Title of Invention	A PROCESS FOR IDENTIFYING AFLATOXIGENIC ASPERGILLI
Abstract	The present invention relates to a process for identifying aflatoxigenic aspergilli using three sets of novel primers of SEQ ID Nos. 1-6, wherein said three sets of primer are designed from three genes omt, ord, and afl R respectively of aflatoxin biosynthesis pathway of fungi Aspergillus flavus.

Full Text

The present invention relates to a process for identifying aflatoxigenic aspergilli by using oligonucleotide primers. In particular, the present invention relates to three sets of novel primers of SEQ ID Nos. 1-6, wherein said three sets of primer are designed from three genes omt, ord, and afl R respectively of aflatoxin biosynthesis pathway of fungi Aspergillus flavus and an improved method of identifying aflatoxinogenic aspergilli using said three sets of primers. Aflatoxins are potent carcinogenic, mutagenic and teratogenic metabolites produced primarily by the fungal species of Aspergillus flavus and Aspergillus parasiticus. Foods and feeds, especially in warm climates are susceptible to invasion by aflatoxigenic Aspergillus sp. And subsequent production of Aflatoxins during preharvesting, processing, transportation or storage. Over the last few years, means for mycotoxin detection have been simplified, by the adoption of immunological methods. The level of mold infestation and identification of the governing species are important parameters which could give an indication of the quality of the material and future potential for the presence of mycotoxins. Mold counts are a part of quality control assurance for foods. This method is time consuming, labour intensive, costly requires facilities and mycological expertise and do not allow the specification of mycotoxegenic fungi. With the advances made in the detection methods, polymerase chain reaction (PCR) facilitates in vitro amplification of target sequence and offers several advantages over traditional methods of detection. Reference may be made to the work of Miller and Martin (1988) for the application of PCR techniques for the detection of microorganisms, including plant pathogens. However no attempt has been made to detect aflatoxin-producing fungi. Reference may be made to the works of Payne and Woloshuk (1989) and Nu, et al (1995). Who have identified the genes in Aflatoxins biosynthetic pathway of strains of A. flavus and A. parasiticus. However, detection of aflatixigenic fungi were not attempted. Reference may be made to the work of Shapira, et al (1996) , where in the identification of aflatoxin producing molds in grains has been attempted using PCR techniques. Three genes ver- 1, omt- 1 and apa - 2 coding for key enzymes and regulatory factor in biosynthesis of aflatoxin were used as primers. Positive results were obtained in 24h enriched cultures at lowest spore level of 102 spores per gram. However incubation of dried ground corn seeds in enrichment media allowed detection as few as 102 spores per gram after 48h of incubation. The drawback of these references is that no attempts have been made to detect aflatoxigenic fungi and the traditional methods are non-sensitive, time consuming and lack consistency. The present invention enables detection of aflatoxigenic fungi by PCR using specific aflatoxin biosynthetic pathway genes. This use has application in food system. The main object of the present invention is an improved method for detection of Aflatoxinogenic aspergilli Another main object of the present invention is to develop primers for genes omt, ord, and afl R of aflatoxin biosynthesis pathway. Yet another object of the present invention is to develop an improved use for identifying aflatoxinogenic aspergilli. Still another object of the present invention is to develop an improved use for identifying aflatoxinogenic aspergilli using said primers. Still another object of the present invention is to develop a use of identifying aflatoxinogenic aspergilli directly in food articles. Still another object of the present invention is to develop a highly sensitive use to identifying aflatoxinogenic aspergilli. Further object of the present invention is to develop an identification use using multiple number of primers for more accuracy. The present invention relates to three sets of novel primers of SEQ ID Nos. 1-6, wherein said three sets of primer are designed from three genes omt, ord, and afl R respectively of aflatoxin biosynthesis pathway of fungi Aspergillus flavus and an improved use of identifying aflatoxinogenic aspergilli using said three sets of primers. Accordingly, the present invention provides an improved msethod for the detection of aflatoxigenic molds in food systems which comprises : a), designing a set of novel nucleotide primers for o-methyl transferase , oxidoreductase and aflatoxin regulatory genes in Aspergillus flavus which may be selected from the sequence of o/r?M ( F ) 5 AGCGTCCGAATCCCTTTAAT 3 (SEQ ID NO. 1) ( R ) 5'AGGGTGTTCGCCAATCATAG 3' (SEQ ID NO. 2) ord ( F ) 5 ACTGCCCCTCAGCTAACCTC 3' (SEQ ID NO. 3) ( R ) 5' GCATCAGCATTCTTCCAAGG 3' (SEQ ID NO. 4) afIR ( F ) 5 AACCGCATCCACA ATCTCAT 3' (SEQ ID NO. 5) ( R ) 5' AGTGCAGTTCGCTCAGAACA3' (SEQ ID NO. 6) b). detecting of aflatoxigenic fungi using primers specific for omt, ord and afl R gene in a mixed rnicroflora. c). extracting of template DNA from moulds in grains or other food commodities. d). extracting of template DNA from Aspergillus flavus, Aspergillus parasiticus and Fusarium sp. may be effected by grinding the fungal mass in Tris - EDTA (50mM: 5mM ) buffer containing % sodium dodocyl sulphate ( SDS ), followed by extraction using phenol: iso- amyl alcohol at 25 : 24 : 0.1. e). reacting the PCR mixture in a total volume of 25 nl may consist of buffer 2.5|al ,d NTP mix 0.5 ^l, taq - polymerase 0.3 jj.1, water 18.78 jal , each specific primer - forward 1|al, reverse 1 jal and template DNA 1^1. f). detecting of aflatoxigenic fungi by amplification of target gene may be effected from an initial denaturation at 90° - 98°C for 2 - 8min, amplification cycle of 28 to 40 ,each cycle with a denaturation at 90° - 98°C for 40 - 70secs,annealing at 46° - 62°C for 40 - SOsecs and an extension at 68° - 76°C for 4 to 12min. g). achieviing the analysis of the PCR product in 1.2 - 1.8% agarose gel electrophoresis, visualization of PCR product by staining with 0.5 ^g /ml ethidium bromide and observation in a UV - transilluminator. i). detecting of time course may be effected indicating the rapidity of detection. j). detecting of aflatoxigenic moulds amongst different moulds may be effected indicating high sensitivity of the reaction. In an embodiment of the present invention, effective amplification of o-methyl transferase, oxidoreductase and aflatoxin regulatory genes may be effected at initial denaturation at 93° - 95°C for 4 - 6min, amplification cycles of 32 - 38, each cycle with a denaturation at 93° - 95°C for 55 - 65 seconds annealing at 48° -52°C for 55 - 65 seconds and an extension at 70° - 74°C for 55 - 65 seconds and a final extension at 68° - 76°C for 6 - 10min. In another embodiment of the present invention, the PCR use can detect from 12 to 120h old mycelia. In yet another embodiment of the present invention, the PCR use may detect toxigenic fungi directly in grains. The patent relates to PCR use for the detection of aflatoxigenic fungi. Polymerase chain reaction use was used to selectively amplify o-methyl transferase, oxidoreductase and aflatoxin regulatory genes in toxigenic fungi. Fungi grown in czapek-dox or potato dextrose broth or from contaminated grains were used for the isolation of template DMA. The PCR reaction mixture and amplification conditions were optimized for specific amplification. Visualization of PCR products revealed that by the use followed, it is possible to detect toxigenic fungi from 10~2 to 10"6 cell numbers in grains and only from aflatoxigenic fungi. The novelty of this use is the use of the designed primers for the direct detection of aflatoxigenic moulds by PCR. This use can detect aflatoxigenic fungi from contaminated grains. The use is rapid and sensitive making it possible to detect aflatoxigenic fungi from contaminated food systems without culturing them. The following examples are given by way of illustrations of the present invention and therefore should not be construed to limit the scope of the present invention. Example 1 Oligonucleotide primers for o-methyltransferase, oxidoreductase, and aflatoxin regulatory gene of Aspergillus flavus were designed based on the gene sequence (ENTREZ) using the software programme primer 3.0. These primer sets amplify 406, 387and 798 base pair (bp) respectively fragment of the gene, the sequence of which is given below. Sterilization of media and other solutions was achieved by autoclaving for 20 min. at 121°C. omM ( F ) 5' AGCGTCCGAATCCCTTTAAT 3 omt 2 ( R ) 5 AGGGTGTTCGCCAATCATAG 3' ord 1 ( F ) 5' ACTGCCCCTCAGCTAACCTC 3' ord 2 ( R ) 5' GCATCAGCATTCTTCCAAGG 3' afIR 1 ( F ) 5' AACCGCATCCACA ATCTCAT 3' afl R 2 ( R ) 5' AGTGCAGTTCGCTCAGAACA3' Ten ml of Czapek-dox or potato dextrose broth was inoculated with 1 ml spore suspension of Aspergillus flavus ATCC 46283, Aspergillus ochraceus CFR 221 and Fusarium tricinctum NRRL 32998 separately and the flasks were incubated for 120h at ambient temperature (26° - 28°C) under stationary conditions. The mycelia were harvested by centrifugation, washed well with buffer, ground well using lysis buffer after freezing in liquid nitrogen. After 1h of incubation at 65°C, DMA was extracted using phenol: chloroform: amyl alcohol mixture at 25:24:1 concentration. The aqueous phase was redissolved in Tris-EDTA buffer. Amplification was performed in a total reaction volume of 25jJ which contained 1 x PCR buffer (10 mM Tris-HCI, pH 9.0, 50 mM KCI, 1.5 mM MgCI2, 0.01% gelatin), each of deoxyribonucleoside triphosphate,4nm of each primer and unit of taq DMA polymerase and sterile ultra filtered water. Template DMAs were initially denatured at 94°C for 4 min. Subsequently, a total of 35 amplification cycle was carried out in a programmable thermocycler. Each cycle consisted of denaturation for 30 sec. at 94°C, primer annealing for 45 secs.at 50°C , 58°C and 62°C separately and an extension for 1.15 min. at 72°C . The last cycle was followed by a final extension at72°Cfor10min. PCR products were analysed by agarose ge^ electrophoresis. Aliquots of 10(al PCR products were mixed with 2.0 jal of loading dye and loaded on to 1.2% agarose gel and subjected to electrophoresis for 2h at 100 volts in 1 x TAB buffer. Gel was stained with ethidium bromide (0.5jag /ml), destained with distilled water and examined on a UV transilluminator. A 100 bp ladder was used as a molecular size marker. The amplification profile in the gel was documented in a CCD-camera based gel documentation system. Specific amplicons of 406, 387, and 1299 bp for omt, ord and afl R were observed with Aspergillus flavus template DNA while, Aspergillus ochraceus and Fusarium tricinctum template genes did not show amplification. Example 2 Oligonucleotide primers for o-methyltransferase, oxidoreductase, and aflatoxin regulatory gene of Aspergillus flavus were designed based on the gene sequence (ENTREZ) using the software programme primer 3.0. These primer sets amplify 406, 387, and 798 base pair (bp) fragment of the gene, the sequence of which is given below. Sterilization of media and other solutions was achieved by autoclaving for 20 min. at 121 °C. omt 1 ( F ) 5' AGCGTCCGAATCCCTTTAAT 3 omt 2 ( R ) 5 AGGGTGTTCGCCAATCATAG 3 ord 1 ( F ) 5' ACTGCCCCTCAGCTAACCTC 3 ord 2 ( R ) 5' GCATCAGCATTCTTCCAAGG 3' afIR 1 ( F ) 5' AACCGCATCCACA ATCTCAT 3' a/7 R 2 ( R ) 5' AGTGCAGTTCGCTCAGAACA3' Ten ml of Czapek-dox or potato dextrose broth was inoculated with 1 ml spore suspension of Aspergillus flavus ATCC 46283 and the flasks were incubated for 120h at ambient temperature (26° - 28°C) under stationary conditions. The mycelia were harvested by centrifugation, washed well with buffer, ground well using lysis buffer after freezing in liquid nitrogen. After 1h of incubation at 65°C, DNA was extracted using phenol : chloroform : amyl alcohol mixture at 25:24:1 concentration. The aqueous phase was redissolved in Tris-EDTA buffer Amplification was performed in a total reaction volume of 25^1 which contained 1 x PCR buffer (10 mM Tris-HCI, pH 9.0, 50 mM KCI, 1.5 mM MgCI2, 0.01% gelatin), each of deoxyribonucleoside triphosphate,4nm of each primer and unit of taq DNA polymerase and sterile ultra filtered water. Template DMAs were initially denatured at 94°C for 4 min. Subsequently, a total of 35 amplification cycle was carried out in a programmable thermocycler. Each cycle consisted of denaturation for 30 sec. at 94°C, primer annealing for 45 sees.at 50°C , 58°C and 62°C separately and an extension for 1.15 min. at 72°C . The last cycle was followed by a final extension at 72°C for 10 min. PCR products were analysed by agarose gel electrophoresis. Aliquots of 10^1 PCR products were mixed with 2.0 ^1 of loading dye and loaded on to 1.2% agarose gel and subjected to electrophoresis for 2h at 100 volts in 1 x TAB buffer. Gel was stained with ethidium bromide (0.5^g /ml), destained with distilled water and examined on a UV transilluminator. A 100 bp ladder was used as a molecular size marker. The amplification profile in the gel was documented in a CCD-camera based gel documentation system. At 50°C amplification was observed in all 3 primers. At 55°C omt did not show any amplicons. However for ord and a/7 R primers the amplicons were observed. At 62°C all the primers showed no amplicons production. Example 3 Oligonucleotide primers for o-methyltransferase, oxidoreductase, and aflatoxin regulatory gene of Aspergillus flavus were designed based on the gene sequence (ENTREZ) using the software programme primer 3.0. These primer sets amplify 406, 387, and 798 base pair (bp) fragment of the gene, the sequence of which is given below. Sterilization of media and other solutions was achieved by autoclaving for 20 min. at121 °C. omM ( F ) 5' AGCGTCCGAATCCCTTTAAT 3' omt 2 ( R ) 5'AGGGTGTTCGCCAATCATAG 3' ord 1 ( F ) 5' ACTGCCCCTCAGCTAACCTC 3' ord 2 ( R ) 5' GCATCAGCATTCTTCCAAGG 3' afIR 1 ( F ) 5' AACCGCATCCACA ATCTCAT 3 af R 2 ( R ) 5' AGTGCAGTTCGCTCAGAACA3 ' Ten ml of Czapek-dox or potato dextrose broth was inoculated with 1 ml spore suspension of Aspergillus flavus ATCC 46283 and the flasks were incubated for 120h at ambient temperature (26° - 28°C) under stationary conditions. The mycelia were harvested at different periods from 12h through 144h by centrifugation, washed well with buffer, ground well using lysis buffer after freezing in liquid nitrogen. After 1h of incubation at 65°C, DMA was extracted using phenol: chloroform : amyl alcohol mixture at 25:24:1 concentration. The aqueous phase was redissolved in Tris-EDTA buffer. Amplification was performed in a total reaction volume of 25^il which contained 1 x PCR buffer (10 mM Tris-HCI, pH 9.0, 50 mM KCI, 1.5 mM MgCI2, 0.01% gelatin), each of deoxyribonucleoside triphosphate,4nM of each primer and unit of taq DMA polymerase and sterile ultra filtered water. Template DMAs were initially denatured at94°Cfor4min. Subsequently, a total of 35 amplification cycle was carried out in a programmable thermocycler. Each cycle consisted of denaturation for 30 sec. at 94°C, primer annealing for 45 sees at 50°C , and an extension for 1.15 min. at 72°C . The last cycle was followed by a final extension at 72°C for 10 min. PCR products were analysed by agarose gel electrophoresis. Aliquots of 10^1 PCR products were mixed with 2.0 jal of loading dye and loaded on to 1.2% agarose gel and subjected to electrophoresis for 2h at 100 volts in 1 x TAE buffer. Gel was stained with ethidium bromide (O.S^ig /ml), destained with distilled water and examined on a UV transilluminator. A 100 bp ladder was used as a molecular size marker. The amplification profile in the gel was documented in a CCD-camera based gel documentation system. Amplification could be observed from DMA extracted from 24h to 120h grown mycelia. Amplifications were observed with omt, ord and a/7 R primers. Example 4 Oligonucleotide primers for o-methyltransferase, oxidoreductase, and aflatoxin regulatory gene of Aspergillus flavus were designed based on the gene sequence (ENTREZ) using the software programme primer 3.0. These primer sets amplify 406, 387, and 798 base pair (bp) fragment of the gene, the sequence of which is given below. Sterilization of media and other solutions was achieved by autoclaving for 20 min. at121 °C. omM ( F ) 5' AGCGTCCGAATCCCTTTAAT 3 omt 2 ( R ) 5 AGGGTGTTCGCCAATCATAG 3' ord 1 ( F ) 5' ACTGCCCCTCAGCTAACCTC 3' ord 2 ( R ) 5' GCATCAGCATTCTTCCAAGG 3' afIR 1 ( F ) 5' AACCGCATCCACA ATCTCAT 3' aflR 2 ( R ) 5 AGTGCAGTTCGCTCAGAACA3 ' One ml spore suspensions of 27 different fungi, belonging to Fusarium spp (6 no.)., Aspergillus flavus (6 nos.), Aspergillus parastf/ays.(3nos.), Aspergillus spp, (4 nos.), Aspergillus oryzae ( 3 nos.),Rhizopus spp (3 nos.) were inoculated to potato - dextrose broth and incubated at ambient temperatures (26° - 28°C ) under stationary conditions for 96h . DNA was extracted . from ground mycelia without liquid nitrogen treatment. Amplification was performed in a total reaction volume of 25(al which contained 1 x PCR buffer (10 mM Tris-HCI, pH 9.0, 50 mM KCI, 1.5 mM MgCI2, 0.01% gelatin), each of deoxyribonucleoside triphosphate,4nm of each primer and unit of tag DNA polymerase and sterile ultra filtered water. Template DMAs were initially denatured at 94°C for 4 min. Subsequently, a total of 35 amplification cycles were carried out in a programmable thermocycler. Each cycle consisted of denaturation for 30 sec. At 94°C, primer annealing for 45 sees.at 50°C and an extension for 1.15 min. at 72°C . The last cycle was followed by a final extension at 72°C for 10 min. PCR products were analysed by agarose gel electrophoresis. Aliquots of 10jal PCR products were mixed with 2.0 |il of loading dye and loaded on to 1.2% agarose gel and subjected to electrophoresis for 2h at 100 volts in 1 x TAB buffer. Gel was stained with ethidium bromide (0.5fag /ml), destained with distilled water and examined on a UV transilluminator. A 100 bp ladder was used as a molecular size marker. The amplification profile in the gel was documented in a CCD-camera based gel documentation system The template DNA from Rhizopus 3spp (2 )Aspergillus flavus (2), Fusarium strains (6) and Aspergillus (4), Aspergillus oryzae (5) strains did not show any amplification. However, toxin producing Aspergillus flavus (4) and Aspergillus parasiticus (3) showed amplifications. The main advantages of the present invention are: 1. The designed o-methyltransferase, oxidoreductase, and aflatoxin regulatory primers are specific for the detection of aflatoxigenic fungi. 2. The designed primers can detect aflatoxigenic fungi even at 24h of growth. 3. The designed primers can specifically detected fungi possessing aflatoxin- producing genes. 4. A simple and effective use has been used for the isolation of template DMA without the application of liquid nitrogen. Sequences of three genes omt, ord A, and afl R. A. O methyltransferase (Omt) gene from the published gene sequence with Accession no L.25834 where the primers covers the region between 1811 to 2218 with the product size 407 bp of SEQ ID NO. 7. L25834. Aspergillus paras... omt gene [gi:414297] 1811 agcgtccgaatccctttaat ttgcttcgat ggctaattgt tccaacagtg 1861 catgcgtgga aatcctctcc aacatcgtca ccgccatgga cccaagcaag tcgcgcatcc 1921 ttctggacga aatgattatg cccgatcttt tggcgcagga ttcgcagcgc ttcatgaatc 1981 agatcgacat gactgttgtt ctgacattga acgggaagga gaggtctacc aaggagtgga 2041 attcgcttat tacgacggta gatggtagac tggagactga gaagatatgg tggcgcaaag 2101 gcgaggaagg gtctcactgg ggcgttcaac aactgcgttt gcgcaagtag gggaatgcaa 2161 tggagatatc cttgggtctg tcagaagaac ggctgag ctatgattggcgaacaccct 2218 B. Oxidoreductase (ord) gene from the published gene sequence with Accession no AF 169016 where the primer covers the region between 3142 to 3530 with product size 388 bp of SEQ ID NO. 8. ACCESSION AF169016 VERSION AF169016.1 61:6715098 Aspergillus parasitlcus oxidoreductase (ordA), versicolorin B synthase (vbs), cytochrome P450 monooxigenase (cypX), and monooxigenase (moxY) genes, complete cds 3142 actgcccct cagctaacct catactaatt aggacgttta 3181 cccatgatcc cagtgtctac cacgacccaa tggtgttcaa gccagagcga ttcctggagc 3241 gacaaagctc cccgccggaa acggatccca tgaaatttgt gttcggcttt gggcgtcgta 3301 tatgccccgg tcggtttgta acagacgaaa agctattttt gattgcgtgc cacgccatca 3361 gttgcttctt gatctcgccc aaggatccag gagctccgga acccgactgg ttgccgggcg 3421 tcatcagtca accgggcccc tttgacctca atgtggtgcc tcgcagccct gctcacgaag 3481 aattgattcg ttcaatcgag acggaccat ccttggaagaatgctgatgc 3530 C. Aflotoxin regulatory gene (aflR) from the published gene sequence with Accession no AF 264763 where the said primer covers the region between 540 to 1338 with the product size 798 bp of SEQ ID NO. 9. Aspergillus sojae strain ATCC 42251 AFLR regulatory protein (aflR) gene, complete cds. ACCESSION AF264763 VERSION AF264763.1 Gl:8572226 540 aaccgcatcca caatctcatc ctcaatcgaa tcaaccacca cacgctctgc ccacccccaa 601 tggtagcagt agcgtctccg ccatcttttc tcaccagagt cccccgccac tcgtggagac 661 ccagggcctt ggaggagatc tggctggtca ggcgcaaagc accctgtctt ccctaacagt 721 cgattcggaa ttcgggggct ctttgcagtc aatggaacac ggaaaccatg ccgatttctt 781 ggcggagtcg acggggagtc ttttcgacgc gtttttggaa gtggggaccc ccatgatcga 841 cccgttcctc gagtcggccc cactgccacc gtttcaggcg cgctattgct gcttttcgct 901 agcactacaa acactgacct gcctcttccc ccacgccccg ctgggctgtc agctgcggct 961 gacggacggt gaggacagtt cgtgcaacct gatgacgact gatatggtca tctcggggaa 1021 caagaaggct accgatgcgg tccggaagat cctcgggtgt tcgtgcgcgc aggatggcta 1081 cttgctgagc atggtcgtcc ttatcgttct caaggtgctg gggtggtatg ctgcggcagc 1141 aggcacccag tgtacctcaa cggcggcggg tggagaaacc aacagtggca gctgtagcaa 1201 cagtcccgcc accgtgtcca gtggctgtct gacggaagag cgcgtgctgc accaccctag 1261 tatggtgggc gaggattgtg tggatgagga agaccagccg cgagtggcgg cacagcttgt 1321 tctgagcgaactgcact 1338 We claim: 1. A process for identifying aflatoxigenic aspergilli employing oligonucleotide primers represented by three sets of primers comprising primers of SEQ ID Nos. 1 through 6, wherein the steps comprising: [a] harvesting mixed microflora from any food sample, [b] extracting DNA from said harvested flora, [c] amplifying DNA by PCR using the primers of SEQ ID 1 to 6 comprising: omt 1 (F) 5' AGCGTCCGAATCCCTTTAAT 3' (SEQ ID NO. 1) (R) 5' AGGGTGTTCGCCAATCATAG 3' (SEQ ID NO. 2) ord (F) 5' ACTGCCCCTCAGCTAACCTC 3' (SEQ ID NO. 3) (R) 5' GCATCAGCATTCTTCCAAGG 3' (SEQ ID NO. 4) aflR (F) 5' AACCGCATCCACAATCTCAT 3' (SEQ ID NO. 5) (R) 5' AGTGCAGTTCGCTCAGAACA 3' (SEQ ID NO. 6); [d] analyzing amplified DNA by electrophoresis, and [e] identifying aflatoxigenic fungi. 2. A process as claimed in claim 1, wherein the said primers are designed from genes of aflatoxin biosynthesis pathway of fungi Aspergillus flavus. 3. A process as claimed in claim 1, wherein the primers are designed for three specific genes omt, ord, and afl R. 4. A process as claimed in claim 1, wherein the primers 1 and 2 correspond to gene omt encoding o-methyl transferase. 5. A process as claimed in claim 1, wherein the primers 1 and 2 cover the region between 1811 to 2218 bp in gene omt with the product size of 407 bp. 6. A process as claimed in claim 1, wherein the primers 3 and 4 correspond to gene ord encoding oxidoreductase. 7. A process as claimed in claim 1, wherein the primers 3 and 4 cover the region between 3142 to 3530 in gene ord with the product size of 388 bp. 8. A process as claimed in claim 1, wherein the primers 5 and 6 correspond to gene all R encoding aflatoxin regulatory protein. 9. A process as claimed in claim 1, wherein the primers 5 and 6 cover the region between 540 to 1338 in gene aflR with the product size of 798 bp. 10. A process as claimed in claim 1, wherein the primers of SEQ ID No. 1, 3, and 5 are forward primers. 11. A process as claimed in claim 1, wherein the primers of SEQ ID No. 2, 4, and 6 are reverse primers. 12. A process as claimed in claim 1, wherein the length of primers is 20 base pairs (bp). 13. A process as claimed in claim 1, wherein fungi are harvested by centrifugation. 14. A process as claimed in claim 1, wherein DNA is extracted using mixture of phenol, chloroform, and amyl alcohol in ratio of about 25:24:1. 15. A process as claimed in claim 1, wherein amplification mixture for amplifying DNA comprises Tris-HCl, Potassium Chloride (KC1), Magnesium Chloride (MgCl.sub.2). gelatin, deoxyribonucleoside triphosphates, primers, Taq DNA polymerase, and sterile ultra filtered water. 16. A process as claimed in claim 1, wherein it identifies aflatoxigenic fungi as young as 12 hrs old. 17. A process as claimed in claim 1, wherein said process is particularly useful in detecting aflatoxigenic Aspergillus flavus, and Aspergillus parasiticus. 18. A process as claimed in claim 1, wherein said method detects aflatoxigenic fungi directly in food grains. 19. A process as claimed in claim 1, wherein it detects aflatoxigenic fungi from 10-2 to 10-6 cell numbers in grains. 20. A process as claimed in claim 1, wherein it extracts DNA without using liquid nitrogen.

Documents:

343-DEL-2002-Abstract-(06-11-2008).pdf

343-DEL-2002-Abstract-(26-11-2008).pdf

343-del-2002-abstract.pdf

343-DEL-2002-Claims-(06-11-2008).pdf

343-DEL-2002-Claims-(26-11-2008).pdf

343-del-2002-claims.pdf

343-DEL-2002-Correspondence-Others-(06-11-2008).pdf

343-DEL-2002-Correspondence-Others-(14-11-2008).pdf

343-DEL-2002-Correspondence-Others-(26-11-2008).pdf

343-del-2002-correspondence-others.pdf

343-DEL-2002-Description (Complete)-(06-11-2008).pdf

343-del-2002-description (complete).pdf

343-del-2002-drawings.pdf

343-DEL-2002-Form-1-(06-11-2008).pdf

343-DEL-2002-Form-1-(26-11-2008).pdf

343-del-2002-form-1.pdf

343-del-2002-form-13-(14-11-2008).pdf

343-del-2002-form-18.pdf

343-DEL-2002-Form-2-(06-11-2008).pdf

343-DEL-2002-Form-2-(26-11-2008).pdf

343-del-2002-form-2.pdf

343-DEL-2002-Form-3-(06-11-2008).pdf

343-del-2002-form-3.pdf

343-DEL-2002-Petition-137-(06-11-2008).pdf