 h. The catalyst was filtered off (silica gel) and washed with methanol (4 x 3 ml). The combined filtrate was concentrated and the residue was subjected to column chromatography on silica gel using methanol:dichloromethane (1:9, v/v) as eluent to give nucleoside 74 (0.015 g, 67%). Spectral data were in accordance with data reported earlier for 74. Example 64L-1 1- (2-Amino-2-tf, 4-C-methylene-2-N-trif luoroacetyl-p-P- ribofuranosyl)thymine (74-C0CF3) • To a suspension of nucleoside 74 (0.050 g, 0.186 mmol) in methanol (2 mL) was added NfN-di-methylaminopyridine (0.013 mg, 0.106 mmol) and ethyl trifluoroacetate (0.029 mL, 0.242 mmol) and the mixture was stirred at room temperature for 2.5 h. The solvent was removed under reduced pressure and the residue was subjected to column chromatography on silica gel using methanol:dichloromethane (2.5:97.5, v/v) as eluent to give the title nucleoside 74-COCF3 as a white solid material after evaporation of the solvents under reduced pressure (0.055 g, 81%). FAB-MS m/z 366 [M+H]+. "C NMR (CD3OD, 62.9 MHz) 5 166.5, 157.7 (q, 2JCF 37.5 Hz, COCF3) , 157.6 (q, 2JCtF 37.2 Hz, COCF3) , 151.8, 136.8, 136.8, 117.6 (d, {JCF 287.5 Hz, CF3), 117.5 (d, lJCF 286.5 Hz, CF3) , 110.8, 110.8, 90.7, 89,3, 87.7, 87.3, 70.1, 68.6, 66.2, 66.2, 64.5, 57.9, 53.3, 12.7. Anal. Calcd. f or C13H14N306F3: C, 42.8; H, 3.9; N, 11.5. Found: C, 42.5; H, 4.0; N, 11.2. Example 64L-2 l-(2-Amino-5-0-4,4' -dimethoxytrityl-2-W/4-C-methylene-2-W- trifluoroacetyl-p-D-ribofuranosyl)thymine (74-DMT). To a solution of nucleoside 74-COCF3 (0.030 g, 0.082 mmol) in anhydrous pyridine (0.6 mL) at 0 °C was dropwise (during 20 min) added 4,4'-dimethoxytrityl chloride (0.054 g, 0.159 mmol) dissolved in anhydrous pyridinerdichloromethane (0.6 mL, 1:1, v/v) and the mixture was stirred for 10 h at room temperature. A mixture of ice and water was added (5 mL) and the resulting mixture was extracted with dichloromethane (3 x 5 mL). The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3x2 mL), dried (Na2S04) and filtered. The filtrate was evaporated to dryness under reduced pressure and the residue was subjected to column chromatography on silica gel using methanolrdichloromethane: pyridine (1.5:98.0:0.5, v/v/v) as eluent to give nucleoside 74-DMT as a white solid material after evaporation of the solvents under reduced pressure (0.051 g, 93%). FAB-MS m/z 667 [ML, 668 [M+H] ,FAB-HRMS calcd. for .C34HjaN308F3+: 667.2142. Found: 667.2146. I3C NMR (C5D5N, 100.6 MHz) S 165.1, 165.0, 159.5, 159.5, 151.4, 145.7, 136.3, 136.1, 134.8, 134.6, 130.9, 130.9, 130.9, 128.9, 128.9, 128.7, 128.7, 128.4, 127.7, 123.2, 114.1, 114.1, 114.0, 110.4, 89.4, 87.9, 87.5, 87.4, 87.2. 70.8, 69.0, 66.0, 64.4, 60.5, 60.2, 55.5, 53.6, 53.4, 49.9, 13.2, 13.1. Example 64L-3 1- (2-Amino-3-0- (2-cyanoethoxy (diisopropylamino)posphinoxy) -5-0- 4,4' -dimethoxytrityl-2-1-624-C-methylene-2-JP7-trifluoroacetyl-P-I7- ribofuranosyl)thymine (74A). To a solution of nucleoside 74-DMT (0.121 g, 0.181 mmol) in anhydrous dichloromethane (2 mL) were added W,2,f-diisopropylethylamine (0.093 mL, 0.54 mmol) and 2-cyanoethyl i1-6N-diisopropylphosphoramidochloridite (0.057 mL, 0.2 6 mmol) at 0 °C and the mixture was stirred for 10 h at room temperature. The mixture was diluted with dichloromethane (20 mL), extracted with a saturated aqueous solution of sodium hydrogencarbonate (3 x 10 mL), dried (Na2S04) and filtered. The filtrate was evaporated to dryness under reduced pressure and the residue was subjected to column chromatography on silica gel using methanol:dichloromethane:pyridine (1.5:98.0:0.5, v/v/v) as eluent to give crude product (0.107 g) after evaporation of the solvents under reduced pressure. The residue was dissolved in anhydrous dichloromethane (1 mL) and by dropwise addition to vigorously stirred petroleum ether (60-80 °C, 30 mL) at -30 °C, nucleotide 74A precipitated to give a white solid material after filtration (0.090 g, 57%). FAB-MS m/z 868 [M+H]+, 890 [M+Na], 31P NMR (CD3CN, 121.5 MHz) 5 150.4, 150.2, 148.8, 149.1. Example 64L-4 l-(2-Amino-2-W/4-C-methylene-3/5-0-(l,l/3,3- tetraisopropyldisiloxane-l,3-diyl)-p-U-ribofuranosyl)thymine (74B). To a solution of nucleoside 74 (0.20 g, 0.74 mmol) in anhydrous pyridine (3 mL) at -15 °C was dropwise (during 3 h) added 1,3-dichloro-l,1,3,3-tetraisopropyldisiloxane (0.305 mL, 0.0011 mol) and the mixture was stirred for 10 h at room temperature, MeOH (3 mL) was added and the mixture was evaporated to dryness under reduced pressure. The residue was subjected to column chromatography on silica gel using methanol:dichloromethane (1:99, v/v) to give nucleoside 74B as a white solid material after evaporation of the solvents under reduced pressure (0.370 mg, 97%). FAB-MS m/z 512 [M+H], :H NMR ( (CD3)2SO, 400 MHz) 8 11.37 (bs, IH) , 7.48 (s, IH) , 5.32 (s, IH), 4.06 (d, IH, J 13.5 Hz), 4.00 (s, IH), 3.84 (d, IH, J 13.5 Hz), 3.41 (s, IH), 2.92 (d, IH, J 10.2 Hz), 2.64 (d, IH, J 10.2 Hz), 1.74 (s, 3H) , 1.10-0.92 (m, 28 H) . 13C NMR ( (CD) 3S02, 62.9 MHz) 8 163.8, 149.8, 134.1, 107.9, 89.5, 87.9, 70.1, 61.1, 57.9, 49.3, 17.2, 17.2, 17.0, 16.9, 16.8, 16.7, 12.6, 12.2, 11.7. Anal. Calcd. for C2JH41N306Si2: C, 54.0; H, 8.1; N, 8.2. Found: C, 54.0; H, 8.3; N, 7.8. Example 64L-5 1-(2-Methylamino-2- N, 4-C-methylene-3,5-0-(1,1,3,3- tetraisopropyldisiloxane-1,3-diyl)-|3-.D-ribofuranosyl) thymine (74C). To a solution of nucleoside 74B (0.33 g, 0.64 mmol) in anhydrous THF:dichloromethane (4:1, v/v) at -10 °C was dropwise (during 30 min) added 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU, 0.125 mL, 0.836 mmol) and methyl iodide (0.05 mL, 0.79 mmol) and the mixture was stirred for 48 h at 10 °C. Additional DBU (0.05 mL, 0.33 mmol) and methyl iodide (0.020 mL, 0.32 mmol) was dropwise (during 15 min) added to the reaction mixture and stirring at 10 °C was continued for 24 h. The mixture was evaporated to dryness under reduced pressure and the residue was subjected to column chromatography on silica gel using methanolrdichloromethane (1:99, v/v) as eluent to give nucleoside 74C as a white solid material after evaporation of the solvents (0.25 g, 74%). FAB-MS m/z 526 [M+H], 'H NMR (CDC13, 400 MHz) 8 8.19 (bs, IH) , 7.65 (d, IH, J 1.3 Hz), 5.59 (s, IH) , 4.11 (s, IH) , 4.05 (d, IH, J" 13.2 Hz), 3.87 (d, IH, J 13.2 Hz), 3.44 (s, IH) , 2.98 (d, IH, J" 9.5 Hz), 2.71 (d, IH, J 9.5 Hz), 2.72 ( s, 3H ) , 1.91 (d, IH, J 1.1 Hz), 1.12-0.96 (m, 28 H) . UC NMR (CDC13, 62.9 MHz) 8 163.7, 149.6, 135.2, 109.7, 90.9, 85.7, 71.4, 67.3, 58.6, 58.2, 41.2, 17.5, 17.4, 17.3, 17.2, 17.1, 16.9, 13.3, 13.1, 13.0, 12.6, 12.1. Anal. Calcd. for C24H44N3O?Si2,0.25H2O: C, 54.4; H, 8.3; N, 7.9. Found: C, 54.4; H, 8.1; N, 7.7. Example 64L-6 1- (2-Methylamixio-2-W, 4-C-methylene-P-D-ribofuranosyl) thymine (74D). To a solution of nucleoside 74C (0.40 g, 0.76 mmol) in THF at room temperature was added a solution of tetrabutylammonium fluoride in THF (1.0 M, 2.2 mL, 2.2 mmol) and the reaction mixture was stirred for 2 0 min whereupon pyridine:water:methanol (6 mL, 3:1:1, v/v/v) was added. The mixture was added to Dowex 50x200 resin (2.2 g, H+ (pyridinium) form, 100-200 mesh) suspended in pyridine:water:methanol (6 mL, 3:1:1, v/v/v) and the resulting mixture was stirred for 20 min. After filtration, the residue was washed with pyridine:water:methanol (3x3 mL, 3:1:1, v/v/v) and the combined filtrate was evaporated to dryness under reduced pressure to give an oily residue after coevaporation with methanol (2 x 5 mL), Column chromatography on silica gel using methanol:dichloromethane (1:49, v/v) as eluent gave nucleoside 74D as a white solid material after evaporation of the solvents under reduced pressure (0.17 g, 79%). FAB-MS m/z 284 [M+H] + . FAB-HRMS calcd. for C12H18N305+: 284.12465. Found: 284.12402. 'H NMR ((CD3)2SO, 400 MHz) 8 11.3 (bs, 1H, NH) , 7.70 (d, 1H, J 1.1 Hz, 6-H), 5.50 (s, 1H, l'-H), 5.26 (d, 1H, J 4.9 Hz/ 3'-OH), 5.12 (t, 1H, J 5.7 Hz, 5'-OH), 3.87 (d, 1H, J 4.8 Hz, 3'-H), 3.67 (d, 2H, J 5.5 Hz, 5'-H), 3.12 (s, 1H, 2'-H), 2.87 (d, 1H, J 9.3 Hz, 5"-Ha), 2.56 (s, 3H, NCH3) , 2.52-2.49 (1H, m, 5"- Hb) , 1.77 (s, 3H, CH3) . 'H NMR (CD3OD, 400 MHz) 8 7.80 (d, 1H, J" 1.3 Hz, 6-H), 5.71 (s, 1H, l'-H), 4.07 (s, 1H, 3'-H), 3.83 (s, 2H, 5'-H), 3.36 (s, 1H, 2'-H), 3.08 (d, 1H, J" 9.9 Hz, 5'-HJ , 2.68 (s, 3H, NCH3), 2.57 (d, 1H, J. 9.9 Hz, 5' ' -HJ , 1.88 (d, 3H, J 1.1 Hz, CH3) . 1JC NMR (CD3OD, 62.9 MHz) 8 166.6, 151.9, 137.4, 110.4, 91.3, 85.2, 71.4, 69.1, 59.4, 58.7, 40.2, 12.2. Example 64L-7 l-(-5-0-4,4'-Dimethoxytrityl-2-methylamino-2-N/4-C-methylene-p-D-ribofuranosyl)thymine (74E). To a solution of nucleoside 74D (0.135 g, 0.477 mmol) in anhydrous pyridine (1.5 mL) at 0 °C was dropwise (during 20 min) added a solution of 4,4'-dimethoxytrityl chloride (0.238 g, 0.702 mmol) in anhydrous pyridine:dichloromethane (1.0 mL, 1:1, v/v) and the resulting mixture was stirred for 10 h at RT. A mixture of ice and water was added (5 mL) and the mixture was extracted with dichloromethane (3 x 10 mL). The combined organic phase was washed with a saturated aqueous solution of sodium hydrogencarbonate (3x5 mL) , dried (Na2S04) and filtered. The filtrate was evaporated to dryness under reduced pressure and the residue was subjected to column chromatography on silica gel using methanol .-dichloromethane:pyridine (1:98:1, v/v/v) as eluent to give nucleoside 74E as a white solid material after evaporation of the solvents under reduced pressure (0.20 g, 72%). FAB-MS m/z 586 [M+H], 'H NMR (C5D5N , 400 MHz) 8 13.2 (bs, 1H), 7.98 (d, 1H, J 1.3 Hz), 7.98-7.00 (m, 13H), 6.12 (s, 1H), 4.78 (d, 1H, J 3.7 Hz), 3.88-3.79 (m, 4H), 3.71 (s, 3H), 3.71 (s, 3H), 3.29 (d, 1H, J 9.3 Hz), 2.84 (d, 1H, J 9.3 Hz), 2.81 (s, 3H) , 1.85 (d, 3H, J 0.9 Hz). 13C NMR (C5D5N, 62.9 MHz) 8 165.1, 159.2, 151.4, 145.9, 136.5, 136.4, 130.8, 130.7, 128.7, 128.4, 127.4, 113.8, 109.6, 89.8, 86.8, 85.1, 72.0, 68.7, 60.9, 59.4, 55.2, 40.1, 13.1. Anal. Calcd. for C33H3SUfllf0.25H20: C, 67.2; H, 6.1; N, 7.1. Found: C, 67.2; H, 6.2; N, 6.9. Example 64L-8 l-(3-0-(2-Cyanoethoxy(diisopropylamino)posphinoxy) -5-0-4,4 ■ -dimethoxytrityl-2-methylmino-2- trifluoroacetyl-p-D-ribofuranosyl) thymine (74F) . To a solution of nucleoside 74E (0.13 0 g, 0.222 mmol) in anhydrous dichloromethane (2 mL) at 0 °C were added N,N- diisopropylethylamine (0.088 mL, 0.514 mmol) and 2-cyanoethyl A/ViV-diisopropylphosphoramidochloridite (0.065 mL, 0.291 mmol) and the mixture was stirred for 10 h at room temperature. Dichloromethane (30 mL) was added and the mixture was extracted with a saturated aqueous solution of sodium hydrogencarbonate (3 x 10 mL), dried (Na2S04) and filtered. The filtrate was evaporated to dryness under reduced pressure and the residue vas subjected to column chromatography on silica gel using methanol:dichloromethane:pyridine (0.5:98.5:1-0, v/v/v) as eluent to give crude product (0.120 g) after evaporation of the solvents under reduced pressure. The residue was dissolved in anhydrous dichloromethane (1 mL) and by dropwise addition to vigorously stirred petroleum ether (60-80 °C, 30 mL) at -30 °C, nucleotide 74F precipitated to give a white solid material after filtration (0.090 g, 52%). 31P NMR (CD3CN, 121.5 MHz) 5 147.7. Example 64M 1- (3, 5-Di-0-benzyl-4-C- (p-toluenesulphonyloxymethyl) -2»0-p- toluenesulphonyl-p»D-ribofuranosyl)uracil (75). To a stirred solution of 1-(3,5-di-0-benzyl-4-C-hydroxymethyl-P-D- ribofuranosyl)uracil 41 (3.55 g, 7.81 mmol) in dichloromethane (50 cm3) was added 4-iV, iV-dimethylaminopyridine (3.82 g) and p-toluenesulphonyl chloride (4.47 g, 23.5 mmol) at room temperature. Stirring was continued for 2 h, and dichloromethane (100 cm3) was added. The reaction mixture was washed with a saturated aqueous solution of sodium hydrogen carbonate (2 x 75 cm3) and dried (Na2S04) . The organic phase was evaporated under reduced pressure and the residue was purified by silica gel column chromatography using dichloromethane/-methanol (99.5:0.5, v/v) as eluent to give nucleoside 75 (4.65g, 78%) as a white solid material. 8H (CDC13) 8.49 (1H, br s, NH), 7.67 (1H, d, J 8.3, 6-H), 7.51-7.03 (18H, m, Bn, Ts), 6.0 (1H, d, J 7.6, l'-H), 5.05 (1H, m, 2'-H), 4.91 (2H, m, 5-H, Bn), 4.56 (2H, m, Bn), 4.42 (1H, d, J 10.4, Bn), 4.31 (1H, d, J 4.9, 3'-H), 4.05 (2H, m, 1"-H), 3.75-3.64 (2H, m, 5'-H), 2.41 (3H, s, CH3), 2.34 (3H, s, CH3) . 8C (CDC13) 162.2 (C-4), 149.5 (C-2), 146.0, 145.3 (Ts), 139.0 (C-6), 136.7, 131.9, 130.0, 129.9, 128.9, 12 8.7, 128.5, 128.4, 128.3, 128.2, 128.0, 127.6 (Bn, Ts) 102.7 (C-5), 85.5 (l'-C),'84.4 (4/-C)/ 79.2, 78.3, 75.1, 74.3, 72.4, 69.1 (Bn, 3'-C, 2'-C, 5'-C, 1'-C ), 21.7, 21.6 (Ts). FAB-MS m/z 763. Found: C, 61.2 ;H, 4.4; N, 3.3; C3yH18N2°nS2 requires C, 59.8; H,5.0; N,3.6. Example 64N l-(2-Deoxy-3/5-di-0-benzyl-2-5,4-C-methylene-2-thio-p-D- ribofuranosyl)thymine (76). To a stirred solution of nucleoside 75 (3.70g, 4.86 mmol) in DMF (40 cmJ) was added potassium thioacetate (0.83 g, 7.28 mmol). The mixture was stirred and heated at 110 °C for 80 h. After evaporation under reduced pressure, H20 (100 cm3) was added. Extraction was performed with dichloromethane (4 x 50 cm3) and the combined organic phase was dried (Na2S04) , filtered and evaporated under reduced pressure. The residue was purified by silica gel chromatography using dichloromethane/methanol (99.6:0.4, v/v) as eluent to give nucleoside 76 (1.65g, 75%) as a white solid material. 5H (CDC13) 9.08 (1H, br s, NH) , 7.98 (1H, d, J" 8.1, 6-H) , 7.39-7.20 (10H, m, Bn), 5.85 (1H, s, l'-H), 5.26 (1H, d, J 8.1, 5-H) , 4.61 (1H, d J 11.4, 5'-H), 4.56 (2H, s, Bn), 4.45 (1H, d, J 11.4, Bn) , 4.14 (1H, d, J 1.7, 3'-H), 3.82 (2H, m, Bn), 3.72 (1H, d, J 1.9, 2'-H), 3.02 (1H, d, J 9.9, 1"-H), 2.78 (1H, d, J 9.9, 1"-Hb). 8C (CDC13) 163.4 (C-4), 150.0 (C-2), 139.9 (C-6) , 137.2, 136.8, 128.6, 128.5, 128.2, 127.9, 127.7 (Bn), 100.8 (C-5), 90.8, 88.8 (C-l', C-4'), 76.5, 73.8, 72.0, 70.0 (2 x Bn, C-3', C-5'), 49.52 (C-2')/ 35.63 (C-l'). FAB-MS m/z 453. Found: C, 63.4; H, 5.1;N, 5.9; C24H24N205S requires C, 63.7; H, 5.3; N, 6.1. Example 64N-1 1- (2-O-p-Toluenesulf onyl-4-C- (p-toluenesulf onyloxymethyl) -p-U- ribofuranosyl) uracil (76A) . To a solution of compound 75 (0.80 g, 1.0 mmol) in absolute ethanol (2 cm3) was added 20% palladium hydroxide over carbon (0.80 g) and the mixture was degassed several times with hydrogen and stirring was continued under an atmosphere of hydrogen for 48 h. The catalyst was filtered off and the filtrate was evaporated under reduced pressure. The residue was purified by silica geh column chromatography using dichloromethane/methanol (99:1, v/v) as eluent to give nucleoside 76A (0.30 g, 49%) as a white solid material. 8H (CD3OD) 7.67 (4H, m) , 7.45 (1H, d, J" 8.2 Hz), 7.34 (4H, m) , 5.86 (1H, d, J" 8.0 Hz), 5.40 (1H, d, J 8.1 Hz), 4.95 (1H, m), 4.35 (1H, d, J 5.0 Hz), 4.17 (2H, m), 3.61 (2H, ?), 2.40 (6H, s). 5C (CD.OD) 165.4, 151.6, 147.5, 146.6, 141.3, 134.0, 133.8, 131.4, 130.9, 129.2, 128.9, 103.7, 88.0, 85.4, 80.7, 72.4,' 71.0, 64.3, 21.7, 21.6. FAB-MS m/z 583 [M+H]+. Example 64N-2 1-(3,5-0-(Tetraisopropyldisiloxa-lr3-diyl)-2-0-p-toluene-sulfonyl-4-C- (p-toluenesulf onyloxymethyl) -p-D-ribofuranosyl) -uracil (76B)• To a stirred solution of nucleoside 76A (0.27 g, 0.46 mmol) in anhydrous pyridine (4 cm3) was added 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (0 .22 cm3, 0.70 mmol). After stirring for 48 h, the mixture was cooled to 0°C and a saturated aqueous solution of sodium hydrogen carbonate (15 cm3) was added. The mixture was extracted with dichloromethane (3 x 10 cm3) and the combined organic phase was dried (Na2S04) and filtered. The solvent was evaporated under reduced pressure and the residue was purified by silica gel chromatography using dichloromethane/methanol (99.5:0.5, v/v) as eluent to give nucleoside 76B (0.37 g, 97%) as a white solid material. 8H (CDC13) 8.70 (1H, br s), 7.80 (4H, m) , 7.36 (4H, m), 6.98 (1H, d, J 8.1 Hz), 5.64 (1H, d, J 8.0 Hz), 5.18 (2H, m) , 4.98 (1H, d, J 7.0 Hz), 4.39-4.32 (2H, m), 3.92-3.76 (2H, s), 2.45 (6H, s), 1.27-0.66 (28H, m) . 8C (CDC13) 162.9, 149.3, 145.6, 144.8, 143.9, 132.9, 130.1, 129.9, 128.2, 128.1, 102.2, 94.6, 84.7, 80.4, 72.8, 67.8, 64.6, '21.7, 17.3, 17.2, 17.1, 16.9, 16.8, 13.1, 12.8, 12.3. FAB-MS m/z 825 [M+H], Example 64N-3 1-(2-Deoxy-2-mercapto-2-fir, 4-C-methylene-3,5-0-(tetraisopropyl- disiloxa-1,3-diyl)-p-D-ribofuranosyl)uracil (76C). To a well stirred solution of nucleoside 76B (0.26 g, 0.32 mmol) in DMF (5 cm3) was added potassium thioacetate (0.054 g, 0.47 mmol). The reaction mixture was stirred at 110 °C for 2 0 h. After evaporation of the mixture under reduced pressure, H20 (20 cm3) was added. Extraction was performed with dichloromethane (3 x 10 cm3) and the combined organic phase was dried (Na2S04) , filtered and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane/methanol (99.25:0.75, v/v) as eluent to give nucleoside 76C (0.125 g, 77%) as a white solid material. 5H (CDC13) 8.55 (1H, br s), 8.02 (1H, d, J 8.1 Hz), 5.82 (1H, s, l'-H), 5.65.f(lH, d, J 8.1 Hz), 4.37 (1H, d, J2.1 Hz); 4.10 (1H, d, J 13.2 Hz), 3.90 (1H, d, J 13.1 Hz), 3.53 (1H, d, J 2.1 Hz), 2.92 (1H, d, J- 10.1 Hz), 2.74 (1H, d, J 10.0 Hz), 1.30- 5 0.80 (28H, m) . 5C (CDC13) 163.2, 149.8, 139.6, 100.9, 91.4, 90.7, 71.5, 59.8, 51.5, 34.4, 17.5, 17.3, 17.1, 16.9, 15.5, 13.6, 13.3, 13.1, 12.9, 12.3. FAB-MS m/z 515 [M+H]+. Example 64N-4 ) 1- (2-Deoxy-2-mercapto-2-iS,4-C-methylene-p-P-ribofuranosyl) -uracil (76D). To a stirred solution of nucleoside 76C (25 mg, 0.049 mmol) in THF (1.0 cm3) was added a solution of tetrabutylammonium flouride (0.20 cm3of a 1M solution in THF, 0.2 0 mmol) at 0°C. After stirring the mixture at 0°C for 1 h, H20 (5 cm3) was added and the mixture was evaporated. The residue was purified by silica gel column chromatography using dichloromethane/methanol (97:3, v/v) as eluent to give nucleoside 76D (9.0 mg, 69%) as a white solid material. 8H (CD3OD) 8.19 (1H, d, J" 8.1 Hz, 6-H) , 5.77 (1H, s, l'-H), 5.65 (1H, d, J 8.1 Hz, 5-H) , 4.31 (1H, d, J 2.1 Hz, 3'-H), 3.86 (2H, s, 5'-H), 3.53 (1H, d, J 2.2 Hz, 2'-H), 2.93 (1H, d, J 10.3 Hz, 1"-Ha), 2.73 (1H, d, J 10.3 Hz, 1"-Hb). 8C (CD3OD) 166.5, 152.0, 141.7, 101.2, 92.1, 92.0, 71.4, 59.9, 53.6, 35.4. FAB-MS m/z 273 [M+H] + . Example 64N-5 l-(2-Deoxy-5-0-(4,4 ■ -dimethoxytrityl) -2-mercapto-2-S#4-C- methylene-p-P-ribofuranosyl)uracil (76E). To a solution of 76D (0.2 g, 0.37 mmol) in anhydrous pyridine (5 cm3) was added 4,4'-dimethoxytrityloxymethyl chloride (0 .186 g, 0 . 55 mmol) at room temperature. The solution was stirred for 5 h whereupon the reaction mixture was cooled to 0 °C. A saturated aqueous solution of sodium hydrogen carbonate (30 cm3) was added and the resulting mixture was extracted with dichloromethane (3 x 50 cm3). The combined organic phase was separated and dried (Na2S04). The solvent was removed under reduced pressure and the residue was purified by silica gel column chromatography with dichloromethane/methanol/pyridine (98.5:1.0:0.5 v/v) as eluent to give nucleoside 76E as a white brownish solid material (0.175 g, 83%). 5C (CDC13) 164.5, 159.4, 151.6, 145.7, 139.9, 136.4, 136.0, 135.6, 130.9, 130.8, 128.8, 128.5, 128.4, 127.5, 127.4, 122.7, 113.9, 101.5, 91.7, 90.2, 87.6, 71.8, 61.9, 55.3, 53.7, 36.2, 30.6. FAB-MS m/z SI A [M]+, 575 [M+H]+ (Found: C, 65.2; H, 5.4; N, 5.0; C31HJ0N2O7S requires C, 64.8; H, 5.3; N, 4.9%). Example 64N-6 1- (3-0-(2-Cyanoethoxy(diisopropylamino)phosphino) -(2-deoxy-5-0- (4,4 • -dimethoxytrityl) -2-mercapto-2-iS/4-C-iaethylene-p-P- ribofuranosyl)uracil (76F) • To a solution of 76E (0.160 g, 0.28 mmol) in anhydrous dichloromethane (2 cm3) at 0 °C was added N,itf-diisopropylethylamine (0.27 cm3) and 2-cyanoethyl N,N-diisopropylphosphoramidochloridite (97mg, 0.42 mmol). Stirring was continued at room temperature for 5 h. The reaction mixture was cooled to 0 °C and a saturated aqueous solutions of sodium hydrogen carbonate (30 cm3) was added. Extraction was performed using dichloromethane (3 x 20 cm3) and the combined organic phase was dried (Na2S04) and evaporated to dryness under reduced pressure, and the residue was purified by silica gel column chromatography using dichloromethane/methanol/pyridine (99:0.5:0:5 v/v) as eluent to give a white foam. This residue was dissolved in dichloromethane (2 cm3) and the product was precipitated from light petroleum (100 cm3, cooled to -40°C) under vigorous stirring. The precipitate was collected by filtration, and was finally dried to give nucleoside 76F as a white solid material (95 mg, 44%). 8P (CDC13) 148.9, 149.0. Example 640 3,5»Di-0-benzyl-l,2-0-isopropylidene-4-C-(p-toulenesulfonyloxy- taethyl) -p-D-ribofuranose (11). A solution of 3,5-di-0-benzyl-4- C-hydroxymethyl-1,2-Oisopropylidene-a-D-ribofuranose (15 . 38 3, 38.4 mmol), anhydrous pyridine (20 cm3) and anhydrous dichloromethane (80 ml) was stirred at -5 °C. p-Toulene-sulphonyl chloride (8.75 g, 46.0 mmol) dissolved in anhydrous dichloromethane (8 cm ) was added during 15 min. The solution vas stirred at room temperature for 17 h. The reaction was quenched with ice-cold H20 (200 cm3 ) , Extraction was performed with dichloromethane (5 x 150 cm3) and the combined organic phase was washed with saturated aqueous solutions of sodium hydrogen carbonate (3 x 100 cm3) and brine (3 x 100 cm3) , dried (Na2S04) , filtered and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dicloromethane:methanol (98.5:1.5, v/v) as eluent to give 77 as a clear oil (17.4 g, 82%). 8H (CDC13) 7.79-7.19 (14H, m, Bn) , 5.66 (1H, d, J 3.6, 1-H), 4.69-4.20 (8H, m, Bn, 5-Ha/ 5-Hb, 3-H, 2-H), 3.53 2.40 (3H, s, CH3), 1.29 (3H, s, CH3) , 1.26 (3H, s, CH3) . 5C (CDC13) 144.6, 137.9, 137.3, 133.0, 129.8, 128.4, 128.3, 128.1, 128.0, 127.9, 127.7, 127.6 (aromatic), 113.6 (C(CH3)2), 104.2, (C-l), 84.7 (C-4), 79.0, 78.7, 73.7, 72.7, 70.7, 70.2, (Bn, C-2, C-3, C-5, C-l'), 26.3, 26.0 (C(CH3)2), 21.6 (CH3) . FAB-MS m/z 555 [M+H], (Found: C, 64.8; H, 6.2; C30H34O8S requires C, 64.9; H, 6.1%) . Example 64P 1,2-Di-0-acetyl-3,5-di-0-benzyl-4-C- (p-toluenesulfonyloxy- methyl)-a,p-D-ribofuranose (78). A solution of furanose 77 (17.4 g, 31.4 mmol) in 80% acetic acid (250 cm3) was stirred at 60 °C for 20 h. The solvent was removed in vacuo and the residue was coevaporated with toluene (3 x 20 cm3) . The residue was redissolved in anhydrous pyridine (100 cm3) . Acetic anhydride (14.2 cm3) was added and the solution was stirred for 15 h at room temperature. The reaction was quenched by addition of ice-cold H20 (200 cm3) , and the mixture was extracted with dichloromethane (4 x 150 cm3) . The combined organic phase was washed with saturated aqueous solutions of sodium hydrogen carbonate (2 x 125 cm3) and brine (3 x 150 cm3) , dried (Na2S04) , filtered and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dicloromethane:methanol (98.5:1.5, v/v) as eluent to give 78 (a,(3-1:1) as a clear oil (13.5 g, 72%). 8C (CDC13) 169.8, 169.6, 69.4, 168.8 (C=0), 144.7, 137.7, 137.5, 132.8, 129.7, 129.6, 12 8.5, 128.4, 12 8.3, 12 8.2, 128.0, 127.8, 127.7, 127.6 (Bn), 97.4, 94.2 (C-l), 86.4, 84.2 (C-4), 78.9, 77.5, 74.5, 74.1, 73.7, 73.5, 71.8, 70.6, 70.5, 69.6, 69.5 (Bn, C-2, C-3, C-l'), 21.6, 21.0,' 20.8, 20.6, 20.4 (COCH3, C(CH3)3)-. FAB -MS m/z 599 [M+H], Alternative procedure for the preparation of compound 78 1,2:5, 6-Di-O-isopropylidene-oc-D-allofuranose (30A) . From Pfanstiehl Laboratories Inc. 3-O-Benzyl-l,2:5,6-di-O-isopropylidene-oc-D-glucofuranose (30B). To a solution of 30A (40 g) in dimethylformamide at OoC was added sodium hydride in smaller portions. The reaction mixture was stirred for lh, benzyl bromide was added drop wise over a period of lh. The reaction mixture was stirred at room temperature for 16h. Methanol was added to quench the reaction and dimethyl formamide was removed under pressure. The syrup was extracted with ethyl acetate and washed with brine. Evaporation of the ethyl acetate layer yielded a semisolid (93%). Homogeneous by TLC. 3-O-Benzyl-l, 2-O-isopropylidene-oc-D-glucofuranose (30C) . Partial hydrolysis of 30B (50 g) was achieved in 75 % acetic acid in a period of 2Oh. Concentration to a smaller volume and extraction with ethyl acetate yielded 30C, 40 g, (90 %). Homogeneous by TLC. 3-O-Benzyl-l,2-O-isopropylidene-cc-D-ribo-pentodialdofuranose (30D). solution of 30C (40 g) in water/methanol (1:1) was slowly added with stirring to a solution of sodium periodate in water at OoC.The reaction was stirred for 2h, ethylene glycol was added and the mixture was extracted with ethyl acetate. The iried extract was evaporated to yield 30D, 32 g, (89%) . Homogeneous by TLC. In this step addition of methanol is essential fpr the completion of the reaction. 3-0-Benzyl-4-(hydroxymethyl)-1,2-0-isopropylidene-a-D-erythro-pentofuranose (30E). Aqueous 37 % formaldehyde and IN sodium hydroxide were added at OoC to a stirred solution of 30D (32 g) in water and tetrahydrofuran (1:1), the reaction was continued for 16h, extracted in ethyl acetate and washed with brine. Evaporation of the organic layer afforded a syrup which crystallised from ether/petroleum ether as white solid, 23 g, the filtrate was an oil which solidified as a low melting solid, 10 g, total yield of 30E, 92%. [23 g (white solid was 99 % pure by TLC), 10 g of low melting solid (had faster moving impurities by TLC, approximately 75% pure)]. In this step addition of tetrahydrofuran is very important for the time and reaction completion. 3,5-Di-0-benzyl-4-C-hydroxymethyl-l,2-O-isopropylidene-a-D-ribofuranose (31). Benzylation of 30E (20 g) with NaH 60 % and BnBr at -10°C yielded a mixture of two isomers 6 and 7. Flash column chromatography afforded 31 as the major isomer, 14 g, (54.26%). Homogeneous by TLC. 3,5-Di-0-benzyl-l,2-0-isopropylidene-4-C-tosyl-a-D-ribofuranose (77). 3 A solution of 31 (12.5 g) in pyridine at 0°C was treated with p-toluenesulphonyl chloride and the reaction was continued at room temperature for 14-16 hours. Removal of pyridine, extraction with methylene chloride and saturated bicarbonate solution afforded 77, 14 g, (80%). Homogeneous by TLC. 1,2-di-0-acetyl-3,5-di-0-benzyl-4-C-tosyl-D-ribofuranose (78). Hydrolysis of 77 (14 g) was done in 75% acetic acid at 65oC for 18 h. The solvent was removed under pressure and the residue was treated with ethanol (3x100), toluene (3x50) and dry pyridine (2x50).[ This compound 78 crystallized from petroleum ether as fine white solid.] The residue was taken in dry pyridine and treated with acetic anhydride at room temperature for 8h. extraction with ethyl acetate and saturated bicarbonate followed by washing with brine afforded 78A as a mixture of a and p anomers, 12g, (83%). A direct comparison with an authentic sample of 78A (TLC, HPLC, NMR) confirmed its identity and purity. Example 64Q 1-(2-0-Acetyl-3,5-di-0-benzyl-4-C-(p-toulenesulfonyloxymethyl)- p-D-ribofuranosyl)thymine (79). To a stirred solution of the anomeric mixture 78 (12.8 g, 21.4 mmol) and thymine (5.38 g, 42.7 mmol) in anhydrous acetonitrile (182 cm3) was added NfO-bis(trimethylsilyl)acetamide (31.68 ml, 128.23 mmol). The reaction mixture was stirred for 1 h at room temperature, and stirring was continued at 60 °C for 1.5 h. After cooling to 0 °C, trimethylsilyl triflate (6.57 ml, 30.33 mmol) was added dropwise, and the mixture was stirred at 60 °C for 10 h. The reaction mixture was neutralized with an ice-cold saturated aqueous solution of sodium hydrogen carbonate (90 mL). The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure to half volume. Extraction was performed using dichloromethane (4 x 200 cm3) . The combined organic phase was washed with saturated aqueous solutions of sodium hydrogen carbonate (3 x 150 cm3) and brine (3 x 150 ml), dried (Na2S04) , filtered and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dicloromethane.-methanol (99:1 to 98:2, v/v) as eluent to give nucleoside 79 as a white solid material (13.1 g, 92%) . 8H (CDC13) 9.04 (s, 1H, NH) , 7.73-7.19 (15H, m, 6-H, aromatic), 5.94 (1H, d, J" 5.5, l'-H), 5.37 (1H, d, J 5.6, 2'-H), 4.57-4.40 (5H, m, 3'-H, 5'-Ha, 5'-Hb, Bn) , 4.14 (2H, s, Bn) , 3.75 (1H, d, J 10.2, l'-HJ, 3.57 (1H, d, J 10.2, 1' '-Hb) , 2.41 (3H, s, CH3CfcH5)., 2.02 (3H, s, COCH3), 1.54 (3H, s, CH3). 8C (CDC13) 169.8 hydride (0.205 g, 5.12 mmol) was added, and the reaction mixture was stirred for additional 22 h at 0 °C. Methanol (20 cm3) was added and the reaction mixture was subsequently concentrated under reduced pressure to half volume. Ice-cold H20 (300 cm3) was added and extraction was performed with dichloromethane (5 x 150 cm3) . The combined organic phase was washed with saturated aqueous solutions of sodium hydrogen carbonate (3 x 40 cm3) and brine (3 x 40 cm3), dried (Na2S04) , filtered and evaporated under reduced pressure. The residue was purified by silica gel column chromatography using dichloromethane:methanol (99.5:0.5, v/v) as eluent to give nucleoside 36 as a white solid material (7.1 g, 92%). Spectral data were in accordance with data given earlier for 36 (Found C, 66.2; H, 5.8; N, 6.1; C25H26N206 requires C, 66.6; H, 5.8; N, 6.2 ) . Example 65 Synthesis of oligonucleotides containing LNA's of formula V, X, Y and Z', ZD, Z, Zc, Z, Z'c. The bicyclic nucleoside 3 '-O- phosphoramidite analogues 8, 19, 30, 39, 46, 53, 57D, 61D, and 66 as well as commercial 3'-O-phosphoramidites were used to synthesise example oligonucleotides of the invention (0.2 to 5 fimol scale) containing one or more of the LNA's of types V, X, Y and ZT, Zff, Z°, Zc, ZA, and Z'c. The purity and composition of the synthesised oligonucleotides was verified by capillary gel electrophoresis, and/or HPLC and/or MALDI-MS. In general, satisfactory coupling efficiencies were obtained for all the monomers. The best coupling efficiencies (.95-100%) were obtained for LNA's 39, 46, 53, 57D, 61D, and 66 (leading to LNA monomers of formula Z) giving very satisfactory results when synthesising fully modified LNAs or when incorporating LNAs in otherwise unmodified DNA or RNA stands or LNA's into an all- phosphorothioate oligonucleotide. Oligonucleotides were dissolved in pure water and the concentration determined as OD260. Solubilities in all cases were excellent. For plain DNA/RNA synthesis and partially modified LNA oligomers, a standard CPG support or a polystyrene support, was used. For the synthesis of fully modified LNA oligomers (e.g. 5'- 1-6 d(GTGATATGC)-3 '), a BioGenex Universial CPG Support (BioGenex, U.S.A.) was'used.) Example 65A Synthesis of phosphorothioate LNA oligonucleotides. The all- phosphorothioate LNA (Table 7) was synthesized on an automated DNA synthesizer using similar conditions as those described earlier (Example 65). Beaucages' reagent was used as sulphurizing agent. The stepwise coupling yields were >98%. After completion of the syntheses, deprotection and cleavage from the solid support was effected using concentrated ammonia (55 °C, 14 h). Example 65B Synthesis of 2'-Thio-LNA oligonucleotides. The 2'-thio-LNAs (containing monomer Zns, Scheme 13, Table 8) were synthesized on an automated DNA synthesizer using standard conditions (Example 65). The step-wise coupling yield for amidite 76F was approximately 85% (12 min couplings; improved purity of amidite 76F is expected to result in increased coupling yield). After completion of the syntheses, deprotection and cleavage from the solid support was effected using concentrated ammonia (55 °C, 8 h) . Example 65C Synthesis of 2 ■-Amino-LNA oligonucleotides. By procedures similar to those described in Example 65B, 2'-Amino-LNAs (containing monomer Z™' and monomer Z™1', Schemes 12 and 12A) was efficiently obtained on an automated DNA synthesizer using amidites 74A and 74F (>98% stepwise coupling yields). Example 66 Thermostability of oligonucleotides containing monomers of formula V, X, Y and ZT, Zu, Z°, Zc, ZA, ZHeC. The thermostability of the LNA modified oligonucleotides were determined spectrophotometrically using a spectrophotometer equipped with a thermoregulated Peltier element. Hybridisation mixtures of 1 ml were prepared containing either of 3 different buffers (lOmM Na2HP04, pH 7.0, lOOmM NaCl, 0. ImM EDTA; lOmM Na2HP04 pH 7.0, pH 7.0, O.lmM EDTA) and equimolar (1 |iM or 1.5 1-6M) amounts of the different LNA modified oligonucleotides and their complementary or mismatched DNA or RNA oligonucleotides. Identical hybridisation mixtures using the unmodified oligonucleotides were prepared as references. The Tm's were obtained as the first derivative of the melting curves. Tables 1-4 summarise the results (LNAs are marked with bold). Figure 2 illustrates the monomeric LNAs used. LNAs containing structure Z were particularly thoroughly examined. When three ZT residues were incorporated into an oligonucleotide of mixed sequence the T/s obtained in NaCl buffer with both complement airy DNA (10) and RNA (16) oligonucleotides were substantially higher (RNA: roughly 7 °C and DNA: roughly 5 °C per modification) than the Tm of the corresponding duplexes with unmodified oligonucleotides (1 and 8). Similar results were obtained with LNAs containing two ZT residues and either one Z° (21 and 24B) or Zu (25), Zc (69), Z'c (65), and ZA (58) residues. When mismatches were introduced into the target RNA or DNA oligonucleotides the TB of the LNA modified oligonucleotides in all cases dropped significantly (11-15A and 17; 18-20 and 22-24A; 26-31; 57 and 59-60; 63-64 and 66; 67-68 and 70), unambiguously demonstrating that the LNA modified oligonucleotides hybridise to their target sequences obeying the Watson-Crick hydrogen bonding rules. In all cases the drop in Tm of the LNA modified oligonucleotides upon introduction of mismatches was equal to or greater than that of the corresponding unmodified oligonucleotides (2-7 and 9; 33-38), showing that the LNA modified oligonucleotide are at least as specific as their natural counterparts. The general difference in Tm between the LNA modified oligonucleotides and the unmodified reference oligonucleotides observed in NaCl buffer was also observed in low salt buffer (without NaCl) and TMAC buffer. The data with the low salt buffer shows that LNA modified oligonucleotide exhibit a sensitivity to the ionic strength of the hybridisation buffer similar to normal oligonucleotides. From the Tm data with the TMAC buffer w1-6 infer that TMAC exhibits a Tm equalising effect on LNA modified oligonucleotides similar to tne ettect observed witn normal UNA oligonucleotides. The fully modified LNA oligonucleotide containing all four monomers (71,75), the almost fully modified LNA oligonucleotide (except for a 3'-terminal DNA nucleoside) containing both ZQ and ZT (41 and 41A) and the partly modified oligonucleotide containing a central block of ZT and Z° (40 and 40A) also exhibit substantially increased affinity compared to the unmodified control oligonucleotide (39 and 39A; 1 and 8). This shows that LNAs of formula Z are very useful in the production of both fully and partly modified oligomers. We note that the almost fully modified oligomer (41 and 41A) exhibits an unprecedented high affinity for both complementory RNA (>93°C) and DNA (83°C) . A similar extreme affinity (for both RNA and DNA) was observed with the almost fully modified LNA oligomer containing exclusively Z' (52 and 53) and the fully modified LNA oligomer (71 and 75). The affinity of the partly modified poly-T oligonucleotide depended on the positions and the number of ZT monomers incorporated (44-51) . Whereas the Tm's with RNA targets (45, 47, 49 and 51) in all cases were higher than the corresponding unmodified oligonucleotides (43) one gave a lower Tm with the DNA target (46). Since mixed sequence oligonucleotide containing 3 ZT residues exhibited a substantially increased affinity compared to the unmodified reference oligonucleotides one explanation for this result is that other binding motifs than Watson-Crick (such as for example the Hoogsteen binding motif) are open to poly-T oligonucleotides and that these binding motifs are somewhat sensitive to the precise architecture of the modified oligonucleotide. In all cases introduction of single base mismatches into the complex between the fully ZT modified poly-T oligonucleotide and a DNA target (54-56) resulted in a significant drop in Tm. Oligonucleotides containing either LNAs of structures V, X and Y were only analysed in the context of fully and partly modified poly-T sequences. Similar to the poly-T oligonucleotides containing ZT the fully modified oligonucleotides of structure V and Y exhibited an increase in Tm (albeit much lower than-the ZT modified oligonucleotides) with both RNA and DNA targets. Partly modified oligonucleotides containing monomers of structure V and Y behaved similarly to partly modified oligonucleotides containing ZT and probably this is due to the homopolymer nature of the sequence as outlined above. Oligonucleotides containing XT in all cases exhibited a much reduced Tm compared to the reference DNA oligonucleotides. Example 67 3 • -Exonucleolytic stability of oligomers 5'-V13T and 5'-ZT13T A solution of oligonucleotides (0.2 OD) in 2 ml of the following buffer (0.1 M Tris-HCl, pH 8.6, 0.1 M NaCl, 14 mM MgCl2) was digested with 1.2 U SVPDE (snake venom phosphodiesterase: 3 '-exonuclease) ; 34 |Lll of a solution of the enzyme in the following buffer: 5 mM Tris-HCl, pH 7.5, 50% glycerol (v/v) at 25 °C. During digestion, the increase in absorbance at 260 nm was followed. Whereas the unmodified control T14 was fµly degraded after 10 min of degradation, 5-Z'13T and 5'-V13T remained intact for 60 min. Example 68 LNA monomers can be used to significantly increase the performance of biotinylated-DNA oligos in the sequence specific capture of PCR amp1icons in a MTP format Two DIG labelled amplicons from pUC19 were generated by PCR amplification as follows: PCR reaction mixture for Amplicon 1 1 µl pUC19 (1 ng/µ) , 1 µl reverse primer (5'-AACAGCTATGACCATG-3') (20 pM), 1 µl forward primer (5'- GTAAAACGACGGCCAGT-3') (20 ,M), 10 µl dUTP-mix (2 mM dATP, 2 mM dCTP, 2 mM dGTP and 6mM dUTP) , 1.5 µ DIG-11-dUTP (1 mM) 10 µ 10x Taq buffer (Boehringer Mannheim incl MgCl2) 1 µ Taq polymerase (Boehringer Mannheim) 5 U/µ H20 ad 100 µ PCR reaction mixture for Amplicon 2 1 ill pUC19 - 0.4 µl primer 3 (5'-GATAGGTGCCTCACTGAT-3') (50 pM) , 0.4 µl primer 4 (5'-GTCGTTCGCTCCAAGCTG-3') (50 pM) , 10 µl dUTP-mix (2 mM dATP, 2 mM dCTP, 2 mM dGTP and 6mM dUTP), 1.5 µl DIG-11-dUTP (1 mM) 10 µl lOx Taq buffer (Boehringer Mannheim incl MgCl2) 1 µl Taq polymerase (Boehringer Mannheim) 5 U/pl H20 ad 100 µl PCR reaction : (Cycler: Perkin Elmer 9600) 94°C 5 min; add polymerase; 94°C 1 min, 45°C Imin, 70°C 2 min (29 cycles) 72°C 10 min 10 µl from each PCR reaction was analysed on a standard agarose gel and the expected fragments of approximately 100 bp and 500 bp were observed. 10 µl of DIG-labelled amplicon 1 or amplicon 2 was mixed with 5 pmol of 5' biotinylated capture probe in lxSSC (0.15 M NaCl, 15mM citrate, pH 7.0) in a total volume of 450 µl. The following capture probes were used: B-DNAl (biotin-ATGCCTGCAGGTCGAC-3'; DNA probe specific for amplicon 1), B-DNA2 (biotin-GGTGGTTTGTTTG-3'; DNA probe specific for amplicon 2) and B-LNA2 (biotin-GGTGGTTTGTTTG-3', LNA nucleosides in bold; LNA probe specific for amplicon 2). Reactions were heated to 95°C for 5 minutes in order to denature amplicons and allowed to cool at 25°C for 15 minutes to facilitate hybridisation between the probe and the target amplicon strand. After hybridisation 190 µl of each reaction were transferred to a streptavidin coated micro plate (µlerce, cat. no.15124) and incubated for one hour at 37°C. After washing the plate with phosphate buffered saline (PBST, 0.15 M Na+, pH 7.2, 0.05% Tween 20, 3x 300pl), 200 µl of peroxidase labelled anti- DIG antibodies were added (Boehringer Mannheim, diluted 1:1000 in PBST). Plates were incubated for 30 minutes at 37°C and washed (PBST, 3x 300pl). Wells were assayed for peroxidase activity by adding 100 µl of substrate solution (0.1 M citrate-phosphate buffer pH 5.0, 0.66mg/ml ortho-pheylenediamine dihydrochloride, 0.012% H202) . The reaction was stopped after 8 minutes by adding 100 µl H2S04 (0.5 M) and the absorbance at 492 run was read in a micro plate reader. As shown in figure 3, the unmodified bio-DNAs capture probes (B-DNA1 and B-DNA2) both behave as expected, i.e. they each capture only their target PCR amplicon. Compared to the B-DNA1 probe the B-DNA2 probe is rather inefficient in capturing its cognate amplicon. The capture efficiency of the B-DNA2 probe, however, can be dramatically improved by substituting 12 of its 13 DNA nucleosides by the corresponding LNA nucleosides. As shown in figure 3 the use of the B-LNA2 probe in place of the B-DNA2 probe leads to a more that 10 fold increase in the sensitivity of the assay. At the same time the B-LNA2 retains the ability of the un-modified B-DNA2 to efficiently discriminate between the related and non-related amplicon, underscoring the excellent specificity of LNA-oligos. We conclude that 1) biotin covalently attached to an LNA modified oligo retains its ability to bind to streptavidin, 2) that LNA modified oligos works efficiently in a MTP based amplicon capture assay and that 3) LNA offers a means to dramatically improve the performance of standard DNA oligos in the affinity capture of PCR amp1icons. Example 69 An LNA substituted oligo is able to capture its cognate PCR amplicon by strand invasion. Two identical sets of 10)11 reactions of ampliconl or 2 (prepared as in example 68) were mixed with either 1, 5 or 25pmol of the B-LNA2 capture probe (biotin-GGTGGTTTGTTTG-3', LNA nucleosides in bold; probe specific for amplicon 2) in 1 x SSC (0.15 M NaCl, 15mM citrate, pH 7.0) in a total volume of 450 ul. One set of reactions were heated to 95°C for 5 minutes in order to denature amplicons and allowed to cool to 25°C to facilitate hybridisation between the probe and the target amplicon strand. The other set of reactions were left without denaturation. From each of the reactions 190 ul were transferred to a streptavidin coated micro plate (pierce, cat. no.15124) and incubated for one hour at 37°C. After washing the plate with phosphate buffered saline (PBST, 0.15 M Na, pH 7.2, 0.05% Tween 20, 3x 3 00pl), 200 ul of peroxidase labelled anti- DIG antibodies were added (Boehringer Manheim, diluted 1:1000 in PBST). Plates were incubated for 30 minutes at 37°C and washed (PBST, 3x 300pl). Wells were assayed for peroxidase activity by adding 100 ,xl of substrate solution (0.1 M citrate-phosphate buffer pH 5.0, 0.66mg/ml ortho-pheylenediamine dihydrochloride, 0.012% H202) . The reaction was stopped after 10 minutes by adding 100 ,xl H2S04 (0.5 M) and the absorbance at 492 run was read in a micro plate reader. When amplicons are denaturated prior to hybridisation with the capture probe (figure 4A) we observe an efficient and sequence specific amplicon capture similar to that shown in example 68. Increasing the concentration of the B-LNA2 from 1 to 5pmol leads to an increase in capture efficiency. A further increase to 25pmol of probe results in a decreased signal. This observation is consistent with saturation of the available biotin binding sites on the streptavidin MTP. When amplicons are not denaturated prior to hybridisation with the capture probe (figure 4B) we also observe an efficient and sequence specific amplicon capture. In fact, the data shows that amplicon capture without denaturation are as effective and specific as amplicon capture with denaturation. This strongly indicates that the Bio-LNA2 probe is capable of binding to its target sequence by strand invasion. To our knowledge, this constitutes the first example ever of sequence specific targeting of dsDNA under physiological salt conditions by a mixed purine/pyrimidine probe. Aside from its potential to significantly simplify a range of basic research and DNA diagnostic procedures this unexpected property of LNA modified oligos can be foreseen to be of major importance in the development of efficient new drugs by the antisense, and in particular anti-gene approach. Example 70 An LNA substituted oligo, immobilised on a solid surface function efficiently in the sequence specific capture of a PCR amplicon. Wells of a streptavidin coated micro-titer plate (Boehringer Mannheim) were incubated for 1 hour with either 5 pmol of the B-DNA2 probe (biotin-GGTGGTTTGTTTG-3'; DNA probe specific for amplicon 2) or the B-LNA2 probe (biotin- GGTG6TTTGTTTG-3 ', LNA nucleosides in bold; LNA probe specific for amplicon 2) in a total volume of lOOjIl IxSSC (0.15 M NaCl, 15mM citrate, pH 7.0). In total, four wells were incubated with the B-DNA2 probe, four wells with the B-LNA2 probe and four wells were incubated with buffer alone. After incubation the wells were washed three times with IxSSC. DIG-labelled ampliconl (60|il) or amplicon2 (60|ll) (prepared as in example 68) were mixed with 540ul of 1 xSSC, heat denaturated at 95°C for 5 min., and transferred (lOOjxl) to the micro plate wells. Two of the wells containing either B-DNA2, B-LNA2 or no capture probe received ampliconl and two of the wells containing B-DNA2, B-LNA2 or no capture probe received amplicon2. After 1 hour at 37°C the plate was washed 3 times with phosphate buffered saline (PBST, 0.15 M Na, pH 7.2, 0.05% Tween 20, 3x 300uD and 2 00 ]il of peroxidase labelled anti- DIG antibodies were added (Boehringer Mannheim, diluted 1:1000 in PBST). Plates were incubated for 3 0 minutes at 37°C and washed 3 times with 3 00pl PBST. Wells were assayed for peroxidase activity by adding 100 µl of substrate solution (0.1 M citrate-phosphate buffer pH 5.0, 0.66mg/ml ortho-pheylenediamine dihydrochloride, 0.012% H202) . The reaction was stopped after 6 minutes by adding 100 jil H2S04 (0.5 M) and the absorbance at 492 run was read in a micro plate reader. As shown in figure 5, the LNA modified capture probe (B-LNA2) captures its specific amplicon (amplicon2) very efficiently and significantly better (approx. five fold increase in sensitivity) than the corresponding unmodified DNA capture probe (B-DNA2). No signal is obtained when the B-LNA2 probe is incubated with the unrelated amplicon (ampliconl) underscoring the exquisite specificity of the B-LNA2 probe. We conclude that LNA modified oligos function efficiently in the sequence specific capture of PCR amplicons when immobilised on a solid surface. We further conclude that the use of LNA modified oligos in place of standard DNA oligos provide for a better signal to noise ratio. Thus, LNA offers a means to significantly improve the performance of current DNA based assays that utilises immobilised capture probes, like for instance the array format wherein multiple immobilised probes are used to .1-6simultaneously detect the occurrence of several different target sequences in a sample. Example 70a Fully mixed LNA monomers can be used to significantly increase the performance of immobilised biotinylated-DNA oligos in the sequence specific capture of PCR amplicons in a MTP format. Three DIG labelled amplicons from Nras sequence (ref.: Nucleic Acid Research 1985 vol. 13 no. 14 p 52-55) were generated by PCR amplification as follows: PCR primers: Forward primer: 5'-CCAGCTCTCAGTAGTTTAGTACA-3' bases 701-723 according to the NAR reference. 910 bp reverse primer: 5'-GTAGAGCTTTCTGGTATGACACA-3' bases 1612-1590 (reverse sequence to NAR ref.). 600 bp reverse primer: 5'-TAAGTCACAGACGTATCTCAGAC-3' bases 1331-1308 (reverse sequence to NAR ref.). 200 bp reverse primer: 5'-CTCTGTTTCAGACATGAACTGCT-3' bases 909-886 (reverse sequence to NAR ref.). PCR reaction mixture for Nras amplicons: 2.3 ul human placental genomic DNA (440 ng/ul), 50 ul lOx PCR buffer (without MgCl2 Perkin Elmer), 30 ul 25 mM MgCl2/ 50 µl dNTP-mix (2 mM dATP, dCTP, dGTP and 1.8 mM dTTP), 10 ul 1 mM Dig-11-dUTP, 10 ul 25 µM forward primer, 10 µl 25 µM reverse primer , 5 ul 5 U/ul AmpliTaq Gold (Perkin Elmer) and water ad 500 ul' PCR reaction: The above mixture was made for all the Nras PCR products. The only difference being reverse primer 910 bp, 600 bp or 200 bp added once at a time. The PCR mixtures were aliquoted into ten PCR tubes each and cycled in a Perkin Elmer 9600 at following conditions: 95°C 3 min; 55°C 2 min, 72°C 3 min, 95°C 1 min (30 cycles); 55°C 2 min, 72°C 10 min and 4°C soak. 10 ul from each PCR reaction was analysed on a standard agarose gel and the expected fragments of approximately 910 bp, 600 bp and 200 bp were observed. Assay conditions: Wells of a streptavidin coated micro-titer plate (Boehringer Mannheim binding 20 pmol biotin per well) were incubated for 1 hour in 5 x SSCT (0.75 M NaCl, 75 mM citrate, pH 7.0, 0.1% Tween 20) at 37°C with either 1 pmol of DNA Nras Cap A (biotin-5 ' -TTCCACAGCACAA-3 ' ) , LNA/DNA Nras Cap A (biotin-5' -TTCCACAGCACAA-3 ') , LNA Nras Cap A (biotin-5'-TTCCACAGCACAA-3'), DNA Nras Cap B (biotin-5'- AGAGCCGATAACA-3' ) , LNA/DNA Nras Cap B (biotin-5 ' -AGAGCCGATAACA-3') or LNA1-6ras Cap B (biotin-5' -AGAGCCGATAACA-3 ') ; LNA nucleosides in bold. Nras Cap A capture probes capture specific amplicons Nras 910, Nras 600 and Nras 200. Nras Cap B capture probes capture specific amplicons Nras 910 and Nras 600. After incubation the wells were washed in 5 x SSCT and 5 ill native or denatured (95° C 5 min and 10 min on ice) DIG-labelled amplicons (Nras 910, Nras 600 or Nras 200) in 95 µl 1 x SSCT (0.15 M NaCl, 15 mM citrate, pH 7.0, 0.1% Tween 20) per well were added and incubated for 1 hour at 37°C. The wells were washed three times in phosphate buffered saline (1 x PBST, 0.15 M Na, pH 7.2, 0.05% Tween 20) and incubated 30 minutes at 37°C with 200 yl peroxidase labelled anti-DIG antibodies (Boehringer Mannheim, diluted 1:1000 in 1 x PBST). Finally the wells were washed three times in 1 x PBST and assayed for peroxidase activity by adding 100 ,il of substrate solution (0.1 M citrate-phosphate buffer pH 5.0, 0.66 mg/ml ortho-pheylenediamine dihydrochloride, 0.012% H202) the reaction was stopped after 9 minutes by adding 100µl 0.5 M H2S04 and diluted 4 times in H2S04 before the absorbance at 492 run was read in a micro-titer plate reader. As shown in figure 23a, capture probes sµlked with 12 LNA nucleosides (LNA Nras Cap A and LNA Cap B) capture very efficiently the specific amplicons without prior denaturation (native amplicons). Capture probes sµlked with 4 LNA nucleosides (LNA/DNA Nras Cap A and LNA/DNA Nras Cap B) capture the same amplicons with a lower efficiency and the DNA capture probes (DNA Nras Cap A and DNA Nras Cap B) do not capture the specific amplicons at all. The control amplicon, Nras 200, are not captured by the LNA Cap B or the LNA/DNA Nras Cap B probes demonstrating the exquisite specificity of the LNA sµlked capture probes. Figure 23b shows the same experiment performed with denatured amplicons. Essentially the same µlcture emerges with the essential difference that capture efficiencies are generally increased. We conclude that LNA modified oligos containing mixed LNA nucleosides (A, T, G or C LNA nucleosides) function efficiently in sequence specific capture of PCR amplicons when immobilised on a solid surface. We further conclude that LNA offers a means to construct capture probes that will function efficiently in amplicon capture without prior denaturation i.e. capture by strand displacement. This ability facilitates a significant simplification of current amplicon detection formats based on DNA. Example 71 LNA modified oligos are substrates for polynucleotide kinase. 20 pmoles of each primer (FP2: 5'- GGTGGTTTGTTTG-3'; DNA probe)(AL2: 5'-GGTGGTTTGTTTG-3', LNA nucleosides in bold) and AL3: 5'-GGTGGTTTGTTTG-3', LNA nucleosides in bold) was mixed with T4 polynucleotide Kinase (5 Units; New England Biolabs) and 6 µl y- ATP (3000 Ci/mmol, Amersham) in a buffer containing 70 mM Tris-HCl (pH 7.6), 10 mM MgCl2/ 5 mM dithiotretol (final volume 20 µl). The samples were incubated 40 minutes at 37°C and afterwards heated to 65°C for 5 minutes. To each of the reactions were added 2|J,1 of tRNA (l]ig/,il) , 291-61 of a 3M ammonium acetate and 100(il of ethanol. The reactions were incubated at -20°C for 30 min. and the labelled oligos were preciµltated by centrifugation at 15000g for 30 min. The pellet was resuspended in 20 µl H20." The samples (1 µl) were mixed with a loading buffer (formamide (pH 8.0), 0.1 % xylene cyanol FF, 0.1 % bromophenol blue and 10 mM EDTA) and electrophoresed on a denaturing polyacrylamide gel (16 % acrylamide/bisacrylamide solution, 7 M urea, 1 X TBE and 0.1 mM EDTA) in a TBE running buffer (90 mM Tris-HCl (pH 8.3), 90 mM boric acid and 2.5 mM disodium EDTA-2 H20) . The gel was dried on a gel dryer (BioRad model 583) and autoradiographed to a X-ray film (CL-XPosure film, µlerce 34075) for 20 minutes. The result is shown in figure 6 (FP2: lane 1 and 2; AL2: lane 3 and 4; AL3: lane 5 and 6). Three conclusions can be drawn on the basis of this experiment. Firstly, it can be concluded that partly and fully LNA modified oligos are excellent mimics of natural nucleic acid in their ability to act as substrate for a nucleic acid specific enzyme like polynucleotide kinase. Secondly, it can be concluded that LNA modified oligos can be efficiently preciµltated by procedures normally employed to preciµltate standard nucleic acids. In fact, the relative signal intencities of the unmodified (lane 1,2), partly (lane 3,4) and fully modified oligos (lane 5,6) in the autoradiogram suggests that the more LNA nucleosides a standard DNA oligo contains the more efficiently it can be preciµltated by salt/alcohol procedures. Thirdly, the similar positions of the signal in the autoradiogram of the unmodified, partly and fully modified oligos shows that incorporation of LNA nucleosides into a DNA oligo does not alter its electrophoretic mobility in polyacrylamide gels. Example 72 LNA modified oligos function as primers for nucleic acid polymerases. The ability of an LNA modified oligo (5'-GGTGGTTTGTTTG-3', LNA nucleosides in bold) to serve as primer in template dependent, enzymatic elongation were investigated with 3 different classes of polymerases. A reverse transcriptase M-MuLV (Boehringer Mannheim) which can use both RNA and DNA as template, the Klenow polymerase which is representative of standard DNA polymerases and a thermostable polymerase, BM-TAQ (Boehringer Mannheim) . As control the extension reactions were conducted using the identical unmodified DNA primer (5'-GGTGGTTTGTTTG-3 ') . The LNA and DNA primers were labelled with 32P-y-ATP as previously described in example 71. A 50mer DNA oligo (5 '-AAAAATCGACGCTCAAGTCAGAAAAGCA-TCTCACAAACAAACAAACCACC-3') was used as template. The reaction with M-MuLV (Boehringer Mannheim, ) contained 2|Al of either labelled LNA-primer or DNA primer (10|iM) , 2|ll of DNA template (10|iM), 21-611 of 2mM dNTP, 2(xl of 10 x buffer (500mM Tris-HCl, 300mM KC1, 60mM MgCl2, lOOmM DTT, pH 8.3 (37°C) ) , l|ll of enzyme (20U/|il) and water to 20(il. The reactions were incubated at 37°C for 60 min. The reaction with Klenow polymerase (USB) contained 2µl of either labelled LNA or DNA primer (10(XM) , 2|!l of DNA template (lO1-6lM ), 2(il of 2mM dNTP, 2fil of 10 x buffer (lOOmM Tris-HCl, 50mM MgCl2, 75mM DTT, pH 7.5), l|!l of enzyme (lOU/µl) and water to 20µl. The reactions were incubated at 37°C for 60 min. The reaction with BM-Taa (Boehringer Mannheim) contained 2fil of either labelled LNA or DNA-primer (10|iM) , 2(ll of DNA template (lO1-6lM) , 2(0,1 of 2mM dNTP, 2|il of 10 x buffer (lOOmM Tris-HCl, 15mM MgCl2/ 50mM KCL, pH 8.3), l|Il of enzyme (5U/µl) and water to 20µl. The reactions were incubated at a starting temperature of 37°C and ramped at l°C/min to 60°C were they were maintained for 3 0min. At the end of the incubation period the reactions were stopped by the addition of 10|ll of loading buffer (0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol, 80% (v/v) formamid). The samples were heated to 95°C for 1 min., placed on ice and 2µl was loaded onto a 8% sequencing polyacrylamide gel and electrophoresed on a Life Technologies Inc. BRL model 52. After electrophoresis the gel was dried on the glass plate and subjected to autoradiography (X-ray film: Kodak X-Omat AR). As shown in figure 7, clear and similar extension products are observed with both the LNA and DNA primer when either the Klenow polymerase (lanes 3) or the BM-Taq polymerase (lanes 5) is used. When M-MuLV reverse transcriptase is used (lanes 2) an extension product can be detected only in the case of the LNA-primer. The labelled LNA and DNA primer that have not been subjected to enzymatic elongation are present in lanes 1, 4 and 6. We conclude that the incorporation of LNA nucleosides into standard DNA oligos does not prevent recognition of the oligo/template duplex by nucleic acid polymerases. We further conclude that LNA modified oligos act as efficiently as primers as unmodified DNA oligos. Example 73 LNA modified oligo functions as primers in target amplification processes' The ability of LNA modified Dligos to act as primers in PCR amplification was analysed with three oligos differing only in the number of LNA nucleosides :hey contained: 4 LNA nucleosides (AL2 primer: 5'-3GTGGTTTGTTTG-3', LNA nucleosides in bold), 1 LNA nucleoside (ALIO primer: 5'-GGTGGTTTGTTTG-3', LNA nucleoside in bold) and 10 LNA nucleoside (FP2 primer: 5 '-GGTGGTTTGTTTG-3 ') . The PCR reactions (lOOjLll) contained either no template (control), O.Olng, O.lng or lng of template (pUC19 plasmid), 0.2|HY[ reverse primer (5 '-GTGGTTCGCTCCAAGCTG-3 ') , 0.2|iM of either the AL2, ALIO or FP2 forward primer, 200pM of dATP, dGTP, dCTP and dTTP, lOmM Tris-HCl pH 8.3, 1.5mM MgCl2, 50mM KC1 and 2 . 5U of the BM-Taq polymerase. A total of 50 cycles each consisting of 94°C lmin. - 45°C lmin. - 72°C 1.5min. were conducted (with an additional 2.5U of Taq polymerase added after the first 3 0 cycles) on a Techne Genius thermocycler. After the final cycle the reactions were incubated at 72°C 3min. and then at 4°C overnight. To 3 0µl of each reaction was added 6|Xl of loading buffer (0.25% (w/v) bromophenol blue and 40% (v/v) glycerol) and the samples (together with a Amplisize size marker) were loaded onto a 2% agarose gel and electrophoresed for 45min. at 150V. Finally, the gel was stained with ethidiumbromid and photographed. As shown in figure 8 the PCR reactions using the unmodified forward primer FP2 and unmodified reverse primer generates detectable amplicons of the correct sizes with all amounts of template used (lane 9: O.Olng template, lane 10: O.lng and lane 11: lng). No signal is obtained in the control reaction without template (lane 12). When the FP2 forward primer is replaced by the primer containing 1 central LNA nucleoside (ALIO) amplicons are also detected with all amounts of template used (lane 5: O.Olng, lane 6: O.lng and lane 7: lng). This clearly indicates that the ALIO primer sustains an exponential amplification, i.e. the ALIO primer can be both extended and used as template in its entirety. Again, the control reaction without template (lane 8) does not produce an amplicon. When the FP2 forward primer is replaced by the primer containing 4 central LNA nucleosides . (AL2), amplicons of the correct size cannot be detected in any of the reactions, (lane 1: O.Olng template, lane 2: O.lng, lane 3: lng and lane 4: no template). With the highest concentration of template (lng), however, a high molecular weight band appears in the gel (lane 3). This, however, is an artefact of the RP1 primer as indicated by the control reaction wherein each of the primers AL2 (lane A), AL1O (lane B), FP2 (lane C) and RP1 (lane D) were tested for their ability to produce an amplicon with the highest amount of template (lng). Since AL2 was shown to act as a primer in, example 72, the absence of detectable amplicons strongly indicates that' it lacks the ability to act as a template, i.e. the block of 4 consecutive LNA nucleosides blocks the advance of the polymerase thereby turning the reaction into a linear amplification (the product of which would not be detectable by the experimental set-up used). We conclude that LNA modified oligos can be used as primers in PCR amplification. We further conclude that the degree of amplification (graded from fully exponential to linear amplification) can be controlled by the design of the LNA modified oligo- We note that the possibility to block the advance of the polymerase by incorporating LNA nucleosides into the primer facilitates the generation of amplicons carrying single stranded ends. Such ends are readily accessible to hybridisation without denaturation of the amplicon and this feature could be useful in many applications. Example 74 LNA monomers can be used to increase the affinity of RNA oligomers for their complementary nucleic acids. The thermostability of complexes between a 9-mer RNA oligonucleotide containing 3 LNA-T monomers (ZT) and the complementary DNA or RNA oligonucleotides were measured spectrophotometrically. Hybridisation solutions (1ml) containing lOmM Na2HP04/ pH 7.0, lOOmM NaCl, O.lmM EDTA and 1|IM of each of the two oligonucleotides. Identical hybridisation mixtures using the unmodified RNA oligonucleotides were measured as references. As shown in table 5 the LNA modified RNA oligonucleotide hybridises to both its complementary DNA (1) and RNA (3) oligonucleotide. As previously observed for LNA modified DNA oligonucleotides, the binding affinity of the LNA modified RNA oligonucleotide is strongest to the RNA complement (3). In both cases the affinity of the LNA modified RNA oligonucleotide is substantially higher than that of the unmodified controls (2 and 4). Table 5 also shows that the specificity towards both DNA and RNA targets are retained in LNA modified RNA oligonucleotides. Example 75 LNA-LNA base pairing. RNA or DNA oligonucleotides containing three ZT LNA monomers or an oligonucleotide composed entirely of LNA Z monomers were hybridised to complementary unmodified DNA oligonucleotides or DNA oligonucleotides containing three ZA LNA monomers and the Tm of the hybrids were measured spectrophotometrically. Hybridisation solutions (1ml) contained lOmM Na2HP04, pH 7.0, lOOmM NaCl and 0 .1mM EDTA and ljiM of each of the two oligonucleotides. As shown in table 6 all the LNA modified oligonucleotides hybridises to the complementary, unmodified DNA oligonucleotides (2 and 3) as well as the complementary LNA modified oligonucleotides (4, 5 and 6). As observed previously the presence of LNA monomers in one strand of a hybrid (2 and 3) increases the TM significantly compared to the unmodified control hybrid (1). The presence of LNA-LNA base pairs in the hybrid increases the TM even further (4 and 5) Moreover, a highly stable hybrid can be formed between a fully modified LNA oligonucleotide and a partly LNA-ZA modified DNA oligonucleotide (6). This constitutes the first example of LNA-LNA base pairs in a hybrid. Example 76 An LNA all-phosphoromonothioate oligonucleotide display-relatively less decreased thermostability towards complementary DNA and RNA than the corresponsing all-phosphorothioate DNA oligonucleotide. The thermostability of an all-phosphoromonothioate DNA oligonucleotide containing three ZT LNA monomers (LNA oligonucleotide) and the corresponding all-phosphoromonothioate reference DNA oligonucleotide towards complementary DNA and RNA was evaluated (Table 7). It was observed that the LNA all-phosphoromonothioate oligonucleotide containing three LNA ZT monomers displayed only weakly decreased thermostability (Table 7, 3 and 4) when compared to the corresponding reference LNA oligonucleotide (Table 1, 10 and 16). The corresponding all-phosphoromonothioate DNA oligonucleotide (Table 7, 1 and 2) displayed significantly decreased thermostability when compared to the corresponding reference DNA oligonucleotide (Table 1, 1 and 8). This has important possible implications on the use of all- or partially phosphoromonothioate LNA oligonucleotides in antisense and other therapeutic applications. Thus, the compatibility of LNA monomers and unmodified monomers in an phosphoromonothioate oligonucleotide has been demonstrated. It can be anticipated that such constructs will display both Rnase H activity and nuclease resistance in addition to the LNA enhanced hybridisation characteristics. Example 76A 2'-Thio-LNA display nucleic acid recognition properties comparable with those of LNA (Monomer Z). The results for the 2'-thio-LNAs (Table 8) clearly indicate a positive effect on the thermal stability of duplexes towards both DNA and RNA by the introduction of 2'-thio-LNA monomer Zus. This effect (ATm - +5 °C / modification towards DNA; ATm - +8 °C / modification towards RNA) is comparable with that observed for parent LNA. The µlcture is complicated by the simultaneous introduction of two modifications (the 2 '-thio functionality and uracil instead of thymine). However, as we have earlier observed identical melting temperatures for the LNA thymine and uracil monomers, and as the references containing 2'-deoxyuridine instead of thymidine, if anything, would be expected to display lower Tm values, the comparison is relevant. Example 77 Fluorescein-labeling of LNA oligomers. LNA oligomers AL16 (5'-d(TGTGTGAAATTGTTAT)-3/: LNA nucleotides underlined) and AL17 (5'-d(ATAAAGTGTAAAG)-3': LNA nucleotides underlined) were succesfully labeled with fluorescein using the FluoroAmp T4 Kinase Green Oligonucleotide Labeling System as described by the manufacturer (Promega). Briefly, 16 nmol of either LNA-oligomer AL16 or AL17 was 5' -thiophosphate labelled in a 50|il reaction buffer containing T4 kinase and y-S-ATP. The reactions were incubated for 2 hrs at 37° C. The thiophosphorylated LNA oligos were preciµltated by the addition of 5µl of oligonucleotide preciµltant (Promega) and 165µl of ice cold (-20°C) 95 % ethanol. After centrifugation the pellets were washed once with 500µl of ice cold (-20° C) 70% ethanol and redissolved in 25µl of PBSE buffer. Freshly prepared 5-maleimide-feluorescein solution (50pg in 5pl DMSO) were added to the thiophosphorylated LNA oligos and the reaction mixtures incubated at 68° C for 30 min. Additional 5-maleimide-fluorescein (50yg in 5,µl DMSO) were added to each LNA oligo and the reaction mixtures incubated for an additional 60 min. After incubation 10ul of oligonucleotide preciµltant was added to each reaction mixture followed by 180 µl ice-cold (-20° C) and lOOpl N,N-dimethylformamide. The fluorescein labeled LNA oligos were isolated by centrifugation followed by asµlration of the supernatant. The fluorescein labelled LNA-oligomers were purified by reversed-phase HPLC as follows: column Delta-Pack C-18, 300A, 0.4 x 30 cm; eluent 0-50 % acetonitrile in 0.04 M triethylammonium buffer (pH 7.0); flow rate 1.5 ml/min. The fractions containing LNA-oligos were pooled and evaporated under reduced pressure (oil pump and speed-vac system) during 12 hrs• Example 78A A LNA oligonucleotide hybridises to complementary DNA in the parallel orientation (Table 1, 77) displaying a reduced thermostability as compared to complementary oligonucleotides in the anti-parallel orientation (Table 1, 71), Example 76B 2' -Amino-LNA (Monomer Z™') and 2 '-Methylamino-LNA (Monomer Z™') display nucleic acid recognition properties comparable with those of parent LNA (Monomer Z)• The melting results for the 2'-amino-LNA's (Table 9) clearly indicate a positive effect on the thermal stability of duplexes towards DNA and RNA by introduction of 2 '-amino-LNA monomers Z™' and Z™'. This effect (ATm - +3 °C / modification towards DNA and ATm - +6 to +8 °C / modification towards RNA) is comparable to that of parent LNA. It is notheworthy, that the increased thermal affinity is concerved in an oligo composed of a mixture of 2'-alkylamino-LNA monomers and nonalkylated 2'-amino-LNA monomers. Example 79 An LNA modified oligomer carrying a 5'anthraq1-6iinone can be covalently immobilised on a solid support by irradiation and the immobilised oligomer are efficient in the capture of a complementary DNA oligo. Either 25 pmol/pl or 12.5 pmol/pl of an anthraquinone DNA oligo (5'-AQ-CAG CAG TCG ACA GAG-37) or an anthraquinone LNA modified DNA oligo (5'-AQ-CAG CAG TCG ACA GAG-37; LNA monomer is underlined) was spotted (1 pl/spot) in 0.2 M LiCl on a polycarbonate slide (Nunc). The oligos were irradiated for 15 min with soft UV light. After irradiation the slide was washed three times in Milli-Q water and air-dried. 25ml of 0.5 pmol/pl of complimentary biotinylated oligomer (5'-biotin- CTC TGT CGA CTG CTG-3') was hybridized to the immobilized oligomers in 5 x SSCT (75 mM Citrate, 0.75 M NaCl, pH 7.0, 0.1% Tween 20) at 50°C for 2 hours. After washing with four times 1 x SSCT and one time phosphate buffered saline (PBST, 0.15 M Na, pH 7.2, 0.05% Tween 20),25ml PBST containing 0.06 pg/ml streptavidin conjugated horse radish peroxidase and 1 ug/ml streptavidin were added to the slide. The slide was incubated for 3 0 minutes and washed 4 times with 25ml PBST. The slide was visualised by using chemiluminescent substrate (SuperSignal; µlerce) as described by the manufacturer and X-ray film (CL-XPosure film, µlerce 34075) . As shown in figure 9 both the AQ-DNA oligo and the AQ-LNA modified DNA oligo yields a clearly detectable signal. We conclude that anthraquinone linked LNA modified DNA oligos can be efficiently attached to a solid surface by irradiation and that oligos attached in this ways are able to hybridise to their complementary target DNA oligos. Example 80 Hybridisation and detection on an array with different LNA modified Cy3-labelled 8mers' Slide preparation: Slide Washes 94.9%, (1) 39.7%, (2) 83.7%, (3) 31.7%. We conclude that LNA modified oligos are substrates for the TdT enzyme. Example 81A Synthesis of LNA nucleoside 5'-triphosphates• (Tetrahedron Letters 1988, 29 4525). In a 13x100 mm polypropylene tube, nucleosides 37, 44, 51, 4-N- benzoylated 57A or 61B (93.8 |Jmol) was suspended in 1 mL pyridine (dried by CaH2) . The solution was evaporated in a speedvac, under high vacuum, to dryness. The residue was twice resuspended in acetonitrile (dried by CaH2) and evaporated to dryness. The nucleoside was suspended in 313 |IL trimethyl phosphate (dried by 4A molecular sieves), to which 30.1 mg TM Proton Sponge (1.5 equivalents) were added. The mixture was sealed, vortexed, and cooled to 0° C. P0C13 (9.8 flL, 1.1 equivalent) was added with vortexing. The reaction was allowed to proceed at 0° C for 2.5 hours. During this interval, 469 (Jmols sodium pyrophosphate (5 equivalents) were dissolved in 5 mL water and passed through 5 mL Dow 50 H+ion exchange resin. When the effluent turned acidic, it was collected in 220|IL tributylamine and evaporated to a syrup. The TBA pyrophosphate was coevaporated three times with dry acetonitrile. Finally, the dried pyrophosphate was dissolved in 1.3 mL DMF (4A sieves). After 2.5 hours reaction time, the TBA pyrophosphate and 130 |1L tributylamine were added to the nucleoside solution with vigorous vortexing. After 1 minute, the reaction was quenched by adding 3 mL 0.1 M triethylammonium acetate, pH 7.5. Assay by Mono Q chromatography showed 49% nucleoside 5'-triphosphate. The reaction mixture was diluted to 100 mL with water and adsorbed onto a Q Sepharose ion exchange column, washed with water, and eluted with a linear gradient of 0 to 700 mM NaCl in 5 mM sodium phosphate, pH 7.5. Fractions containing triphosphate were assayed by Mono Q ion exchange chromatography. Fractions containing triphosphate were pooled and concentrated to the point of NaCl saturation. The product was desalted on a C18cartridge. The triphospate was quantitated by UV spectroscopy and adjusted to 10 mM solution. Yields were 17 - 44%. LNA nucleosides prepared by this method were, U, T, A, G, and C. Example 8IB The ability of terminal deoxynucleotidyl transferase (TdT) to tail LNA modified oligonucleotides depends on the design of the oligomer The following 15mer primers and 8 to 32 base oligonucleotide markers were 5' end labelled with [y 33P] ATP and T4 polynucleotide kinase: µl 5'-TGC ATG TGC TGG AGA-3' P2 5'- GC ATG TGC TGG AGA T-3' PZ1 5'-TGC ATG TGC TGG AGA-3' PZ2 5'- GC ATG TGC TGG AGA T-3' (Bold Type indicates the LNA monomers) Reactions were boiled for 5 minutes .after labelling to remove any PNK activity. Four µlcomoles of each labelled primer, 25 U terminal deoxynucleotidyl transferase and 16µM dATP were Incubated in 25,µl lOOmM cacodylate buffer pH7.2, 2mM CoCl2 and .2mM 2-mercaptoethanol for 90 minutes at 37°C. The reactions Were stopped by the addition of formamide stop solution and the reaction products run on a 19% polyacrylamide 7M urea gel with :he labelled markers. Autoradiography using Biomax film was carried out on the dry gel. The results (see Figure 22) showed that µl, P2 and PZ1 all gave L tails estimated at greater than 70 bases long. Primer PZ2 was tot extended under these reaction conditions. We conclude that he TdT enzyme will tolerate LNA monomers within the ligonucleotide, but not at the extreme 3' end. Example 82 LNA-thymidiiie-5' -triphosphate (LNA-TTP) as a substrate for terminal deoxynucleotidyl transferase (TdT). In order to test the ability of the triphosphate of LNA-TTP to be accepted by terminal deoxynucleotidyl transferase as a substrate, an oligonucleotide tailing reaction was performed, A 15mer primer (sequence: 5'-TGC ATG TGC TGG AGA-3') and 8 to 32 base oligonucleotide markers were 5' end labelled with [y nP] ATP and T4 polynucleotide kinase. Reactions were boiled for 5 minutes after labelling to remove any PNK activity. Four µlcomoles of the labelled primer, 25 U terminal deoxynucleotidyl transferase and 32,64 or 128flM dTTP or LNA-TTP were incubated in 25|ll lOOmM cacodylate buffer pH7.2, 2mM CoCl2 and 0.2mM 2-mercaptoethanol for 90 minutes at 37°C. The reactions were stopped by the addition of formamide stop solution and the reaction products run on a 19% polyacrylamide 7M urea gel with the labelled markers. Autoradiography using Biomax film was carried out on the dry gel. The results (Figure 10) showed that dTTP gave a tail estimated at greater than 100 bases long. The LNA-TTP reaction resulted in all the primer being extended by one base and -50% of this being extended by a further base. This result is very similar to that obtained with ribonucleotides and TdT. We conclude that LNA derived triphosphates can be recognised and incorporated into a DNA oligonucleotide by the TdT enzyme. This latter finding that LNA-TTP can bind to the polymerase underscores the possibility of successfully using LNA-monomer derivatives as nucleoside drugs. Example 83 Primer extension assays to study LNA Thymidine-5'-triphosphate (LNA-TTP) incorporation by DNA polymerases. A primer extension assay was used to evaluate the LNA-TTP, a ribonucleotide analogue, as a substrate for exonuclease free Klenow fragment DNA polymerase I (EFK) , ThermoSequenase™ and Taq DNA polymerases. The assay used a 33P 5' end labelled 15mer primer hybridised to one of three different 24mer templates The sequences of the primer and templates are: One µlcomole JJP labelled primer was hybridised to 2 µlcomoles of template in x2 Klenow buffer, x2 ThermoSequenase buffer, x2 PCR buffer. To this was added either 4fiM dNTPctS, 50µM dNTP or 80|µM, 250µM, 500µM or IµM LNA-TTP or a mixture of 4µM dNTPaS or 50µM dNTP and 80µM, 250µM, 500µM or IµM LNA-TTP. Two units of DNA polymerase were added to each reaction. 2mU inorganic pyrophosphatase was added to each of the EFK reactions. Primer alone, primer plus template plus enzyme controls were also carried out. The EFK reactions were incubated at 37°C for 3 minutes. The ThermoSequenase and Taq reactions were incubated at 60°C for three minutes. Reactions were then stopped by the addition of formamide EDTA stop solution. Reaction products were separated on a 19% polyacrylamide 7M urea gel and the product fragments sized by comparison with a 33P labelled 8 to 32 base oligonucleotide ladder after exposure to Kodak Biomax autoradiography film. Using the first template EFK and ThermoSequenase™ DNA polymerases were able to incorporate the ribonucleotide analogue LNA-TTP opposite A in the template. The efficiency of incorporation increased with increasing LNA-TTP concentration (figure 11).The major product was the +2 product where one LNA-TTP was added. At high LNA-TTP concentrations it is possible to see the +3 product from the incorporation of consecutive LNA-TTP residues. Very little incorporation was seen with Taq DNA polymerase even at the IµM LNA-TTP concentration. Using the second template EFK and ThermoSequenase™were able to incorporate LNA-TTP as the first base. Addition of dGTPaS and LNA-TTP resulted in a +5 product with both enzymes instead of the expected +3 product (figure 12 and 13). This appears to show that the LNA-TTP is incorporated as though it were an "A" analogue and that it can form a stable LNA T— T base pair. Again very little incorporation was seen with Taq DNA polymerase even at IµM LNA-TTP concentrations. Incorporation of LNA-TTP as an "A" analogue was confirmed by using template three. The addition of dCTPaS, dGTPaS and dTTPaS gave the +1 product from the incorporation of dGTPaS. However by adding dCTPOCS, dGTPaS, dTTPaS and LNA-TTP the full length 24mer product was made (figure 14). This present experiment constitutes yet another example of the ability LNA-TTP to bind to and be incorporated by nucleic acid polymerases. As such, the experiment underscores the potential of using LNA-monomer derivatives as nucleoside drugs. Example 83A Primer extension assays to study the incorporation of LNA Adenosine, Cytosine, Guanosine and Uridine-5'-triphosphates (LNA ATP, LNA CTP, LNA GTP, LNA UTP) by Exonuclease free Klenow fragment DNA polymerase I A primer extension assay was used to evaluate the LNA NTP's, ribonucleotides, as substrates for exonuclease free Klenow fragment DNA polymerase I (EFK) . The assay used a 33P 5' end labelled 15mer primer hybridised to one of four different 24mer templates The sequences of the primer and templates are: Primer 5' TGCATGTGCTGGAGA 3' Template 1 3' ACGTACACGACCTCTACCTTGCTA 5' Template 2 3' ACGTACACGACCTCTCTTGATCAG 5' Template 3 3' ACGTACACGACCTCTTGGCTAGTC 5' Template 4 3' ACGTACACGACCTCTGAACTAGTC 5' One µlcomole 3JP labelled primer was hybridised to 2 µlcomoles of template in x2 Klenow buffer. To this was added either 4flM dNTPccS or 500(iM LNA NTP or a mixture of 4|LIM dNTPOCS and 500|iM LNA NTP. Two units of EFK DNA polymerase was added to each reaction. 2mU inorganic pyrophosphatase was added to each of the reactions. Primer plus template plus enzyme controls were also carried out. All reactions were carried Out in a total volume of 20|il. The reactions were incubated at 37°C for 3 minutes. Reactions were then stopped by the addition of 10|il formamide EDTA stop solution. Reaction products were separated on a 19% polyacrylamide 7M urea gel and the product fragments sized by comparison with a 33P labelled 8 to 32 base oligonucleotide ladder after exposure to Kodak Biomax autoradiography film. Experiments using Template 1 (figure 20) show that LNA UTP is specifically incorporated as a "T", unlike the LNA TTP which is preferentially incorporated opposite a "T" in the template (i.e. it behaves as though it were a dATP analogue). Further extension from an LNA UTP terminated 3' end with dNTPOCS is very slow. Experiments using Template 2 (Figure 21) show that LNA GTP is able to produce the +1 product with efficient extension of the primer. The addition of dGTPCtS and LNA ATP results in mainly the +2 product. This is from the incorporation of dGTPCtS to give the +1 product followed by extension with LNA ATP. There is evidence of a small amount of +3 product from the consecutive incorporation of LNA ATP. Experiments using Template 3 (Figure 21) show that LNA ATP is efficiently incorporated to give the +1 product. Extension of this product with dCTPCXS is very slow. The addition of dATPocS and LNA CTP results in the +2 and +3 products. The absence of any significant +1 product shows that the addition of the first LNA CTP is efficient, but that the addition of the second LNA CTP is slow. The results from experiments on Templates 1 and 4 (Figure 21) show similar trends to those on the other templates. LNA CTP is efficiently incorporated to give the +1 product on Template 4. Extension of this product by dTTPotS is again very slow. The addition of LNA GTP and dTTPaS to reactions on Template 1 results in the +2 product. Again this shows that the addition of a single LNA triphosphate is quite efficient, but that the addition of consecutive LNA triphosphates is very slow. In all these reactions it should be remembered that the LNA triphosphates are essentially ribonucleotide analogues and it is therefore surprising that they are incorporated at all by DNA polymerases. Example 83B Use of [cc33P] ddNTP's and ThermoSequenase™DNA Polymerase to Sequence DNA Templates Containing LNA T Monomers Radiolabelled terminator sequencing reactions were set up in order to test the ability of the LNA T monomer to be accepted as a template for DNA polymerases. The 15mer primer (sequence: 5'- TGC ATG TGC TGG AGA -3') was used to prime the following short oligonucleotide sequences: [■ b) Template TZ1 mix 2µll xl6 ThermoSequenase Buffer 6µl Primer 2pmole/(µl 6µl Template TZ1 lpmole/µl 4µl Water 2|ll ThermoSequenase DNA Polymerase (4U/|ll) 20jll Total volume 2|ll Nucleotide mix (7.5|1M each dNTP) was added to each of 8 Eppendorf tubes. 0.5(il [α33P] ddATP was added to tubes 1 and 5. 0.5|J,1 [α33P] ddCTP was added to tubes 2 and 6. 0. 5|il [α33P] ddGTP was added to Tubes 3 and 7. 0.5(il [α33P] ddTTP was added to tubes 4 and 8. 4. 5fll of Template 1 mix was added to each of tubes 1-4. 4.5|il of Template TZ1 mix was added to each of tubes 5-8. All the reactions were incubated at 60°C for 3 minutes. The reactions were stopped by the addition of 4|il formamide/EDTA stop solution. Reactions were heated at 95°C for 3 minutes before loading onto a 19% polyacrylamide 7M urea gel. The gel was fixed in 10% acetic acid 10% methanol before transferring to 3µM paper and drying. The dried gel was exposed to Kodak Biomax autoradiography film. As shown in figure 18 and 19, the full sequence of both templates can easily be read from the autorad. The sequence is 5'-TGG AAC GTA- 3' which corresponds to the template sequence 3'-ACC TTG CTA- 5'. This shows that a single LNA T monomer can act as a template for DNA polymerases. The LNA T monomer is specifically coµled as "T" with ddATP being incorporated. There is no sign of ddTTP incorporation opposite the LNA T in the template. Therefore, the LNA T - T base pair seen when LNA TTP is incorporated by the polymerase, opposite a template "T" (example 83), is a specific attribute of the LNA TTP and the polymerase. This supports the idea of using LNA TTP in mutagenic PCR applications to cause T to A transversions. Example 84 LNA modified oligos can be transferred into cells' Experiment with radiolabelled LNA oligos. 10 pmol of a oligodeoxynucleotide (ODN) (ODN#10: 5'-TTA ACG TAG GTG CTG GAC TTG TCG CTG TTG TAC TT-3', a 35-mer complementary to human Cathepsin D ) and 10 pmoles of two LNA oligos: AL16 (5'-d(TGT GTG AAA TTG TTA T)-3', LNA nucleosides in bold) and AL17 (5'-d(ATA AAG TGT AAA G)-3', LNA nucleosides in bold) were mixed with T4 polynucleotide Kinase (10 units, BRL cat. no. 510- 8004SA) , 5 µl gaµMa-32P-ATP 5000 Ci/µMol, 10 uCi/µl (Amersham) in kinase buffer (50 µM Tris/HCl pH 7,6, 10 µM MgCl2, 5 µM DTT, 0.1 µM EDTA). The samples were incubated for 45 minutes at 37°C and afterwards heated to 68°C for 10 minutes, and then moved to +0 °C. Unincorporated nucleotides were removed by passage over Chroma Sµln TE-10 columns (Clontech cat. no. K1320-1). The yields were 5xl05 cpm/µl , 2xl05 cpm/µl and 0.8xl05 cpm/µl for ODN#10, AL16 and AL17, respectively. MCF-7 human breast cancer cells originally obtained from the Human Cell Culture Bank (Mason Research Institute, Rockville) were cultured in DME/F12 culture medium (1:1) supplemented with 1% heat inactivated fetal calf serum (Gibco BRL), 6 ng/ml bovine insulin (Novo) and 2.5 µM glutamax (Life Technologies) in 25 cm2 cell culture flasks (Nunclon, NUNC) and incubated in a humified incubator at 37°C, 5%C02, 20%O2, 75%N2. The MCF-7 cells were approximately 40% confluent at the time of the experiment. A small amount (less than 0.1 pmol) of the kinased oligos were mixed with 1.5 (ig pEGFP-NI plasmid (Clontech cat. no. 60851) and mixed with 100 µl.1 diluted FuGENE6 transfection agent (Boehringer Mannheim cat no. 1 814 443), dilution: 5|il FuGENE6 in 95 (µl DME/F12 culture medium without serum. The FuGENE6/DNA/oligo-mixture were added directly to the culture medium (5 ml) of adherent growing MCF-7 cells and incubated with the cells for 18 hours, closely following the manufacturers directions. Three types of experiments were set up. 1) ODN#10 + pEGFP-NI; 2) AL16 + pEGFP-NI; 3) AL17 + pEGFP-NI. Cellular uptake of DNA/LNA material were studied by removing FuGENE6/DNA/oligo-mixture containing medium (an aliquot was transferred to a scintillator vial). Cells were rinced once with phosphate buffered saline (PBS), fresh culture medium was added and cells inspected by fluorescence microscopy. Approximately 30% of the transfected cells contained green fluorescent material, indicating that approximately 3 0% of the cells have taken up the pEGFP-NI plasmid and expressed the green fluorescent protein coded by this plasmid. Following fluorescence microscopy the adherent MCF-7 cells were removed from the culture flasks. Briefly, the culture medium was removed, then cells were rinsed with a solution of 0.25% trypsin (Gibco BRL) 1 µM EDTA in PBS (without Mg2+ and Ca2+) , 1 ml trypsin/EDTA was added and cells were incubated 10 minutes at 37°C. During the incubation the cells loosened and were easily resuspended and transferred to scintillator vials. The cells were then completely dissolved by addition of 10 ml Optifluor scintillation coctail (Packard cat. no. 6013199), and the vials were counted in a Wallac 1409 scintillation counter. The results were as follows: 1) ODN#10 + pEGFP-NI: approximately 1.4% of the added radioactivity were associated with cellular material; 2) AL16 + pEGFP-NI: approximately 0.8% of the added radioactivity were associated dth cellular material; and 3) AL17 + pEGFP-NI: approximately 3.4% of the added radioactivity were associated with cellular naterial. tfe conclude that 0.4 - 0.8% of the added LNA oligos were taken jp by the cells. Example 84A JNA is efficiently delivered to living human MCF-7 breast lancer cells To increase the efficiency of LNA-uptake by human MCF-7 cells lifferent transfection agents were tested with various concentrations of 5'FITC-labelled LNA's and DNA. The oligonucleotides described in Table AB were tested. AL16 and AL17 were enzymatically labelled with FITC as described in example 77. EQ3009-01 and EQ3008-01 were labelled with FITC by standard solid phase chemistry. Three transfeetion agents were tested: FuGENE-6 (Boehringer Mannheim cat. no. 1 814 443), SuperFect (Quiagen cat. no. 301305) and Lipofectin (GibcoBRL cat. no. 18292-011). Human MCF-7 breast cancer cells were cultured as described previously (example 84). Three days before the experiments the cells were seeded at a cell density of approx. 0.8 x 104 cells per cm2. Depending on the type of experiment the MCF-7 cells were seeded in standard T25 flasks (Nunc, LifeTechnologies cat. no. 163371A), 24 wells multidish (Nunc, LifeTechnologies cat. no. 143982A) or slide flasks (Nunc, LifeTechnologies cat. no. 170920A). The experiments were performed when cells were 30 -40 % confluent. Cellular uptake of LNA and DNA was studied at serum-free conditions, i.e. the normal serum containing DME/F12 medium was removed and replaced with DME/F12 without serum before the transfection-mixture was added to the cells. Under these conditions SuperFect proved to be toxic to the MCF-7 cells. Transfection mixtures consisting of SuperFect and either plasmid DNA (pEGFP-Nl, Clontech cat. no. 6085-1), oligo DNA or oligo LNA was equally toxic to MCF-7 cells. In contrast to SuperFect, FuGene6 and Lipofectin worked well with plasmid DNA (pEGFP-Nl). However, only lipofectin was capable of efficient delivery of oligonucleotides to living MCF-7. Briefly, efficient delivery of FITC-labelled LNA and DNA to MCF-7 cells was obtained by culturing the cells in DME/F12 with 1% FCS to approx. 40% confluence. The Lipofectin reagent was then diluted 40 X in DME/F12 medium without serum and combined with the oligo to a concentration of 750 nM oligo. The oligo-Lipofectin complex was allowed to form for 15 minutes at r.t., and further diluted with serum-free medium to at final concentration of 250 nM oligo, 0.8 ug/ml Lipofectin. Then, the medium was removed from the cells and replaced with the medium containing oligo-Lipofectin complex. The cells were incubated at 37°C for 6 hours, rinsed once with DME/F12 medium without serum and incubated for a further 18 hours in DME/F12 with 1% FCS at 37°C . The result of the experiment was evaluated either directly on living cells in culture flasks or in 24 wells multidishes or on cells cultured in slide flasks and fixed in 4% ice-cold PFA. In all cases a Leica DMRB fluorescence microscope equipped with a high resolution CCD camera was used. The result with living cells is shown in figure 16 and the result with fixed cells cultured in Slide flask is shown in figure 17. Both the cells in figures 16 and 17 was transfected with the FITC-labelled AL16 LNA molecule. By counting total number of cells and green fluorescent cells in several fields we observe that FITC-labelled AL16 LNA was transfected into approximately 35% of the MCF-7 cells. Importantly, we saw that the LNA predominantly was localised in the nuclei of the cells (figure 17). This is noteworthy, since nuclear uptake of fluorescent oligos correlates with their antisense activity (Stein C,A. et al. (1997) Making sense of antisense: A debate. In HMS Beagle: A BioMedNet Publication (http://hmsbeagle.com/06/cutedge/overwiev.htm)). Increasing the amount of oligo and lipofectin up to a final concentration of 1250 nM oligo and 4 ug/ml lipofectin only increased the percentage of green fluorescent cells marginally. Increasing the concentration even further was toxic for the cells. Similar results were obtained with the other LNA's and the FITC-labelled oligo DNA (see Table AB). We conclude that: 1) LNA can be efficiently delivered to living MCF-7 breast cancer cells by Lipofectin-mediated transfection. 2) A consistent high fraction, 30% or more of cells, is transfected using a final concentration of 250 nM LNA, 0,8 ug Lipofectin pr. ml growth medium without serum. Increasing the concentrations of LNA and Lipofectin up to 5 times only increased the transfection yield marginally. 3) The procedure transfected the LNA into the nuclei of the cells, which according to literature is a good indication that such transfected LNA's may exhibit antisense effects on cells. Example 85 LNA modified oligos can be transferred into cells. Experiment with fluorescein labelled LNA oligos. Two LNA oligos: AL16 (51-TGT GTG AAA TTG TTA T-3 ' , LNA nucleosides in bold) and AL17 (5'-ATA AAG TGT AAA G-3', LNA nucleosides in bold) were labeled with fluorescein as described in example 77. MCF-7 human breast cancer cells were cultured as described in example 84. Three types of experiments were set up. 1) approximately 1.5 ug FITC- labelled AL16; 2) approximately 1.5 ug FITC-labelled AL17; and 3) approximately 0.75 ,µg FITC-labelled AL16 and 0.75 ug ■? pRSVPgal plasmid (a plasmid expressing the bacterial lac Z gene coded enzyme P-galactosidase, Tulchinsky et. al. (1992) PNAS, 89, 9146-50). The two LNA oligos and the LNA-plasmid mix were mixed with FuGENE6 and added to MCF-7 cells as described in example 84. After incubation for 18 hours cellular uptake of the LNA oligos were assessed by fluorescence microscopy of the cell cultures. A part of the treated cells contained green fluorescent material (see Figure 16), indicating that cells take up the fluorescein labelled LNA. The fluorescein labelled AL16 appeared superior to fluorescein labelled AL17 in this respect. After fluorescence microscopy the culture medium were removed from the cells treated both with fluorescein labelled AL16 and pRSVpgal. The cells were washed once with PBS, fixed in 2% (v/v) formaldehyde, 0.2% (v/v) glutaraldehyde at 4°C for 5 minutes and P-galactosidase containing cells were stained blue with X-gal (5-bromo-4-chloro-3-indoyl P-D-galacto-pyranosid) which turns from colorless to blue in the presence of p-galactosidase activity. The X-gal staining showed that the pRSVpgal effectively had been transferred into cells. We conclude that the fluorescein LNA oligos were taken up by the cells. Example 86 LNA modified oligos are relatively stable under cell culture conditions. Following fluorescence microscopy as described in example 85 cells treated only with the fluorescein labelled AL16 LNA were allowed to incubate for, an additional 3 days. During this period of time the number of green fluorescent cells appeared unaltered. We conclude that fluorescein labelled LNA oligos has a good stability under the conditions prevailing in cell culture. Example 87 LNA Amidites 4-N-Benzoyl-LNA-C [(1R, 3R, 4R, 7S) -3- (4-N-benzoylcytosine-l-yl)-1-(hydroxymethyl)-7-hydroxy-2,5-dioxabicyclo {2.2.1} heptane] LNA-C was taken in absolute ethanol and heated at reflux. To the refluxing solution, benzoic anhydride (2 equivalents) was added and the reaction was followed by HPLC (Eluant: 20% acetonitrile in 0.1M TEAA, pH 7'0, flow rate: lml/min., Novapak C-18 analytical column). Additional anhydride was added at 0.5-2h intervals till no more increase in product was observed by HPLC. Reaction mixture was concentrated on rotavap. Residue was repeatedly washed with ether, filtered and dried to give an off white solid. Yield: 45%. General method for dimethoxytritylation of base protected LNA nucleosides (LNA CB% LNA-', LNA»GiBu, LNA-ABz) Base protected LNA-nucleoside was coevaporated with pyridine (2x) and was stirred with dimethoxytrityl chloride (1.5 equivalents) in pyridine (-10 ml/g of nucleoside). The reaction was followed by HPLC (50% acetonitrile in 0.1M TEAA, pH 7.0, for 5 min., 50-100% acetonitrile in 10 min. and 100% acetonitrile for 5 min., flow rate: 1 ml/min., Novapak C-18 column). When >95% of the starting material had reacted, reaction mixture was cooled in ice. Reaction was quenched by addition of cold saturated NaHC03 (-15 ml x vol. Of pyridine) . The mixture was extracted with dichloromethane (3 x half the vol. of sodium bicarbonate). Organic extractions were combined, dried over anhydrous sodium sulfate, filtered and concentrated on rotavap. Residue was dried in vacuo and purified by silica gel chromatography using 0.5% pyridine and 0-2% methanol in dichloromethane as eluant. Fractions containing pure products were combined and concentrated on rotavap. Residue was coevaporated with anhydrous acetonitrile (3x) and dried in vacuo. triethylamine. Residual solid was coevaporated with anhydrous acetonitrile (2-3x) and dried in vacuo to give pure product as white solid. General method for LNA nucleoside supports Base protected DMT-LNA-nucleoside succinate (free acid or triethylaµMonium salt, 65 micromol/g of support), amino derivatized support (Primer Support™ 30HL, 160 micromol amino groups/g of support), DMAP (3 mg/g of support) and l-(3-[dimethylamino]propyl)-3-ethylcarbodimide hydrochloride (80 mg/g of support) were taken in anhydrous pyridine (6 ml/g of support). To this mixture, triethylamine (16 microliter/g of support) was added and the mixture was kept on a shaker at 150 rpm overnight. Support was filtered, washed with methanol (3 x 10 ml/g of support) and dichloromethane (3 x 10 ml/g of support). After air drying, support was dried in vacuo for 0.5h. To this 6% DMAP in anhydrous acetonitrile (Cap A, ~ 3 ml/g of support) and a mixture of 20% acetic anhydride/ 30% 2,4,6-collidine/ 50% acetonitrile (Cap B, ~ 3 ml/g of support) were added. The micture was kept on shaker for 5h. Support was filtered, washed with anhydrous dichloromethane (2 x 10 ml/g of support) and dried as above. It was resuspended in a mixture of Cap A and Cap B (total vol. 6 ml/g of support) and kept on shaker overnight. Support was filtered, washed with methanol (6 x 10 ml/g of support), dichloromethane (3 x 10 ml/g of support) and dried in air. It was further dried in vacuo for 5-6h. Loading was determined by dimethoxytrityl assay and was found to be ca. 40 micromol/g. Example 89 First Strand cDNA Synthesis Using Poly dT Primers Containing LNA T monomers Reactions were set up in order to test the ability of poly dT primers containing LNA T residues to prime 1st strand cDNA synthesis. The following poly dT primers were tested: RTZ1 5'-TTT TTT TTT TTT TT-3' Oligo bound resins were divided into two portions (-25 mg resin each) for poly (rA) binding analysis in duplicate. Poly (rA) Pharmacia #27-4110-01 (dissolved at 28.2 A260 units/ml in binding buffer) was used for binding. Five (5) A260 units were bound to duplicate 25 mg portions of each oligo bound resin per SOP QC 5543. Unbound "breakthrough" poly (rA) was guantitated by A1-6 absorbance and used to calculate bound. The fate of the bound poly (rA) was tracked throung Low salt buffer wash and several elutions (see Table of poly (rA) Binding and Elution As shown in the table (Table of poly (rA) Binding and Elution Data) both the LNA and DNA coated beads function efficiently in the capture of poly (rA) target molecules. The LNA coated beads, however, bind the poly (rA) target much more tightly than the DNA coated beads as evidenced by the poly (rA) elution profiles of the different beads. We conclude that 1) an LNA T9 oligo is efficient in the capture of RNA molecules containing a strech of A residues and that 2) the captured RNA molecules are bound much more tightly to the LNA T9 oligo beads than to the control DNA T9 and DNA T16 oligo. 100%). Found: C, 64.07; H, 6.01; N, 9.94; C29H38N207Si, 0. 5H20 requires C, 63.88; H, 6.25; N, 10.34 %. Example 205 5 (1R,2R,3R)-2-Benzyloxy-3-benzyloxymethyl-3- hydroxytetrahydrofurfural (206) . A solution of 202/203 (252 mg, 0.707 µMol) in 80% acetic acid (3.8 mL) was stirred at 90°C for 2 h whereupon the solvent was removed by distillation under reduced pressure. The residue was coevaporated in toluene (3x10 l mL) to give the product 206 as an oil (242 mg, 100%). 'H NMR (CDCIJ : 5 9.66 (1 H, d, J 0.8 Hz, H-l), 7.36-7.25 (10 H, m, Bn) , 4.68 (1 H, d, J 11.9 Hz, Bn) , 4.60-4.39 (5 H, m, Bn, H-2, H-3), 3.98-3.92 (2 H, m, H-5), 3.85 (1 H, d, J 9.3 Hz, H-5') , 3.52 (1 H, d, J 9.2 Hz, H-5'); 13C NMR (CDC13) : 5 203.64 (C-l), 137.39, 137.19, 128.61, 128.54, 128.29, 128.12, 127.87, 127.83 (Bn), 87.17, 87.05 (C-4, C-2), 80.98 (C-3), 75.00, 73.70, 71.86 (Bn, C-5') , 67.84 (C-5); MS FAB: 707 (2xM+Na, 100%). Example 206 (IS, 3S, 4R, 7S) -3-Acetoxy-7-benzyloxy-l-benzyloxymethyl-2,5-dioxabicyclo[2.2.1]heptane (207). To a stirred solution of 206 (230 mg, 0.672 µMol) in anhydrous pyridine (2.0 mL) was added acetic anhydride (0.18 mL, 1.91 µMol.). The reaction mixture was stirred for 23 h at room temperature, water (0.13 mL) was added, and the solvent was removed by distillation under reduced pressure. The residue was coevaporated in toluene (3x10 mL) and purified by chromatography over silica gel with dichloromethanermethanol (99:1) as eluent to give the product as an clear oil (56.7 mg, 23%); JH NMR (CDC13) : 8 7.38-7.26 (10 H, m, Bn) , 6.00 (1 H, s, H-l), 4.68 (1 H, d, J 12.0 Hz, Bn) , 4.62 (1 H, d, J 12.2 Hz, Bn), 4.60 (1 H, d, J 12.A Hz, Bn), 4.56 (1 H, d, J 12.2 Hz, Bn) , 4.17 (1 H, s, H-2), 4.14 (1 H, s, H-3), 4.01 (1 H, d, J- 7.7 Hz, H-5'), 3.81-3.78 (3 H, m, H-5', H- 5), 20.06 (3 H, s, COCH3) ; ,3C NMR (CDC13) : 8 169.18 (C=0) , 137.92, 137.48, 128.52, 128.45, 128.03, 127.77, 127.73, 127.68 (Bn), 95.95 (C-l), 86.49 (C-4), 78.27, 76.58 (C-3, C-2), 73.65 (Bn) , 72.26, 71.96 (Bn, C-5'), 65.49 (C-5), 20.98 (COCH3);-MS FAB: 407 (M+Na, 55%). Found: C, 68.80; H, 6.11; C22H24Os requires C, 68.74; H, 6.29 %. Example 207 S (IS, 3S, 4R, 7S) -3- (6-tf-Benzoyladenine-9-yl) -7-benzyloxy-l-benzyloxymethyl-2,5-dioxabicyclo[2.2.1]heptane (208). A solution of furanose 207 (167 mg, 0.434 µMol) and 6-N-benzoyladenine (194 mg, 0.813 µMol) in anhydrous acetonitrile (5.3 mL) was added BSA (0.43 mL, 1.7 6 µMol) and stirred at room temperature for 1 h. The solution was cooled to 0°C and trimethylsilyl triflate (0.16 mL, 0.86 µMol) was added dropwise. After stirring at 65°C for 2 h, the reaction was quenched with a saturated aqueous solution of sodium hydrogen carbonate (40 mL) and the mixture was extracted with dichloromethane (2x50 mL). The combined extract was dried (MgS04) . The solvent was removed under reduced pressure and the residue was purified by chromatography over silica gel with dichloromethane:methanol (98:2) as eluent to give the product as a solid (111 mg, 45%); 'H NMR (CDC13) : 5 8.82 (1 H, s, H-8), 8.14 (1 H, s, H-2), 7.59-7.26 (15 H, m, Bz, Bn), 6.74(1 H, s, H-l'), 4.92 (1 H, s, H-2'), 4.74-4.39 (4 H, m, Bn) , 4.42 (1 H, s, H-3') , 4.19-4.10 (2 H, m, H-5"), 3.92 (1 H, d, J 11.8 Hz, H-5'), 3.88 (1 H, d, J 11.5 Hz, H-5'); MS FAB: 564 (M+H, 100%). Example 208 Methyl 2-0-acetyl-3,5-di-0-benzyl-4-C-methylsulfonyloxymethyl-D-ribofuranoside (209). To a stirred solution of 201 (687 mg, 1.52 µMol) in anhydrous pyridine (4 mL) at 0°C was added dropwise acetic anhydride (0.43 mL, 4.56 µMol). The reaction mixture was stirred for 2 days at room temperature, quenched with saturated aqueous sodium hydrogen carbonate (75 mL) and extracted with dichloromethane (150 + 75 mL). The combined extract was dried (MgS04) , the solvent was removed by distillation under reduced pressure and the residue was purified by chromatography over silica gel with dichloromethane as eluent to give the product as a clear oil (p:a - 3:1, 750 mg, 100 %); MS FAB: 463 (M-OCH3, 100%), 517 (M+Na, 28%); Found: C, 58.53; H, 6.16; C24H30O9S requires C, 58.29; H, 6.11 %. Methyl 2-0-acetyl-3,5-di-0-benzyl-4-C-methylsulfonyloxymethyl- P-D-ribofuranoside (209$). lH NMR (CDC13) : 5 7.36-7.18 (10 H, m, Bn), 5.27 (1 H, d, J4.9 Hz, H-2), 4.88 (1 H, s, H-l), 4.55- 4.44 (6 H, m, H-5', Bn) , 4.35 (1 H, d, J 5.0 Hz, H-3), 3.73 (1 H, d, J 9.2 Hz, H-5), 3.38 (1 H, d, J 9.3 Hz, H-5), 3.30 (3 H, s, OCH3), 2.95 (3 H, s, S02CH3) , 2.11 (3 H, s, OCCH3) ; 1JC NMR (CDC13) : 8 169.91 (C=0), 137.83, 137.28, 128.49, 128.44, 127.99, 127.87, 127.77 (Bn), 105.40 (C-l), 82.65, 81.05, 74.55, 73.62, 73.56, 71.86, 70.22 (C-2, C-3, C-4, C-5, C-5', Bn) , 55.03 (OCH3), 37.14 (S02CH3) , 20.73 (OCCH3) . Methyl 2-0-acetyl-3, 5-di-0-benzyl-4-C-methylsulfonyloxymethyl- a-D-ribofuranoside (209a). 'H NMR (CDC13) : 8 7.36-7.18 (10 H, m, Bn), 5.09 (1 H, d, J 4.5 Hz, H-l), 4.95 (1 H, dd, J 4.5, 6.8 Hz, H-2), 4.65-4.44 (6 H, m, H-5', Bn), 4.27 (1 H, d, J 6.6 Hz, H-3), 3.49 (1 H, d, J 9.9 Hz, H-5), 3.46 (3H, s, OCH3) , 3.36 (1 H, d, J 9.9 Hz, H-5), 2.92 (3 H, s, S02CH3) , 2.14 (3 H, s, OCCH3); 13C NMR (CDC13) : 8 170.41 (0=0), 137.59, 137.28, 128.56, 128.51, 128.49, 128.44, 127.98, 127.88 (Bn), 102.35 (C-l), 84.25, 77.53, 74.66, 73.67, 72.12, 70.39, 70.28 (C-2, C-3, C-4, C-5, C-5', Bn), 56.07 (OCH3) , 36.94 (S02CH3) , 20.63 (OCCH3) . Example 209 Phenyl 2-0-acetyl-3,5-di-0-benzyl-4-C-methylsulfonyloxymethyl- 1-thio-p-D-ribofuranoside (210). Method a. A stirred solution of 209 (738 mg, 1.49 µMol) in anhydrous dichloromethane (6.4 mL) was added phenylthiotrimethylsilane (2.42 mL, 12.8 µMol) and cooled to 0°C. Trimethylsilyl triflate (0.67 mL, 3.67 µMol) was added dropwise and the solution was stirred at room temperature for 4 h. The reaction was quenched with a saturated aqueous solution of sodium hydrogen carbonate (100 mL) and extracted with dichloromethane (2x2 00 mL). The combined extract was dried (MgS04) and the solvent removed by distillation under reduced pressure. The residue was purified by chromatography over silica gel with dichloromethane as eluent to give the product 210 as a clear oil (564 mg, 66%) and unreacted starting material (191 mg, 2 6%); Method b. A stirred solution of 211 (86 mg, 0.165 µMol) in anhydrous dichloromethane (0.49 mL) was added phenylthiotrimethylsilane (0.16 mL, 0.825 µMol) and cooled to 0°C. Trimethylsilyl triflate (0.037 mL, 0.206 µMol) was added ahd the solution was stirred at room temperature for 2 h. The reaction was quenched with a saturated aqueous solution of sodium hydrogen carbonate (15 mL) and the resulting mixture was extracted with dichloromethane (2x25 mL). The combined extract was dried (MgS04) and the solvent removed by distillation under reduced pressure. The residue was purified by chromatography over silica gel with dichloromethane as eluent to give the product 210 as a clear oil (75 mg, 79%); [H NMR (CDClj) : 8 7.47-7.19 (15 H, m, Bn, SPh), 5.48 (1 H, d, J 3.6 Hz, H-2), 5.34 (1 H, dd, J 3.7, 5.2 Hz, H-1), 4.54-4.36 (7 H, m, H-3, H-5', Bn) ,. 3.66 (1 H, d, J 9.7 Hz, H-5), 3.48 (1 H, d, J 9.5 Hz, H-5), 2.89 (3 H, s, S02CH3) , 2.09 (3 H, s, OCCH3) ; l3C NMR (CDC13) : 5 169.93 (C=0), 137.69, 137.08, 132.65, 132.45, 129.15, 128.53, 128.52, 128.18, 128.14, 128.08, 127.91, 127.85 (Bn, SPh), 87.99, 84.35, 80.34, 75.33, 74.20, 73.67, 70.83, 69.34 (C-l, C-2, C-3, C-4, C-5, C-5', Bn) , 37.27 (S02CH3) , 20.68 (OCCH3) ; MS FAB: 463 (M-SPh, 100%), 595 (M+Na, 24%); Found: C, 61.17; H, 5.55; C29H3208S2 requires C, 60.82; H, 5.63 %. Example 210 l#2-Di-0-acetyl-3/5-di-0-benzyl-4-C-methylsulphonyloxymethyl-D-ribofuranose (211). A solution of 201 (150 mg; 0.313 µMol) in 80% aqueous acetic acid (1.5 mL) was stirred at 90°C for 3 h. The solvent was removed by distillation under reduced pressure and the residue was coevaporated in ethanol (3x5 mL), toluene (3x5 mL) and pyridine (2x5 mL). The residue was redissolved in anhydrous pyridine (0.62 mL) and added acetic anhydride (0.47 mL) and the solution was stirred at room temperature for 16 h. The reaction was quenched with water (50 mL) and the resulting mixture extracted with dichloromethane (2x50 mL). The combined extract was washed with an aqueous saturated solution of sodium hydrogen carbonate (50 mL) and dried (MgS04) . The solvent was evaporated and the residue purified on column chromatography over silica gel with dichloromethane as eluent to give the product 211 as an oil (99 mg, 60%); !H NMR (CDC13): 8 7.39-7.21 (m, Bn), 6.38 (d, J 4.6 Hz, H-1 p) , 6.15 (s, H-1 a), 5.35'; (d, J 4.9 Hz, H-2 a), 5.17 (dd, J 6.3, 4.9Hz, H-2 p), 4.69-4.23 (m, H-3, Bn), 3.64 (d, J 9.7 Hz, H-5 a ), 3.52 (d, J 10.1 Hz, H-2 P), 3.45 (dr J 9.7 Hz, H-5 a), 3.39 (d, J 9.9 Hz, H-2 p), 2.99 (s, S02CH3 a) , 2.96 (s, S02CH3p), 2.14, 2.13, 2.06, 1.90 (4xs, COCH3) ; 13C NMR (CDCI3) : 8 169.68, 169.00 (C=0) , 137.68, 137.05, 128.60, 128.55, 128.50, 128.21, 128.12, 128.04, 127.94, 127.82, 127.79 (Bn), 99.35 (C-1 a), 94.24 (C-1 fj) , 86.36 (C-4 p) , 84.28 (C-4 a), 79.15, 77.47, 74.58, 74.06, 73.73, 73.56, 71.67, 70.57, 70.19, 69.84 (Bn, C-2, C-3, C-5, C-5'), 37.61 (S02CH3 P) , 37.48 (S02CH3a), 21.07, 20.74, 20.63, 20.39 (COCH3) ; MS FAB: 545 (M+Na, 13%). Found: C, 57.70; H, 5.56; C25HJ0O10S requires C, 57.46; H, 5.79 %. Example 211 (3R)- and (3S) - (IS, 4R, 7S) -7-Benzyloxy-l-benzyloxymethyl-3-phenylthio-2,5-dioxabicyclo[2.2.1]heptane (212). A solution of 210 (553 mg, 0.966 µMol) in methanol saturated with aµMonia (35 mL) was stirred at room temperature for 2 h whereupon the solvent removed by distillation under reduced pressure. The residue was redissolved in anhydrous DMF (3.5 mL) and the solution stirred at 0°C. A 60% suspension of sodium hydride (118 mg, 2.88 µMol) was added and the mixture stirred at room temperature for 12 h. The reaction was quenched with a saturated aqueous solution of sodium hydrogen carbonate (100 mL) and the resulting mixture was extracted with dichloromethane (2x100 mL). The combined extract was dried (MgS04) and the solvent was removed by distillation under reduced pressure. The residue was purified by chromatography over silica gel with dichloromethane as eluent to give the product 212 as a clear oil (404 mg, 9.6%). MS FAB: 435 (M+H, 35%), 457 (M+Na, 16%); Found: C, 71.76; H, 6.18; C26H2604S requires C, 71.86; H, 6.03 %. (lS,3R,4kR, 7S) -7-Benzyloxy-l-benzyloxymethyl-3-phenylthio-2,5- dioxabicyclo[2.2.1]heptane (212p) . 'H NMR (CDC13) : 8 7.46-7.26 (15 H, m, Bn, SPh), 5.35 (1 H, s, H-l), 4.68-4.56 (4 H, m, Bn), 4.31 (1 H, s, H-2), 4.10 (1 H, s, H-3), 4.09 (1 H, d, J 7.3 Hz, H-5'), 3.93 (1 H, d, J" 7.8 Hz, H-5'), 3.79 (2H, m, H-5); 'JC NMR (CDC13) : 5 138.03, 137.45, 133.42, 132.36, 129.19, 128.55, . 128.46, 128.05, 127.84, 127.83, 127.76 (Bn, SPh) , 89.96 (Ol) , 87.18 (C-4T, 79.71 (C-2), 79.40 (C-3), 73.64 (Bn), 73.23 (C- 5') , 72.30 (Bn) , 66.31 (C-5) . (IS, 3S, 422, 7S) -7-Benzyloxy-l-benzyloxymethyl-3-phenylthio-2/ 5-dioxabicyclo[2.2.1]heptane (212a). !H NMR (CDC13) : 8 7.52-7.19 (15 H, m, Bn, SPh), 5.52 (1 H, s, H-l), 4.70-4.50 (4 H, m, Bn), 4.41 (1 H, s, H-2), 4.18 (1 H, d, J 7.8 Hz, H-5'), 4.08 (1 H, d, J 8.4 Hz, H-5'), 4.07 (1 H, s, H-3), 3.78 (1 H, d, J 11.3 Hz, H-5), 3.72 (1 H, d, J 11.5 Hz, H-5); l3C NMR (CDC13) : 8 137.89, 137.46, 135.29, 130.93, 129.13, 128.99, 128.57, 128.48, 127.81, 127.76, 127.58, 126.95 (Bn, SPh), 91.87 (C-l), 88.59 (C-4), 80.07, 79.14 (C-2, C-3), 73.65, 73.40, 72.04 (Bn, C-5'), 65.62 (C-5). Example 212 (3R) - and (3S) -(IS, 4R, 7S) -7-Benzyloxy-l-benzyloxymethyl-3» (thymine-1-yl) -2/5-dioxabicyclo[2.2.1]heptane (36+213) . Thymine (175 mg, 1.38 µMol) was stirred in HMDS (6.8 mL) at reflux and added aµMonium sulphate (5 mg). After stirring for 16 h, the clear solution was cooled to 40°C and the solvent was removed by distillation under reduced pressure. The residue was added a solution of 212 (201 mg, 0.463 µMol)- in anhydrous dichloromethane (4.6 mL) and 4A molecular sieves (180 mg). After stirring at room temperature for 10 min, NBS (107 mg, 0.602 µMol) was added and the mixture stirred for another 3 0 minutes. The reaction was quenched with a saturated aqueous solution of sodium thiosulphate (25 mL) and the resulting mixture was extracted with dichloromethane (2x50 mL). The combined extract was dried (MgSOJ and evaporated, and the residue was purified on column chromatography over silica gel with dichloromethane:methanol (97:3) as eluent to give the product as an anomeric mixture (p:(X~l:2) (127 mg, 61%); 'H NMR (CDC13) : 5 7.49 (d, J 0.9 Hz, H-6 p) , 7.46 (d, J 1.0 Hz, H-6 a), 7.39-7.25 (m, Bn) , 5.94 (s, H-l' a) , 5.64 (s, H-l' P) , 4.71- 4.50 (m, Bn, H-2'), 4.23 (s, H-37 a) , 4.16 (d, J 8.6 Hz, H-5"a) , WE CLAIMS 1. An oligomer comprising at least one nucleoside analogue (hereinafter termed "LNA") of the general formula la wherein X is -O-,; B is selected from nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; P designates the radical position for an internucleoside linkage to a succeeding monomer, or a 5'-terminal group, such internucleoside linkage or 5'-terminal group optionally including the substituent R5; R3' is a group P' which designates an internucleoside linkage to a preceding monomer, or a 3'-terminal group; R2' and R4' together designate a biradical selected from -0-, -S, -N(R')-, -(CRR')r+s+1-, -(CR'R')r-0-(CR'R')s-, " (CRV) r-S- (CR'R') .-, -(CR'R')r-N(R')-(CR'R')g-, -0-(CR'R')r+s-0-, -S-(CR'R') r+s~0-, -0-(CRR)r+a-S-t -N(R')-(CR'R')r+s-0-, -0-(CR'R') r+s-N(R')-, -S-(CR'R ) r+s-S-, -N(R)-(CRR)HI-N(RV, -N(Ri)-(CRV)r+g-S-/ and -S-(CR'R')r+s-N(R')-; wherein each R' is independently selected from hydrogen, halogen, azido, cyano, nitro, hydroxy, mercapto, amino, mono-or di (C1-6-alkyl) amino, optionally substituted C^-alkoxy, optionally substituted C^-alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and/or two adjacent (non-geminal) R' may together designate a double bond, and each of r and s is 0-3 with the proviso that the sum r+s is 1-4; each of the substituents R1', R2, R3, R5, and R5' is independently selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, hydroxy, C1-6-alkoxy, C2_6-alkenyloxy, carboxy, C1-6-alkoxycarbonyl, C1-6-alkylcarbonyl, formyl, amino, mono- and di (C1-6-alkyl)amino, carbamoyl, mono-and di (C1-6-alkyl) -amino-carbonyl, C1-6-alkyl-carbonylamino, carbamido, azido, C1-6-alkanoyloxy, sulphono, sulphanyl, C1-6-alkylthio, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and halogen, where two geminal substituents together may designate oxo; and basic salts and acid addition salts thereof. 2. An oligomer according to claim 1, wherein one R* is selected from hydrogen, hydroxy, optionally substituted C1-6g-alkoxy, optionally substituted C1-6-alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and any remaining substituents R* are hydrogen. 3. An oligomer according to any of the claims 1-2, wherein the biradical is selected from -0-, - (CH2) o1-6-O- 4. A nucleoside analogue (hereinafter LNA) of the general formula Ila wherein X is -0-; B is selected from nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; R3' is a group Q'; each of Q and Q' is independently selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, Prot-O-, Act-O-, mercapto, Prot-S-, Act-S-, C1-6-alkylthio, amino, Prot-N(RH) -, Act-N(RH)-, mono- or di (C1-6-alkyl) amino, optionally substituted C,.6-alkoxy, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, optionally substituted C2,6-alkenyloxy, optionally substituted C2_6-alkynyl, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, triphosphate, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, hydroxymethyl, Prot-0-CH2-, Act-0-CH2-, aminomethyl, Prot-N(RH) -CH2-, Act-N(RH) -CH2-, carboxymethyl, sulphonomethyl, where Prot is a protection group for -OH, -SH, and -NH(RH), respectively, Act is an activation group for -OH, -SH, and -NH(RH), respectively, and RH is selected from hydrogen and C1-6-alkyl; O ' A it R and R together designate a biradical selected from -0-, -S, -N(R')-, -(CR'R')r+g+1-, -(CR'R')r-0-(CR'R')g-, - (CRR) r-S~ (CRR ) s~, -(CR'R')r-N(RV(CR'R')s-, -0-(CR'R') r+8-0-, -S- (CR'R') „.-0-, -0-(CRlRl)r+.-S-/ -N(R')-(CR'R')r+s-0-, -0-(CR'R' )r+s-N(R')-, -S-(CR'R\+g-S-, -N(R')-(CR'R')r+s-N(R')-, -N(RV(CR'R\+S-S-, and -S-(CR'R\+g-N(R')-; wherein each R' is independently selected from hydrogen, halogen, azido, cyano, nitro, hydroxy, mercapto, amino, mono-or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and/or two adjacent (non-geminal) R' may together designate a double bond, and each of r and s is 0-3 with the proviso that the sum r+s is 1-4; each of the substituents R1', R2, R3, R5, and R5' is independently selected from hydrogen, optionally substituted C,_6-alkyl, optionally substituted C2_6-alkenyl, hydroxy, C,_6-alkoxy, C2_h~ alkenyloxy, carboxy, C1_6-alkoxycarbonyl, Cj_6-alkylcarbonyl, formyl, amino, mono- and di (C1-6-alkyl)amino, carbamoyl, mono- and di (C1-6-alkyl) -amino-carbonyl, C1-6-alkyl-carbonylamino, carbamido, azido, C1-6-alkanoyloxy, sulphono, sulphanyl, C,_6-alkylthio, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and halogen, where two geminal substituents together may designate oxo; and basic salts and acid addition salts thereof; and with the proviso that any chemical group (including any nucleobase), which is reactive under the conditions prevailing in oligonucleotide synthesis, is optionally functional group protected. 5. A nucleotide analogue according to claim 4, wherein one R' is selected from hydrogen, hydroxy, optionally substituted Cj_6-alkoxy, optionally substituted C1-6-alkyl, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, and any remaining substituents R' are hydrogen. 6. A nucleotide analogue according to any of the claims 4-5, wherein the biradical is selected from -0-, - (CILJ1-6-O- (CH2) NJ-, -(CH2)0_1-S-(CH2)1_3-/ -(CH2)0.1-N(RN)-(CHJ1.3-, and -(CH2)2_4-. 7. An oligomer comprising at least one nucleoside analogue (hereinafter termed "LNA") of the general formula I wherein X is selected from -0-, -S-, -N(RN')-, -C(R6R6')-, -0-C(R7R7V, -C(R6R6')-0-, -S-C(R7R7')-, -C (R6R6') -S- , -N(RN')-C (R7R7') -, -C(R6R6-)-N(RN')-, and -C (R6R6') -C (R7R7') - ; B is selected from hydrogen, hydroxy, optionally substituted C,_ 4-alkoxy, optionally substituted C. -alkyl, optionally substituted C1-6-acyloxy, nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; P designates the radical position for an internucleoside linkage to a succeeding monomer, or a 5'-terminal group, such internucleoside linkage or 5'-terminal group optionally including the substituent R5; one of the substituents R2, R2,R3, and R3' is a group P' which designates an internucleoside linkage to a preceding monomer, or a 3'-terminal group; one or two pairs of non-geminal substituents selected from the present substituents of R1', R4, R5, R5, R6, R6, R7, R7, RN, and the ones of R2, R2, RJ, and R3' not designating P' each designates a biradical consisting of 1-8 groups/atoms selected from -C(RaRb)-, -C (Ra) =C (Ra)-, -C(Ra)=N-, -0-, -Si(Ra)2-, -S-, -S0a-, -N(Ra)-, and >C=Z, wherein Z is selected from -0-, -S-, and -N(Ra)-, and Ra and Rb each is independently selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2_12-alkenyl, optionally substituted C2_12-alkynyl, hydroxy, C1-6-alkoxy, C2_12-alkenyloxy, carboxy, C1-6.1-6-alkoxycarbonyl, Cj.1-6-alkylcarbonyl, forrrtyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbony1, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di (C1-6-alkyl) amino, carbamoyl, mono- and di (C1-6-alkyl) -amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di (C1-6-alkyl) amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C:_6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents Ra and Rbtogether may designate optionally substituted methylene (=CH2) , and wherein two non-geminal or geminal substitutents selected from Rd, Rb, and any of the substituents R1', R2, R2, RJ, R3, R4', R5, R5', R6 and R', R7, and R7' which are present and not involved in P, P' or the biradical(s) together may form an associated biradical selected from biradicals of the same kind as defined before; said pair(s) of non-geminal substituents thereby forming a mono- or bicyclic entity together with (i) the atoms to which said non-geminal substituents are bound and (ii) any intervening atoms; and each of the substituents Rl, R2, Ra, R, R4, R5, R5, R6 and R6, R7, and R7' which are present and not involved in P, P' or the biradical(s), is independently selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2_12-alkenyl, optionally substituted C2,12-alkynyl, hydroxy, C1-6-alkoxy, C2_12-alkenyloxy, carboxy, Cj1-6-alkoxycarbonyl, Cj_12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryl-oxy, heteroarylcarbonyl, amino, mono- and di (C1-6-alkyl) amino, carbamoyl, mono- and di (Cx_6-alkyl) -amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di (C1-6-alkyl) amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene, or together may form a spiro biradical consisting of a 1-5 carbon atom(s) alkylene chain tfhich is optionally interrupted and/or terminated by one or nore heteroatoms/groups selected from -0-, -S-, and -(NRN)-vhere RN is selected from hydrogen and C,.4-alkyl, and where two adjacent (non-geminal) substituents may designate an additional 1-6ond resulting in a double bond; and RN, when present and not Involved in a biradical, is selected from hydrogen and C,_4-Alkyl; and basic salts and acid addition salts thereof; with the proviso that, 2 1 (i) R and R do not together designate a biradical selected from -0-CH2-CH2- and -0-CH2-CH2-CH2- when LNA is a bicyclic nucleoside analogue; (ii) R3 and R5 do not together designate a biradical selected from -CH2-CH2-, -0-CH2-, when LNA is a bicyclic nucleoside analogue; (iii) R3, R5, and R5' do not together designate a triradical -CH2-CH(-)-CH2- when LNA is a tricyclic nucleoside analogue; (iv) R1' and R6' do not together designate a biradical -CH2- when LNA is a bicyclic nucleoside analogue; and (v) R4' and R6' do not together designate a biradical -CH2- when LNA is a bicyclic nucleoside analogue. 8. An oligomer according to claim 7, wherein the one or two pairs of non-geminal substituents, constituting one or two biradical(s), respectively, are selected from the present substituents of R1', R4, R6, R6, R7, R7, RN', and the ones of R2, R2', R3, and R3' not designating P'. 9. An oligomer according to any of the claims 7-8, comprising 1-10000 LNA(s) of the general formula I and 0-10000 nucleosides selected from naturally occurring nucleosides and nucleoside analogues, with the proviso that the sum of the number of nucleosides and the number of LNA(s) is at least 2, preferably at least 3, such as in the range of 2-15000. 10. An oligomer according to claim 9, wherein at least one LNA comprises a nucleobase as the substituent B. 11. An oligomer according to any of the claims 7-10, wherein one of the substituents R3 and R3' designates P'. di (C1-6-alkyl) amino, carbamoyl, mono- and di (C,_6-alkyl)-amino-' carbonyl, amino-C,_6-alkyl-aminocarbonyl, mono- and di (C,_6-alkyl) amino-C,_6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, 5 nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, ) thioxo, imino, or optionally substituted methylene, or together may form a spiro biradical consisting of a 1-5 carbon atom(s) alkylene chain which is optionally interrupted and/or terminated by one or more heteroatoms/groups selected from -0-, -S-, and -(NRN)- where RN is selected from hydrogen and C1-4- I alkyl, and where two adjacent (non-geminal) substituents may designate an additional bond resulting in a double bond; and RN, when present and not involved in a biradical, is selected from hydrogen and C1-6-alkyl; and basic salts and acid addition salts thereof; with the first proviso that, (i) R2 and R3 do not together designate a biradical selected from -0-CH2-CH2- and -0-CH2-CH2-CH2-; and (ii) R3 and R5 do not together designate a biradical selected from -CH2-CH2-, -0-CH2-, and -O-Si ('Pr)2-O-Si ('Pr) 2-0-; and with the second proviso that any chemical group (including any nucleobase), which is reactive under the conditions prevailing in oligonucleotide synthesis, is optionally functional group protected. 59. A nucleoside analogue according to claim 58, wherein the group B is selected from nucleobases and functional group protected nucleobases. 60. A nucleoside analogue according to any of the claims 58-59, wherein X is selected from -0-, -S-, and -N(RN')-. 61. A nucleoside analogue according to any of the claims 58-69, wherein each of the substituents R1', R2, R2, RJ, RJ, R4, R5, and R5', which are present and not involved in Q, Q' or the biradical, is independently selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, hydroxy, C1-6-alkoxy, C2_6-alkenyloxy, carboxy, Cx_6-alkoxycarbonyl, C1-6-alkylcarbonyl, f onnyl/ amino, mono- and di (C1-6-alkyl) amino, carbamoyl, mono- and di (C1-6-alkyl) -amino-carbonyl, CN6-alkyl-carbonylamino, carbamido, azido, C1-6-alkanoyloxy, sulphono, sulphanyl, C1-6-alkylthio, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, and halogen, where two geminal substituents together may designate oxo, and where RN, when present and not involved in a biradical, is selected from hydrogen and C1-6-alkyl, with the proviso that any hydroxy, amino, mono (C1-6-alkyl) amino, sulfanyl, and carboxy is optionally protected. 62. A nucleotide analogue according to any of the claims 58-61, each of the substituents R1', R2, R2, R3, R3', R4, and R5, Rs, R6, R6', which are present and not involved in Q or the biradical, designate hydrogen. 63. A nucleoside analogue according to any of the claims 58-62, wherein R3' designates P'. 64. A nucleoside analogue according to any of the claims 58-63, wherein Q is independently selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, Prot-O-, mercapto, Prot-S-, C1-6-alkylthio, amino, Prot-N(RH)-, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyl, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, triphosphate, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, hydroxymethy 1, Prot -0-CH2 - , aminomethy 1, Prot -N (RH) -CH2- , selected from DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands. 95. A nucleoside analogue according to any of the claims 70-94, wherein the LNA(s) has/have the general formula la. 96. A nucleoside analogue according to claim 69, wherein B designates a nucleobase, X is -0-, R2' and R4' together designate a biradical selected from - (CH2) 1-6-0- (CH2) ,_3-f - (CH2) 0_X-S- (CH2) {_r, and - (CH2)0_1-N(RN) - (CH2) 1-3- where RN is selected from hydrogen and Ct_4-alkyl, Q designates Prot-0-, R3' is Q' which designates Act-OH, and R1', R2, R3, R5, and R5' each designate hydrogen, wherein Act and Prot are as defined in claim 58. 97. A nucleoside analogue according to claim 69, wherein B designates a nucleobase, X is -0-, R2' and R4' together designate a biradical selected from - (CH2) 1-6-O- (CH2),_,-f - (CE2)0_rS- (CH2) 10-, and - (CH2)0_1-N(RN) - (CH2) 1-3- where RN is selected from hydrogen and C1-6-alkyl, Q is selected from hydroxy, mercapto, C1-6-alkylthio, amino, mono- or di (C1-6-alkyl) amino, optionally substituted C1-6-alkoxy, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, and triphosphate, R3' is Q' which is selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, mercapto, C1-6-alkylthio, amino, mono- or di (C1-6-alkyl) amino, optionally substituted Cj.g-alkoxy, optionally substituted C1-6-alkyl, optionally substituted C2_6-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyl, and optionally substituted C2_6-alkynyloxy, R3 is selected from hydrogen, optionally substituted C1_6-alkyl, optionally substituted C2_6-alkenyl, and optionally substituted C2_6-alkynyl, and R1', R2, R5, and R5' each designate hydrogen. 98. A nucleoside analogue according to claim 69, wherein B designates a nucleobase, X is -0-, R2 and R3 together designate a biradical selected from - (CH2) O.r0-CH=CH-, - (CH2) 0_rS-CH=CH-, and - (CH2)0.1-N(RN) -CH=CH- where RN is selected from hydrogen and C1-4-alkyl, Q is selected from hydroxy, mercapto, C, ()-alkylthio, amino, mono- or ai (C1-6-aiKyi) ammo, optionally Substituted C1-6-alkoxy, optionally substituted C2_6-alkenyloxy, -optionally substituted C2_6-alkynyloxy, monophosphate, diphosphate, and triphosphate, R3' is Q' which is selected from hydrogen, azido, halogen, cyano, nitro, hydroxy, mercapto, C1-6-alky 1 thio, amino, mono- or di (C1-6-alkyl) amino, optionally substituted Cj1-6-alkoxy, optionally substituted CW6-alkyl, optionally substituted C2_b-alkenyl, optionally substituted C2_6-alkenyloxy, optionally substituted C2_6-alkynyl, and optionally substituted C2_6-alkynyloxy, and R1', R2, R4, R5, and R5' each designate hydrogen. 99. A nucleoside analogue according to claim 58, which is selected from (1R,3R, 4R, 7S)-7-(2-cyanoethoxy(diisopropyl- amino)phosphinoxy)-1-(4,4'-dimethoxytrityloxymethyl)-3-(thymin- 1-yl)-2,5-dioxabicyclo[2.2.l]heptane, . (1R,3R, 4Rt 7S) -7-hydroxy- 1-(4,4'-dimethoxytrityloxymethyl)-3-(thymin-1-yl)-2,5-dioxa- bicyclo[2.2.l]heptane-7-0-(2-chlorophenylphosphate), and (1R,3R, 4R, 7S)-7-hydroxy-1-(4,4'-dimethoxytrityloxymethyl)-3 -(thymin-1-yl)-2,5-dioxabicyclo[2.2.l]heptane-7-0-{H-phosphonate). 100. The use of an LNA according to any of the claims 4-6 and 58-99 for the preparation of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57. 101. The use according to claim 100, wherein the LNA modified oligonucleotide has an increased specificity towards complementary ssRNA or ssDNA compared to the native oligonucleotide. 102. The use according to claim 100, wherein the LNA modified oligonucleotide has an increased affinity towards complementary ssRNA or ssDNA compared to the native oligonucleotide. 103. The use according to claim 100, wherein the LNA modified oligonucleotide is capable of binding to a target sequence in a dsDNA or dsRNA molecule by way of "strand displacement" or by triple helix formation. 104. The use according to claim 100, wherein the LNA to modulate the ability of oligonucleotide to act as substrates for nucleic acid active enzymes. 105. The use according to claim 100, wherein the LNA modified oligonucleotide is more resistant to nucleases than the native oligonucleotide. 106. The use of an LNA according to any of the claims 4-6 and 58-99 for the preparation of an LNA modified oligonucleotide comprising normal nucleosides as well as other modified nucleosides. 107. The use of an LNA according to any of the claims 4-6 and 58-99 as an substrate for DNA and RNA polymerases. 108. The use of an LNA (according to any of the claims 4-6 and 58-99) triphosphate a,s substrates for enzymes active on nucleic acids. 109. The use of an LNA (according to any of the claims 4-6 and 58-99) triphosphate to facilitate the incorporation of non-Watson-Crick basepairs in an enzyme-mediated transcription/replication process, primer extention or nucleic acid amplification process. 110. The use of an LNA according to any of the claims 4-6 and 58-99 as a therapeutic agent. 111. The use of an LNA according to any of the claims 4-6 and 58-99 for the preparation of a composition for use in therapy. 112. The use of an LNA according to any of the claims 4-6 and 58-99 for diagnostic purposes. 113. The use of LNAs according to any of the claims 4-6 and 58-9.9 in the construction of more than one LNA modified oligonucleotide of different sequences attached to a solid surface. 114. The use according to claim 113, wherein the LNA modified oligonucleotides are attached in a predetermined pattern. 115. The use according to claim 113, wherein the LNAs are used to equalise the Tm of the oligonucleotides. 116. The use according to claim 113, wherein the LNA modified oligonucleotides have an increased affinity toward complementary ssDNA or ssRNA compared to native oligonucleotide. 117. The use according to claim 113, wherein the LNA modified oligonucleotides have an increased specificity toward complementary ssDNA or ssRNA compared to native oligonucleotide. 118. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 in therapy, e.g. as an antisense, antigene or gene activating therapeutic. 119. The use of complexes of more than one LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 in therapy. 12 0. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 for the preparation of a composition for use in therapy, e.g. as an antisense, antigene or gene activating therapeutic. 121. The use according to claim 119 or 120, wherein the LNA modified oligonucleotide comprises at least one internucleoside linkage not being a phosphate diester linkage. 122. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 in diagnostics, e.g. for the isolation, purification, amplification, detection, identification, quantification, or capture of natural or synthetic nucleic acids. 123. The use of an LNA modified oligonucleotide according to claim 122, wherein the oligonucleotide comprises a photochemically active group, a thermochemically active group, a chelating group, a reporter group, or a ligand that facilitates the direct of indirect detection of the oligonucleotide or the immobilisation of the oligonucleotide onto a solid support. 124. The use of an LNA modified oligonucleotide according to claim 123, wherein the photochemically active group, the thermochemically active group, the chelating group, the reporter group, or the ligand is attached via the biradical of at least one of the LNA(s) of the oligonucleotide. 125. The use of one or more LNA modified oligonucleotide according to claim 123 for capture and detection of naturally occurring or synthetic double stranded or single stranded nucleic acids such as RNA or DNA. 126. The use of one or more LNA modified oligonucleotide according to claim 123 for purification of naturally occurring double stranded or single stranded nucleic acids such as RNA or DNA. 127. The use of one or more LNA modified oligonucleotide according to claim 123 as a probe in in-situ hybridisation, in Southern hydridisation, or in Northern hybridisation. 128. The use of a LNA modified oligonucleotide according to claim 123 in the construction of an affinity pair. 129. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 as a primer in a nucleic acid sequencing reaction. 130. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 as a primer in a nucleic acid amplification reaction. 131. The use of an LNA modified oligonucleotide (an oligomer) according to claim 130, wherein the primer is so adapted that the amplification reaction is an essentially linear reaction. 132. The use of an LNA modified oligonucleotide (an oligomer) according to claim 13 0, wherein the primer is so adapted that the amplification reaction is an essentially exponential reaction. 133. The use according to any of the claims 130-132, wherein the nucleic acid amplification reaction results in a double stranded DNA product comprising at least one single stranded end. 134. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 for recruiting RNAseH. 135. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 as an aptamer in molecular diagnostics. 13 6. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 as an aptamer in therapeutic applications. 137. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 as an aptamer in RNA mediated catalytic processes. 138. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 as an aptamer in specific binding of antibiotics, drugs, amino acids, peptides, structural proteins, protein receptors, protein enzymes, saccharides, polysaccharides, biological cofactors, nucleic acids, or triphosphates. 139. The use of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 as an aptamer in the separation of enantiomers from racemic mixtures by stereospecific binding. 140. The use of LNA according to any of the claims 4-6 and 58-99 to construct oligonucleotides with nucleic acid catalytic activity (LNA modified ribozymes) which can cleave nucleic acid sequences sequence specifically. 141. The use of LNA modified ribozymes according to claim 140 in the sequence specific cleavage of target nucleic acids. 142. A conjugate of an LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 and a compound selected from proteins, amplicons, enzymes, polysaccharides, antibodies, haptens, peptides, and PNA. 143. The use of an LNA according to any of the claims 4-6 and 58-99 for the preparation of a conjugate of an LNA modified oligonucleotide and a compound selected from proteins, amplicons, enzymes, polysaccharides, antibodies, haptens, peptides, and PNA. 144. A kit comprising one or more LNA modified oligonucleotide (an oligomer) according to any of the claims 1-3 and 7-57 for the isolation, purification, amplification, detection, identification, quantification, or capture of natural or synthetic nucleic acids. 145. The use of LNA modified oligonucleotides (an oligomer) according to any of the claims 1-3 and 7-57 for the labelling of cells. 146. The use of LNA modified oligonucleotides according to claim 145, wherein the label allows the cells to be separated from unlabelled cells. 147. The use of an LNA modified oligonucleotide (an oligomer) defined in any of the claims 1-3 and 7-57 to hybridise to non protein coding cellular RNAs such as tRNA, rRNA, snRNA and scRNA in vivo or in-vitro. 148. The use of an LNA modified oligonucleotide (an oligomer) defined in any of the claims 1-3 and 7-57 in the construction of an oligonucleotide containing a fluorophor and a quencher, positioned in such a way that the hybridised state of the oligonucleotide can be distinguished from the unbound state of the oligonucleotide by an increase in the fluorescent signal from the probe. 149. The use of an LNA modified oligonucleotide (an oligomer) defined in any of the claims 1-3 and 7-57 in the construction of Tagman probes or Molecular Beacons. oligomer, substantially as hereinabove described and illustrated with reference to the accompanying drawings™

Documents:

2040-mas-1998 abstract-duplicate.pdf

2040-mas-1998 description (complete) duplicate-1.pdf

2040-mas-1998 description (complete) duplicate-2.pdf

2040-mas-1998 description (complete) duplicate.pdf

2040-mas-1998 description (complete)-1.pdf

2040-mas-1998 description (complete)-2.pdf

2040-mas-1998 drawings-duplicate.pdf

2040-mas-1998 form-2.pdf

2040-mas-1998 form-26.pdf

2040-mas-1998 form-4.pdf

2040-mas-1998 form-6.pdf

2040-mas-1998 petition.pdf

2040-mas-1998-claims.pdf

2040-mas-1998-correspondence others.pdf

2040-mas-1998-correspondence po.pdf

2040-mas-1998-description complete.pdf

2040-mas-1998-drawings.pdf

2040-mas-1998-form 1.pdf

2040-mas-1998-form 19.pdf

abs-2040.jpg