Title of Invention	THERAPEUTIC AGENTS USEFUL FOR TREATING PAIN
Abstract	ABSTRACT (2998/CHENP/2004) Therapeutic agents useful for treating pain A compound of formula (I): wherein the substituents are disclosed herein, or a pharmaceutically acceptable salt thereof (a "Cyanoiminopiperazine Compound"), composition, comprising an effective amount of a Cyanoiminopiperazine Compound, and methods for treating or preventing pain, urinary incontinence, an ulcer, inflammatory-bowel disease, irritable-bowel syndrome, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder; a memory deficit, restricted brain function. Huntington's chorea, amyotrophic lateral sclerosis, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia or depression in an animal comprising administering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound are disclosed.

Title of Invention

THERAPEUTIC AGENTS USEFUL FOR TREATING PAIN

Abstract

ABSTRACT (2998/CHENP/2004) Therapeutic agents useful for treating pain A compound of formula (I): wherein the substituents are disclosed herein, or a pharmaceutically acceptable salt thereof (a "Cyanoiminopiperazine Compound"), composition, comprising an effective amount of a Cyanoiminopiperazine Compound, and methods for treating or preventing pain, urinary incontinence, an ulcer, inflammatory-bowel disease, irritable-bowel syndrome, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder; a memory deficit, restricted brain function. Huntington's chorea, amyotrophic lateral sclerosis, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia or depression in an animal comprising administering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound are disclosed.

Full Text	THERAPEUTIC AGENTS USEFUL FOR TRE.\TING PAJN This application claims the benefit of U.S. Provisional Application No. 60/391.962, filed Jxme 28, 2002; U.S. Provisional Apphcation No. 60/411,030, filed September 17, 2002; U.S. Provisional Application No. 60/413,148, filed September 25, 2002; and U.S. Provisional Application No. 60/416,582, filed October S, 2002, each of which is incorporated herein by reference in its entirety. 1. FIELD OF THE INVENTION The present invention relates to Cyanoiminopiperazine Compounds, compositions comprising an effective amount of a Cyanoiminopiperazine Compound and methods for treating or preventing pain, urinary incontinence (UT), an ulcer, inflanunatory-bowel disease (IBD), irritable-bowel syndrome (IBS), an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, amyotrophic lateral sclerosis (ALS), dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia or depression, comprising administering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound. 2. BACKGROUND OF THE INVENTION Pam is the most common symptom for which patients seek medical advice and treatment. Pain can be acute or chronic. While acute pain is usually self-limited, chronic pain persists for 3 months or longer and can lead to significant changes in a patient's personality, lifestyle, fonctional ability and overall quality of life (KM. Foley, Pain, in Cecil Textbook of Medicine 100-107 (J.C. Bennett and F. Plum eds., 20th ed. 1996)). Moreover, chronic pain can be classified as either nociceptive or neuropathic. Nociceptive pain includes tissue injury-induced pain and inflammatory pain such as that associated with arthritis. Neuropathic pain is caused by damage to the peripheral or cental nervous system and is maintained by aberrant somatosensory processing. There is a large body of evidence relating activity at both Group I metabotropic glutamate receptors, i.e., metabotiopic glutamate receptor 1 ("mGluRl") and metabotropic glutamate receptor 5 ("mGIuRS") (M.E. Fundyms, CNSDntgs 15:29-58 (2001)), and vanilloid receptors ("VRl") (V. Di Marzo st al. Current Opinion in Neurobiology 12:372-379 (2002)) to pain processing. Inhibiting mGluRl or mGluR5 reduces pain, as shown by in vivo treatment with antibodies selective for either mGIuRl or mGluR5, where neuropathic pain in rats was attenuated (M.E. Fundytus et al, NeuroRepon 9:731-735 (1998)). It has also been shown that antisense oligonucleotide knockdown of mGluRl alleviates both neuropathic and inflammatory pain (M.E. Fundyms et al, British Journal of Pharmacology 132:354-367 (2001); M.E. Fundyms et al., Phannacohgy, Biochemsitiy & SeAav/o/-73:401-410 (2002)). Small molecule antagonists for mOluRS-attenuated pain in in vivo animal models are disclosed in, e.g., K. Walker et al. Neiirophamiacology 40:1-9 {2000) and A. X>o^ra\ et al, Neuroscience Letters 292:115-118(2000)). Nociceptive pain has been traditionally managed by administering non-opioid analgesics, such as acetylsalicylic acid, choline magnesium trisalicylate, acetaminophen, ibuprofen, fenoprofen, diflusinal, and naproxen; or opioid analgesics, including morphine, hydromorphone, methadone, levoiphanoi, fentanyl, oxycodone, and oxymorphone. Id. In addition to ^e above-listed treatments, neuropathic pain, which can be difficult to treat, has also been treated with anii-epileptics (e.g. gabapentin, carbamazepine, valproic acid, topiiamate, phenytoin), NMDA antagonists (e.g. ketamine, dextromethorphan), topical Udocaine (for post-herpetic neuralgia), and tricyclic antidepressants (e.g. fluoxetine, sertraline and amitriptyline). UI is uncontrollable urination, generally caused bybladder-detrusor-muscle nstability. UI affects people of all ages and levels of physical health, both in health care -.ettings and in the community at large. At present, UI aSlicts 15-30% of elderlypeople iving at home, one-third of those living in acute-care settings, and at least one-half of those iving in long-term care instimtions (R.M. Resnick, Lancet 346:94 (1995)). Persons having jl are predisposed to also having urinary-tract infections, pressure ulcers, perineal rashes and irosepsis. Psychosocially, UI is associated with embanassment, social stigmatization, .epression and a risk of instimtionalization (Herao et al, Annu. Rev. Gerontol. Geriatr. 9:74 1989)). Economically, the costs of UI are great; in the United States alone, health-care costs ssociated with UI are over S15 biUion per annum. Physiologic bladder contraction results in large part from acetylcholine-induced stimulation of post-ganglionic muscarinic-receptor sites on bladder smooth muscle. Treatments for UI include the administration of drugs having bladder-relaxant properties, which help to control bladder-detrusor-muscle overactivity. For example, anticholinergics 5 such as propantheline bromide and glycopyrrolate. and combinations of smooth-muscle relaxants such as a combination of racemic oxybutynin and dicyclomine or an anticholinergic, have been used to treat UI (See, e.g., A.J. Wein, Urol Clin. N. Am. 22:557-577 (1995); Levin et al.,J. Urol 128:396-398 (19S2); Cooke el ai, S. Afi: Med. J. 63:3 (19S3); R.K. Mirakhur et ai. Anaesthesia 38:1195-1204 (19S3)). These drugs are not effective, however, in all 0 patients having umnhibited bladder contractions. Administration of anticholinergic medications represent the mainstay of this type of treatment. None of the existing commercial drug treatments for UI, however, has achieved complete success in all classes of UI patients, nor has treatment occurred without significant adverse side effects. For example, drowsiness, dry mouth, constipation, blurred ) vision, headaches, tachycardia, and cardiac arrhythmia, which are related to the anticholinergic activity of traditional anti-UI drugs, can occur frequently and adversely affect patient compliance. Yet despite the prevalence of unwanted anticholinergic effects in many patients, anticholinergic drugs are currently prescribed for patients having UL 77ie Merck Manual of Medical Information 631-634 (R. Berkow ed., 1997). ' Ulcers are sores occurring where the lining of the digestive tract has been eroded by stomach acids or digestive juices. The sores are typically well-defined round or oval lesions primarily occurring in the stomach and duodenum. About 1 in lO people develop an ulcer. Ulcers develop as a result of an imbalance between acid-secretory factors, also known as "aggressive factors," such as stomach acid, pepsin, and Helicobacter pylori infection, and local mucosal-protective factors, such as secretion of bicarbonate, mucus, and prostaglandins. Treatment of ulcers typically involves reducing or inhibiting the aggressive factors. For example, antacids such as al\miinum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicarbonate can be used to neutralize stomach acids. Antacids, however, can cause alkalosis, leading to nausea, headache, and weakness. Antacids can also interfere with the absorption of other drugs into the blood stream and cause diarrhea. HT antagonists, such as cimetidine, ranitidine, famotidine, and nizatidine, are also used to treat ulcers. H2 antagonists promote ulcer healing by reducing gastric acid and digestive-enzyme secretion elicited by histamine and other H. agonists in the stomach and duodenum. H, antagonists, however, can cause breast enlargement and impotence in men mental changes (especially LQ the elderly), headache, dizziness, nausea, myalgia, diarrhea, rash, and fever. H, K"^ - ATPase inhibitors such as omeprazole and lansoprazole are also used to treat ulcers. IT, K* - ATPase inhibitors inhibit the production of enzymes used by the stomach to secrete acid. Side effects associated witli H, K - ATPase inhibitors include nausea, diarrhea, abdominal colic, headache, dizziness, somnolence, skin rashes, and transient elevations of plasma activities of aminotransferases. Sucraflate is also used to treat ulcers. Sucraflate adheres to epithelial cells and is believed to form a protective coating at the base of an ulcer to promote healing. Sucraflate, however, can cause constipation, dry mouth, and interfere with the absorption of other drugs. Antibiotics are used when Helicobacter pylori is the underlying cause of the ulcer. Often antibiotic therapy is coupled with the administration of bismuth compounds such as bismuth subsalicylate and colloidal bismuth citrate. The bismuth compounds are beheved to enhance secretion of mucous and HCO3", inhibit pepsin activitv, 2nd act as an antibacterial against H. pylori. Ingestion of bismuth compounds, however, can lead to elevated plasma concentrations of Bi"^^ and can interfere with the ^sorption of other drugs. Prostaglandin analogues, such as misoprostal, inhibit secretion of acid and stimulate the secretion of mucous and bicarbonate and are also used to treat ulcers, especially ulcers in patients who require nonsteroidal anti-inflammatory drugs. Effective oral doses of prostz^landin analogues, however, can cause diarrhea and abdominal cramping. In addition, some prostaglandin analogues are abortifacients. Carbenoxolone, a mineral corticoid, can also be used to treat ulcers. Carbenoxolone appears to alter the composition and quantity of mucous, thereby enhancing the mucosal barrier. Carbenoxolone, however, can lead to Na* and fluid retention, hypertension, hypokalemia, and impaired glucose tolerance. Muscarinic cholinergic antagonists such as pirenzapine and telenzapine can also be used to reduce acid secretion and treat ulcers. Side effects of muscarinic cholinergic antagonists include dry mouth, blurred vision, and constipation. Tlie Merck Manual of Medical Information 496-500 (R. Berkow ed., 1997) and Goodman and Oilman's Tlie Pharmacological Basis ofTJierapeulics 901-915 (J. Hardman and L. Limbird eds., 9* ed. 1996V IBD is a chronic disorder in which the bowel becomes inflamed, often causina recurring abdominal cramps and diarrhea. The two types of IBD are Crohn's disease and ulcerative colitis. Crohn's disease, which can include regional enteritis, granulomatous ileitis, and ileocolids, is a chronic inflammation of the intestinal wall. Crohn's disease occurs equally in both sexes and is more common in Jews of eastern-European ancestry. Most cases of Crohn's disease begin before age 30 and the majority start between the ages of 14 and 24. The disease typically affects the fill! thickness of the intestinal wall. Generally the disease affects the lowest portion of the small intestine (ileum) and the large intestine, but can occur in any part of the digestive tract. Early symptoms of Crohn's disease are chronic diarrhea, crampy abdominal pain, fever, loss of appetite, and weight loss. Complications associated with Crohn's disease include the development of intestinal obstnictions, abnormal connecting channels (fistulas), and abscesses. The risk of cancer of the large intestine is increased in people wb-^ have Crohn's disease. Often Crohn's disease is associated with other disorders such as gallstones, inadequate absorption of nutrients, amyloidosis, arthritis, episcleritis, aphthous stomatitis, erythema nodosum, pyoderma gangrenosum, ankylosing spondylitis, sacroilitis, uveitis, and primary sclerosing cholangitis. There is no known cure for Crohn's disease. Cramps and diarrhea, side effects associated with Crohn's disease, can be relieved by anticholinergic drugs, diphenoxylate, loperamide, deodorized opium tincture, or codeine. Generally, the drug is taken orally before a meal. Broad-spectrum antibiotics are often administered to treat the symptoms of Crohn's disease. The antibiotic metronidazole is often administered when the disease affects the large intestine or causes abscesses and fistulas around the anus. Long-term use of metronidazole, however, can damage nerves, resulting in pins-and-needles sensations in the arms and legs. Sulfasalazine and chemically related drugs can suppress mild inflammation, especially in the large intestine. These drugs, however, are less effective in sudden, severe flare-ups. Corticosteroids, such as prednisone, reduce fever and diarrhea and relieve abdominal pain and tenderness. Long-term corticosteroid therapy, however, invariably results in serious side effects such as iii^ blood-sugar levels, increased risk of infection, osteoporosis, water retention, and fragility of the skin. Drugs such as azathioprine and mercaptourine can compromise the immune system and are often effective for Crohn's disease in patients that do not respond to other drugs. These drugs, however, usually need 3 to 6 months before they produce benefits and can cause serious side effects such as allergy, pancreatitis, and low white-blood-cell count. When Crohn's disease causes the intestine to be obstructed or when abscesses or tlstulas do not heal, surgery can be necessary to remove diseased sections of the intestine. Surgery, however, does not cure the disease, and inflammation tends to recur where the intestine is rejoined. In almost half of the cases a second operation is needed. Hie Merck Manual of Medical Information 52S-530 (R. Berkow ed., 1997). Ulcerative colitis is a chronic disease in which the large intestine becomes inflamed and ulcerated, leading to episodes of bloody diarrhea, abdominal cramps, and fever. Ulcerative colitis usually begins between ages 15 and 30; however, a small group of people have their first attack between ages 50 and 70. Unlike Crohn's disease, ulcerative colitis never affects the small intestine and does not affect the full thickness of the intestine The disease nsuaUy begins in the rectum and the sigmoid colon and eventually spreads partially or completely through out the large intestine. The cause of ulcerative colitis is unknown. Treatment of ulcerative colitis is directed to controlling inflammation, reducing symptoms, and replacing lost fluids and nutrients. Anticholinergic drugs and low doses of diphenoxylate or loperamide are administered for treating mild diarrhea. For more intense diarrhea higher doses of diphenoxylate or loperamide, or deodorized opium tincture DF codeine are administered- Sulfasalazine, olsalazie, prednisone, or mesalamine can be used to reduce inflammation. Azathioprine and mercaptopurine have been BSKI to maintain remissions in ulcerative-colitis patients who would otherwise need long-term corticosteroid Teatment. In severe cases of ulcerative colitis the patient is hospitalized and given ;orticosteroids intravenously. People with severe rectal bleeding can require transfusions and ntravenous fluids. If toxic colitis develops and treatments fail, surgery to remove the large ntestine can be necessary. Non-emergency surgery can be perforaied if cancer is diagnosed. precancerous legions are detected, or unremitting chronic disease would otherwise make the person an invalid or dependent on high doses of corticosteroids. Complete removal of the large intestine and rectum permanently cures ulcerative coliris. Tlie Merck Manual of Medical Information 530-532 (R. Berkow ed., 1997) and Goodman and Gilman 's TJic Pharmacological Basis ofllterapetitics (J. Hardman and L. Limbird eds., 9"' ed. 1996). IBS is a disorder of motihty of the entire gastrointestinal tract, causing abdominal pain, constipation, and/or diarrhea. IBS affects three-times more women than men. In IBS stimuli such as stress, diet, drugs, hormones, or irritants can cause the gastrointestinal tract to contract abnormally. During an episode of IBS contractions of the gastrointestinal tract become stronger and more frequent, resulting in the rapid transit of food and feces through the small intestine, often leading to diarrhea. Cramps result from the strong contractions of the large intestine and increased sensitivity of pain receptors in the large intestine. There are two major types of IBS. The first type, spastic-colon type, is commonly triggered by eating, and usually produces periodic constipation and diarrhea with pain. Mucous often appears in the stool. Thepain can come in bouts of continuous dull aching pain or cramps, usually in the lower abdomen. The person suffering from spastic-colon type IBS can also experience bloating, gas, nausea, headache, fatigue, depression, anxiety, and difficulty concentrating. The second type of IBS usually produces painless diarrhea or constipation. The diarriiea can begin suddenly and with extteme urgency. Often the diairiiea occurs soon after a meal and can sometimes occur immediately upon awakening. Treatment of IBS typically involves modification of an IBS-patient's diet-Often it is recommended that an IBS patient avoid beans, cabbage, sorbitol, and fiiictose. A low-fat, high-fiber diet can also help some IBS patients. Regular physical ^tivity can also help keep the gastrotntestiQal tract functioning properly. Drugs such as propantheline that slow the function of the gastromtestinal tract are generally not effective for treating IBS. Antidiarrheal drugs, such as diphenoxylate and loperamide, help with diarrhea: Tire Merck Manual of Medical Information 525-526 (R. Berkow ed., 1997). Many drugs can cause physical and/or psychological addiction. Those most well known types of these drugs include opiates, such as heroin, opium, and morphine; sympathomimetics, including cocaine and amphetamines; sedative-hypnotics, including alcohol, benzodiazepines and barbiturates; and nicotine, which has effects similar to opioids and sympathomimetics. Drug addiction is characterized by a craving or compulsion for taking the drug and an inability to limit its intake. Additionally, drug dependence is associated with drug tolerance, the loss of effect of the drug following repeated i administration, and withdrawal, the appearance of physical and behavioral symptoms when the drug is not consumed. Sensitization occurs if repeated administration of a drug leads to an increased response to each dose. Tolerance, sensitization, and withdrawal are phenomena evidencing a change in the central ner\'ous system resulting from continued use of the drug. This change can motivate the addicted individual to continue consuming the drug despite serious social, legal, physical and/or professional consequences. {See, e.g., U.S. Patent No. 6,109,269 to Rise era/.). Certain pharmaceutical agents have been administered for treating addiction. U.S. Patent No. 5,556,838 to Mayer et al. discloses the use of nontoxic NMDA-bloctdng agents co-administered with an addictive substance to prevent the development of tolerance or withdrawal symptoms. U.S. Patent No. 5,574,052 to Rose et al. discloses co¬administration of an addictive substance with an antagonist to partially block the pharmacological effects of the substance. U.S.Patent No. 5,075,341 to Mendeison ei a^. discloses the use of a mixed opiate agonist/antagonist to treat cocaine and opiate addiction. U.S. Patent No. 5,232,934 to Downs discloses administration of 3-phenoxypyridine to treat addiction. U.S. Patents No. 5,039,680 and 5,198,459 to hnperato et al. disclose using a serotonin antagonist to treat chemical addiction. U.S. Patent No. 5,556,837 to Nastier et. al. discloses infiising BDNF or NT-4 grovrth factors to inhibit or reverse neurological adaptive changes that correlate with behavioral changes in an addicted individual. U.S. Patoit No. 5,762,925 to Sagan discloses implanting encapsulated adrenal medullary cells into an animal's central nervous system to inhibit the development of opioid intolerance. U.S. Patent No. 6,204,284 to Beer et al. discloses racemic (±)-l-(3,4-dichlDrophenyl)-3-azabicyclo[3.i.0]hexane for use in the prevention or rehef of a withdrawal syndrome resulting from addiction to drugs and for the treatment of chemical dependencies. Parkinson's disease is a clinical syndrome comprising bradykinesia (slowness and poverty of movement), muscular rigidity, resting tremor (which usually abates during voluntary movement), and an impairment of postural balance leading to disturbance of gait and falling. The features of Parkinson's disease are a loss of pigmented, dopaminergic neurons of the substantia nigra pars compacta and the appearance of intracellular inclusions known as Lewy bodies (Goodman and Gillman 's Tlie Pharmaceutical Basis of Tlierapeutics 506 (9* ed. 1996)). Without treatment, Parkinson's disease progresses to a rigid akinetic state in which patients are incapable of caring for themselves. Death frequently restUts from compiicalions of immobility, including aspiration pneumonia or pulmonary embolism. Drugs commonly used for the treatment of Parkinson's disease include carbidopa/levodopa, pergolide, bromocriptine, selegiline, amantadine, and trihexyphenidyl hydrochloride. There remains, however, a need for drugs useful for the treatment of Parkinson's disease and having an improved therapeutic profile. Anxiety is a fear, apprehension, or dread of impending danger often accompanied by restlessness, tension, tachycardia, and dyspnea. Other symptoms commonly associated with anxiety include depression, especially accompanied with dysthymic disorder (chronic "neurotic" depression); panic disorder; agoraphobia and other specific phobias; eating disorders; and many personality disorders. Often anxiety is unattached to a clearly identified treatable primary illness. If a primary ilbiess is found, however, it can be desirable to deal with the anxiety at the same time as the primary illness. Currently, benzodiazepines are the most commonly used anti-anxiety agents for generalized anxiety disorder. Benzodiazepines, however, carry the risk of producing impairment of cognition and skilled motor functions, particularly in the eldorly, which can result in confusion, deleriima, and falls with fractures. Sedatives are also commonly prescribed for treating anxiety. The azapirones, such as buspirone, are also used to treat moderate anxiety. The azapirones, however, are less usefiil for treating severe anxiety accompanied with panic attacks. Epilepsy is a disorder characterized by the tendency to have recurring seizures. The etiology commonly consists of lesions in some part of the cortex, such as a timior; ievelopmental malformation; or damage due to trauma or stroke. In some cases the etiology :s genetic. An epileptic seizure can be triggered by repetitive sounds, flashing lights, video games, or touching certain parts of the body. Epilepsy is typically treated with anti-seizure Irugs. In epilepsy cases, where anti-seizure drugs are ineffective, and the defect in the brain .s isolated to a small area of the brain, surgical removal of that part of the brain can be helpful in alleviating the seizures. In patients who have several sources for the seizures or who have seizures that spread quickly to all parts of the brain, surgical removal of the nerve fibers diat connect the two sides of the brain can be heipfiii. Examples of drugs for treating a seizure and epilepsy include carbamazepine, ethosuximide, gabapentin, lamotrignine, phenobarbital, phenytoin, primidone, valproic acid, trimethadione, bemzodiaepines, 7-vinyl GABA. acetazoiamide, and felbamate. Anti-seizure drugs, however, can have side effects such as drowsiness; hyperactivity; hallucinations; inability to concentrate; central and peripheral nervous system toxicity, such as nystagmus, ataxia, diplopia, and vertigo; gingival hyperplasia; gastrointestinal disturbances such as nausea, vomiting, epigastric pain, and anorexia; endocrine effects such as inhibidon of antidiuretic hormone, hyperglycemia, glycosuria, osteomalacia; and hypersensitivity such as scarlatinifonn rash, morbilliform rash, Stevens-Johnson syndrome, systemic lupus erythematosus, and hepatic necrosis; and hematological reactions such as red-cell aplasia, agranulocytosis, thrombocytopenia, aplastic anemia, and megaloblastic anemia. The Merck. Manual of Medical Information 345-350 (R. Berkow ed., 1997). A seizure is the result of abnormal electrical discharge in the brain. The discharge can involve a small area of the brain and lead to the person only noticing an odd taste or smell or it can involve a large area of the brain and lead to convulsions, i.e., a seizure ;hat causes jerking and spasms of the muscles throughout the body. Convulsions can also result in brief attacks of altered consciousness and loss of consciousness, muscle control, or jladder control. A seizures is often preceded by auras, i.e., unusual sensations of smell, taste, ■K vision or an intense feeling that a seizure is about to begin. A seizure typically lasts for ibout 2 to 5 minutes. When the seizure ends the person can have headache, sore muscles, musual sensations, confusion, and profound fatigue (postictal state). Usually the person :annot remember what happened during the seizure. A stroke or cerebrovascular accident, is the death of brain tissue (cerebral nfarction) resniting from the lack of blood flow and insufficient oxygen to the brain. A Iroke can be either ischemic or hemorrhagic. In an ischemic stroke, blood supply to the jrain is cut off because of atherscierosis or a blood clot that has blocked a biood vessel. In a lemoirhagic stroke, a blood vessel bursts preventing nomial blood flow and allowing blood o leak into an area of the brain and destroying it. Most strokes develop rapidly and cause brain damage within minutes. In some cases, however, strokes can continue to worsen for several hours or days. Symptoms of strokes vary depending on what part of the brain is effected. Symptoms include loss or abnormal sensations in an arm or leg or one side of the body, weakness or paralysis of an arm or leg or one side of the body, partial loss of vison or hearing, double vision, dizziness, slurred speech, difficulty in thinking of the appropriate word or saying it, inability to recognize parts of the body, unusual movements, loss of bladder control, imbalance, and falUng, and fainting. The symptoms can be permanem and can be associated with coma or stupor. Strokes can cause edema or swelling of the brain which can further damage brain tissue. For persons suffering fiom a stroke, intensive rehabilitation can help overcome the disability caused by impairment of brain tissue. Rehabilitation trains other parts of the brain to assume the tasks previously performed by the damaged part. Examples of dmgs for treating strokes include anticoagulants such as heparin, drugs that break up clots such as streptokinase or tissue plasminogen activator, and drugs that reduce swelling such as mannitol or corticosteroids. The Merck Manual of Medical Information 352-355 (R. Berkow ed., 1997). Pruritus is an unpleasant sensation that prompts scratching. Pruritus can be attributed to dry skin, scabies, dermatitis, herpetiformis, atopic denaaiitis, piitritus vulvae et ani, miliaria, insect bites, pediculosis, contact dermatitis, drug reactions, urticaria, urticarial ertiptions of pregnancy, psoriasis, hchen planus, Uchen simplex chronicus, exfoliative dermatitis, folliculitis, bullous pemphigoid, and fiberglass dermatitis. Conventionally, prurihjs is treated by phototherapy with ultraviolet B or PUVA or with th^apeutic agents such as naltrexone, nalmefene, danazol, tricychcs, and antidepressants. Selective antagonists of the metabotropic glutamate receptor 5 ("mGluRS") have been shown to exert analgesic activity in in vivo animal models (K. Walker et ai. Neuropharmacology 40:1 -9 (2000) and A. Dogrul et al., Neiiroscience Letters, 292(2): 115-118(2000)). Selective antagonists of the mGluR5 receptor have also been shown to exert anxiolytic and anti-depressant activity in in vivo animal models (E. Tatarczynska et al, Br. J. Pharmacol I32(7):1423-1430 (2001) and P.J.M. Will etal, Trends in Pharmacological 5c(e;jce5 22(7);331-37 (2001)). Selective antagonists of the mGluR5 receptor have also been shown to exert ann-Parkinson activity in vivo (K. J. Ossowska et a!., Neurophaimacology 41_(4):413-20 (2001) and PJ.M. Will et ai. Trends in Pharmacological Sciences 22(7):331-37 (2001)}. Selective antagonists of the mGliiRi receptor have also been shown to exert anti-dependence activity in vivo (C. Chiamulera et ai. Nature Neiiroscience 4{9):S73-74 (2001)). International publication no. WO 02/16318 discloses a class of "N-cyanounines allegedly usefiil for treating a acute pain, urinary bladder hypersensitiveness, an ulcer, IBD, and IBS. There remains, however, a clear need in the art for new drugs usefiil for treating or preventing pain, UI, an ulcer, BD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain fimcrion, Htmtington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression. Citation of any reference in Section 2 of this application is not to be construed as an admission that such reference is prior an to the present application -CH^Oialo); each R- is independently: (a) -halo, -CN, -OH, -NO;, or -NH,; (b) -{C,-C,o)aBcyl, -(C,-C,o)alkenyI, -(C,-C,o)alkynyl, -(Cj-C,o)cycloalkyl, -(Cg-C\|4)bicycloaDcyl, -(Cs-C,j)tricycloalkyl, -(C;-C,(,)cycloaikenyl,-(C5-C\|d)bicycloalkenyL -(Cs-C,4)tiicycIoaikenyl, -(Cj-C7)heterocycle, or -(C7-C,o)bicycloheterocycle, each of which is imsubstituted or substituted with one or more R^ groups; or (c) -phenyl, -naphthyl, -(C,i)aryl, or -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one ormore R' groups; each R^ is independently: (a) -halo, -CN, -OH, -NO^, or -NH,; or (b) -(Ci-Cio)allcyl, -(C,-C,o)alkenyl, -(C,-C,o)alkynyI, -(C3-Cio)cycloalkyl, -(Cs-C\|4)b!cycloalkyl, -{Cs-C,j)tricycloalk>'!, -(C5-Cio)cycloalkenyl,-(Cg-Ci4)bicycloa!kenyi,-(Cs-Ci4)tricycloaIkenyi,-(C3-C7)heterocycIe, or -(C7-Ci[i)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups; or (c) -phenyl, -n^hthyl, -(C,4)aryl or -{C5-C,o)heteroaiyl, each of which is unsubstituted or substituted with one or more R^ groups; R-" is -(CrC^aikyl, or -0-(C,-Cs)aIkyI; each R^ is independenUy -CN, -OH, -(C,-C6)alkyU -{C,-C6)alkenyl, -{C2-C5)alkenyl, -halo, -N3, -NO^, -NCR^);, -CH=NR, -NROH, -OR, -COR- -CCOPR, -OC(0)R^ -0C{O)0R. -SRS -S(0)R, or-S(0)3R^ R^ is -phenyl, -n^hthyl, -(C3-C8)cycloalliyl,-(C,4)aryl, or -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; each R^ is mdepeadently -(C,-C6)alkyl, -(C2-C6)alkenyl, -(Cj-Cgjalkynyl, -(Cj-Cg)cycloa!kyl, -(C5-CB)cycloalkenyI, -phenyl, -(C3-C5)heterocycle, -C0ialo)3, -CH:(halo), -CH(halo),, -CN, -OH, -halo, -Nj, -NO,, -N(R^),, -CH=NR, -NR^OH, -OR, -COR', -C(0)OR, -OC(0)R, -OC(0)OR^ -SR^ -S(0)R, or -S(0),R^ each R^ is independently -H, -(C\|-C6)alkyl, -{C2-C^)z]ksny\, -(C,-Ci)alkynyl, -(C3-Cg)cycloalkyt, -(C5-Cg)cycloalkenyl, -phenyl, -(C3-C5)heterocycle, -C(halo)3, -CH2(haIo),or-CH(halo),; each halo is independently -F, -CI, -Br or -I; n is an integer ranging from 0 to 3; and m is an integer ranging from 0 to 2. (c) -phenyl, -naphtbyi, -{C,^)aryl, or -{Cs-C,o)heteroaiyl, each of which is unsubstituted or substituted with one or more R' groups; each R^ is independently: (a) -halo, -CN, -OH, -NO,, or -NH,; or (b) -(CrCm)aDcyl, ^(C;-C,o)alkenyl, -(C,-C,o)a5kynyl, -(C3- C,o)cycloalkyl, -(Cg-C,4)bicycloalkyl, -(C3-Ci4)tricycloalkyi, -(Q- C\|(,)cycIoa!i-eny!,-(Cg-Ci4)bicycloalkeny!,-(Cs-Ci4)tncycIoaIkenyl,-(C3- C-T)heterocycle, or -(C7-C\|o)bicycloheterocycle, each of which is imsubstituted or substituted with one or more R^ groups; or (c) -phenyl, -naphthyi, -(Ci4)aryl or -{C5-Cjo)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; each R= is independently -CN, -OH, -(C-C5)aa-yl, -(C2-C6)alkenyl, -(C:-Cs)alkeny], -halo, -Nj, -NO,, -N(R^),, -CH=NR^ -Ml^OH, -OR^ -COR^- -C(0)OR^ -OC(0)R^ -0C(0)0R^ -SR^ -S{0)R^ or -S(0),R^ R^ is: (a) -naphthyi, -(C,4)ar>'l, or -(C3-C8)cycloaUcyi each of which is unsubstituted or substituted with one or more R' groups; or (b) pyridyl, fiiryl, benzofuranyl, thiophenyl, benzothiophenyl, quinoiinyi, indoiyi, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyiidazioyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, ciimolinyl, phthalazinyl, or quinazolinyl, each of which is substituted with one or moie R^ groups; each R^ is independently -{C\|-Cs)alkyl, -(C2-C6)alkenyl, -(C.-C6)alkynyl, -{Cj-Cgjcycloalkyl, -(C5-Cg)cycloalkenyl, -phenyl, -(C3-C5)heterocycle, -Cthalo),, -CH;(halo), -CH(halo)2, -CN, -OH, -halo, -N3, -NO,, -N(R)2, -CH=NR^ -NR^OH, -0R^ -COR^ -C(0)OR^ -OC(0)R^ -OC(0)OR\ -SR^ -S(0)RS or -S(0)2R^ each R" is independently -H. -(C,-C6)alkyl, -(C;-C6)alkenyl, -{C,-C6)alkynyl,, -(C3-C8)cycloalky], -(Cs-COcycloalkenyl, -phenyl, -(C3-C5)heterocycle, -Cflialo),, -CH,(halo), or -CHChalo);; each halo is independently -F, -CI, -Br or -1; n is an integer ranging from 0 to 3; and m is an integer ranging from 0 to 2. The present invention encompasses compounds having the formula (lb): and phaimaceutically acceptable salts thereof, wherein: A is -NR"-, -0-, or -S-; each R^ is independently: (a) -halo, -CN, -OH, -NO., or -NH,; or (b) -(CrC,o)alkyl, -(CrC,o)alken>-I, -(C,-C,o)a!kynyl, -(C3-C,o)cyc!oalkyl, -{Cs-Ci,)faicycloalkyl, -(Cs-C,4)tricyc]oalkyl, -(C5-Cio)cycIoaIkenyl,-(Cs-C,4)bicycloalkenyl,-(Cj-C,4)tricycloaIkenyI,-(C3-C7)heterocycIe, or -(CTC\|o)bicycloheterocycle, each of which is unsubstituted or substituted widi one or more R^ groups; or (c) -phenyl, -naphdiyl -(C\|4)aryi or -(C5-Cio)heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups; R-" is -(C,-C6)alkyl, or-0-(C,-C6)alkyl; each R' is independently -ON, -OH, -(C,-Cs)alkyl, -(a-C^jalkenyL -(C,-C6)aUceuyl, -halo, -N3, -NO,, -N(R^),, -CH=NR^ -NR^OH, -0R^ -COR^- -C(0)OR^ ^0C(0)R^ -0C(O)OR^ -SRl -S(0)R', or -S(0)3R^ R^ is -phenyl, -naphthyl, -(C3-Cs)cycloalkyl,-(Ci4)aiyl, or -(C5-Cio)heteroar>'i, each of which is unsubstituted or substituted with one or more R^ groups; each R' is independently -(Ci-C6)alkyl -(C2-Cs)alkenyl, -(C,-C6)alk>'nyl, -(C3-C8)cycloallcyI, -{C5-Cs)cycloalkenyl, -phenyl, -(C3-C5)heterocycle, -C(halo)3, -CHChalo)^, -CH2(halo), -CN, -OH, -halo, -N3, -NO,, -N(K\ -CH=NR^ -NR^OH, -OR^ -COR^ -C(0)OR^ -0C(O)R^ -OC(0)0R^ -SR^ -S(0)R^ or -S(0)3R^ each R' is independently -H, -(C\|-C6)alkyl, -{C^-C^jalkenyl, -{C,-C(i)alkyny], -(C3-Cs)cycloaIkyl, -(C5-CE)cycloalkenyl, -phenyl, -(C3-C5)heterocycle, -C(haIo)3, -CH2(halo), or -CHOalo);; R" is -hydrogen, -halo, -CH3, -NO,, -CN, -OH, -OCH3, -NHj, -C(halo)3, -CH(halo)., or -CH;(haIo); each R" is independently: (a) -halo, -CN, -OH, -NOj, or -NH^; (b) -(C,-C,o)aUcyI, -(C3-Cio)alkeny!, -(Ci-C,o)aHcynyI, -(C3-Cio)cycloall£yl, -(Ca-Ci4)bicycloaIkyl, -(C8-Ci4)tricycloalkyI, -{C5-C,o)cycloalkenyl,-{Cg-C,4)bicycloalkenyl,-(C8-C\|4)tricycIoalkenyl, -(Cj-C7)heterocycle, or -(C7-Cio)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R' groups; or (c) -phenyl, -naphthyl, -(Cijjaryl, or -{C;-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; m is an integer ranging from. 0 to 2; and q is an integer ranging from 0 to 3. The present invention also encompasses compounds having the formula (11): and phamiaceutically acceptable salts thereof, wherein; A is -NR--, -0-, or -S-; R' is -halo, -CH3, -NOj, -CN, -OH, -OCH3, -NH,, -C(halo)3, -CH(haio)2, or -CHj(halo); each R^ is independently: (a) -halo, -CN, -OH, -NO,, or -NH,; (b) -(C,-C,o)alkyI, -(C3-C,o)aIkenyl, -(Q-Cio)aikynyl, -(Cj-C,o)cycloalkyl, -(Cs-CiJbicycloalkyl, -(Cg-C,4)tricycloalkyl, -(C5-C,o)cycloaJkenyI,-(C8-C,4)bicycloaIkenyl,-(Cs-C,4)tricycloalkenyI,-(Cj-C7)heterocycle, or -(C-7-C,o)bicycloheterocycle, each of which is imsubstituted or substituted with one or more R' groups; or (c) -phenyl, -naphthyl, -(Ci4)aryl, or -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; each R^ is independently: (a) -halo, -CN, -OH, -NO,, or -NH^; (b) -(C,-C,o)alkyl, -(C2-C,o)alkeny!, -(Q-Cio)alkynyl, -(C3-Coycycioalkyl, -(C3-C\|4)bicycloalkyl, -(Cs-C,4)tricycloalkyi, -(C,-C\|,,)cycloalkenyl,-(C5-C,4)bicycloalkenyl -(Cj-C\|4)tricycloaIkenyl,-(C3- and pharmaceutically acceptable salts thereof, wherein: C,)heterocycle, or -(C7-C,o)bicycloheterocycle, each of which is imsubstituted or substituted with one or more R5 groups; cr (c) -phenyl, -naphthyl, -(CiJaryl. or -(C5-C]o)heteroaryl, each of which is unsufastituted or substituted with one or more R^ groups; and each halo is independently -F, -CI, -Br or -I: q is an integer ranging from 0 to 2; and m is an integer ranging from 0 to 2. The present invention also encompasses compounds having the formula (lH): CHjChalo); each R^ is independently: (a) -halo, -CN, -OH. -NO,, or -NH,; (b) -(C,-C,o)aIkyl, -(C-C,(,)alkenyi. -(C2-C,o)alkynyl, -(Cj- Cio)cycloalkyl, -(Cg-C,4)bicycloalkyi, -(CB-C,Jtricycloalkyl, -(C,- C,o)cycloalicenyl,-(C8-C,4)bicycloalkenyl,-(Cs-C,4)ticycloaIkenyl,-(C5- C7)heterocycle, or -(C,-C,(,)bicycloheterocycle, each of which is unsubslituted or substituted with one or more R^ groups; or (c) -phenyl, -naphthyl, -(C\|4)aiyl, or -{C;-C\|o)heteroaTyl, each of which is unsuhstituted or substituted with one or more R' groups; each R-' is independently: (a) -halo, -CN, -OH, -NO;, or -NH,; (b) -(C,-C,o)alkyI, -(C,-C,o)alkenyl, -(C^-C,o)alkynyl, -(C3-C,o)cycloaIIcyl, -(Cg-Ci4)bicycioaikyI, -(Cg-C\|JtricycloaUcyl, -(C5-Cio)cycloalkenyl,-(Cs-C,4)bicycloalkenyl,-(Cs-C,4)tricycloalkenyi,-(C3-C7)heterocycle, or -(C--C]o)bicycloheterocycle, each of which is unsubstituled or substituted with one or more R^ groups; or (c) -phenyl, -aaphthyl, -(C5^)aryl or -(C5-Ci(,)heteroaiyl, each of. which is unsubstituted or substituted with one or more R' groups; R" is -(C-CJalkyl, or '0-(C,-Cs)alkyl; each R^ is independently -CN, -OH, -(Ci-C6)a!kyl, -(C2-C6)aU;enyl, -C:-Cs)aikenyl, -halo, -Nj, -NO., -N(R^)„ -CH=N■R^ -NR'OH, -OR^ -COR^' -CCO)OR^ OC(0)R\ -OC(0)OR^ -SR\ 'S(0)R\ or -S(0),R; R* is -phenyl, -naphthyl, -(C3-Cs)cycIoalkyl,-(C,4)aryi, or -(C5-C,o)het6roaryl, lachof which is unsubstituted or substituted with one or more Regroups; each R^ is independently -(Ci-C6)aikyl, -(C2-C6)alkenyl, -(C2-C6)alkynyl, (C3-Cg)cycioalkyl, -(C5-Cg)cycloalkenyI, -phenyl, -(C3-C5)heterocycle, -Cthalo),, CH(halo)., -CHi(halo), -CN, -OH, -halo, -Nj, -NO^, -NCR^),, -CH=NRS -NR^OH, -0R^ COR\ -C(0)OR^ -OC(0)R^ -0C(0)0R^ -SR^ -S(0)R, or -S(0),R; each R^ is independently -H, -(C^-C^aikyl, -(C3-C6)alkenyi, -(C2-C6)alkynyl, [Cj-Cg)cycloalkyI, -(C3-C3)cycIoalkenyl, -phenyl, -(C3-C5)heterocycle, -C(halo)3, CH,(haIo), or -CH(haIo>,; each halo is independently -F, -CI, -Br or -I; n is an integer ranging from 0 to 2; and m is an integer ranging from 0 to 2. The present invention encompasses compounds having the formula (Ula): each R^ is independently -CN, -OH, -(Ci-C6)ailcyl, -(C,-C6)alkenyl, -(C--C6)alkenyl, -halo, -N3, -NO,, -'^{^\ -CH=NR^ -NR^OH, -0R^ -COR' -C(0)OR\ -OC(0)R^ -OC(:0)OR^ -SR^ -S(0)R^ or -S(0),R^ RMs; (a), -naphthyl, -(C,^)aryl, or -(C5-Cs)cycloalkyl each of which is unsubstiruted or substihited with one or more R' groups; or (b) pyridyl, fUryi, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, indolyl, oxazolyl, beozoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyi, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl, or quinazolinyl, each of which is substituted with one or more R' groups; each R' is independently -{C,-Cs)alkyl, -(,C2-Ca)alkenyl, -(C2-C5)alkynyl, -(C3-Cs)cycloalkyi, -(C5-Cg)cycIoalkenyl, -phenyl, -{C3-C;)heterocycle, -C(halo)3, -CH(halo),, -CH,{halo), -CN, -OH, -halo, -N3, -NO,, -NCR')., -CH=NR, -NR^OH, -0R^ -COR^ -C(0)OR^ -OC(0)R^ -OC(0)OR\ -SR«, -S{0)R\ or -S{0),R^ each R^ is independently -H, -(C,-C6)alfcyl, -(C2-Cfi)alkeny], -(C3-C^)alkynyl, -{C3-CB)cycloalkyl, -(C5-CE)cycloalkenyl, -phenyl, -{C3-C5)heterocycle, -C(halo)3, -CH;(halo), or -CHChalo);-, each halo is mdependently -F, -CI, -Br or -I; n is an integer ranging from 0 to 2; and m is an integer ranging from 0 to 2. The present invention encompasses compounds having the formula (IHb): and pharmaceutically acceptable salts thereof, wherein; R' is -halo, -CH3, -NO,, -CN, -OH, -OCH3, -NH,, -CChalo)3, -CH(halo);, or -CH2(halo); (b) -(C,-C,o)aIkyl, -(C,-C,o)alkenyl, -(CrC,„)alkynyl, -(C3-C\|o)cycloalkyl, -(Cs-C,4)bicycloaikyl, -(Cs-C,4)tricycloalkyl, -(C5-C,o)cycloaIkenyL-(C5-C,4)bicycloalkenyl, -(CrCiJtricycloalkenyl, -(Cj-C7)heterocycle, or -(C,-C,o)bicycloheterocycle, each of which is unsubstitured or substituted with one or more R^ groups; or (c) -phenyl, -naphthyl, -(C,j)aryl or -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups; R-* is -(C,-C6)alkyl, or -0-{C;-Cs)alkyl; each R^ is independently -CN, -OH, -(C,-Cs)alkyl, -(C2-C6)alkenyl, -(C,-C,)alkenyl, -halo, -N3, -NO,, -N(R^),, -CH=NR^ -NR^OH, -0R^ -COR^- -C(0)OR^ -OC(0)R^ -OC{0)OR^ -SR^ -S(0)R^ or -S{0),R^ R* is -phenyl, -naphthyl, -(C3-Cs)cycloaIkyI,-(Ci4)aiyl, or -(C^-C io)heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups; each R" is independently -(Ci-C6)alkyl, -(C:-C6)aikenyi, -OR^ -OC(0)R', -OC(0)OR\ -SR^ -S{0)R^ or -S(0),R; each R^ is independently -H, -(C, -C6)alkyl, -(C^-Csjalkenyl, -(C,-C6)a!kynyl, -(C3-Cs)cycloalkyl, R'^ is -hydrogen, -halo, -CH3, -NG^, -CN, -OH, -OCH3, -NHj, -C{halo)3, -CH(halo),, or -CH,(halo); each R'^ is independently: (a) -halo, -CN, -OH. -NO,, or -NH,; (b) -(C,-C,o)alkyl, -(C3-C,c)a]kenyl, -(C,-C,o)alkynyl, -(C3-C,o)cycloalkyl, -(Cg-CiJbicycloalkyl, -(Cs-CiJtricycloaikyl, -(C5-C,o)cyc!oalkenyl,-(Cg-C,4)bicycIoalkenyl,-{Ca-C,4)hicycIoalkenyl,-(Cj-CT)heterocycle, or -(C7-C,o)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R- groups; or (c) -phenyl, -naphthyl, -(C.jjaryl, or -{C5-C,o)heteroaryl, each of which is unsubstituted or substimted with one or more R' groups; and pharmaceutically acceptable salts thereof, wherein: A is -NR"-, -0-, or -S-; each R^ is independently: (a) -halo, -CN, -OH, -NO., or -NH,; (b) -(C,-C,o)alkyl, -(C-C,o)allcenyi, -{a-C,o)alkynyl, -(C3-C,o)cycioalkyl, -(C3-Cj^)bicycloaIkyI, -{Cg-CiJtricycloalkyI, -(C5-C,(,)cycloalkenyl,-(C3-C,4)bicycloalkenyl, -(Cs-C\|4)tricycloalkenyl, -(C3-C7)heterocycle, or -(C7-C,o)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups; or (c) -phenyl, -naphthyl, -(C\|4)aryl or -(Cj-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; R^ is hydrogen, -(C,-C6)alkyl, or -©-(C.-CJalkyl; each R^ is independently -CN, -OH, -(C,-C6>alkyl, -(Cj-C5)alkenyl, -:3-C6)alkenyl, -halo, -N3, -NOj, -U(R% -CH=NR^ -NR'OH, -ORl -COR'- -C(O)0R^ )C(0)R^ -OC(0)OR^ -SR^ -S(0)R^ or -S(0)2R^ R^ is -phenyl, -naphthyl, -(C3-Cs)cycloancyI,-(C,4)aryl, or -(Cj-Cj(j)heteroaryl, ,ch of which is unsubstituted or substituted with one or more R' groups; each R' is independently -(C,-C6)alkyl, -(C2-C6)alkenyl, -(C2-C6)alkynyl, "3-Cs)cycloaUcyI, -{C5-Cs)cycloalkenyl, -phenyl, -(C3-^5)heterocycle, -C(halo)3, :H(halo)2, -CH^Oialo), -CN, -OH, -halo, -Nj, -NO^, -NCR);, -CH-NR^ -NR^OH, -0R^ :0R^ -C(0)OR^ -OC(0)R^ -0C(0)0RS SR\ -S(0)RS or -SiO)^^^ each R* is independently -H, -(Cj-Cjjalkyl, -(C2-C5)alkenyL -(C2-C6)alkynyl, -3-C8)cycloaIlcyl, -(Cs-Cs)cycioal]cenyl, -phenyl, -(C3-C3)heterocycle, -C(halo)3, ;H,(halo), or -CHChalo)^; R" is -hydrogen, -halo, -CH3, -NO,, -CN, -OH, -OCH3, -NH,, -C(haIo)j, -^(lialo);, or -CH2(halo); each R' is independently: (a) -halo, -CN, -OH, -NO,, or -NH^; (b) -(Ci-C,o)aU;yI, -(Q-C,o)alkenyl, -{C,-C,o)alkynyl, -(C3-C,o)cycJoalk:yl, -(Cs-C,.)bicycloalkyl, --(Cs-C,4)tricycloalkyI, -{C5-CiQ)cycloa!kenyl,-(Cs-C^.)bicycloalkenyl, -(Cg-Ci4)tricycloalkenyl, -(Cj- C7)heterocycle, or-(C7-C\|i])bicycloheterocycle, each of which is xmsubstituted or substituted ■with one or more R^ groups; or (c) -phenyl, -naphthyi, -(C\|^)aryl. or -{C;-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; each halo is independently -F, -CI, -Br or -I; q is an integer ranging from 0 to 2; and in is an integer ranging from 0 to 2. :K(halo)j,or-CH3(halo); each R^ is independently: (a) -halo,-CN,-OH,-NOj,or-NH,; (b) -(C,-C,o)alkyl, -(Cj-C„)a]kenyl, -(Ci-C,o)alkynyI, -(C3-C\|o)cycloalkyl, -(C3-C,4)bicycloaIkyl, -(C3-C,4)tricycloalkyU -(C,-Cio)cycloalkenyl,-(Cs-C,4)bicycIoalkenyl,-(C3-Ci4)tricycloalkenyl,-(C3-C7)heterocycle, or -(C7-Cio)bicycloheterocycle, each of which is unsubstituied or substituted with one or more R^ groups; or (c) -phenyl, -naphthyi, -(C,4)aiyl or -{C5-C]o)heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups; R^ is hydrogen, -(C,-C5)alkyl, or -O-CCj-CJalkyl; R' is -H, -halo, -CH3, -NO2, -CN, -OH, -OCH3, -NH,, C(halo)3, -CHChalo)^, or -CH,(iiaio)-, each R^ is independently: (a) -halo, -CN, -OH, -NO,, or -NH,; (b) -CCrC,o)aUcyl, -(Cj-C,o)aIkenyl, -(C,-C,,)allcynyl, -(Cj-C,o)cycloalkyl, -(Cs-C,4)bicycIoalkyl, -(Cg-CiJtricycioalky], -(C5-C,o)cycloalkenyl, -(Cj-C\|4)bicycioalkenyl, -(Cg-C,4)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -{7-to 10-membered)bicycioheterocycle, each of which is imsubstituted or substituted with one or more R^ groups; or (c) -phenyl, -naphthyl, -(C\|4)aryl or -(5- to 10'membered)heteroaryl, each of which is unsubstitute or substituted with one or more R^ groups; each R' is independently: (a) -halo, -CN, -OH, -NO,, or -NH,; 0) -{C,-C,o)alkyl, -(CrC,o)alkenyl, -(C;-C,o)alkynyl, -(C3-C,i,)cycloalkyl, -(Cg-C,4)bicycloalkyl, -(C3-C,4)tricycloallcyl, -(C;-Cio)cycloalkenyl, -(Cg-Ci4)bicycloalkenyl, -(Cg-Ci^itricycloalkenyl, -{3- to 7-membered)heterocycle, or -(7-to 10-membered)bicycIoheterocycle, each of which is unsubstituted or substituted with one or more R? groups; or (c) -phenyl, -naphthyl, -(C,4)aryl or -(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R* groups; each R^ is independently -(C,-C6)alkyl, -{C2-C6)alkenyl, -(C^-C^alkynyl, -(C3-C3)cycloaIkyl, -(C5-Cj)cycloaIkenyl, -phenyl, -(3- to 5-meinbered)heterocycle, -:(halo)3, -CH(haIo)2, or CH,(halo); each R' is independently -CN, -OH, -(Ci-C6)aikyl, -(C3-C6)alkenyl, -:C,-C5)alkenyI, -halo, -N3, -NOj, -NCR^);, -CH=NR, -NR^OH, -0R^ -COR^- -C(0)OR^ ■OC(0)R^ -OC(0)OR^ -SR^ -S(0)R^ or -S(0)2R; each R^ is independently -(C,-C6)alkyl, -(C2-Cs)alkenyl, -{Cj-CJalkynyl, ■(C,-C3)cycloalkyl, -(C5-C3)cycloallcenyl, -phenyl, -(3- to 5-membered)heterocycie, ■C(halo)3. -CH(halo)„ -CH,(haIo), -CN, -OH, -halo. -N3, -NO,, -CH-NR,, -NR,OH, -OR,, ■COR7, -CCO)OR„ -OC{0)R„ -OC(0)OR„ -SR„ -S(0)R„ or-S(0)2R,; each R^ is independently -H, -{C\|-C6)alkyl, -(C;-C6)alkenyl, -(C2-C6)alkynyi, -iC3-C3)cycloaIkyl, -{C5-Cj)cycIoalkenyl, -phenyl, -(3- to 5-membered)heterocycle, -C(halo)3, -CH(halo)j, or CH^Chalo); each R^ is independently -(C,-C6)alkyl, -(C,-Cs)alkenyl, -{C,-C6)alkyuyl, -(Q-Cg)cycloalky!, -(C5-CB)cycloalkenyl, -phenyl, -C(haIo)3, -CH(halo)„ -CH,(halo), -CN, -OH, -halo, -N3, -NO,, -CH=NR„ -NR7OH, -OR,, -COR7, -C(0)OR7, -00(0)^-,, -OC(0)OR„ -SR„ -S{0)R7, or -S{0)3R,; each R" is independently -CN, -OH, -(C,-C6)alkyl, -(C;-Q}al]fenyl, -halo, -N3, -NO,, -N(Rj\, -CH=NR^, -NR,OH, -OR,, -COR,, -C(0)OR„ -0C{O)R7, -OC(0)OR,, -SR,, -S(0)R„ or -S(0),R,; each halo is independently -F, -CI, -Br, or -I; mis 0 or 1; n is an integer ranging from 0 to 3; o is an integer ranging from 0 to 4; p is an integer ranging from 0 to 2; q is an integer ranging from 0 to 6; r is an integer ranging from 0 to 5; s is an integer ranging from 0 to 4; and t is an integer ranging from 0 to 2. The present invention encompasses compounds having the fonnula (VH): C,a)bicycloaUcenyl, -(Cj-C, Jtricycloaikenyl, -(3- to 7-merabered)helerocycle, or -(7-to 10-inembered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups; or (c) -phenyl, -naphthyl, -(CiJaryl or -(5- to 10-membered)heteroaiyl, each of which is unsubstitute or substituted with one or more R^ groups; each R^ is independently: (a) -halo, -CN, -OH. -NO,, or -NH,; (b) -(CrC,o)alkyI, -(C2-C,o)alkenyl, -(C,-C,o)aIkynyI, -(Cj-C,o)cycloalkyl, -(Cj'C, Jbicycloalkyl, -{C3-C,4)tricycloaIkyl, -(C5-C\|o)cycloalkenyl, -(Cs-C\|4)bicycloalkenyl, -(C5-Ci4)tricycloalkenyl, -{3- to 7-membered)heterocycle, or -(1-to 10-membered)bicyc]oheterocycle, each of which is unsubstituted or substituted with one or more R^ groups; or (c) -phenyl, -naphthyl, -(C,4)aryl or-(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R" groups; eachR" is independently -(Cj-CsJalkyl, -(C;-C6)alkenyl, -(C2-C6)alkynyl, -(C3-Cg)cycloalkyl, -(C5-Cg)cycIoalkenyl, -phenyl, -(3- to 5-membered)heterocycle, -C(halo)3, -CH(halo),, or CH2{balo); each R^ is independently -CN, -OH, -(Cj-C^lalkyl, -(C2-C6)alkenyl, -(C,-Cs)alkenyl, -halo, -N3, -NO,, -N(R^)j, -CH=NR^ -NR^OH, -OR, -COR^- -C(0)OR\ -OC(0)R\ -OC(0)OR^ -SR^ -S(0)R^ or-S(0)jR; each R* is independently -(C,-C6)alkyl, -(C2-C6)alkenyl, -(C2-C6)alfcynyl, -(C3-Cg)cycloalkyl, -(C5-CE)cycIoalkenyl, -phenyl, -(3- to 5-membered)heterocycle, -CChalo)j, -CH(halo)2, -CH^Chalo), -CN, -OH, -halo, -N3, -NO,, -CH=NR7, -NR,0H, -OR,, -COR,, -C(0)0R7, -OC(0)R„ -0C(O)OR7, -SR„ -S(0)R„ or -S(0)2R7; each R' is mdependently -H, -(Ci-C6)alkyl, -(C,-C6)alkenyl, -(C2~C6)alkynyl, -(Cj-Cs)cycloallcyl, -(C5-C8)cycloalkenyl, -phenyl, -(3- to 5-inembered)heterocycle, -C(halo)3, -CH(halo);, or CHjOialo); each R' is independently -(C,-C6)a!kyl, -(C2-C6)alkenyl, -(C2-C6)alkynyl, -{C3-Cs)cycloalkyl, -{C5-Cs)cycloalkenyl, -phenyl, -C(haIo)3, -CH(halo)„ -CHjChalo), -CN, -OH, -halo, -N3, -NO,, -CH=NK„ -NR,OH, -OR,, -COR,, -C(0)0R7, -0C(O)R„ -0C(0)OR„ -SR„ -S(0)R„ or -S(0),R,; each R" is independently -CN, -OH, -(C\|-Q)aOcyl, -{C2-Q)aikenyl, -halo, -X,, -NO2, -N(R,)3, -CH=NE.„ -NR7OH. -OR,, -COR,, -C(0)OR,, -OC(0)R„ -OC(0)OR7, -SR„-S(0)R„or-S(0),R,; each haio is independently -F, -CI, -Br, or -I; m is 0 or 1; n is an integer ranging fi"om 0 to 3; o is an integer ranging from 0 to 4; p is an integer ranging from 0 to 2; q is an integer ranging from 0 to 6; r is an integer ranging from 0 to 5; s is an integer ranging from 0 to 4; and t is an integer ranging from 0 to 2. A compound of formula (I), (la), (lb), (Ic), (U), (Ha), (HI), (Ilia), (mb), (tQc), {TV), (IVa), (V), (VT), or (VII), or a pharmaceutically acceptable salt thereof (a "Cyanoiminopiperazine Compound") is useful for freating or preventing pain, UI, an ulcer, EBD, IBS, an addictive disorder, Parkinson's disease, parldiisomsm, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, TOmiting, dyskinesia, or depression (each being a "Condition") in an animal. The invention also relates to compositions comprising an effective amount of a Cyanoiminopiperazine Compound and a pharmaceutically acceptable carrier or excipienl. The compositions are useful for treating or preventing a Condition in an am'mal. The invention further relates to methods for treating a Condition, comprising idministering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound. The invention hrrther relates to methods for preventing a Condition, :omprising administering to an animal in need thereof an effective amount of a ^Cyanoiminopiperazine Compound. The invention still further relates to methods for inhibiting Vanilloid Receptor 1 ('■VRI") function in a cell, comprising contacting a cell capable of expressing VRI with an effective amount of a Cyanoiminopiperazine Compound. The invention stiU fuittier relates to methods for inhibiting mGltiRS fimction m a cell, comprising contacting a cell capable of expressing mGluRS with an effective amount of a Cyanoiminopiperazine Compound. The invention still further relates to methods for inhibiting melabotropic giutamate receptor 1 ("mGIuRl") function in a cell, comprising contacting a cell capable of expressing mGluRl with an effective amotmt of a Cyanoiminopiperazine Compound. The invention still further relates to a method for preparing a composition, comprising the step of admixing a Cyanoiminopiperazine Compound and a pharmaceutically acceptable carrier or excipient. The invention still fiirther relates to a kit comprisiEg a container containmg an effective amount of a Cyanoiminopiperazine Compound. The present invention may be understood more fiilly by reference to the following detailed description and illustrative examples, which are intended to exemphfy non-limiting embodiments of the invention. ibove for the Cyanoiminopiperazine Compounds of formula (I). In one embodiment n is 0. In another embodiment, n is 1. In another embodiment, n is 2. hi another embodiment, n is 3. in another embodiment, m is 0. In another embodiment, m is 1. In another embodiment, m is 2. In another embodiment, A is -N((C,-Q)alk>-l)-. In another embodiment, A is -N(0(C,-Cs)aIkyl)-. In another embodiment, A is -0-. In another embodiment, A is -S-. In another embodiment, R' is halo. In another embodiment, R' is -CI. In another embodiment, R' is -Br. In another embodiment, R' is -I. In another embodiment, R' is -F. In another embodiment, R' is -CH,. ■3-2 - In another embodiment, n is 1 and R is -halo, -CN, -OH, -NOj, or -NHj-In another embodiment, n is 1 and R^ is -(C,-C,o)aikyl, -(C2-C,o)alkenyl, -(C2-C\|o)alkynyl, -(C3-C,o)cycloalkyl, -(Cg-C,4)bicycloaikyi, -(C3-C,4)tricycloalkyl, -(C5-C[o)cycloalkenyU-(Cs-C,4)bicycloalkenyl, -(Cs-C,4)tricycloalkenyl, -(C3-C7)heterocycle, or -(C,-Cio)b:cycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups. In another embodiment, n is 1 and R^ is -phenyl, -naphthyl, -(C,4)aryl, or -(C3-Cio)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; In another embodiment, m is 1 and R' is -halo, -CN, -OH, -NO,, or -NHi-In another embodiment, m is 1 and R^ is -(C,-C,o)aIlcyl, -{C,-Cio)alkenyl, -(Cj-C,o)alkynyL -(C3-Cio)cycloalkyl, -(C8-C,4)bicycloalkyl, -(Ca-Ci4)tricycloalkyl, -(Cj-C\|o)cycloaIkenyl,-(Cg-Cj4)bicycloa]kenyl, -(Cs-C[4)tricycloalkenyl, -(C3-C-j)heterocycle, or-(C7-Cio)bicycloheterocycie, each of which is unsubstituted or substituted with one or more R^ groups. In another embodiment, m is 1 and R^ is -phenyl, -naphthyl, -(C\|4)aryl or -{C5-C\|o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, R^ is -phenyl, -naphthyl, -(C-;-Q)cycloaDcyl,-(C, Jaryl, or -(C5-Cio)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, R is -phenyl. ' In another embodiment, m is 1 and R' is -CH^. In another embodiment, m is 1, R-' is -CH,, and the carbon atom to which the -R^ is attached is in the (R)-configuration. In another embodiment, m is 1, R^ is -CHj, and the carbon atom to which the -R"* is attached is in the (S)-coniiguration. In one embodiment, a and m are 0 and R* is -phenyl. In another embodiment, n is 0, m is 1, R^ is methyl, and R* is phenyl. In another embodiment, the -phenyl is substimted with a -(Ci-Cg) alkyl group. In another embodiment, the -(CfCg) alky! group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Ci-Cj) alkyl group is a (-butyl group substituted at 4-position of the -phenyl. In another embodiment, the -(C,-Cg) alkyl group is an ijo-propyl group substituted at the 4-position of the -phenyl. In another embodiment, R' is -CF3 or -CHF,. In another embodiment, n and m are 0 and R* is -phenyl substituted at its 4-position with a -CF3 group. In another embodiment, n and m are 0, R' is -halo or methyl; and R* is -phenyl. In one embodiment, -halo is -CI. In another embodiment, the -phenyl is substituted with a -(Cj-Cg) alkyl group. In another embodiment, the -(Cj-Cj) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Cj-Cs) alkyl group is a /-butyl group or an wo-propyl group substituted at the 4-position of the -phenyl. In another embodiment, n and m are 0, R' is -halo or methyl; and R* is -phenyl substituted with-CF3. In another embodiment,-halo is-CI. Li another embodiment, the-CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is -CI and the -CF3 is substituted at the 4-position of the -phenyl. 4.2 CVANOIMINOPIPERAZINE COMPOUNDS OF FORMULA (IA) The present inveation also encompasses compounds of formula (la) and pharmaceutically acceptable salts thereof, wherein R', Rl R^, R^, n, and m are defined above for the Cyanoimmopiperazine Compounds of formula (la). In one embodiment, R' is -halo. In another embodiment, R^ is -CI. In another embodiment, R' is -Br. In another embodiment, R' is -I. in another embodiment, R' is -F. hi another embodiment, R' is -CH3. In another embodiment, n is 1 and R^ is -halo, -CN, -OH, -NOj, or -NHj. In another embodiment, n is 1 andR^ is -{C,-C,(,)alkyl, -(C2-C,(,)alkenyl, -(€3-Cio)alkynyI, -(C3-Cio)cycloalkyl, -(Cg-C,4)bicycloalkyl, -{Ca-Cj4)tricycloalkyl, -(Cj-C,o)cycloalkenyl,-(C3-Ci4)bicycloalkenyl, -(Cg-C,4)tricycIoallcenyi, -(Cj-C7)heterocycle, or -{C7-C,o)bicycloh6terocycle, each of which is unsubstituted or substituted with one or more R^ groups. In another embodiment, n is 1 and R^ is -phenyl, -naphthyl, -(CiJaiyl, or -(Cj-C,(\|)heteroaryI, each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, m is I and R' is -halo, -CN, -OH, -NO2, or -NH;. In another embodiment, m is 1 and R' is -{C,-Cio)alkyl, -(C,-C,o)alkenyi, -(C;-C,^)alkynyl, -(C3-C,o)cyc[oalkyl, -(Cs-CiJbicycloalkyl, -(Cg-C, Jti-icycloalkyl, -(C5-Cjo}cycIoalkenyI,-fCg-C,j)bicycloaikenyl, -(C5-C,j)tricycloalkenyi, -(C3-C7)heterocycle, or - {C7-C,(,)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, m is 1 and R^ is -phenyl, -naphthyi, -(CiJaryl or -(C;-C,o)beteroaryl, each of which is unsubstituted or substituted with one or more R'groups. In another embodiment, ra is 1 and R^ is -CH^. In another embodiment, m is !, RMS -CH,, and the carbon atom to which the -R' is attached is m the (R)-configuration. In another embodiment, m is 1, R-* is -CH^, and the carbon atom to which the -R-^ is attached is in the (S)-configuration. In another embodiment, R^ is -naphthyi, -{Cjjaryl, or -(C3-Cg)cycloalkyl each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, R^ is pyridyl, fiiryl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyi, phthalazinyl, or quinazolinyl, each of which is substituted with one or more R^ groups. In another embodiment, R* is pyridyl, pyrazinyl, pynmidinyl, pyiidazinyl, or thiadiazolyl. 43 CYANOIMINOPIPERAZINE COMPOUNDS OF FORMULA ffB) The present invention encompasses compounds having the formula (lb): (lb) nd pharmaceutically acceptable salts thereof, wherein R', R-, R\ R', R'", ii, m, p and halo re defined above for the Cyanoiminopiperazine Compounds of formula (lb). In one embodiment, n is 0. In another embodiment, n is I. In another emHodimenl, n is 2. In another embodiment, m is 0. In another embodiment m is 1. In another embodiment, m is 2. In another embodiment, R' is -halo. In another embodiment, R' is -CI. In another embodiment, R1 is -Br. In another embodiment, R1 is -I. In another embodiment, R1 is -F. In another embodiment, R1 is -CH3. In one embodiment, n is 1 and R^ is -halo, -ON, -OH, -NO2, or -NHj- In another embodiment, n is 1 and R' is -(C,'C\|o)alkyi, -(C2-C,o)alkenyl, -(C^-io)alkynyL -(C,-C,o)cycloalkyl, -(CrCi4)bicycloaIk7l, -fCs-Ci,)tricycloa!kyl, -(C5-,o)cycloalkenyl, -(C;-C,4)bicycloalkenyl, -(Cg-Ci^)tricyc-loalkenyl, -(C3-C7)heterocycle, or -(C7-Cni)bicycloheterocycle, each of which is unsubstltuted or substituted with one or more R' groups. In another embodiment, n is 1 and R- is -phenyl, -naphthyl, -(C,4)aryl, or -(C5-C\|o)heteroaryl, each of which is unsubstimted or substituted with one or more R^ groups. bi another embodiment, m is land R^ is -halo, -CN, -OH, -NO-., or In another embodiment, m is 1 and R^ is-phenyl, -naphthyl, -(Ci4)aTyl or (C5-C,(i)heteroaryl, each ofwhichisimsubstituted or substituted with one or more R' groups. In another embodiment, m is 1 and R^ is -CHj. In another embodiment, m is 1, R^ is -CH3. and the carbon atom to which the -;i^ is attached is in the (R)-configuration. In another embodiment, m is 1, R^ is -CHj, and the carbon atom to which the -V is attached is in the (S)-configuration. 4.4 CVANOIMINOPIPERAZINE COMPOUNDS OF FORMULA aO The present invention encompasses compounds having the formula (Ic): and phannaceuticaiiy acceptable salts thereof, wherein A, R^, R, R', R'-, m, and q are defined above for the Cyanoiminopiperazine Compounds of formula (Ic). hi one embodiment, m is 0. hi another embodiment, m is 1. hi another embodiment, m is 2. In another embodiment, q is Q. Jn another embodiment, q is 1. hi another embodiment, q is 2. hi another embodiment, q is 3. hi another embodiment, A is -N((CpC6)aUcyi)-. hi another embodiment, A is -N(0{Ci-Co)alkyl)-. In another embodiment, A is -0-. hi another embodiment, A is -S-. hi another embodiment, m is 1 and R' is -halo, -CN, -OH, -NO., or -NH,^ or hi another embodiment, m is 1 and R- is -(C,-Cio)alkyI, -(C2-Cio)alk6nyl, -(Cj-Cio)alkynyl, -(C3-C,o)cycloalkyl, -(Cs-Ci4)bicycloa!lcyl, -(Cs-C,4)tricycloalkyl, -{C5-"io)cycloaIkenyl,-(C3-C,4)bicycIoalkenyl, -(C5-C\|4)tricycioalkenyI, -(Cj-C7)heterocycle, or -'C,-C,o)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ jroups. hi another embodiment, m is 1 and R' is -phenyl, -naphthyl, -(C,4)aryl or -(C,-i;io)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, m is 1 and R' is -CH3. Li another embodiment, m is 1, R' is -CHj, and the carbon atom to which the -i? is attached is in the (R)-configuration- In another embodiment, m is 1, R^ is -CH3, and the carbon atom to which the -X' is attached is in the (S)-configuration. hi another embodiment, R is -phenyl, -naphthyl, -(C3-C8)cycloalkyl,-(C\|4)ary!, r -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' roups. hi another embodiment, R^ is -phenyl. in another embodimeat, R' is -hydrogen, -halo, -CHj, -NO^, -CN, -OH, -OCH3, ~NH,, -Caia!o)3, -CH(halQ)., or -CH,(ba!o). In another embodiment, R" is -halo. In another embodiment, R" is -CI. In another embodiment, R^^ is -Br. In another embodiment, R^' is -F. In another embodiment, R" is -I. In another embodiment, R" is -CH3. In another embodiment, q is 1 and R'- is -halo, -CN, -OH, -NO^, or -NH,. In another embodiment, q is 1 and R'- is -(C\|-C],i)alkyJ, -(C3-C\|(\|)alkenyl, -(Q-C,o)aIkynyl, '(C3-Cio)cycloalkyl, -(Cg-Ci4}bicycloaIkyi, -(Cg-CiJtricycIoalkyl, -(C5-C;]Q)cycloaIkenyI,'(Cg-C,j)bicycIoalkeayI, -{Cj-Ci4)tricycloalkenyI, -(C3-C7)heterocycle, or -'C7-C io)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R' p-oups. In one embodiment, q is 1 and R'- is -phenyl, -naphthyl, -(C,4)ai7l, or -(C5-Diojheteroaryl, each of which is unsubstituted or substituted with one or more R' groups. 4.5 CYANOIMINOPtPERAZINE COMPOUNDS OF FORMULA gi^ The present invention also encompasses compounds of formula (E) hi another embodiment, n is 1. In another embodiment, n is 2. In another embodiment, m is 0. In another embodiment, m is 1. In another embodiment, m is 2. In another embodiment, R' is -halo. In another embodiment, R' is -CI. In another embodiment, R' is -Br, In another embodiment, R' is -I. In another embodiment, R' is -F. In another embodiment, R' is -CH3. In another embodiment, A is -NH-. In another embodiment, A is -N((C,-C6)aIkyI)-. In another embodiment, A is -N(0(Ci-C5)alkyl)-. In another embodiment, A is -0-. In another embodiment, A is -S-. In another embodiment, n is 1 and R.~ is -halo, -CN, -OH, -NOj, oi -NH,. In another embodiment, n is 1 and R^ is -{C,-C,i,)alkyl, -{C2-C,o)aIkenyI, -(C,-,o)alkynyl, -(C3-C,o)cycloalkyl, -(Cs-C,4)bicycloaIkyI, -(Cg-C,4)tricycloalkyl, -(Cj-,o)cycloalkenyl,-(Cs-Ci4)bicycloaIkenyi, -(Cg-Ci4)tricycloalkenyl, -{C3-C7)heterocycIe, or -'7-Cio)bicycIoheterocycle, each of which is unsubstituted or substituted with one or more "R? oups. In another embodiment, n is 1 and R^ is -phenyl, -naphthyl, -(C,4)aryl, or -(C5-[o)heteroaiyl, each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, m is 1 and R^ is -halo, -CN, -OH, -NOj, or -NHj. In another embodiment, m is 1 and R^ is -{C\|-C,o)aIkyI, -(C2-C,o)alkenyl, -{C,-,o)alkynyl, -(C3-C,o)cycloalkyl, -{Cs-C,4)bicycloalkyl, -(C3-C„)tricycloalkyl, -(C;-io)cycloalken3'],-(Cs-Ci4)bicycIoalkenyl, -{Cs-C\|4)tricycloaIkenyI, -(C3-C7)heterocycle, or -'^-C\|(i)bicycIoheterocycle, each of which is unsubstituted or substituted with one or more R^ ouos. In another embodiment, m is 1 and R-* is -phenyl, -Daphthyl, -(C,4)aryl or -(Cj-C\|o)heteroaryl, each of which is unsubstituied or substituted with one or more R^ groups. In another embodiment, m is I and R'^ is -CHj. In another embodiment, m is 1, R^ is -CH3, and the carbon atom to which the -R' is attached is in the (R.)-configuration. In another embodiment, m is 1, RMS -CH3, and the carbon atom lo which the -R^ is attached is in the (S)-configuration. In another embodiment, R^ is -phenyl, -naphthyl, -(Cj-Cs)cycloalicyI,-(Ci4)aryl, or -(Cs-C5o)heteroaryl, each of which is unsubstituted or substihited with one or more R' groups. In another embodiment, R^ is -phenyl. In one embodiment, n and m are 0 and R^ is -phenyl. In another embodiment, n is 0, m is 1, R^ is methyl, and R^ is phenyl. In another embodiment, the -phenyl is substituted with a -(C,-Cg) alkyl group. In another embodiment, the -(C,-C^) alkyi group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Cj-CJ alkyl group is a r-butyl group substituted at 4-position of the -phenyl. In another embodiment, the -(C,-Cg) alkyl group is an ijo-piopyl group substituted at the 4-position of the -phenyl. In another embodiment, R' is -CF^ or -CHF^. In another embodiment, n and m are 0 and R' is -phenyl substituted at its 4-iosition with a -CF3 group. In another embodiment, n and m are 0, R' is -halo or methyl; and R* is phenyl. In one embodiment, -halo is -CI. In another embodiment, the -phenyl is substituted vith a -(Cj-Cj) alkyl group. In another embodiment, the -(Cj-C^ alkyl group is substituted at be 4-position of the -phenyl. In another embodiment, the -(Cj-Cg) alkyl group is a ^butyl joap or an iso-propyl group substituted at the 4-position of the -phenyl. In another embodiment, n and m are 0, R' is -halo or methyl; and R* is -phenyl ubstituted with -CF3. In another embodiment, -halo is -CI. In another embodiment, the -CF3 i substituted at the 4-position of the -phenyl. In another embodiment, -halo is -CI and the 3F, is substituted at the 4-position of the -phenyl. 4.6 CVANOlMrNOFIPERAZINE COMPOUNDS OF FORMULA (HAThe present invenrion also encompasses compounds having the formula (Ha): ifined above for the Cyanoiminopiperazine Compounds of fomiula {Ha). In one embodiment, q is 0. In another embodiment q is 1. In another embodiment q is 2. In one embodiment, m is 0. In pziuthei embodiment, m is 1. In another embodiment, m is 2. In another embodiment, A is -N((Ci-C4)alkyI)-. In another embodiment, A is -N(0(C1-C6)alkyl)-. In another embodiment, A is -0-. ia another embodiment, A is -S-. In another embodiment, m is 1 and R' is -halo, -CN, -OH, -NO,, or -NHj- In another embodiment, m is 1 and R' is -(C,-C,n)allcyl, -(C2-C,(,)aikenyl, -( ,)alkyny!, -(C3-C\|o)cyclo3lkyl, -(C8-C,4)bicycloaUcyl, -(C3-Ci,)tricycloaIkyl, -(C5-,)cycloalkenyl,-(Cs-C,4)bJcycloa]kenyl, -(C8-C,4)tricycIoaIkenyI, -(C3-C7)heterocycle, or rC\|o)bicycloheterocycle, each of which is unsubstimted or substituted with one or more lups. In another embodiment, m is 1 and R^ is -phenyl, -naphthyl, -(Ci4)aiyl or -(( )heteroaTyI, each of which is unsubstituted or substituted with one or more R' ^oups. In another embodiment, m is 1 and R-' is -CHj. In another embodiment, m is 1, R^ is -CH,, and the carbon atom to which die -R^ is attached is in the (R)-configuration. hi another embodiment, m is 1, R' is -CH„ and the carbon atom to which the -K^ is attached is in the (R)-configuration. In another embodiment, R^ is -phenyl, -naphthyl, -(C;-Cs)cycloalJcyI,-(C) Jaryl, or -(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R" groups. In another embodiment, R* is -phenyl. In another embodiment, R' is -hydrogen, -halo. -CH,, -NO^, -CN, -OH, -OCH3, -NH,, -C{haIo)3, -CH(halo),, or -CH,(haIo). In another embodiment, R' is -halo. In another embodiment, R" is -CI. In another embodiment, R" is -Br. In another embodiment, R" is -F. In another embodiment, R" is -I. (n another embodiment, R' is -CH,. 3- 12 In anothc. embodiment, q is 1 and R' is -halo, -CN, -OH, -NOj, or -NH;. In another embottoient, q is 1 and R'^ is -(C,-Cio)alkyl, -(C2-C,o)alkenyl, -(C,-C,(,)alkynyl, -(C3-C,o)cycloallcyl, -(C3-C,4)bicycloaIkyl, -(C3-C,4)tricycloaIkyl, -(Cj-C,o)cycloalkenyl,-(Ca-C\|4)bicycloalkenyI, -(Cg-Ci4)tricycIoaIkenyl, -(C3-C,)heterocycle, or -(C7-Cio)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups. In another embodiment, q is 1 and R'^ is -phenyl, -naphthyl, -(C,4)aryl, or -(C,-C,(i)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups. 4.7 CVANOIMINQPIPERAZINE COMPOUNDS OF FORMULA giO The present invention also encompasses compounds of formula (TO) (C7-C,o}bicycloheterocycle, each of which is unsubstituled or substituted with one or more R^ groups. In one embodiment, n is I and R- is -phenyl, -naphthyl, -(Cja)aryl, or -(C-C]Q)heteroary!, each of which is unsubslituted or substituted with one or more R^ groups. In one embodiment, m is 1 and R^ is -halo. -CN, -OH, -NO^, or -NH,. In one embodiment, m is 1 and R^ is -(CrC]o)alkyi, -(Cj-C\|(,)alkenyl, -(C,-C,o)alk7nyl, -(C3-C,o)cycloalk7l, -{Cs-C,4)bicycloalkyI, -(Cs-C,JtricycloaIkyl, -(Q-CiQ)cycloalkenyl,-(C3-C,4)bicycloal}ceny!, -(Cj-CtJtricycloalkenyl, -(C3-C7)heterocycle, or -(C7-C,o)bicycloheteracycle, each of which is unsubstituted or substituted with one or more R^ groups. In one embodiment, m is 1 and R^ is -phenyl, -naphthyl, -{CiJaryl or -(C5-Cij)heteroaryl, each of which is unsubstimied or substituted with one or more R' groups. In another embodiment, m is 1 and R^ is -CH3. In another embodiment, m is I, R'^ is -CHj, and the carbon atom to which the -R^ is attached is in the (R)-configuration. In another embodiment, m is 1, RMS -CH3, and the carbon atom to which the -R^ is attached is in the (S)-configuration. In one embodiment, R^ is -phenyl, -naphthyi, -(C3-C3)cycloalkyi,-(C,4)aryi, or -(C3-C\|o)heteroaiyl, each of which is unsubstituted or substituted with one or more R' groups. In one embodiment, R* is -phenyl. In one embodiment, n and m are 0 and R^ is -phenyl. In another embodiment, n is 0, m is 1, R' is methyl, and R* is phenyl. In another embodiment, the -phenyl is substituted with a -{C,-Cs) alkyl group. In another embodiment, the -(Cj-Cg) alkyi group is substituted at the 4-position of tie -phenyl. In another embodiment, the -(Ci-C^) alkyl group is a (-butyl group substituted at 4-position of the -phenyl. In another embodiment, the -(C,-Cg) alkyl group is an wo-propyl group substituted at the 4-position of the -phenyl. bi another embodiment, R' is -CF3 or -CHFj. In another embodiment, n and m are 0 and R* is -phenyl substituted at its 4-losition with a -CF3 group. In another embodiment, n and m are 0, R' is -halo or methyl; and R^ is -phenyl. In one embodiment, -halo is -CI. In another embodiment, the -phenyl is substituted with a -(C\|-Cs) alkyl group. In another embodiment, the -(Cj-Cs) alky! group is substituted at the 4-position of the -phenyl. In another embodiment, tlie -{C,-C^) altyl group is a f-butyl group or an iso-propyl group substituted at the 4-position of the -phenyl. In another embodiment, n and m are 0, R' is -halo or methyl; and R° is -phenyl substituted with -CF3. In another embodiment, -halo is -CI. In another embodiment, the -CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is -Ci and the -CF3 is substituted at the 4-position of the -phenyl nd phamiaceutically acceptable salts thereof, wherein R', R^, R^, R, n, and m are defined bove for the Cyanoiminopiperazine Corapoimds of formula (Illa). In one embodiment, n is 0. In another embodirtieni, □. is 1. In another embodiment, n is 2. In another embodiment, m is 0. ID another embodiment, m is 1. In another embodiment, m is 2. In another embodiment, R' is -halo. In another embodiment, R' is -CI. hi another embodiment, R' is -Br. 4.9 CVANOnviINOPIPERAZINE COMPOUNDS OF FORMULA ailB) The present invention encompasses compounds having the formula (IDb): The present invention encompasses compounds having the formula (IHc): and phaimaceutically acceptable salts thereof, wherein A, R^, R^, R"', R'", m, and q are defined above for the Cyanoiminopiperazine Compounds of fonnula (IIIc). 4.11 CYANOIMINOPIPERAZINE COMPOUNDS OF FORMULA (TV) The present invention also encompasses compounds of formula (IV): losilion with a -CF3 group. In another embodiment, n and m are 0, R' is -halo or methyl; and R is -phenyl. In one embodiment, -halo is -CI, In another embodiment, the -phenyl is substituted defined above for the Cyanoimiaopiperazine Compounds of fonnula (IVa). Li one embodiment, q is 0. ki another embodiment, q is 1. In another embodiment, q is 2. In one embodiment, m is 0. In another embodiment, m is L In another embodiment, m is 2. In another embodiment, A is -NH-. In one embodiment, m is 0. In another embodiment, m is 1. In another embodiment, m is 2. In another embodiment, A is -NH- In another embodiment, A is -N((C,-Ce)a!kyl)-, In another embodiment, A is -N(0{C,-C6)al]cyl)-. In another embodiment, A is -0-. In another embodiment, A is -S-. In another embodiment, R' is -hydrogen. groups. In another embodiment, m is 1 and R^ is -phenyl, -naphthyl, -{Ci4)aryi or -(C5-C,o)heteroaiyl, each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, m is 1 and R^ is -CHj. In another embodiment, m is 1, RMS -CH3, and the carbon atom to which the R-' is attached is in the (R)-configuration. In another embodiment, m is I, R^ is -CH,, and the carbon atom to which the -R^ is attached is in the (S)-configuration. In another embodiment, R* is -phenyl, -naphthyl, -(C3-C8)cycloalkyU-(C\|4)aryl, or -(C5-Cio)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups. In another embodiment, R* is -phenyl. In one embodiment, m is 0 and R" is -phenyl. In another embodiment, m is 1, R' is methyl, and R* is phenyl. In another embodiment, the -phenyl is substituted with a -(Ci-C^) aikyi group. In another embodiment, the -(Cj-Cg) alkyi group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Cj-Cg) alkyl group is a r-butyl group substituted at 4-position of the -phenyl. In another embodiment, the -{C,-Cg) alkyl group is an iso-propy] group substituted at the 4-posit.ion of the -phenyl. In another embodiment, R' is -CFj or -CHF,. In another embodiment, m is 0 and R' is -phenyl substituted at its 4-position with a -CF5 group. hi another embodiment, m is 0, R' is -halo or methyl; and R^ is -phenyl. In one embodiment, -halo is -CI. In another embodiment, the -phenyl is substituted with a -(CfCg) alkyl group. In another embodiment, the -(Ci-C^) alfcyl group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Ci-Ce) alkyl group is a t-butyl group or an wo-propyl group substituted at the 4-position of the -phenyl. In another embodiment, m is 0, R' is -halo or methyl; and R^ is -phenyl substituted with -CF3. In another embodiment, -halo is -CI. In another embodiment, the -CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is -CI and the -CF3 is substituted at the 4-position of the -phenyl. and pharmaceutically acceptable salts thereof, wherein Ar„ A12 R^, R', m, and t are defined above for the Cyanoiminopiperazine Compound of formula (VI). In one embodiment AT, is a pyridyl group. In another embodiment, Ai, is apyrimidinyl group. In another embodiment, Ar, is a pyridazmyl group. In another embodiment. Ar. is a nvrazinvl sroun. In another embodiment, ATJ is a thiadiazoiyi group. In another embodiment, ATJ is a benzothiazolyl group. In another embodiment, Ar2 is a benzoimidazolyl group. In another embodiment, Ai, is abenzooxazolyl group. In another embodiment, Ar, is 4.15 CVANOIMINOPIPERAZINE COMPOUNDS OF FORMULA (VXD The present invention also encompasses compounds of fonnula (VH): In another embodiment, R, is -H. In another embodiment, R, is -halo. In another embodiment, R, is -CI. In another embodiment, Ri is -Br. In another embodiment, Rj is -I. In another embodiment, R, is -F. In another eitibodiment, R, is -CH3. In another embodiment, R, is -NO-j. In another embodiment, R, is -CN. In another embodiment, R, is -OH. In another embodiment, R, is -OCH3. In another embodiment, R^ is -NH;. In another embodiment, R, is -C(halo)3. In another embodiment, Rj is -CHChalo);- In another embodiment, R, is -CB2(halo). In another embodiment, R, is -halo, -CN, -OH, -NOj, or -NH;;. In another embodiment, R; is -(C,-Cio)alkyI, -(C2-Cn))aikenyl, -(C^-Cjo)alk:ynyI, -(C3-Cio)cycloalkyl, -(Cg-CiJbicycloalkyl, -(C5-C,4}tricycloaIkyl, -(C5-C,\|,)cycIoalkenyl, -(Cs-C,4)bicycloalkenyl, -(Cs-C,4)tricycloaIkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is misubstituted or substituted with one or more R5 groups; or In another embodiment, R2 is -phenyl, -naphthyl, -(Ci4)aryl or -(5- to 10-membered)lieteroaryl, each of which is imsubstilute or substituted with one or more R^ groups; In another embodiment, R3 is -halo, -CN, -OH, -NO3, or -NHj. In another embodiment, Rj is -(Ci-C\|o)alkyl, -(Ci-C,o)alkenyl, -(C,-C,o)ali-ynyl, -(Cj-CioXycloalkyl, -(Cj-CiJbicycloalkyl, -{C3-C,4)tricycloalkyl. -(C5-C,o)cycloalkenyl, -(Cs-CiJbicycIoalkenyl, -(Cj-CJtricydoalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituled or substituted with one or more R^ groups. In another embodiment, R3 is -phenyl, -naphthyl, -{CiJaryl or -(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups. therefore exist in different enantiomeric and diastereomic forms. This invention relates to the use of all optical isomers and stereoisomers of the Cyanoiminopiperazine Compounds, and mixtures thereof, and to all pharmaceutical compositions and methods of treatment that may employ or contain them. In the Cyanoiminopiperazine Compounds each R^ can be on any carbcn of the piperazine ring. In one embodiment, the Cyanoiminopiperazine Compounds have only one R' group, and that R^ group is attached to a carbon atom adjacent to the nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group. In another embodiment, the Cyanoiminopiperazine Compound has only one R' group, and that R' group is attached to a carbon atom adjacent to the nitrogen atom attached to the -C(=N-CN)-A-R group, -C(=N-CN>NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-{R')-phenyl. In another embodiment, two R' groups are on a single atom of the piperazine ring. In another embodiment, an R^ group is attached to a carbon atom adjacent to the nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group and another R' group is attached to a carbon atom adjacent to the nitrogen atom attached to the -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethyl group, 'C(=N-CN)-NH' phenpropyl group, or -C(=N-CN)-NH-(R^)-phenyl. In another embodiment, the Cyanoiminopiperazine Compound has uvo R' groups, each being attached to a different carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group. In another embodiment, the Cyanoiminopiperazine Compound has two R^ groups, each being attached to a different carbon atom adjacent to a nitrogen atom attached to the -C{=N-CN)-A-R' group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or-C(=N-CN)-NH-(R^)-phenyI. hi one embodiment, wherein the Cyanoiminopiperazine Compound has one or two Ji? groups, the carbon atom to which an R^ group is attached has the (R) configuration. In another embodiment, wherein the Cyanoiminopiperazine Compound has one or two K? groups, the carbon atom to which the K^ group is attached has the (S) configuration, hi another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, and at least one of die carbon atoms to which an R' group is attached has the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R"* groups, and at least one of the carbon atoms to which an R^ group is attached has the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R"' groups, an R-' group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazmyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R- group is attached is in the (R) configuration. In another embodiment the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -{C\|-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the B? group is attached is in the (R) configuration, and R^ is -CH3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R-* groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached'is in the (R) configuration, and R' is -CFj. In another embodiment, the Cyanoiminopiperazine Compound has one or two R-' groups, an R-' group is attached to a carbon atom adjacent to a nitrogen attached to the pyridy!, pyrimidinyl, pyrazinyl, pyridazinyl, or ttiiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CHiCH^. hi another embodiment, the Cyanoiminopiperazine Compound has one or two R"* groups, an R' group is attached to a carbon atom adjacent to a nitrogen atom attached to the ■C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethy! group, -C(=N-CN)-NH-phenpropyI group, or -C(=N-CN)-NH-(R')-pheny!, and the carbon to which the R^ group is attached is in the (R) configuration. In another embodiment, the Cyanoirainopiperazine Compound has one or two R^ groups, an R' group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R^ group,-C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C{=N-CN)-NH-(R')-phenyI, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -{Ci-C4)alkyl unsubstituted or substituted with one or more halo groups, hi another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN>NH-phenpropyl group, or -C(=N-CN)-NH-(R')~phenyI, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CHj. In another embodiment, the Cyanoiminopiperazine Compound has one or two R' groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenetiiyI group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R^-phenyl, the carbon to which the R^ group is attached is in the CR) configuration, and R^ is -CF3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group,-C(=N-CN)-NH-phenethyl group, -C(=N-CN>-NH-pheiipropyI group, or -C{=N-CN>NH-CR'>phenyl, the carbon to which the R^ ^oup is attached is in the (R) configuration, and R^ is -CHjCHj. In another embodiment, the Cyanoiminopiperazine Compound has one or two B? groups, an R-' group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R^ group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R' groups, an R^ group is attached lo a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazmyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R' group is attached is in the (S) configuration, and R^ is -(Ci-CJalkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R-* groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyi group, the carbon to wliich the R-^ group is attached is in the (S) configuration, and R^ is -CHj. In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyi group, the carbon to which the R-* group is attached is in the (S) configuration, and 'R? is -CF^, In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyi group, the :arbon to which the R"' group is attached is in the (S) configuration, and R-" is -CHjCH,. Jn another embodiment, the Cyanoiminopiperazine Compound has one or two R.' groups, an R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to :he -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl 5roup, or -C(=N-CN)-KH-(R')-phenyi, and the carbon to which the R^ group is attached is in he (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one )r tw'c R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to he -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl jroup, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the R' group is attached is in the S) configuration, and R"' is -(Ci-C4)alkyl unsubstituted or substituted with one or more halo ^Dups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ jroups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-::N)-A-R* group, -C(=N-CN>-NH-phenethyI group, -C(=N-CN)-NH-pfaenpropyl group, or -X=N-CN)-NH-(R')-phenyl, the carbon to which the R' group is attached is in the (S) onfiguration, and R^ is -CH3. In another embodiment, the Cyanoiminopiperazine llompound has one or two R' groups, an R' group is attached to a carbon atom adjacent to a dtrogen attached to the -C(=N-CN)-A'R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-l!N)-NH-phenpropyl ^oup, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the 'B? group ; attached is in the (S) configuration, and R-' is -CF3. hi another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R"^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-phenyI, the carbon to which the R^ group is attached is in the (S) confi^ration, and R^ is -CH2CH3. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyiimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R^ group is attached is in the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pynmidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -(Ci-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CH,. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R-' group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, tlie carbon t^j which the R^ group is attached is in the (R) configuration, and R^ is -CF3. In another embodunent, the Cyanoiminopiperazine Compound has only one R-' group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to tiie pyridyl, pyrimidinyl. pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CH2CH3. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to the -C(=N-C:N)-A-R^ group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-phenyl, and the carbon to which the R^ group is attached is in the (R) configuration, hi another embodiment, the Cyanoiminopiperazine Compound has only one R^ gi'oup, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C{=N-CN)-A-R' group, -C(=N-CN)-NH-phenethyi group, -C(=N-C1S0-NH-phenpropyl group, or -C(=N-CN)-NH-(R")-phenyl, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -{C,-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C{=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R^)-phenyi. the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CH3. In another embodiment, the Cyanoiminopiperazine Compound has only one R' group, the R-' group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R' group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the R^ group is attached is m the (R) configuration, and R^ is -CFy In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R' group is attached to a caibon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R^)-phenyl, the carbon to which the R' group is attached is in the (R) configuration, and R^ is -CH3CH3. In another embodiment, the Cyanoiminopiperazine Compoxmd has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidmyi, pyrazinyl, pyridazinyi, or thiadiazoiyl group, and the carbon to which the R^ group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazuayl, or thiadiazoiyl group, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -(Ci-C4)alky] unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one Ti? group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyi, or thiadiazoiyl group, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -CHj. In another embodiment, the Cyanoiminopiperazine Compound has only one R-* group, the R^ group is attached to a carbon atom adjacent to a nittogen attached to the pyridyl, pyrimidinyi, pyrazinyl, pyridazinyi, or thiadiazoiyl group, the carbon to which the R' group is attached is in the (S) configuration, and R^ is -CF;. In another embodiment, the Cyanoiminopiperazine Compound has only one R' group, the 'R? group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, p>TimidinyI, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -CHiCH,. hi another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to the -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethyl group, -C{=N-CN)-NH-phenpropyl group, or -C{=N-CN)-NH-{R')-phenyl, and the carbon to which the R-' group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R^ group, -C(=N-CN}-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN>NH-(R^-phenyi, the carbon to which the R^ group is attached is ui the (S) configuration, and R-* is -(C\|-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R' group, the R' group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -CH,. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent tc i nitrogen attached to the -C(=N-CN)-A-R group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-pheny!, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -CF3. Jix another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyI group, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the R^ group is attached is in the (R) configuration, and K' is -CH3CH3. The present invention includes the Cyanoiminopiperazine Compounds, and the phannaceutically acceptable salts thereof, wherem one or more hydrogen, carbon or other atoms are replaced by isotopes thereof. Such compounds maybe useful as research and diagnostic tools in metabolism phannacokinetic studies and in binding assays. Illustrative Cyanoiminopiperazine Compounds are listed below in Tables 1 -8: 4.17 DEFINITIONS As used herein, the ternis used above having following meaning: "-(C,-C\|r))alkyl" means a straight chain or branched non-cyclic hydrocarbon laving firom 1 to 10 carbon atoms. Representative straight chain -(C,-C,o)alky!s include methyl, -ethyl, -n-propyl, -n-butyl, -n-pentvi, -n-hexyl, -n-heptyl, -n-octyl, -n-nonly and -n-lecyl. Representative branched -(C,-C,o)atkySs include -isopropyl, -sec-butyl, -isobutyl, tert-butyl, -isopentyi, -neopentyi, I-methy!but\^i, 2-methyIbutyl, S-methylbutyl, ,,1-diinetbylpropyl, 1,2-dimethylpropyl. 1-methylpentyI, 2-methylpentyl, 3-methylpentyi,. t-insthylpentyl, 1-eihylbutyl, 2-ethyIbutyL 3-eth\'Ibutyl, 1,1-dimethtylbutyL :,2-diniethy]bi!tyl. 1,3-dimethylbutyl, 2,2-dimediyIhutyL 2,3-dimethylbutyI and i,3-dimethylbutyl. -isopropyl, -jec-butyl, -isobutyl, 1-methylhexyl, 2-methylhexyl, 3-nethylh.exyl 4-niethyIhexyl, 5-methylhexyl, 1,2-dimethylpeniyl, 1,3-dimethylpentyl, 1.2-hmethylhexyl, l,3-dimethylhexyh3,3-diniethylhexyl, l^Z-dimethylheptyl, 1,3-iimeihylheptyl, siid 3,3-dimethylheptyl. "-(C,-C(;)a]lc>'l" means a straight ch;-iin or branched non-cyclic hydi-ocarbon lavina; .fi-om I to 6 carbon atoms. Rrprsscntative ijtraight chain -(C\|-C-)alkyIs include me'Jiyi; -ethyl, -fi-propyi, -ii-butj'l, -n-pentyl and -n-hexyl. Representative branched -(C,-3fi)?II(yb include -isopropyl, -sec-butyi, -isobutyl, -tert-butyl. -isopentyi, -neopentyi, l-eic!hylbut>i, 2-tnethylbutyl, 3-metliyibutyl, 1,1-diniethylpropyl. 1 ;2-dnnethylpropyI, i-inelhy!pentyl, 2-methylpentyi, 3-methylpentyl, 4-methylpentyl, 1-ethylbtityl, 2-ethyIbut>-l, i-efliylbutyl, 1,1-dimethtylbutyI, l^-thmethylbutyl, 0-diinethy!butyl,2;2-dimethyibutyL >,3-dimethylbuti'l and 3,3-dimethylbiityl. "-(C2-C\|o)alkenyr' means a straight chain or branched non-cyclic hydrocarbon la^dtir; fecim 2 to 10 carbon atoms and including at least one carbon-carbon double bond. [representative straight chain and branched (Ci-C,o)aIkeiiyls include -vinyl, -allyl, -1-butenyI. ■2-buieuyi, -isobutylenyl, -1-pentenyl, -2-pentenyl, -3-methyl-I-butenyi, -2-metby!-2-butenyl, ■2,3-ciunethyi-2-butenyI, -1-hexenyl, -2-hexenyl, -3-hexenyl, -1-heptenyl, -2-heptenyl, -3-hiepteiiyl, - [-octenyl, -2-octsiiyl, -3-octenyl, -l-noneJiyl, -2-nqnenyi. -3-nonenyl, -!-deceiiyl, ■2-deceTiy!, -3-decenyl and the like. "-(C2-C6)aikenyl" means a straight chain or branched non-cyclic hydrocarbon ha'/ingfiom 2 to 6 carbon atoms and including a: least one carbon-carbon double bond. Representative straiglit chain and branched (C.-C,)alkenyls include -vinyi, -ally!, -1-butenyl, -2-butenyI, -isobutylenyl, -l-pentenyl, -2-pentenyl. -3-methyl-l-butenyl. -2-methyl-2-butenyl, -2,3 -dimetliyI-2-butenyl, -1-hexenyl, 2-hexenyl, 3-hexenyi and the like. '-(C2-C,o)alkynyr' means a straight chain or branched non-cyclic hydrocarbon having from 2 to 10 carbon atoms and including at lease one carbon-carbon triple bond. Representative straight chain and branched -(C;-C,o)aIkynyis include -acetylenyl, -propyny!, -1-butynyl, -2-butynyl, -1-pentynyi,-2-pent}'nyL -3-methyl-l-butynyl, -4'pentynyl, -1-iiexynyl, -2-hexynyl -5-hexynyl, -1-heptynyL -2-hept>Tiyl. -6-hept5.-nyl, -1-octynyl, -2-octynyl, -7-octynyl, -1-nonynyl, -2-nonynyl, -8-nonyny!, -1-decynyl, -2-decynyl, -9-decynyl and the iiia". "-(C2-Cs)alkynyr' means a straight chain or branched non-cyclic hydrocarbon having from 2 to 6 carbon atoms and including at lease one carbon-carbon triple bond. Representative straight chain and branched (Ci-C,,)alkyiiyls include -acetylenyl, -p^op>^^yI. -1-butyiiy!, -2-butynyl, -1-pentynyl, -2-pe3tynyl, -3-methyl-l-butynyl, -4-pent\iiyl. -I-hexwyl, -2-hexyiiy], -S-hexynyl and the like. "-{C3-C,o)cyc]oalkyl" means a saturated cyclic hydrocarbon having from 3 lo 10 carbon atoms. Representative (C3-Cio)cycloalkyls are -cyclopropyl, -cyclobutyl, -cyclopsntyl, -cyclohexyl, -cyciohept>'l, -cyclooctyl, -cyclononyl and -cyclodecyL "-{C3-Cs)cycloall:yr' means a saturated cyclic hydrocarbon having from 3 to 8 carbon atoms. Representative (C3-CB)cycloalkyls include -cyciopropyl, -cyclobutyl, -cyclopentyl, -cyclohexyl, -cycloheptyl and -cyclooctyl. "-(Cg-C,4)bicycloalkyl" means a bi-cyclic hydrocarbon ring s>^tem having from 8 to 14 carbon aioms and at least one saturated cyclic alkyl ring. Representative -f Cg-CiJbicycloalkyls include -indanyl, -1^,3.4-tetrahydronaphlhyl, -5,6,7,8-tetrahydronaphthyL -perhydronaphthy! and the like. "-(Cg-C.JtricycIoalkyi" means a tri-cyclic hydrocarbon ring system having from S to 14 carbon atoms and at least one saturated ring. Representati\'e -(Cj-CijJLiicycloallcyis include -pyi-enyl, -1,2,3,4-tetrahydroanthracenyl, -perhydroanthraceny! -acspnthronsyl, -1,2,3,4-tetrahydropenanthrenyl, -5,6,7,8-tetrahydrophenanthrenyl.. -perhydrophenanthrenyl and the Hke. "-(C5-Ci(,)cycloaIlcetiyl" means a cyclic non-aromatic hydrocarbon having at least one carbon-carbon double bond in the cyclic system and from 5 lo 10 carbon atoms. Representative (C5-C,o)cyc!oalkenyls include -cyciopentenyl, -cyclopentadienyl, -cyclohexenyl, -cyciohexadienyL-cycloheptenyl. -cycloheptadienyl, -cycloheplatiienyl, -cyciooctenyl, -cyclooctadienyl, -cyclooctatiienyi, -cyclooctatetraenyL -cyclononenyl -cyclononadienyl, -cyclodecenyl, -cyclodecadienyl and the like. "-(C;-Cs)cycloalkenyI" means a cyclic non-aromatic hydrocarbon having at ■ ;ast one carbon-carbon double bond in the cyclic system and from 5 to S carbon atoms. Lepresentative (C5-Cy)cycioaIkenyls include -cyciopentenyl, -cyclopentadienyl, :yclohexenyU -cyclohexadienyi, -cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl, :yclooctenyl, -cyclooctadienyl, -cyclooctatrienyl, -cyclooctatetraenyl and the like. "-(Cj-C\|4)bicycioalkenyr' means a bi-cychc hydrocarbon ring system having at iiist one carbon-carbon double bond in each nag and from 8 to 14 carbon atoms. Lepresentative -(CB-C]4)bicycloalkenyls include -indenyl, -pentalenyl, -naphtiialenyl, azulenyl, -beptalenyl, -1,2,7,8-tetrahydronaphthalenyl and the like. "-(Cg-C,4)tric>'cloalkenyi" means a tri-cyciic hydrocarbon ring system having t least one carbon-carbon double bond in each ring and from 8 to 14 carbon atoms. Lepreseutativs -(Ca-Ci4)tricycIoalkeriyls include -anthracenyl, -phenanthrenyl, phenalenyl, -acsnaphthalenyl, iis-indacenyl, r-indacenyl and the like. "-(C3-C7)heterocycle" or "-(C3-C,)heterocyclo" means a 3- to 7-membered aonocyclic Ueteroc>-clic ring which is either saturated, unsaturated non-aromatic, or aromatic. ^ 3-membered -(C3-C7)heterocycle can contain up to 3 heteroatoms, and a 4- to 7-membered (Cj-C7)beterocycle can contain up to 4 heteroatoms. Each heteroatom is independently elected from nitrogen, which can be quatemized; oxygen; and sulfur, including sulfoxide and ulfone. The -(C3-C7)heterocycle can be attached via a nitrogen, sulfur, or carbon atom. lepresentative -(C3-C7)heterocycles include pyridyl, fiiryl, tliiophenyl, pyrrolyl, oxazolyl, niidazolyl, thiazolyl, thiadiazolyl isoxazolyl, p>TazolyI, isothiazolyl, pyridazinyl, lyrimidinyl, pyrazinyl, tria2inyl, morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyi, jipsraziiiyl, hydantoinyl, valerolactamyl, oxinmyl. oxetanyl, tetrahydrofliranyl, tetrahydropyranyl, tetrahydropyrindinyl, tetrahydrcpyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl and the like. "-(C3-C5)heterocycle" or '-(C-Cj^iheterocyclo" means a 3- to 5-membered monocyclic heterocyclic ring which is either sanirated, unsaturated non-aroraatic, or aromatic. A 3-membered -(C3-C7)heterocycle can contain up tc 3 heteroatoms, and a 4- to 5-meinbered -(C3-C5)heterocycIe can contain up to 4 fieteroatcms. Each heteroatom is independently selected from nitrogen, which can be quaternized; oxygen; and sulfor, including sulfoxide and SLilfone. Tlie -(C,-C;)heterocycle can be attached via a nitrogen, sulfur, or carbon atom. Representative -(C;-C'5)heterocycles include fury!, thiophenyl, pyrrolyl. oxazoiyl, imidazoiyi, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, triazinyi. pvrrolidinonyl, pyrrolidinyl, hydantoinyl, oxiranyl, oxetanyl tetrahydrofiiranyl, tetrahydrothiophenyl and the like. "-(C7-C,o)bicycloheterocycle" or "-{C7-C,5)bicycloheterocyclo" means a 7- to 10-meinbered bicyclic, heterocyclic ring which is either saturated, unsaturated non-aromatic, or aromatic. A -(C7-C,o)bicycloheterocycle contains from 1 to 4 heteroatoms independently selected fi om nitrogen, which can be quaiemized; oxygen; and sulfiir, including sulfoxide and sulfcne. '.rhe (CT-C,o)bicycioheterocyc!e can be attached via a nifrogen, sulflir, or caibon atom. Representative -(C7-C\|£,)bicycloheterocycles include -quinolinyl, -isoquinoHnyl, -chromonyl, -coumarinyl, -indolyl, -indoHzinyl, -ben2o[b]furanyL, -benzo[b]thiopbeny], -iodazclyl, -purioyl, -4H-quinolizinyI, -isoquinolyl, -quinolyi, -phtlialaziayl, -oaphthyridinyl, -carbazolyl, -^-carbolinyl and the like. ■ "-(Ci4)aryr' means a 14-membered aromatic carbocyclic moiety such as -anthryl or -phenanliiiyl. '■-(Cc-Cic)heteroar>(" means an aromatic heterocycle ring of 5 to 10 members, including both mono- and bicyclic ring systems, wherein at least one carbon atom of one or both of the rings is replaced with a heteroatom independently selected from nitrogen, oxygen and sulfrif. One or both of the -(C5-Cio)heteroaryrs rings contain at least one carbon atom. -R-ppiesentative (C5-C\|o)heveroaryls include pyridyl, finyl, benzofui&nyl, thiophenyl, benzotiiiophcnyi, quinolinyl, pyrrolyl, indolyl, oxazoiyl, benzoxazolyl, imidazoiyi, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyriniidinyl, pyrazinyl thiadiazolyl, triazinyi^ cinnoUnyl, phihalazinyl, and quinazoliiiyl. The term "animal," includes, but is not limited to, a cow, monkey, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, guinea pig and human. The phrase "pharmaceutically acceptable salt," as used herein, is a sah formed from an acid and a basic nifrogen group of one of the Cyanoiminopiperazine Compounds. Illustrative salts include, but are not limited, to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nifrate, bisuifate, phosphate, acid phosphate, isonicotinate, lactate, sahcylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitarfrate, ascorbate, succinaie, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanes',;Ifonate. ethanesuifonate, benzenesulfonate.fi-toluenesulfonate, and pamoate (i.e., I.r-methylene-bis-(2-hydroxy-3-naphthoate)) sahs. The term'pharmaceutically acceptable salt" also refers to a salt prepared from a Cyanoiminopiperazine Compound having an acidic functional group, such as a carboxylic acid functional group, and a pnarmaceutically acceptable inorganic or organic base. Suitable bases include, but are not limited to, hydroxides of alkah metals such as sodium, potassium, and hthiura; hydroxides of alkaline : eaith metal such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammoma, and organic amines, such as unsubstituted or hydroxy-substituEed mono-, di-, or trialkyiaraines: dicyclohexy\amine; tributyl amine; pyridine; N-methyl,N-cthylamine;: dietliylamuie; triethylainine; mono-, bis-, or tris-(2-hydroxy-lower all^l amines), such as n\ono-, bis-, or tris-fZ-hydroxyethylJamine, 2-hydroxy-tert-butylamine, or tris-(hydroxymethyl)methylamine, N, N,-di-low6r alkyl-N-{hydroxy lower alkyl>-amiues, : such as N,N,-dimethyl-N-(2-hydroxyethyl)amine, or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine, lysine, and the like. When a first group is "substituted with one or more" second groups, each of one or more of the first group's hydrogen atoms is replaced with a second group. In one embodiment, each carbon atom of a first group is independently substituted with one or two second groups. In another embodunent, each carbon atom of a first group is independently substituted with only one second group. The term "UI" means urinary incontinence. The term "IBD" means inflammatory-bowel disease. The term "IBS" means iniiable bowel syndrome. The tenn "DIEA" means diisopropylethylamine. Scheme B An amine of formula l^R^R"", wherein R"* and R^ are defmea above, i& reacted with dipiisiiylcyanocabonimidaxe (commercially available from Sigma-Aldrich, St. Louis, MO (w^-v\ .sigma-aldiicli.com)) in an aptotic solvent such as diethyl ether, tii-D-pTOvyl ether, tetrahycfrof^iraii, methylene chloride, or toluene to provide the compound of fonnula A. In one embodimetir. the aprotic solvent is DCM and the reaction mixture of NHR^'R' aud .-diphenylcyanocabonimidate is allowed to react at about room temperature. In another embodiment, the ^rohc solvent is toluene and the reaction mixture of NHR^R* and diphenylcyanocabonimidate is allowed to react at about UCC. The NHR^R"* and diphenylcyanocaboniraidare is typically allowed to react for a period of about 0.5 h to about 24 h. Topically the compound of foraiuia A is used without Parther purification. Compounds of formuls B can be obtained as shown below in Scheme C: wherein R-, R', m, and Ai are defined above for the Cyanoiminopiperazine Compounds. A compound of formula B is reacted with a compound of fomiula E to provide tJie wherein R' is defined above. The compound of formula F can be obtained by reacting a compound of formula G with PCI5. A representative procedure for obtaining a compound of formula F from a compound of formula G is provided in R,L. Webb et al., J. HeierocycL Chem. 19(5)--1205-1206(19S2). The compound of formula G can be obtained by reacting a compound of brmula R^-OH with COClj, triphosgene, or CO and a Pd catalyst as described in U.S. Patent \H). 6,175,01? to H. Buyschi et al; A. Gode et al., Chemistry-A Evropean JOWTIOI !(19):3522-30 (2lX)0); orH. Yasudaet al.: Organoi}ietanics,2\(6):l2\6-20 (2002), espectively. Compounds of formula R'-OH are commercially available or can be prepared ly (Tiethods -well known to those .^killed in the art. wixrein R^ and SJ° are defined above. A thiol of formula RSH is reacted with a compound of formula J to provide lie conipouud of formula H. Representative procedures for obtaining compounds of formula t and for obtaining the compound of formula H by reacting a thiol with a compoxmd of ormula J are provided in R.L. Webb et a!., J. Heterocyci Che?n... 24(l):275-78 (1987); I. luid et al., Liebigs Ann. Chem. 6:599-601 (1988); and L.S. Wittenbrook et al., J. Heterocyci. Mem. .i2!;i)::37-42 (1975). Compounds of formula R-SH are commercially available or can e prepared by methods well known to those skilled in the art. The Cyanoiniinopiperazine Compounds of formula VI and VII can be obtained 5 describ.^d below in Scheme I. /hcKirt AT,, 'R^, and t are defined above. Scheme I ■ Anan-iineof foimulalorananaineoffonnula Jisreactedwith iphenylcyanocabonimidate (commercially avaiiahle from Sigma-Aldrich, St. Louis, MO v-v.nw.sigma-aldrichxom)) in an aprotic solvent such as diethyl ether, di-n-propyl ether, trahydroiuraii, methylene chloride, ov toluene to provide the compound of formula K or a impound of formula L, respectively. In one embodiment, the aprotic solvent is DCM and e reaction mixture of the amine of fonnula I or the amine of formula J and pheuylcyanocabonimidate is allowed to react at about room temperature, hi another ibodiment. the aprotic solvent is toluene and the reaction mixture of the amine of formula 3 tlte amine of fomiula J and diphenyicyanocaboniraidate is allowed to react ac about 0'C. The amine of formula i or the amine of formula J and diphenylcyanocaboniinidate is typically allowed to react for a period of about 0.5 h to about 24 h. Typically the compound of formula K or the compound of formula L is used without inrther purification. The compound of formula K or the compound of formula L is then reacted with a compound of formula B, obtained as described above in Scheme B, according to the 5 procedure described above in Scheme A to pro'-ide the Cjanoiminopiperazine Compound of formula (VT) or (VII) , respectively. 4.19 THERAPEUTIC USES OF THE CVANOIMUNOPIPERAZINE COMPOUNDS In accordance with the invention, the Cyanoiminopiperazine Compounds are ) adminisiered to an animal in need of treatment or prevention of pain, Ul. an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pnirilic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopatiiy, a muscle spasm, a migraine,, vomiting, dyskinesia, or depression. In one embodiment, an effective amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by inhibiting VRl. Examples ofconditions that are treatable or preventable by inhibiting VRl include, but are not limited to, pain, Ul, an ulcer, BD, and IBS. Ill another embodiment, an effective amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by inhibiting mGluRS. Examples of conditions that are treatable or preventable by ioliibitiog mGItiRS inchwie, but are not limited to, pain, an addictive disorder, Paridnson's disease, parkinsonism, ■ anxiety, a pruritic condition, and psychosis. In another embodiment, an efifectivs; amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by mhibiting mGluRl. Examples of conditions that are treatable or preventable by inhibiting raGluRl include, but are not limited to, pain, Ul, an addictive disorder, Parkinson's disease, pai'kinsomsra, anxiety, epilepsy, stroke, a seizure, a pruritic conditionj psychosis, a cognitive disorder, a memory deficit, restricted brain function, Hundngton's chorea, ALS, dementia, retinooatiw, a muscle spasm, a migraine, vomiting, dyskinesia, and depression. The Cyanoiminopiperazine Compounds can be used to treat or prevent acute or chronic pain. Examples of pain treatable or preventable using the Cyanoiminopiperazme Compounds include, but are not limited to, cancer pain, central pain, labor pain, myocardial infarction pain, pancreatic pain, colic pain, post-operative pain, headache pain, muscle pain, 5 pain associated with intensive care, arthritic pain, neuropathic pain, and pain associated with a periodontal disease, including gingivitis and periodontitis. The Cyanoiminopiperazine Compounds can also be used for inhibiting, preventing^ or treating pain associated with inflammation or wth an ioilammatory disease in an animal. The pain to be inhibited, treated or prevented may be associated with inflammation associated with an inflammatory disease, which can arise where there is an inllamniation of the body rissue, and which can be a local inflammatory response and/or a systemic inilammation. For example, the Cyanoiminopiperazine Compounds can be used to inhibit, treat, or prevent pain associated with inflammatory diseases including, but not limited to: organ transplant rejection; reoxygenation injury resulting from organ transplantation (see Giupp et al.. J. UoL Cell Cardiol. 31:297-303 (1999)) including, but not limited to, transplantation of the hean, lung, liver, or kidney; chronic inflammatory diseases of the joints, including arthritis, rheumatoid arthritis, osteoarthritis and bone diseases associated with increased bone resorption; inflammatory lung diseases, such as asthma, adult respiratory distress syndrome, and chronic obstructive ainvay disease; inflammatory diseases of the eye. including corneal dystrophy., trachoma, onchocerciasis, uveitis, sympathetic ophthalmitis and endophthalmitis; chronic inflammatory diseases of the gum, including gingivitis and periodontitis; tuberculosis; leprosy; inflammatory diseases of the kidney, including uremic complicaticns, glomerulonephritis and nephrosis; inflammatory diseases of the skin, including sclerodsrmafitis, psoriasis and eczema; inflammatory disease of the central nervous system, including chronic demyelinating diseases of the nervous sj^tem, multiple sclerosis, AIDS-celaied neurodegeueratioa and Alzheimer s disease, infectious meningitis, encephalomyehlis, Parkinson's disease, Huntington's disease, arcyotrophic lateral sclerosis and viral or lutoinmiimf; encephalitis; autoimmune diseases, including Type I and Type H diabetes nellitus; diabetic complications, inciudmg, but not limitea to, diabetic cataract, glaucoma, ■etiiiopaUiy, nepliropathy (such as microaluminuria and progressive diabetic aephropatliy). jolyneuropathy, mononeuropathies, autonc-mic neuropathy, gangrene of the f-^et. atherosclerotic coronary arterial disease, peripheral arterial disease, nonketotic hyperglycemic-hyperosmolar coma, foot ulcers, joint problems, and a skin or mucous membrane complication (such as an infection, a shin spot, a candidal infection or necrobiosis lipoidica diabeticorum); immune-complex vasculitis, and systemic lupus erythematosus (SLE); inflammatory diseases of the heart, such as cardiomyopathy, ischemic hean disease hypercholesterolemia, and atherosclerosis; as well as various other diseases that can have sigmficant inflammatory components, including preeclampsia, chronic liver failure, brain and spinal cord trauma, and cancer. The Cyanoiminopiperazine Compomids can also be used for inhibiiing, treating, or preventing pain associated with inflammatory disease that can, for example, he a systemic inilanunation of the body, exemphfied by gram-positive or gram negative shock, hemorrhagic or anaphylactic shock, or shock induced by cancer chemotherapy in resiponse to pro-inflammatory cytokines, e.g., shock associated with pro¬inflammatory cytokines. Such shock can be induced, e.g., by a chemotheiapeutic agent that is adrainstered as a treatment for cancer. The Cyanoiminopiperazine Compounds can be used to treat oi prevent Ul. E.xampies of XJI treatable or preventable using the Cyanoirainopiperazine Compounds uiclude. but are not limited to, urge incontinence, stress inconlinence, overflow incontinence, neurogemc incontinence, and total incontinence. The Cjimoiminopiperazine Compounds can be used to treat or prevent an ulcer. Exairples of ulcers treatable or preventable using the Cyanoiminopiperazine Compounds include, but are not limited to, a duodenal ulcer, a gastric nicer, a marginal ulcer, an esophiigeal ulcer, or a stress ulcer. The Cyanoiminopiperazine Compounds can be used to treat or prevent IBD, it^oluding Crohn's disease and ulcerative colitis. The. Cyaooiminopiperazine Compounds can be used to treat or prevent IBS. Examples o^'IBS treatabia or preventable using the Cyanoiminopiperazine Compounds include, but are not limited to, spastic-colon-type IBS and constipation-predominant IBS. The Cyanoiminopiperazine Compounds can be used to treat or prevent an iddiclive diijcrder, including but not limited to, :in eating disorder, an impulse-control iisordsi; an alcohol-related disorder, a nicotine-related disorder, an amphetamine-related iisyrder. a cannabis-relaied disorder, a cocaine-related disorder, an hallucinogen-related disorder, an inhalant-related disorders, and aiY opioid-reiated disorder, all of which are further iiub-classified as listed below. Eating disorders include, but are Bot limited to. Bulimia Nen'osa, Nonpurging Type; Bulimia Nervosa, Purging Type; Anorexia; and Eating Disorder not otherwise specified i (>fOS). Impulse control disorders include, but are not limited to, Intermirtent Explosive Disorder, Kleptomania, Pyromania, Pathological Gambling, Trichotillomania, and impulse Coutro! Disorder not otherwise specified (NOS). Alcohol-related disorders include, but are not limited to, Alcohol-hiduced l^sychotic Disorder with delusions. Alcohol Abuse, Alcohol Intoxication, Alcohol V/ithdrawal, Alcohol Intoxication Delirium, Alcohol Withdrawal Delirirun, Alcohol-Induced Persisting Dementia, Alcohol-Induced Persisting Amnestic Disorder, Alcohol Dependence, Alcohol-Induced Psychotic Disorder with hallucinations, Alcohol-Induced Mood Disorder, Alcohol-Induced Anxiety Disorder, .\lcohoI-Induced Sexual Dystiiiiction, A icohol-Induced" Sleep Disorder, Alcohol-Related Disorder not otherwise specified (NOS), Alcohol Intoxicraioii, and Alcohol Withdrawal. Micotine-related disorders include, but are not limited co. Nicotine Dependence, Nicotine Withdrawal, and Nicotine-Related Disorder not otherwise specified : (MOS). .\m{jhexaLiine-relaled disorders include, but are not Umited to, Ampht^taroine Dependence, Amphetamine Abuse, Amphetamine Intoxicatioii, Amphetamine Withdrawal, Amphetamine Intoxication Delirium, Amphetamine-Induced Psychotic Disorder with delusions, Amphetamine-Induced Psychotic Disorders with hallucinations, Amphefaiuine-Induced Mood Disorder, Amphetamine-Induced Anxiety Disorder, A-mphetamine-Induced Sexual Dysfimction, Amphetamine-Induced Sleep Disorder, (Amphetamine Related Disorder not otherwise specified (NOS), Amphelamine Intoxication, md Amphetamine Withdrawal. Cannabis-related disorders include, but are not limited to, Cannabis :)ependence, Cannabis Abuse, Cannabis Intoxication, Cannabis Intoxication Delirium, ^'smnabis induced Psychotic Disorder with delusions, Cannabis-Induci^d Psychotic Disorder with hallucinations, Cannabis-Induced Anxiet>- Disorder, Cannabis Related Disorder not otherwise specified (NOS), and Cannabis Intoxication. Cocaine-related disorders include, but are not limited to. Cocaine Dependence, Cocaine Abuse, Cocaine Intoxication, Cocaine Withdrawal, Cocaine Inloxication Delirium, ' Cocaine-Induced Psychotic Disorder witli delusions, Cocaine-Induced Psychotic Disorders with hallucinations, Cocaine-Induced Mood Disorder, Cocaine-Induced Ajixiety Disorder, Cocaine-Induced Sexual Dysfunction,. Cocaine-Induced Sleep Disorder, Cocaine Related Disorder nor otherwise specified (NOS), Cocaine Intoxication, and Cocaine Withdrawal. Hallucinogen-related disorders include, but ai-e not limited to, Hallucinogen Dependence. Hallucinogen Abuse, Hallucinogen Intoxication, Hallucinogen Withdrawal, Hallucinogen Intoxication Delirium, Hailucinogen-iiduced Psychotic Disorder with delusions, Hallucinogen-Induced Psychotic Disorders with hallucinatioas, Hallucinogen-Induced Mood Disoider, Hallucinogen-Induced Anxiety Disorder, Hallucinogen-Induced Sexual Dysfimction, Hallucinogen-Indxiced Sleep Disorder, Hallucinogen Related Disorder not otherwise specified (NOS), Hallucinogen Intoxication, and Hallucinogen Psrsisring Perception Disorder (Flashbacks). Inhaiant-reiatp^ disoiders include, but aie not limited to. Inhalant Dependence, Inhalant Abuse, Lihalant Intoxication, Inhalant Intoxication Delirium, Inhalant-Induced Psychotic Disorder with delusions, Mialant-Induced Psychotic Disorder with haUucinations, Iiihalant-Iaduced Anxiet>- Disorder, Inhalant Related Disordet not otherwise specified (NOS), and Inhaiant Intoxication. Opioid-related disorders include, but are not limited to, Opioid Dependence, Opioid Abiise, Opioid Intoxication, Opioid Intoxication Delirium, Opioid-Induced Psychotic Disorder -m-ii delusions, Opioid-Induced Psychotic Disorder with hallucinations, C>iiioid-Induced Anxiety Disorder, Opioid Related Disorder not o^erwise specified (NOS), Opioid Intoxication, snd Opioid Withdrawal. The Cyanoiminopiperazine Compounds can be used to treat or prevent Parkinson's disease and parkinsonism and the symptoms associated with Parkinson's disease and parldnsonism; inciudiiig but not limited to, bradykinesia, muscular rigidity, resting [rernon and impairment of postural balance. The Cyanoiminopiperazine Compounds can be used to treat or prevent generalized anxiety or severe anxiety and the symptoms associated with anxiety, including but not limited to, restlessness; tension: tachycardia; dyspnea; depression, including ciironic "neurotic" depression; panic disorder; agoraphobia and other specific phobias; eating disorders; and personality disorders. The Cyanoiminopiperazine Compounds can be used to treat or prevent epilepsy, including but not limited to, partial epilepsy, generalized epilepsy, and the s^/mptoms associated with epilepsy, including but not limited to, simple partial seizures, jacfcsoman seizures, complex partial (psychomotor) seiziu-es, convulsive seizures (grand mai or tonic-cionic seizures), petit raal (absence) seizures, and status epilepdcus. The Cyanoiminopiperazine Compounds can be used to treat or prevent strokes, including but not limited to, ischemic strokes and hemorrhagic strokes. The Cyanoiminopiperazine Compounds can be used to treat or prevent a seizure, including but not limited to, infantile spasms, febrile seizures, and epileptic seizures. The Cyanoiminopiperazine Compounds can be used to treat or prevent a pruritic condition, including but not limited to, pnirihis caused by dry skin, scabies, dermatitis, herpetifonnis, atopic dermatitis, _I3;-M/7/MJ vu.'vae et ani, mih'iiria, insect bites, aediculosis, contact dermatitis, drug reactions, urticaria, urticarial eniptions of pregnancy, jsoriasis, lichen planus, lichen simples chronicus, exfoliative dermatitis, folliculitis, bullous leniphiaoid, or fiberglass dennatitis. The Cyanoiminopiperazine Compounds'can be used to treat or prevent tsychosis, including but not limited to, schizophrenia, including paranoid schizophrenia, lebephrenic or disorganized schizophrenia, catatonic schizophrenia, undifferentiated chizophrcnia, negative or deficit subtype schizophrenia, and non-deficit schizophrenia; a elusionaJ disorder, including erotomanic subtype delusional disorder, grandiose subtype elusional disorder, jealous subtype delusional disorder, persecutory subtype delusional isorder, and somatic subtype delusional disorder; and brief psychosis. The Cyanoiminopiperazine Compo\md3 can be used to treat or prevent a Dgnitive disorder, including but not limited to, delirium and dementia such as multi-infarct trnitntia, dementia pugihstica, dimentia caused by AIDS, and dementia caused by Izheimer's disease. The Cyanoiminopiperazine Compounds can be used to treat or prevent a menioi-y deficiency, including but not limited to. dissociative amnesia and dissociative fugue. The CyauQiminopiperazine Compounds can be used to treat or prevent ■restricted brain function, including but not limited to, that caused by surgery or an organ iiansplant, restricted blood supply to the brain, A spinal cord injury, a head injury, hypoxia, cardiac arrest, or hypoglycemia. The Cyanoiminopiperazine Compounds can be used to treat or prevent iluritington's chorea. The Cyanoiminopiperazine Compounds can be used to treat or prevent ALS. The Cyanoimiaopiperazine Compounds cm be used to treat or prevent retinopathy, including but not limited to, aneriosclerotic retinopathy, diabetic arteriosclerotic lelinopathy, hypertensive retinopathy, non-proliferative retinopatliy, und proliferative retinopathy. The Cyanoiminopiperazine Compounds can be used to treat or prevent a miisc'./s spasm. The Cyanoiminopiperazine Compound!; can be used to treat or prevcinl a migvaiue. The Cyanoiminopiperazine Compounds ran be used to inhibit, treat or prevful vomiting, including but not limited to, nausea vomiting, dry vomiting (retching), and regrargitation. The Cyanoiminopiperazine Compounds can be used to treat or prevent dyykineaia, including but not Jimited to, tardive dyskinesia and biliary dyskinesia. The Cyanoiminopiperazine Compounds can be used to treat or prevent depresJ-ion, including but not limited to, major depression and bipolar disorder. Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for VRl. The invention also relates to methods for inhibiting VRl function in a cell, coiiipfising contacting a cell capable of expressing VRI with an effective amount of a Cyanoimiiiopipurazine Compound. This method can be used in vitw, for example, as an-assay to select c^^IIs that express VRl and, accordingly, are lisefiil as part of an assay to select coir.pC'imus useful for treating or preventing pain. LT, an ulcer, IBD, or IBS. The method is also useful for inhibiting "VRl function in a cell in vivo, in an animal, a human in one embodiment, by contacting a cell, in an animal, with an effective amount of a Cyanoiminopiperazine Compound. In one embodiment, the method is useful for treating or preventing pain in an animal. In another embodiment, the method is useful for treating or i preventiirg Ul in an animal. In another embodiment, the method is useful for treating or preventing an ulcer in an animal, hi another embodiment, the method is useful for treating or preventing IBD in an animal. In another embodiment, the method is useful for treating or pre-v'enting IBS in an animal. £xaraples of tissue comprising cells capable of expressing VRI include, but 1 are noc limited to, neuronal, brain, kidney, urothehura. and bladder tissue. Methods for assaying cells that express VRI are well known in the art. Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for mGIuR5. The invention also relates to methods for inhibiting mGliJl5 function in a cell, comprising contacting a cell capable of expressing mGluRS with an amount of a Cyanoirainopiper.isine Compound effective to inhibit mGluR5 function in the cell. This methori can be used in vitro, for example, as an assay to select cells thai express mGIuR5 and. accordingly, are useful as part of an assay to select compounds useful for treating or preventing pain, an addictive disorder, Parkinson's disease, paridnsonisni, anxiety, a pruritic ' condition, or psychosis. Tbe mefliod is also useful for inhibiting mGluRS nmction in a cell in vivo, in an animal, a human in one embodiment, by contacting a cell, in an animal, with an zmount of a Cyanoiminopiperazine Compound effective to inhibit mGIuR5 function in the cell. In one embodiment, the method is usefijl for treating or preventing pain in an animal in need thereof. In another embodiment, the method is usefiil for treating or preventing an addictive disorder in an animal in need thereof In another embodiment, the method is useful for treating or preventing Parkinson's disease in an animal in need thereof. In another embodiment, the method is useful for treating or preventing parkinsonism in an animal in need thereo-f. In another embodiment, the method is useful for treating or preventing anxiety in an animal in need thereof In another embodinaent, the method is useful for treating or preventing a pruntic condition in an animal in need thereof In another embodiment, the method is ust-fiil for treating or preventing psychosis in an animal in need ihereof Examples of cells capable of expressing mGIuRi are neuronal and glial cells of the central nervous system, particularly the brain, especially in the nucleus accumbens. Methods for assaying cells that express mGluR5 are well known in the art. Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for mGluRl. The invention also relates to methods for inhibiting mGluRl function in a cell, comprising contacting a cell capable of expressing mGluRl with an amount of a Cyanoiminopiperazine Compound effective to inhibit mGluRl function in the cell. This method can be used in vitro, for example, as an assay to select cells that express mGluRI an disorder in an animal in need thereof. In another embodiment, the method is usefiil for treating or preventing a memory deficit in an animal in need thereof In another embodiment, the method is usefiil for treating or preventing restricted brain function in an animal in need thereof. In another embodiment, the method is use&l for treating or preventing Huntington's chorea in an animal in need thereof hi another embodiment, the method is useful for tieating or preventing ALS in an animal in need thereof In another embodiment, the method is useful for treating or preventing dementia in an animal in need thereof In another embodiment, the method is usefiil fortreating or preventing retinopathy in an animal in need thereof In another embodiment, the method is useful for treating or preventing a muscle spasm in sn animal in need thereof In another embodiment, the meihod is usefiil for treating or preventing a migraine in an animal in need thereof hi another embodiment, the method is useful for treating or preventing vomiting in an animal in need thereof. In another embodiment, the method is usefiil for treating or preventing dyskinesia in an animal in need thereof fii another embodiment, the method is useful for treating or preventing d^^ressiou in an animd in need thetsof. Examples of cells enable of expiessiiig mGIuRl include, but are not limited to, cerebellar Pm'kinje neuron cells, Purkinje cell h(}dies (punctate), cells of spiue(s) of the cerebelluca; Ticurons and nearopMl cells of olfactory-bulb glomeruli; cells of the superficial: iaver of the cerebral cortex; hippocampus cells; thalamus cells; superior colliculus cells; and spinai trigeminal nucleus cells. Methods for assaying cells that express mGluRl are well Imowa in the art 4.19.1 THERAPEUTIC/PROPHYLACTIC ADMINISTR-ATION A.\p COMPOSITIONS OF THE iNVENTroN Due to fneir activity, the Cyanoimiuopiperazine Compounds are advantageously uEefiil in veterinar>' aaid human medicine. As described above, the Cyanoirrdnopiperazine Compounds are useful for treating or preventing pain, UI, an ulcer, IBD, lES, an addictive disorder, Parkin-^on's disease, parkinsonism, anxiety, epilepsy, stroke, a seiiure, a poii-Jtic condition, psychosis, :L cogniuve disorder, a memory deficit, restricted brain function. Huntin.gton's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, ■/oniiting, dyskinesia, or depression in an animal in need thereof When administered to an animal, the Cyanoiminopiperazine Compounds are administered as a component of a composition that comprises a pharmaceutically acceptable carrier or escipient. The present compositions, which comprise a Cyanoiminopiperazine Compound, can be administered orally. The C>'anoiminopipera2ine Compounds of the invencion can also be administered by any other convenient route, for example^ by infusion or bolus injection, by absorption through epiiheiiai or mucocutaneous linings (e.g., oral, rectal, and intestinal mucosa, etc.) and can be administered together with another biologically active sgsnt. Adininistrationcanbe systemic or local. Various delivery systems are known, e.?., encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer tlie Cyanoiminopiperazine Compoimd. Methods of administration include, but are not limited to, intradermal, inti'amuscuhir, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginai, transdermal, rectal, by inhalation, or topical, particularly io the eais, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the Telea>je of ±,e Cyanoimmopiperazine Com.pounds into the bloodstream. In specific embodiments, it can be desirable to administer the Cy^anoiminopiper?i:ne Compounds locally. This can be achieved, for example, asw iwt by ivay cf limitation, by local infusion during surgery, topical ^plication, e.g., in conjunction .viih a wound dressing after surgery, by injection, by means of a catheter, by means of a * suppository or enema, or by means of an implant, said implant being of a porous, non-porous jr gelatinous material, including membranes, such as sialastic membranes, or fibers. In certain anbodiments, it can be desirable to introduce the I^^tmoimij^cpiperazine Compounds into the central nervous system or gastrointestinaj tract b luy suitable route, including intraventricular, intrathecal, and epidural injection, and enema. niravGRtiicular injection can be facilitated by an intraventricular catheter, for example, Lttaehed to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use of an inhaler or itbulizer, and fomiulation with an aerosolizing agent, or via perfiision in a fluoiocarbon or yntheiic pulmonary surfactant. In certain embodiments, the Cyanoiminopiperazine Compounds can be formulated as a suppository, with traditional binders and excipienls such as trigiycerides. In anotber embodiment, the Cyanoiminopiperazine Compounds can be delivered in a vesicle, in particular a. liposome (see Langer, Science 249:1527-1533 (1990) and Treat st al.. Liposomes in the Tlierapy of Infections Disease and Cancer 317-327 and 353-365(1989)). In yet another embodiment, the Cyanoiminopiperazine Compounds can be delivered in a controlled-release system or sustained-release system (see, e.g.. Goodson, in MedicnlApplicationsof Controlled Release, i-«pra, vol. 2, pp. 115-138(1984)). Other controlled- or sustained-release systems discussed in the review by Langer, Science 249:1527-1533 (1990) can be used. In one embodiment, a pump can be used (Langer, Science 249:1527-1533 (1990); Sefton, CRC Cril. Ref Biomed Eng. .14:201 (1987); Buchwald etal.. Surgery ^.501 (19S0); and Saudek et al, N. Engl. J. Med. 321:574 (1989)). 61 anoth':;r embodiment, polymeric materials can be used {see Medical Applications of ConiroUed Release (Langer ar,fl Wise eds., 1974); Controlled Drug Bioavailabilit); Dmg Product JJesign and Perfonnance (Smolen and Ball eds., 1984); Ranger and Peppas, ./-Mncromol. Sci. Re\'. Macromol. Chem. ^3:61 (1983); Uvy ei al.. Science 2.2S:l90 (I9S5): Diirin5era/.,.4ii!i. Neurol 25:351 (1989); and Howard eta/., 7. Neurostirg. 71:105 (t9S9i;. In yet ziiother embodiment, a controlled- or .sustained-release sj^em can be placed in proximity of 2 target of flieCj'anoimiDopiperazine Compounds, e.^., tbe spinal column, brain. 31 gastrointestinal tract, thus requiring only a fraction of the sj^temic dose. The present compositions can optionally comprise a suitable amount of a iharmaceutically acceptable excipient so as to provide the form for proper administration to heaciimii. Such phamiaceiitical excipient'? nan be liquids, such as water and oils, Dciading those of petroleum, aoimal, vegetable, oi- synthetic origin, such as peanut oil, ojteart oil mineral oil, sesame oil and the like.. The phamiaceutical excipienls can be atjne, giiTR acacia^ gelatin, starch paste, talc, keratin, colloidal silica, urea and the like. In ddition, aimliaiy-, stabilizing, thickening, lubricating, and coloring agents can be used. In mc emhcdinieni, the phaxmaceutically acceptable excipicnts are sterile ■v>.-hen administered to n animal. Water is a particularly useful excipient when the Cyanoiminopiperazine Compound is administered intravenously. Saline solutions and aqueous dextrose and glycerol soiutions can also be employed as liquid excipients, particularly for injectable solutions. Suitable pliarmaceutical excipients also include starch, glucose, lactose, sucrose, gelatin, mall, rice, flour, chaik, silica gel, sodium stearaie, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The }>resent compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The preseni compositions can take the fomi of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, suf-tained-release fonnulat?ons, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the composition is in the form of a capsule (see e.g.. U.S. Patent No. 5,698,155). Other examples of suitable piiamiaceutical excipients ais descnhed in Remington's Phannaceutical Sciences 1447-1676 (Alfonso R. Gennaro ed., l?thed. 1995). incorporated herein by reference. In one embodiment, the Cyanoiminopiperazine Compounds are tbnnuiaced in accordance with routine procedures as a composition adapted for oral admiuistration to h'-im3ii. beings. Composidons tor oral delivery can be in the form of tablets, lozenges, aqueous or oily suspension"?, granules, powders, emulsions, capsules, syrups, or elixirs, fot example. Orally administered compositions can contain one or more asents^ for example, s'/veeiening agents such as ftuctose, aspartame or sacchaiin; ilavoring agents such as pcppennint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a phannaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract tliereby providing a sustained action over an extended period of time. Selectively permeable mambianes surroimding an osmotically active driving compound are also suitable for orally administered compositions, bi these latter plattbrms, fluid from the environment surroimding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. Tliese delivery platfomis can provide an essentially zero order deliveiY profile as opposed to the spiked profiles of immediate release formulations. A time-delay material such as glycerol monostearate or glycerol steaiate can also be used. Oral ccmpositions can include standard excipients such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. In one embodiment, the excipients are of pharmaceutical grade. In another embodiment, the C>"anoittiinopipera2ine Compounds can be formulated for intravenous administration. T>pically, compositions for intravenous adininistration comprise sterile isotonic aqueous buffer. Where necessary, the compositions can also include a solubilizing agent. Compositions for intravenous administration can optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry iyophiljzed powder or water free concentrate in a hermeticaliy sealed contaioer such as. an ampule ov sachette indicating the quantit>' of active agent. Where the Cyanoiminopiperazine Compounds are to be administered by infusion, they can be dispensed, for example, with an infusion bottle containing sterile phannaceutical grade water or saline. Where the Cyanoiminopiperazine Compounds are administered by injection, an ampule of sterile water for injei.;tior or saline can be provided so that the ingredients can be mixed prior to administration. The Cyanoiminopiperazine Compounds can be administereti by controlled-release: oi sustained-release means or by delivery devices that are well Icnown to those of ordinary skill in the -an. Examples include, bm are not limited to, those described in U.S. : Patent Nos.; 3,845,770; 3,916,899; 3,536,809; 3,598,123; 4.008,719; 5,674,533; 5,059,595; 5,591,767; 5,120,548; 5,073,543; 5,639,476; 5354,556: and 5,733,566, each of which is incorporated herein by reference. Such dosage forms can be used to provide controlled- or sustained-release of one or more active ingredients using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coalings, microparticles, iiposoraes, microspheres, or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled- or sustained-release Ibrmulations known to those of ordinaiy skill in the art, including those describe-d herein, can be readily selected for use with the active ingredients of the invention. The invention thus SQcorapa-^ses single unit dosage forms suitable for oral administration such as, but not limited to, tablets, capsules, gelcaps, and caplets that are adapted for controlled- or sustained-release. Controlled- or suslained-releass pharmaceutical compositions can have a ■:ommon goal of improving dmg ther?.\>y over ';hat achieved by '■heii non -controlled or non- sustained counterparts. In one embodiment, a controlled- or sustained-release composition comprises a minimal amount of a Cyanoiminopiperazine Compound to cure or control the condition in a minimum amount of time. Ad\-antages of controlled- or susiained-relsase compositions include extended activity of the drug, reduced dosage frequency, and increased patient compliance. In addition, controlled- or sustained-release compositions can favorably affect the lime of onset of action or other chaiacleristics, such as blood levels of the Cyanoiminopiperazine Compound, and can thus reduce the occurrence of adverse side sffectE. Conti'olled' or sustained-release compositions can initially release an amount >f a Cyanoiminopiperazine Compound thai promptly produces the desired therapeutic or prophylactic effect, and gradually and continually release other amounts of the !?yanoinimopiperazine Compound to maintain this level of therapeutic or prophylactic effecl )ver an extended period of time. To maintain a constant level of the Cyanoiminopiperazine 3r-rapound in the boiiy, the Cyanoiminopiperazine Compound can be released from the iosage form ai a rate tliat will replace the amoimt of Cyanoiminopiperazine Compound bein: netabolized and excreted from the body. Controlled- or sustairied-release or an active n.gredient can be stimulated by various conditions, including but not limited to, changes in iH, changes in temperature, concentration or availability of enzymes, concentration or vailabiiity of water, or other physiological conditions or compounds. The amount of tlie Cyanoiminopiperazine Compotn?d that is eflective in the reatment or prevention of pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's isease, paiidnsonism, snxietj', qjilepsy, stroke, a seizure, a pruritic conditioii, psychosis, a ognitive disorder, a memory deficit, restricted brain fimction, Himtington's chorea, ALS, ementia, reiinopalhy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression and an be determined by standard clinical techniques. In addition, in vitro or in vivo assays can ptionally bi smployed to help identify optimal dosage ranges. The precise dose to be mployed will also depend on the route of administration, and the seriousness of tlie sndiiion being treated and should be decided according to tlie judgment of the practitioner ■id each patient'.^ circumstances in view of, e.o.. published clinical studies. Suitable effectiv jGagu anoa:itt, however, range from about 10 micrograms to about 2500 milligrams about /er/ 4 b, uithouih they are topically about 100 mg or less. In one embodinif;nt, the effective dosage amount ranges from about 0.01 milligrams to about 100 milligrams of a Cyanoiminopiperazine Compound about every- 4 h, in another embodiment, about 0.020 milligrams to about 50 milligrams about even' 4 h, and in another embodiment, about 0.025 milligrams to about 20 milligrams about ever>' 4 h. The effective dosage amounts described herein refer to total amounts administered; that is, if more than one Cyanoiminopiperazine Compound is administered, the effective dosage arnounts correspond to the total amount administered. UTiere a ce'l capable of expressing VRl, rnGluR5, or mGJuRl ;s contacted with a Cyanoiminopiperazine Compound in vitro, 'Jie amount etfective for inhibiting the receptor ftinction in a cell will typically j-ange from about 0.01 jjg'L to about 5 nig/L, in one embodiment, &om about 0.01 fig/L to about 2.5 mg/L, in another embodiment, from about 0.0] \xg/L to about 0.5 mg/L, and in another embodiment, from about 0.01 pg/L to about 0.25 mg/L of a solution or suspension of a pharmaceutically acceptable carrier or excipient. In one embodiment the volume of .solution or suspension is from about 1 ^L to about 1 IFLL- In another embodiment, the volume of solution or suspension is about 200 nL. VvTiere a celi capable cf expressing VRl, mGluR5, or mGluRl is contacted with a Cyanoiminopiperazine Compound in 'i'ivo, the amoimt effective foi inhibiting the receptor frinction in a cell will typically range from about 0.01 mg to about 100 mg/kg of body weight per day, in one embodiment, from about 0.1 mg to about 50 mg/kg body weight psr dsy, and in aaotber embodiment, from abdut 1 mg to about 20 rngp^kg of body R-ei^t per day. The CyanoiminopiperdZine Compounds can be assayed in vitro or in vivo for the desired therapeutic or prophylactic activity prior to use in humans. Animal model si'Siems can be used to demonstrate safety and efficacy. The present methods for treating or preventing pain, UI, an ulcer, IBD, IBS, an iddictii'e disorder. Parkinson's disease, parldnsonism, anxiety, ^ilepsy, stroke, a seizure, a :jruriiic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain fimction, ^'.mtingion's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, iyskinesia, or depression in an animal in need thereof can fiirther comprise administering to he animal being administered a Cyanoiminopiperazine Compound another therapeutic agent, n one embodiment, the other therapeutic agent is administered in an effective amount. acetaminophen and phenacetin; indole and indene acetic acids, including indometfaacin, sulindac, and elodolac; heteroaryl acetic acids, including tolmetin, diclofenac, and ketorolac; anthiraiiilic acids (fenamates), including mefenamic acid and meclofenamic acid; enolic acids, including oxicams (piroxicam, tenoxicam), and pyrazolidinediones (phenylbutazone, oxyphenthartazone); and alkanones, including nabumetone. For a more detailed description of the NSAJDs, see Paul A. Insel, Analgesic-Antipyretic and A7iti'inflammatory Agents and Di-ugs Employed in the Treatment of Gout, in Goodman.& Gilman 's The Pharmacological Basis of Tlierapantics 617-57 (PerryB. Molinhoff and Raymond W.Ruddon eds., 9''ed 1996) and Glen R. ¥i.m&QT]., Analgesic, Antipyretic and Anti-Inflammato}y Drugs in Remington: TJie Science and Practice of Pharmacy Vol II1196-1221 (A.R. Gennaro ed. 19th :d. 1995) which are hereby incorporated by reference in their entireties. Examples of useful Cox-H inhibitors and 5-hpoxygenase inhibitors, as well as combinations thereof, are described in U.S. Patent No. 6,136,839, which is hereby ncorporated by reference in its entirety. Examples of useful Cox-11 inhibitors include, but are lot limited to, rofecoxib and celecoxib. Examples of usefijl antimigraine agents include, but are not limited to, lipiropride, dihydroeigotamine, dolasetron, ergocomine. ergocominine. ergocryptbie, ergot, Tgotamine, iluciedroxone acetate, fonazine, lisiiiije, lomerizine, methysergide oxetoroiic, )izotyline, and mixtures thereof The other therapeutic agent can also be an agent use&l for reducing any lotential side effects of a Cyanoiminopiperazine Compounds. For example, the other herapeutic agent can be an antiemetic agent Examples of usefiil antiemetic agents include, lui are not limited to, metoclopromide, domperidone, prochlorperazine, promethazine, hlorpromazine, trimethobenzamide, ondansetron, granisetron, hydioxyzine, acetylleucine icnoetlianolamine, alizapride, azasetron, benzquinamide, bietanautine, bromopride, uclizine, clebopride, cyclizine, dimenhydrinate, diphenidol, dolasetron, meclizine, lethaljatal, metopimazine, nabilone, oxypemdyl, pipamazine, scopolamine, sulpiride, :U-a]iydrocamiabinoI, thiethylperazine, thioproperazine, uropisetron, and mixtures thereof. Examples of useful i3-adrenergic blockers include, but are not limited to, ccbutolol, alprenolol, amosulabol, arotinolol, atenolol, beiunolol, beraxolol, bevantolol. iaoproiol. bopiiidr-Iol, bucunioloL bufetoloi, bufiiiaiol, bunitrolol, bupranolol, butidrine hydrochloride, butofilolol, carazolol, carteolol, cai-veditol, celiprolol, cetamolol, cloranolol, dilevalol, epanolol, esmolol, indenolol, labetalol, levobunolol, mepindolol, metipraoolol, metoprolol, moprolol, nadolol, nadoxolo!, nebivaloj, nifeiiaioi. nipradilol, oxprenolol, penbutolol, pindolol, practolol pronefealol, propranolol, sotalol. sulfinalol, talinoiol, i tcrtatolol, tilisolcl, timolol, toliprolol, and xibenolol. Examples of useful anticonvulsants include, but are not iimiied to, acetylpbenetunde, albutoin, aloxidone, aminogluiethimide, 4-amino-3-hydroxybutyric acid, atrolactamide, beclamide, buramate, calcium bromide, carbarnazepine, cinromide, clomethiazole, clonazepam, decimennide, diethadione, dimethadione, doxenitroin, eterobarb, ethadione. etlriosuximide, ethotoin, felbamate, fluoresone. gabapeniiti, 5-hydroxytryptophan, lamotrigine, magnesium bromide, magnesium sulfate, mephenytoin, mephobarbital, metharbital. methetoin. methsuxiinide, 5-methyl-5-(3-pheitanthryl)-hydantoin, 3-inethyl-5-phenylhydantoin, naicobaibital, nimetazepam, nitrazepam, oxcarbazepine, paramethadione, phenacemide, phenetharbital, pheneturide, phenobarbital, phensuximide. pbenylmethylbaibituric acid, phenytoin, phethenylate sodiiun, pofas-num bromide, prtgabaline, primidone, progabide, sodiran bromide, solanum, strontiom bromide, suciofenide, sulthimne, tetrantoin, tiagabine, topiramate, trimchadioue, valproic acid, valpromide, vigabatiin, and zonisamide. Examples of useful antidepressants include, but are not limited to, binedaJine, caroxazone, citaloprara, dimethazan, fencainine, indalpine, indeloxazine hydrocholoride, nefopam, nomifensine, oxiiriptan, oxypertine, paroxetine, sertraline, fliiazesim, trazodone, betjmoxine, ipioclozide, ipxoniazid, isocaiboxazid, nialamide, octamoxin, phenelziiie, cotinine, rolicyprine, rolipram, maprotiline, metraliadole, mianserin, mirtazepine, adinazolaai, amitriptyline, amitriptylinoxide, amox^ine, butript>'Iine, clomipramine, demeyiptiline, desipranaine, dibeazepin, dimetaciine, dothiepin, doxepin, fluacizine, imipramine, imipramine N-oxide, iprindole, lofepramine, melitracea. metapramine, nortriptyline, noxiptilin, opipramol, pizotyiine, propizepine, protriptyline, quinupramine, lianepdne, trimipramine, adrafinil, benactyzine, bupropion, cutacetin, dioxadrol, duloxetine, etoperidone, febarbamate, femoxetine, fenpentadiol, fluuxetire, fluvoximiiue, heinatoporphyrin, hypericin, levophacetoperane, medifoxamins, niilnacipran, minaprine, racciobemidti, nefazodone, oxaflozaixe, piberaline, proUatane, pyrisuccideauoL. ritanserin. The present methods for inhibiting VRI function in a cell capable of expressing VRl can further comprise contacting the cell with an effective amount of another therapeutic agent. The present methods for inhibiting mGluil5 function in a cell capable of expressing mGiuR5 can further comprise contacting the cell with an effective amount of iii?,oi!ier therapeutic agent. The present methods for inhibiting mGluRl function in a cell capable of expressing mOluRl can further comprise contacting the cell with an effective amount of another therapeutic agent. The other Iherdpeutic agent includes, but is not iimiied to, an opioid agonist, a non-opioid analgesic, a non-steroid anti-inflanunatory agent, an antimigraine agent, a Cox-II inhibitor, an aniiemetic, a p-adrenergic blocker, an anticonvulsant, an antidepressant, a Ca2+-chaim6l blocker, an anticancer agent, an agent for treating or preventing UI, an agent tor treating or preventing an ulcer, sn agent for treating or preventing BD, an agent for ti'ealing or preventing IBS, an agent for h-ealing addictive disorder, an agent for treating PavkiiL^on's disease and parkinsonism, an ageut for hrcating anxiety, an agent for treating spt'.epsy, ao agent for treating a strokcj an agent for treating a seizure, an agent for treating a prj-rrtic condition, an agent for treating psychosis, an agent fcg- treating Huntington's cfiOieci, ai: ageur for treating ALS, an ageni for treating a cognitive disorder, an agent tor treating a tnigi'aiije, an agent for treating vomiting, an agent for treating dj^kinesia, or an agent for tieating depression, and mixtures thereof. Effective amounts of the other thia^eutic ^ents are well known to those skilled in the art However, it is well within the skilled artisan's purview to determine the other iherapeutic agent's optimal effective-aniount range, hi one embodiment of the ■ invention, where another therapeutic agent is administered to an animal, the effective amount ■jf the Cyanoiniinopiperazine Compound is less than its effective amount would be where the Dther therapeutic agent is not administered. In this case, without being bound by theory, it is jslioved tl-.:-i.t tlie Cyanoiniinopiperazine Compomids and the other therapeutic agent act jvnergistically to treat or prevent pain, UI, an ulcer, IBD, IBS, an addictive disorder, ■"arkinson's disease, parkinsonism, anxiery, epilepsy, stroke, a seiztu-e, a pruntic condition, ;.=ychosii, a cognitive disorder, a memory deficit, rectricted brain function, Huntington's chorea., ALS. dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression. Examples of useflil opioid agonists include, but are not limited to, alfentanil, ailyiprodine, alphaprodine, anileridine, benz\'lmorpiiine, bezitraniide, buprenoiphine, biitorphanol, clonitazene, codeine, desomorphine, dextromoramide, dezocine, diampromide, diaraorphone, dihydrocodeine, dihydromorphine, dimenoxadol, dimepheptaiioi, dimethylthiambutene, dioxaphetyl butyrate, dipipanone, eptazocine, ethoheptazine, ethybnetliylthiambutene, ethylmorphine, etonitazene fentanyl, heroin, hydrocodone, bydromorphone, hydroxypethidine, isomethadone, ketobemidone, ievorphanol, ievophenacylmorphan, lofentanii, meperidine, meptazinol. metazocine, roethadone, metopon, morphine, myrophine, nalbuphine, narceine, nicomorphine, norlevorphanol, nonnethadone, ualorpliiiie, noimorphroie, norpipanone, opium, oxycodone, oxymorphone, papaveretum, pentazocine, phenadoxone, phenomocphan, phenazocine, phenoperidine, piminodine, piriiramide, proheptazine, promedoi, properidine, propiram, propoxypiieae, sufentanil, tilidine, UaiDadol, phannaceuticaLly acceptable salts thereof, and mixtures thereof In ceitain embodiments, Ihe opioid agonist is selected from codeine, hydromorplioiie, nydrocodone, oxycodone, dihydiocodeine. (^lydToniurphmc. moipiiine, tramadol, oxjinorphone, pharmaceuticaliy acceptable salts thereot^ and inixtiiiei; thereof. Examples ofusefulnou-opioid analgesics include non-steroidal. mti-inflamniatory agents, such as aspirin, ibuprofeh, diclofenac, naproxen, benoxaprofen, 3urbiprofen, fenoprofen, flubufen, ketoprofen, indoprofen, piroprofen, caiprofen, ox^rozin. jramoprofen, muroprofen, trioxaprofen, suprofen, aminoprofen, tiaprofenic acid, fluprofen, )ucloxic acid, icdomethacin, sulindac, tolmetin, zomepirac, tiopinac, zidometacin, icemstacii!. fsaliazac, clidanac, oxpinac, mefenamic acid, meclofenamic acid, flufenamic xid, niflumic acid, tolfenamic acid, diflurisal, flufemsai, piroxicam, sudoxicam, isoxicam, aid pharmaceutically acceptable salts thereof, and mixtures thereof- Other suitable :cr-opioid .-malgesics inchidc the following, non-limiting, chemical classes of analgesic, intip>TCtic, nonsteroidal anti-inflammatory drags: salicylic acid derivatives, including ispirLiL, liodiom salicylate, choline magnesium trisalicylate, salsalate. diflunisal, ■alicylsalicylic acid, sulfasalazine, and olsalazin; para-aminophennol derivatives including roxindole, rubidium chloride, sulpiride, tandospirone, thozalinone, tofenacin, toloxatone, traQylcypromine, L-tryptophan, venlafaxine, %-iloxazine, and zimeldiiie. Examples of useful Ca2+-chaimel blockers include, but are not limited to, bepridil, clentiazem, diltiazera, fendiline. gaUopamil, mibe&adil, prenylainine, semotiadil, terodiline, verapamil, amiodipine, aranidipine. baniidipine, benidipine, cilnidipine. efoDidipiiie, elgodipine, felodipine. isradipine, lacidipine, lercanidipine. tnanidipiiie, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipLne, nitrendipine, cinnarizine, flimarizine, iidoflazine, lomerizine, bencyclane, etafenone, fantofarone, and peibexiline.. Examples of useful anticancer agents include, but are not limited to, acivicin. icUirubicin, acoda^ole hydrochloride, acronine, adozelesin, aldusle'jkin, altretamine, . ■ ambomycin, ametantrone acetate, aminoglutethirmde^ amsacrine, anastrozole, anthramycin, asparaginase, asperlin, azaciiidine, azetepa, azocomycin, batiinastat. benzodepa, bicaiutamjde, bisantrene hydrochloride, bisnafide dimesylate, lazelesin, bleomycin sulfate, brequinar sodium, bropiriraincbusulfan, cacunomycin, calusterone, caracemide, carbeliraer. caiboplatin, carmustine, canibicin hydrochloride, carzelesin, cedeiiDgol, chlorambucil,, circieniycin, cisplatin, cladribine, crisnato! mesylate, cyclophosphamide, c;;,'tarabine, dacaib;izinc, dactinomycin, daunorubicin hydrochloride, decitabme, dcxormaplaiin, dezaguanine. dezaguanine mesylate, diaziquone, docetaxel, doxonibicL-i, doxorubicin hydrochloride, droloxifene, droloxifene citrate, dromostanolone propionate, duazomycin, edatrexate, efloinithine hydrochloride, elsamitrucin, enloplatin, eapromate, epipropidine, epimbicin hydrochloride, erbulozole, esorubicin hydrochloride, estramustine, estramustine phospliate sodium, etanidazole, etoposide, etoposide phosphate, etoprine, fadrozole hydrochloride^ fazarabine, fenretinide, floxuridine, fludarabine phosphate, fluorouracil, flmocitabine, fosqiridone, fosiriecin sodium, gemcitabine, gemcitabine hydrochloride, faydroxyurea, idarabicin hydrochloride, ifosfamide, ilmofostne, interleukin IE (including recombinant interleukin IT or rIL2), interferon aifa-2a, interferon alfa-2b, uiterferon alfa-nl interferon alfa-n3, interferon beta-1 a, interferon gamma-I b, iproplatin, hinotecan hydrochloride, lanreotide acetate, letrozole, leuprolide acetate, liarozole hydrochloride, !i;'inetrexoi sodium, loinusliue, losoxantrone hydrochloride, raasoprocol. maytansine, rnechicrtthamine hydrochloride, megestrol acetate, raelengestrol acetate, melphatan. menogaril, mercaptopurine, methotrexate, methotrexate sodium, metopiine, mtituredepa. mitindomide, mitocarcin, mitocromin. milogiUin, mitomalcin, mitomycin, mitosper, mitotane, mitoxaotrone hydrochloride, mycophenolic acid, nocodazole, nogalaraycin, ormaplatiji, oxisuran, paclilaxel, pegaspargase, peliomycin, pentamustine, peplomycin sulfate, perfosfamide, pipobroman, piposulfan. piroxantrone hydrochloride, plicamycin, piomestane, porfimer sodium, porfiromycin, prednimustine. procarbazine hydrochloride, 3uromycin, puromycin hydrochloride, pyrazoiurin, riboprine, rogietimide, safingol, safingol iiydrochloride, semustine, simtrazene, sparfosate sodium, sparsomycin, spirogermanium lydrochloride, spiromustine, spiroplatin, streptonigrin. streptozocin, sulofenur, talisomycin, :ecogalan sodium, tegafiir, teloxantrone hydrochloride, temoporfin. teniposide, teroxirone, estolacione, thiamiprine, thioguanine, thiotepa, tiazofimn, tirapazamine, toremifeiie citrate, restolone acetate, triciribine phosphate, trimetrexate, trimetrexate glucuronate, triptorelin, ubulozole hydrochloride, uracil mustard, uredepa, vapreotide, verteporfin, vinblastine . iulfate, vincristine sulfate, vindesine, vindesine sulfate, vinepidine sulfate, vinglycinate iulfate, vinieurosina sulfate, vinocclbine tartrate, vinrosidine sulfate, viozolidine fnilfate, . 'orozole, zeniplatin, zinostatin, zorubicin hydrochloride. Examples of other anti-cancer drugs include, but are not limited to, ;0-epi-],25 dihydrox>vifainin D3; 5-ethynyluracil; abiraterone; aolarubicin; acylfulvene; decypenol; adozelesin; aldesleukin; AIX-TK antagonists; altretamine; aisbajuudtine; midox; amifostine; aminolevulinic acid; anuubicin; amsacrine; anagrelide; anastrozols: ndrographoiide; angiogenesis inhibifcrs; antagonist D; antagonist G; antarelix; nti-dorsaljzing morpfaogenedc protein-1; antiandrogen, prostatic carcinoma; antjestrogen; ntineoplaston; antisense. oligonucleotides; aphidicolin glycioate; ^optosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; alaroestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin IE derivatives; balanol; batimastat; BCR/ABL antagonists; benzochloi'ins; benzoylstaurosporine; beta lactam derivatives; beta-aletbine; betaclamycin B: betuHnic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide: bistratene A; bi^elesin; breflate; bropiiimine; budotitane; buthionine suifoximine; calcipolricl; calphostin C; camptothecin derivatives; canarypox IL-2: capecitabine; ca-iboxamide-amino-triazole; carboxyamidotriazole; CaRestVB; CAiC cetroreiix; chlorkis; chloroquinoxaUne sulfonamide; cicaprost; cis-porphyrin; cladribine; clomifene analogues; clotrimazole; collismycm A; colhsmycm B; combretastatm A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol, cryptophycin 8; cryptophycin A derivatives; curacin A; cyclop entanthraquiiiones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cyiostatin; dacliximab; decitabine; dehydrodideranin I desiorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethyhiorspermine; dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamyci diphenyl spiromustiiie; docetaxel; docosanol; dolasetron; doxitluridine; droloxifene; dronabinol; duocarmycin SA; ebseien; ecomustiiie; edelfosine; edrecolomab; efiomithine; elemene; emitefUr; epirubicin; epristeride; estraniu.'Jtine analogue; estrogen agonists; estroge: antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabioe; fenretinid' filgrastim; finasteride; ilavopiridol; flezelastine; fliiasterone; fiudarabine; fluorodaunorunicii hydrochloride; forfenimex; formestane; fostriecin;-fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; getatinase inhibitors; gemcitabtne; glutathione inhibitors; hepsulfam; heregulin; hexamethylenc bisacetamide; bypericin; ibandronic acid;' idarubicin; idoxifeiie; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquiincd; immunostimulant peptides; insulin-like growth factor-1 recepttsr irihibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, ^; iroplaci; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; Iqitolstatin; letrozole; leukemia inhibiting factor, leukocyte alpha interferon; leuproUderestrogen+progesterone; leuprorelin; ievamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; Upophilic platintnn compounds; lissoclinamide 7; lobaplaiin, lombricine; lometrexol; lonidaniine; losoxantrone; lovastatin; loxoribine; hutoi;ecan; lutelium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A: maiimastat: masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; raerbarone; metM"elin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltsfosine: roirimostim; mismatched double stranded RNA; mitoguazone; mitoiadol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; naitoxantrone: mofarotene; raolgramostira; monoclonal antibody, human chorionic gonadolTophin; monophosphoryl lipid A+myobacterium c^Al v^'all sk; mopidamol; m\iltiple drug resistance gene inhibitor; multiple tumor suppressor 1-based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acet;/ldinaline; N-substiruted benzamides; nafarelin; nagrestip: naloxone+pentazocine; napavin; naphteipin; nartograstim; nedaplatin; nemorubicin; neridroruc acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitmllyn: 06-benz\-lguamne; octreotide; okicenone; oligonucleotides; onapristone; ondansen-on; ondansetron; oracin; oral cytokine inducer; onnaplatin; osaterone; oxaliplatin; oxaunomycin;pacIitaxel; paclitaxel analogues; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidroiiic acid; panaxytriol; panomifene; parabactin; pazeiiiptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubrnn; perfostamide; perillyl aicobol; pheoazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placeiiu A; piacetin B; plasminogen acrivator inhibitor, platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; prbteasom.^ inhibitoi's; protein A-cased immune moduiator: protein kinase C inhibitor; protein kinase C inhibitois, microalgal; -proieLn tyrosine phosphatase inhibitors; purine nucleoside phosphoiylase inhibitors; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf mtagonists; raltitrexed; ramosetron; ras fame-ryl protein transferase inhibitors; ras irii'.bitors: ras-GAP inhibitor; iBtelUptine demethylated; Thenixim Re 186 etidronaie; rhizosin; ibozyines; RH retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubigjnone Bl: ■uboxyl: safingol; saintopin; SatQNfU; sarcophytolA; sargramostim; Sdi 1 mimetics; lemustine; senescence derived inhibitor 1: sense oligonucleotides; signal transduction nhibitors; signal transduction modulators; single chain antigoi binding protein; stzofiran; obuOTxajie; sodium boroc^tate; sodium phenylacetate; solverol; somatomedin binding notein; sonennin; sparfosic acid; spicamycin D; spiromustiae; spienopentin; spongistatin 1; qualamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin ihibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; iiramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; iuromustb£; tazarotene; tecogalan sodium; tegatiir; reliurapyrylium; telomerase inhibitors; unoportin; temozoloniide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblasiine; lic-corali^e; ibrombopoietin; thtombopoietin mimetic; th^Tnalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazaniine; titariOcene bichloride; topsemin; toremifene; totipotent stem ceil factor; translation inhibitoi tretinoin; triacetyluiidine: triciribine; trimetrexate; tiiptoreiin; tropisetrcn; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived > gi'ov/th inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocjae gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaitine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer. , Examples of usefiirtherapeutic agents for treating or preventing UI include, b^it art not limited to, propantheline, imipramine. hyoscyamine, oxybutynin, and dicyclomm I Examples of useful therapeutic agents for treating or preventing an ulcer include, antacids such as aluminum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicaitionate; sucraflate; bismuth compounds such as bismuth subsalicylate and bismuth subcitrate; Hj antagonists such as cimetidine, ranitidine, famotidine, and nizatidine; IT", S.' - ATPase inhibitors such as omeprazole, iansoprazoie, and lansoprazole'. cnrbeocixolone; misprosiol; and antibiotics such as tetracycline, metionidazole. timidazole, claiitiiroir.i'cin, and amoxicillin. Examples of useiul therapeutic agents for treating or preventing IBD JBclude, but are not limited to, anticholinergic drugs; diphenoxylate; loperamide; deodorized opium tincl-iire: codeine; broad-spectnim antibiotics snch as metronidazole; sulfasalazine; olsalazie; mesalamine; prednisone; azathioprine; mercaptcpurine; and methotrexate. Examples of usefUl therapeutic agents for treating or preventing IBS include, but are not limited to, propantheline; muscarine receptor antogonists such as pirenzapine, methoctramine, ipratropium, tiotropium, scopolamine, methscopolamine, homatropine, homatropBif. methyibroroide, and tnethzntheline; and aatidiarrbeal drugs such as diphcuoxyiate and loperamide. Examples of usefbl therapeutic agents for treating or preventing an addictive disorder include, but are not limited to, methadone, desipramine, amantadine, fluoxetine, buprenorpjiic'e, an opiate agonist, "'-phenoxypvndine, bvomethadyl acetate hydrochloride, and serotonin antagonists. Examples of useful therapeutic agents for treating or preventing Parkinson's disease and parkinsonism include, but are not limited to, carbidopa/lev'odopa, pergolide. bromocriptine, ropinirole, pramipexole, entac^one, tolcapone, selegiline, amantadine, and trihexyphenidyl hydrochloride. Examples of useful therapeutic agents for treating or preventing anxiety-include, but are not limited to, benzodiazepines, such as alprazolam, brotizolam, chiordiazepoxide, clobazam, clonazepam, clorazepate, demoxepam, diazepam, esiazoiam, flumazenil, flurazepani, halazepam. lorazepam; midazolam, nitrazepam, nordazepam, oxazepam, prazepam, quazepam, temazepam, and triazolam; non-benzodiazepine agents,. such as buspirone, gepirone, ipsaprione, tiospirone, zolpicone, Zolpidem, and zaleplon; tranquihzers, such as barbituates, e.g.^ amobarbital, aprobarbital, butabarbital, butalbital, mephobaibhal, niethobexital, pentobarbital, phenobarbital, secobarbital, and thiopental; and propanediol carbamates, such as meprobamate and tybamate.- Examples of useful therapeutic agents for treating or preventing epilepsy include, but are not limited to, caibamazepine, ethosuximide, gabapentin, lamotrignine, pheiiobarbital, phenj^oin, primidone, valproic acid- trimethadione, bemzodiaepines. gabapentin, laraotrigine, y-vinyl GAB.\, acetazolamide. and felbamate. ' '- Examples of useful therapeutic agents for treating or preventing stroke include,bui are not limited to, anticoagulants such as heiJarin, agents that breakup clots such as streptokinase or tissue plasminogen activator, agents that reduce swelling such as maniutcl or corticosteroids, and acetylsalicylic acid. Examples of usefiil therapeutic agents for treating or preventing a seizure include, but are not limitedto, carbamazepine, ethosuximide, gab^entin, lamotrignine, 3henobarbital, phenytoiit, primidoae, valproic acid, trimethadione, betnzodiaepin«i, gabapentin, laraotiigine, 7-vuiyl GABA, acetazolamide, and felbamate. Examples of usefiil therapeutic agents for treating or preventing a pruritic ;oQdilion inchide, but aie not limited to, naltrexone; nalmefene; danazol; tricyclics such as unittiptyline, imipramine, and doxepin; antidepressants such as those given below, menthol; :amphor; phenol; pramoxine; capsaicin; tar, steroids; and antihistamines. Examples of useful therapeutic- agents for treating or preventing psychosis delude, bui are not limited to, phenothiazines such as chlorpromazine hydrochloride, tiesoridazine besylate. and thoridazine hydrochloride; thioxanthenes auch as hloToprothixenft and thiothixene hydrochloride; clozapine; risperidone; olaiizapuT,^:; quetiapine; quetiapine fumarate; haloperidol; haloperidol decanoate; loxapine succinate; molindone hydrochloride; pimozide; and ziprasJdone. Examples of usefiil therapeutic agents tor treating or preventing Huntington" :horea include, but are not limited to, haloperidol and pimozide. Examples of usefUl therapeutic agents for treating or preventing ALS include )ut are not limited to, baclofen, nsurotrophic factors, rilii;:ole, tizanidine, benzodiazepines ■uch as cionazepan and dantrolene. Examples of usefizl therapeutic agents for treating or preventing cognitive isoiders include, but are not limited to, agents for treating or preventing dementia such as icnne; dciepezil; ibuprofen; antipsychotic drugs such as thioridazine and halop^nidol; and niidepressant drugs such as those given below. Examples of usefiil therapeutic agents for treating or preventing a migraine iclude, but are not limited to, sumatriptan; methysergide; ergotamine; caffeine; and beta-ockers 5uch as propranolol, verapamil, and divalproex. Examples of useful therapeutic agents for treating or preventing vomiting elude, but are not limited to, 5-HTj receptor antagonists such as oudansetronj dolasetron, anisetron, and tropisetron; dopamine receptor antagonists such as prochlorperazine, iethylperazine. chlorpromazin, ffletoclopraniide, and doniperidone; glucocorticoids 3iich as xamethasone; and benzodiazepines such as lorazepam and alprazolam. Examples of usefol vhen^ieuiic agents for treating or pieveoting dyskinesia :iude, but are not limited to, reseipine and tetrabenazine. Examples of usefiil therapeutic agents for treating or preventing depression lude, but are act limited to, tricyclic antidepressants such as amitryplyliae, amoxapine. sropion, ciom^praniine, desipramine, doxepin, imipramine, m^rotilinr, nefazadone, triptjline, protriptyline.. trazodone, trimipramine, and venlaflaxine; selective serotonin ptake inhibitors such as fluoxetine, fiuvoxamine, paroxetine, and setraline; monoamine dase inhibitors such as isocarboxazid, pargyline, phenelzine, and tranylcypromine; and chostirculants such as dexti'oamphetamine and inethylphenidate. A Cyanoiminopiperazine Compound and the other ther^euric agent can act i'iivcly \jr, in One embodiment, synergistically. In one ernbodinieiit, a uoirainopiperazine Compound is administered concurrently with another therapeutic agent. In one embodiment, a composition comprising an effective amount of a Cyanoiminopiperazine Compound and an effective amount of another therapeutic agent can be administered. .Mtematively, a composition comprising an effective amount of a Cyanoiminopiperazine Compound and a different composition comprising an effective '; amount of another therapeutic agent can be conciurently administered. In another embodiment, an effective amount of a Cyanoiminopiperazine Compound is administered prior or subsequent to administration of an effective amount of another therapeutic agent. Ii thir. embodiment, the C>'anoiminopiperazine Compound is admimslered while the other therapeutic agent exerts its therapeutic effect, or the other therapeutic agent is administered vvMle the Cyanoiminopiperazine Compound exerts its preventative or th^apeutic etTeci for treating or preventing a Condition. " A composition of Ihe invention is prepared by a method con:prismg admixing a Cyanoiminopiperazine Compound or a pharmaceuticaily acceptable salt and a pharmacetitlcally acceptable carrier or excipieut. Admixing can be accomplished ixsioe iitethods well known for admixing a compound (or salt) and a phaiinaceutically acceptable cai-rier or excipient. In one embodiment the Cyanoiminopiperazine Compound or the phAroiacc'itically dcceptable ?alt ci the Compound is present in the composition in an etfective amoimt. 4.19.2 Kitq The invention encompasses kits that can simplify flie admimstiation of a Cyanoimhjopiperazine Compound to an animal. A typical kit of the invention comprises a unit dosage form of a C>'anr'imLi.opiperazine Compound. In one embodinient, the unit dosage form is a container, which can t-s sterile, containing an effective amount of a Cyanoiminopiperazine Compound acd a piirtrma^eutically acceptable carrier or excipient 'ITie kit can further comprise a label a printed instructions instracting the use of the Cyanouninopiperazine Compound to treat pain, Ul, an ulcer, IBD. IBS, an addictive disorder, Parkinson's disease, parfdnsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, demenrla, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depieisioo. Tnekit c&iialso fiirther comprise a unit dosage form of another therapeutic agent, for example, a container containing an effective amount of the other ther^eutic agent, hi one embodimeat, the kit comprises a container containing an effective amount of a Cyanoiminopiperazine Compound and an effective amount of another therapeutic ageni. Examples of other therapeutic agents include, but are not limited to, those listed above. Kits of the mvemion can further comprise a device that is useful for admiiastering the unit dosage forms. Examples of such a device includes, but are not limited to, a syringe, a drip bag, a patch, an inhaler, and an enema bag. The following examples are set forth to assist in understanding the invention avi 5. EXAiWl'LES Examples 1 -i relate lo the synihesi? of illustrative Cyanoim.-nopiperazii Compounds. 5.1. Example 1: Synthesis of Componnd AAA CI H CI ^ Tnethylamine, "■^^ DMSO SOV CI n --^-^N ^N. ^N NH^ + P N H I DCM room !emp. a NH A~~^ or toluene at 1 OO^C O cr jp n "rr H —CN ■NH {CH;0CH2CH2)20 75"C 1 ci- .N.. Compouud AAA 2,3-Dichloropyridine (15.0 g, 101.6 mmol), piperazine(9.7S g, 113.70minoll and triethylamine (14.36 g, 141.95 nrniol) were dissolved in 300 mL of DMSO and the resulting mixture was heated at about 80°C for about 24- h. The reaction mixtuie war. then cooled to room temperature and extracted with a saturated aqueous sodium bicarbonate solution. The organic layer was dried, concentrated, and purified using a silica gel column eiuted with a gradient eJution from ethyl acetate to 2:1 ethyl acetate:inethano] to provide N-(3-chloropyridiii-2-yl)-pipera2ine (compound 1) as a yellow liquid. A solution diphenylcyanocarbodunidate (Commercially available from Sigma Aldrich, St. 1-ouis, MO (www.sigma-aldrich.com)) (0.5 mmol) and 4-/err-butylani]ine (0.5 mmol) in 1.5 mL of DCM was stirred at room tejuperature tor aboui 12 h. The mixnire was concentrated under reduced pressure to provide compound 2, which was used directly in the nexi step v/ithout further purification. A solution of compound 2, prepared as described above, and compound 1 (0.5 nmiol), prepared as described above, in ] .5 mL of .Z-methoxymethylethei" was stirred at about 75'C foraboul 12 h. The solution was cooled to room temperature and purified using d-Trect Gash chromatography on a silica gel column eiuted with a gradient elution from 1:10 ethyl acf;t:te:I>exai:eio 1:1 ethyl acemteihexane to provide Comp The identity of compound AAA was confirmed using 'H NMR. Compound A.\A: 'HNMR (CDCIj) 5 9.19(dd, J = 13,4.7 Hz, IH), 6.62 (dd, J =--1,5, 7.S K2, IH), 7.3S (d, 3 = 8.5 Hz, 2H), 7.18 (b, IH), 7.01 (d, J = S3 Hz,. 2H), 6.91 (dd, J = 4.7, 7.8 Hz, IH), 3.58 (m, 4H), 3.34 (m, 4H), 1.33 (s, 9H) ppm. 5 J.. Example 2: Synthesis of Compound AAl Compound AAI was prepared by a procedure analogous to that t-sed to irepare Compound AAA except that 4-trifluoTomethoxyamline was used in plaire oi'4-tert' jutylaniline feield 78%). The identit}' of compound AAI was confirmed using 'H NMR. CompoundAAI: 'HNMRfCDC!j)6 8.19(dd, J = 1.6,4.7llz, lH),7.62(dd, '■ - 1.6, 7.S Hz, IH), 7.26 (b, IH), 7.24 (d, J - 9.0Hz, 2H), 7.12 (d. J - S.O fiz, 2H), 6.92 (dd, = 4.7 Hz, iH), 3.59 (m, 4H), 3.35 (m, 4H) ppm. 5 ) To a solution of 2-(l-cyclohexenyl>ethybiiiine 3 {125.2 rag, 1-0 mmol) in 2-ciethoxyethyi etlier (3.0 luL) wa;3 added diphenykyanocarbodiniidate (commercially available from Sigma-Aldrich, St. Louis, MO (www.sigma-aldricii.com)) (238.2 mg, 1.0 mmol) at rcorc Itvinpeniture. The resultant reaction mixture was heated to about 80° C and allowed lo stir at 80" C for about 5 h. (R)-l-(3-chloro-pyridin-2-yI)-3-methylpiperazine4 (211.6mg, 1.0 mmol) was added to the reaction mixture and the reaction mixture was heated to about 140" C Mid allowsd to stir at about HO" C for about 12 h. The reaction mixture was dien cooled to room temperature and purified using flash chromatography on a silica gel column eluted with ^thvi acetate/hexane (10:90 to 50:50) to provide compound DEY as a slightly yellow product. Cori]pouud 4 was prepared by a procedure analogous to that used to prepare Compound 1, as described above in Example 1, except that (R)-3-methylpiperazine (coronieTcially available from Sigma-Aldrich, Si. Louis. MO (www.sigma-aldrich.com)) was used in place ofpiperazins. The ideniity of compound DEY was confirmed using 'H NMli and mass specu'O'icopy (MS). Compound DEY; 'H NMR (CDCy 5 8.20 (dd, .T = 1.8, 4.9 Hz, IH), 7.63 (dd, J=1.8,7.8Hz, IH), 6.91 (dd, J=4.9, 7.8H2, 1H),5.61 (br,s, lH),4.S0(m, lH),432(m, IH). 3.S0 (m, 3H), 3.63 (m, 2H), 3,42 (m, IHl, 3.10 fm, IH), 3.00 (m, IH), 2.31 (m, IH), 2.05 (m, 2H), 1.96 (m, 2H), 1.64 (m,5H), 1.43 (m, 3H)ppm. MS:m/e3S7.6 5.5. Example 5: Binding of Cvanoiminopiperazine Compounds to mGluRS The following assay can be used to demonstrates Cyanoiminopipereazine Corapoimds that bind to and modulate the activity of mG)uR5. Cell cultures: Primary glial cultures are prepared from conices of Sprague-Dawiey IS days old,embryos. The cortices are dissected and then dissociated by trituration. The resulting ceil horaogenate is plated onto poly-D-lysine precoated T175 flasks (BIOCOAT. commercially available Jrom Becton Dickinson and Company Inc. of Franklin Lalces, NJ ) in Dulbelcco's Modified Eagle's Medium ("DMEM," pH 7.4), buffered with 25 mM HEPES> and siippiernenied witli 15% fetal calf sennn ('TCS." comiriercially available from Hyclone I-abcralories Inc. -jf Omaha, NE ), and incubated at 37°C and 5% CO,. .fVfter 24 hours. FCS sitppleojentarion is reduced to 10%. On day six, oligodendrocytes SJKI microgUa are removed by strongly tapping the sides of the Casks. One day following this purification step, secoadary astrocyte cultures are established by subplatii^ onto 96 poly-D-l^^ine precoated T175 fiasks (BIOCOAT) at a density of 65,000 cells/well inDMEM and 10% FCS- A/ter 24 hours, the astrocytes are washed with serum free medium and ttien cultured inDMEM, without glutamate,supplernented with 0.5% FCS/20mMHEPESJ.0ng/mL epidermal . -giowth factor ("EOF'), 1 roJv'I sodium pyruvate, and IX penicillin/streptomycin at pH 7.5 for 3 to 5 days at 37°C and 5% COj The procedure allows the expression of the mGiuB.5 receptor by astrocytes, as demonstrated by S. Miller el ai, J. Neurosdence IK9):6i03-6109 (1995). Assay Protocol: Aiter 3-5 days incubation 'Mth EGF, the astrocytes are washed with 127 niM NaCi, 5 mM KCL 2 mM MgCK. 700 mM NaH,P04.2 mM CaCl^, 5 m>4 NaHCO^, . a mlvl HEPES, ] 0 mM Glucose at pH 7.4 ("Assay Buffer") and loaded with the dyfi Fluo-4 (connr.erc-ialii' available from Molecular Probes Inc. of Eugene, OR) using 0.1 nil. of Assay Buffer containing Fluo-4 (3 mM fmal). After 90 minutes of dye loading, the cells are then washed twicswith 0.2 mL Assay Buffer and resuspended in 0.1 nd. of iVssay Buffer. The plates containing the astrocytes aie then transferred to a Fluorometric Imaging Plate reader (commercially available from Molecular Dewes Coiporation of Sunnyvale, CA) for the assessment of calcium mobilization flux in the presence of glutamate and in the presence or absence of antagonist. After monitoring fluorescence for 15 seconds to establish a base line, DMSO solutions containing various concentrations of a Cyanoiminopipereazine Compound diluted in Assay Buffer (0.05 mL of 4X dilutions for competition curves) ai-e added to the cell plate and fluorescence is monitored for 2 minutes. 0.05 mL of a 4X glutamate solution (agonist) is then added to each well to provide a final glutamate concentration in each well of 10 mM. Plate fluorescence is then monitored for an additional 60 seconds after agonist iddition- The final DMSO concentraTJon in the assay is 1.0%. In each experiment, [luorescence is monitored as a function of time and the datar-anal>'2ed using Microsoft Excel md GraphPad Prism. Dose-response curves are fit using a non-linear regressiou to determine C50 value. In each experiment, each data point is determined two times. The assay results vili demoELStrate thai Cyanoiminopipereazine Compounds bind to a'jd modulate the activity if:nG]iiR5. 5.6 EXAMPLE 6: BiNurNG OF CVANoiMiNOPiPERAzrNE COMPOUNDS TO MGLURS .Mtematively, flie follouing assay can bs used to demonstrate that a Nanoiiainopiperiziiie Compound binds to and modulates the activity of mOluRS. 40,000 CHO-r^ mGiuR5 cells/well are plated into 96 well plate (Costar 3409, Black, lear bottom, 96 well, tissue culture treated) for an overnight incubation in Dulbecco's lodified Eagle's Medium (DMEM, pH 7.4) and supplemented with glutamine, 10% FBS, % Fen/'Slrep, and 5()Cmg/mL Geneticin. CHO-rat mGIuRS cells are washed and treated wth iptimem mediim: and were incubated for 1-4 hours prior to loading cells- Cell plaies are ashed with loading buffer (127 jnM NaCl, 5 mM KCl, 2 mM MgClj, 700 iM Na H,PO^, 2 M CaCl:, 5 mM NaHCOj, 8 mM Hepes, and 10 mM glucose, pH 7.4) and incubated with JM Pluo 4 (coininercially available from Molecular probes Inc. of Eugene, 0R> in 0.1 mL ■ loading bu£fei. After 90 minutes of dy; loading, the cells are washed iwice wi\h 0.2 mL adiug buffer and resospended in, 0,1 niL loading buffer. The plates containing the CHO-rat mGluR5 cells are transferred to a Fluorometric hnaging Plate Reader (FLIPR) (commercially available from Molecular Devices Corporation of Sunnyvale, CA) for the assessment of calcium mobilization flux in the presence of giulamate and in the presence or absence of test compounds. After monitoring fluorescence for 15 seconds to establish a baseline, DMSO solutions containing various concentrations of the test compound diluted in loading buffer (0.05 mL of 4X dilutions for the competition curves) are added to the cell plate and fluorescence was monitored for 2 minutes. 0.05 mL of 'VX glui:am3te solution (agonist) i& then added to each well lo provide a final glutamate concentration in each well of 10 uiM. Plate fluorescence is then monitored for an additional 60 seconds after agonist addition. The final DMSO concentration in the assay is 1.0%. In e3£h experiment, fluorescence is monitored as a fimction of time and the data analyzed using Microsoft Excel and GraphPad Prism. Dose-response curves are fit using a non-linear regression to determine the IC50 value. In each experiment, ea.ch data point is determined at least Uvo times. 5.7. Example 7: In i^'ivo Assays for PrevcBiion or Treacment of Pain Test Animals: Each experiment uses rats weighing between 200-260 g at the start of thy experiment. The rats are group-housed and have free access to food and water at all ^mes, except prior to oral administration of a Cyanoiminopiperazine Conipoiicd when food is removed ibr 16 hoiirs before dosing. A control group acts as a comparison to rats treated with a CyanoiminopipCTazine Compouiid. The control group is administis-ed the earner for he Cyanoiminqpiperazine Corapoimd. The volume of carrier administered to the control ^up is the same as ttie volume of carrier and Cyanoiminopiperdzine Compound uindnistered to'the test gyoap. Acute Pain: To assess the actions of the Cyanoiminopiperazine Compounds for the reatment or prevention of acute pain the rat tail flick test can be used. Kats are gently estrained by hand and the tail exposed to a focused beam of r^iant heat at a point 5 cm from he tip using a tail flick unit ^lodel 7360, commercially available from Ugo Basile of Italy). Tsij flick latencies are defined as the inters'al between the onset of the thermal stimulus and he flick of the tail. Animals not responding within 20 seconds are removed from tiie tail lick unit and assigned a withdrawal latency of 20 seconds. Tail flick latencies ai-e measured immediately before (pre-treatment) and 1,3, and 5 hours following admiaistration of a Cyaiioiminopiperazine Compound. Data are expressed as tail flick ]atency{s) and the percentage of the maximal possible effect (% MPE), i.e., 20 seconds, is calculated as follow [ (post administration latency) - (pre-administration latency) ] %MPE= '■ X 100 (20 s pre-administration latency) The rat tail flick tesi is described in F.E. D'Amoor et ai, "A Method for Detennining Loss c Pain Seiiealion/'J. Pharmacol. Exp. Tlier. 'ri:14-19 (1941). "i"he results show that Cyanyiminopiperazine Compounds are useftil for treating or preventing acute pain. Acute pain can also be assessed by measuring the animal's response to noxious mechanical stiirxuli by determining the paw withdrawal threshold ("PWT'J, as described below. Infjamniatorv Pain: To assess the actions of the Cyanoiminopiperazine Compounds for Ihe treatment or prevention-of inflammatoiy pain tlieFreund's complete adjuvant ('TCA' model ofinfiammatory pain is used. FCA-induced inflammation of die rat hind paw is associated with the development of persistent inflammatory mechanical hyperalgesia a.'id provides reliable prediction of ttie anti-hyperaigeslc acdon of clinically useftil analgesic drug (L. Bartho et al., 'Thvolvementof Capsaicia-sensitive Neurones in Hyperalgesia and , Enhanced Opioid Antinocicepticm in ^fiiflammation." Naunyn-Schmiedeberg 's Archives of Pharmacology Z^Md-Slf) (IS^O)). The left hind paw of each animal is adminislered a 50 Li.Lintraplantarinjectionof50%FCA- 24 hour post injection, the animal is assessed for ■ respc-riss to noxious mechanical stimuli by detennining the PWl", as described below. Rats .uetbvTi admim'stered a single injection of 1, 3, lOorSOmg/Kgofeithera Cyanofminopiperazine Compound, 30 mg/Kg of a control selected from indomethacin, Celebrex or naproxen or carrier. Responses to noxious mechanical stimuli are then determined 1, ?, 5, and 24 hours post admmistiation. Percentage reversal of hj-peralgesia for each animal is defined as: [ (post administration PWT) - (pre-administration PWT) ] % Reversal = — ~ x 100. ■ [(Baseline ?WT) - (pre-adminislratron PWT)] The results shew that the Cyanoiminopiperazine Compounds are useful for trsaiing or preventing inflammatory pain. Nem-ppathic Pain: To assess the actions of the Cyanoiminopiperazine Compounds for the treatment or prevention of neuropathic pain either the Seltrxr model or the Chung mode! cat- be vsed. In the Seltzer model., the partial sciatic nerve ligation model of neuropathic pain is .. used to produce neuropathic hyperalgesia in rats (Z. Seltzer et a!., "A Novel Behavioral Model of Neuropathic Pain Disorders Produced in Rats by Partial Sciatic Nerve bjury," Pain 43:205-2 IS (1990)). Paitial ligation of the left sciatic uer/s is performed under isoflurane/0, inhalation anaesiiiesia. Following induction of anesthesia, tlie left thigh of the rat is shaved and the sciaiic nerve e'cposed at high thigh level tb ough a small incision and is carefaliy clejired of siuTOunding connective tissues at a site near ihc trocaiitherjust distal to tlae point at which ihe posterior biceps S'^imitendinosus nerve hraucbss off of the common sciatic nerv:e. A 7-0 silk suture {?. inserted into Ihe nerve with a 3/8 curved, re\'ersed-cutting miai-needle and tighlly ligatsd so that the dorsal 1.'3 to K of the nerve thickness is held withm the Ugahire. The wound is closed with a single muscle suture (4-0 nylon (Vicryl)) and a Vetbond surgical . glue. Following surgery, the wotmd area is dusted v/ith antibiotic powder. Sham-treated rats undergo an identical surgjcal procedure except that the sciatic nerve is not manipulated. Following surgery, animals are weighed and placed on a warm pad until they recover &om anesthesia. Afiimals are then returned to their home cages until behavioral testing begins. The animal la assessed for response to noxious mechanical stimuli by determining PWT, as described below, prior to surgery (baseline), then immediately prior to and 1, 3, and 5 hoiu-s sJler drugadministiationfortheleft rearpawof ihe animal. Percentage reversal of :ieuropatb'c hyperalgesia is defined as: [(post administration PWT) - (pre-administration PWT) ] % Reversal = X 100 [(Baseline PWT) - (pre-administration PWT)] fn the Chung model, the spinal nerve ligation model of neuropathic pain is used to produce mechanical hyperalgesia, thermal hyperalgesia and tactile allodynia in rats. Surgery is performed under isoflurane/O, inhalation anaesthesia. Following induction of anaesthesia a 3 cm incision is made and the left paraspina! muscles are separated from the spinous process at the L, - S, levels. The Lg transverse process is caiefuUy removed with a pair of small rongeurs to identify visually the L^ - Lj spinal nerves. The left L5 (or L5 and Lj) spinal nerve(s) is isolated and tightly hgated with silk thread. A complete hemostasia is confirmed and the wound is sutured using non-absorbable sutures, such as nylon sutures or stainless steel stales. Sham-treated rats undergo an identical surgical procedure excqjt thai the spina nc'.ve(s) is aot manipulated. Following surgery viniraals are weighed, adrainistered a- • subcutaneous (s.c.) injection of saline or ringers lactate, the wouiid area is dusted with ac'iihiotic powder ajid they are kept on a warm pad until they recova' from the anesthesia. Animals sia then rehimed to their home cages until behavioral testing begins. The animals are aiisessed for response to noxious mechanical stimuU by determining PWT, as described below,priortosurgery (baseline), then immediately prior to and 1,3, and 5 hours alter being admimstered a Cyanoiminopiperazine Compound for the lefl rear paw of the animal. The animal car also be assessed for response to noxious thermal stimuli or for tactile allodynia, tu described below. The Chung model forneuropalbic pain is described jnS-H. Kim, "An Hxperimcntal Model for Peripheral Neuropathy Produced by Segmental Spinal Nerve Ligation in the Rat," Pain 50(3):355-363 (1992). The results will show that Cyauoiminopiperazine Compounds are usefiii tor treating or preventing neuropathic pain. Response to Mechanical Stimuli as an Assessment of Mechanical Hyperalgesia: The paw pressurs assay can ha used to assess mechanical hyperalgesia. For this assay, hind paw v.'ithdmvval thresholds (PWT) to a noxious mechanical stimulus are determined using an analg5.i;>'niet€T (Model 72t», commeroiaily available from Ugo Basile of Italy) as described ir. C. Stein, "Unilateral Inflammation of the Hindpaw in Rats as a Model of Prolonged Noxious Siimulation: Alterations in Behavior and Nociceptive Thresholds." Pharmacology Biochemistry and Behavior 31:451-455 (1988). The maximum weight that can be applied to the hind paw is set at 250 g and the end point is taken as complete withdrawal of the paw. PWT is determined once for each rat at each time point and only the affected (ipsilateral) paw is tested. Response to Thermal Stimuli as an Assessment of Thennal Hyperalgesia: The plantar test can be used to assess thermal hyperalgesia. For this lest, hind paw withdrawal latencies to a noxious thermal stimulus are determined using a plantar test apparatus (commercially a^'ailable fi-om Ugo Basile of Italy) following the technique described by K. Hargreaves et al., "A New and Sensitive Method for Measuring lliennal Nociception in Cutaneous Hyperalgesia.'/^gjn 32(n:77-88 (19S8)- The maximum exposuretimeisselat 32 second? to avoid tissue damage and any directed paw withdrav/al from the heat source is taken as the end point. Three Latencies are determined at each time point and averaged. Only the affected (ipsilateral) paw is tested. Assessment of Tactile AJlodvnia: To assess tactile allodynia, rats are placed in cieai-, plexiglass compartments with a wire mesh floor and allowed to habiuiate for a period of at least 15 minutes. After habituation, a;?eries ofvonFreynM'no^anicnis are presented to the jlantai' surl'ace of the left (operated) foot of each rat The series of von Frey monoalaments lonsists of six monofilaments of increasing diameter, with the smallest diameter fiber )resented first Five trials are conducted with each Sl-'unent with each trial separateii by ipprqximately 2 minutes. Each presentation lasts for a period of 4-8 seconds or until a lociceprive withdrarral behavior is observed. Flinching, paw withdrawal or h'cking of the law are considered nociceptive behavioral responses. 5.8. Example ii: In Wvo Assays for Preveption or Treatment of Anaety The elevated plus maze test or the shock-probe burying t^t can be used to ssess the anxiolytic activity of Cyanoiminopipereazine Compounds in rats or mice. The Elevated Plus Maze Test: The elevated plus maze consists of a platform /irh 4 arms, t'A^o open and two closed (50x10x50 cm enclosed with an open roof). Rats (or lice) are placed in the center of the platform, at the crossroad of the 4 arms, facing one of the losed arms. Time spent in Hie open 3ims vs the closed .'ums and number of open zxm enhies during the testing period are recorded. This test is conducted prior to drug administration and again after drug administration. Test results are expressed as the mean time spent in open arms, and the mean number of entries into open arms. Known anxioiytic drugs increase both the time spent in open arms and number of open arm eniries. The elevated plus maze test is described in D. Tr«t "Aijimai Models for the Study of Anti-anxiety Agents: A Review," NmroscisTice & BiobeliavioralRe\'iews %2):2G3-222 {\9H5). The Shock-Probe Burving Test: For the shock-probe burying test the testing app:iratus consists ofapiexigiass box measuring 40x50x40 cm, evenly covered with approximately 5 cm of bedding material (odcr absorbent kitty litter) with a small hole in one end tb'ough which a shock probe (6.5 cm long ar.d 0.5 cm in diameter) is inserted. ITie plexiglass shock probe is helically wrapped with two copper wires through which an electric^ cuTsnt is administered. The current is set at 2 mA. Rats are habituated to the testing apparatus for 30 min on 4 consecutive days without the shock probe in the box. On test day, rats are placed in one comer of the test chamber followin&. drug administra! ion. The probe is not electrified imtiJ the rat touches it with its snout cr fore paws, at which point Lhe rat Tijceives » ':.^rief 2 m.A shock. Tht 15 min tesiing period begins once the rat receives itr. fiist i:hock and 'Jbe probe remains electrified for the Tem£Jn'ing behavior) is measured as well as the nunibei' of contact-induced shocks the rat receives from ttie probe. Known anxiolytic drugs reduce die amount of burying behavior. In addition, an index of the rat's reactivity to each shock is scored on a 4 point scale. The total time spent immobile during the 15 min testing period is used as an index of general activity. The shock-probe burying test is described in D. Treit, 1985, supra. The results of this test will demoustrate that Cyanoiminopipeieazine Compounds are n^efiil for treating or V'?t\eiititg soxieiy. 5.9. Example 9: In I'ivo Assays for Prevention or Treatment of an Addictive Disorder The conditioned place preference test or dnig self-administration test cax\ be used to assess tlie. ability of Cyanoiminopipereazine Compounds to attenuate tl:e rewarding propeTtieE of kiiowu drugs of abuse. The Conditioned Place Preference Test: The apparatus for the conditioned place preference test consists of two large compartments (45x45x30 cm) made of wood with a plexiglass ^ont wall. These two large compartments are distinctly different. Doors at the back of each large compartment lead to a smaller box (36x18x20 cm) box made of wood, painted grey, with a ceiling of wire mesh. The two large compartments differ in terms of shading (white vs black), level of illumination (the plexiglass door of the white compartment is covered with aimninum foil except for a window of 7x7 cm), texture (the white compartment has a 3 cm thick floor board (40x40 cm) with, nine equally spaced 5 cm diameter holes and the black has a wire mesh floor), and olfactory cues (saline in the white compaitRTen'. and I ml of 10% acetic acid in the black comparunerit). On habituation and testing days, the doors to the small box remain open, giving the rat free access to both large compartri'.ents. The first session that a rat is placed in the apparatus is a habituation session and entrances to the smaller giey compartment remain o^ieri gi-Jina the rai free ^Ciss to both laige coinpartmcnts. During habituation, mts generally sJaow no preference for either companmear. FoUcwing habivuation, rats are given 6 conditioTiing sessions. Rats are divided . into 4 groups; car:i'^r pre-treatment + carrier (control group), Cyanoiminopipereazine C:ompouiV.i pre-treatment -^ carrier, carrier pre-treatment + morphine, Cyanoimmopipereazine Compound pre-treatment + morphine. During each conditioning session the rat is injected with one of the drug combinations and confined to one compartment for 30 min. On the following day, tiiexat receives a carrier + earner treatment and is amfiiied to fee oflier-large -■ompartmsnt. Each rat receives three conditioning sessions consisting of 3 drug ;ombinarionrcompaitment.and 3 carrier-compartment pairings. The older of injections and he drug/corapaitment pairings are counterbalanced within groups. On the test day, rats ai-e jijected prior to testing (30 min to 1 hour) with either morphine or carrier and fee rat is Placed in the ^^aratus, fee doors to the grey compartment remain open and the rat is allowed :o explore fee entire apparatus for 20 min. The time spent in each compartment is recorded. •Cnown drugs of abuse increase the time spent in fee drug-paiied compartment during fee estina sessioi:. If fee Cyanoiminopipereazine Compound blocks the act{uisition of morphine :onditioned place preference (reward), there will be no difference in time spent in each side .n rats pre-treated wife a Cyatioiriiinopipereazine Compound and the group will not be different from the group of rats that was given carrier + carrier in both compartments. Data will be analyzed as time spent in each compartment (drug combination-paired vs carrier-paired). Generally, the experiment is repeated with a minimum of 3 doses of a Cyanoiminopipereazine Compound. The Dmg Self-Administrarion Test: The apparatus for the drug self-administration test is a standard commercially available operant conditioning chamber. Before drug trials begin rats are trained to press 9 lever for a food reward. After stable lever pressing behavior is acquired, rats are tested for acquisition of lever pressing for drug reward. Rats are implanted w/ith chronically indwelling jugular catheters for i.v. administration of compounds and are allowed 10 recover for 7 days before training begins. Experimental sessions are conducted daily for 5 days in 3 hour sessions. Rats are trained to self-administer a known drug of abuse, such as moiphine. Rats are then presented with two levers, an "active" lever and an "inactive" lever. Pressing of the active lever results in drug infiision on a fixed ratio 1 (FRl) schedule (Le., oat lever press gives an infusion) followed by a 20 second time out period (signaled by iUuminatiou of a light above the levers). Pressing of the inactive lever results m infusion of excipient. Training continues until the total number of morphine infusions stabilizes to within ± 10% per session. Trained rats are then used to evaluate the effect of Cyanoimiiopipereazine Compounds pre-treatment on drag self-administration. On test day, nits are pte-treated with a Cj'anoiminopipereazine Compoimd or excipient and then are allowed to self-administer drug as usual. If the Cyanoiminopipereazine Compound blocks the rewarding effects of morphine, rats pre-trealed with the Cyanoiminopipereazine Compound will show a lower rate, of responding compared to their previous rate of responding and compared to excipient pre-treated rats. Data is malyzed as the change in number of drug infusions per testing session (immber of infusions luiing test session - number of infusions during training session). The results will iemonshate that Cyanoiminopipereazme Compounds are usefiil for treating or preventing an iddictive disorder. 5.10. Example IQ: Functional Assay for Characterizing mGluR 1 Aptagohistic Properties Functional assays for the characterization of mGluRl antagonistic properties r£ well known in the art. For example, the following procedure can be used. cDNA encoding raf mGluRl a receptor is obtained from, e.g.. Prof. S. Nakatiishi (Kyoto, Japan). It is transiently transfected into HEK-EBNA cells using a procedure described by SchJaegere? a/.,.iVeu'/?ev. NewAppl. Anim. Cell Techn., Proc. ESACT Meet., 15a (1998), 105-112 and U 7-120. [Ca-+] measurements are perforaied on mGluRla transfected HEK-EBNA ceils after incubation of the cells v/irh Fluo-3 AM (0.5 ^M final concentration) for 1 hour at 37 '^ C foUowed by 4 washes with assay butfer (DMEM supplemented with Hank's salt and 20 mM HEPES. [Ca^] measurements are done using a fliuonietric imaging plate reader, e.g., FLIPR from Molecular Devices Corporation, La Jolla, CA. 10 uM glutamate as agonist is used to evaluate the potency of the antagonists. Increasing concentrations of antagonists are applied to the cells 5 minutes prior to ^plication of the agonist. The inhibition (antagonists) on^'es are fitted with ippropriate software, for example, the four-paiameter logistic equation giving IC;o and Hill :oefficient using the iterative nonlinear curve fitting software Origin from Microcal Software inc., Northampton, MA- The results of this assay will demonstrate chat Jj-ajioiininopipereazine Compounds bind to and modulate the activity of mGluRl. 5.11. Example 11: Binding of Cvauoimipopiperazine Compounds to VRl Methods for assaying compounds capable of inhibiting VRl are well ioio-sm to hose skilled in the art for example, those methods disclosed in U.S. Patent No. 6,239,267 to Duckworth ei a/.; U.S. Patent No. 6,406,908 to Mclntyre et al.; or U.S. Patent No. 6,335,180 0 JOUAK ef al. The results of fcese assays will demonstrate that Cyanoirainopiperazine iilorapounds bind to and modulate the activity of VRl. Binding of Compound DEYto VRl: Assay Protocol Human VRl cloning. Human spinal cord RNA (commercially available from rionisch. Palo Alto, CA) was used. Reverse transcription was conducted on 1.0 jig total INA using Thermoscript Reverse Transcriptase (commercially available from Invitrogen, ;iarlsbad„CA) and oHgo dT primers as detailed in its product description. Reverse ran.'scription reactions were incubated at 55°C for 1 h, heat-inactivated at S5'C lor 5 min, ml RKase H-treated at Zl'-'C for 20 min. Human VRl cDNA sequence was obtained by comparison of the human genomic sequence, prior to annotation, to the published rat sequence. lutron sequences were removed and flanking exonic sequences were joined to generate the hypothetical human cDNA. Primers flanking the coding region of human VRl were designed as follows: forward primer, GAAGATCTTCGCTGGTTGCACACTGGGCCACA; and reverse primer. GAAGATCTTCGGGGACAGTGACGGTTGGATGT. PCR of VRl was performed on one tenth of the Reverse transcription reaction mixture using. Expand Long Template Polymerase and Expand BuSer 2 in a final volume of 50 \|.iL according to the manufacturer's instrucrions (Roche Apphed Sciences, Indianapolis, U-T). After denaturation at 94°C for 2 min PCR amplification was performed for 25 cycles at 94"C for 15 sec, 58°C for 30 sec, and 68°C for 3 min followed by a final incubation at 72 =C for 7 min to complete the amplification. A PCR product of-2.8 kb was gel-isolated using a 1.0% agarose, Tris-Acetate gel containing 1.6 fig^mL of crystal violet and purified with a S.NA.F. UV-Free Gel Purification Kit (commercialH available from fiivitrogen). TbeVRi PCR product was cloned into the pIND/V5-His-T0P0 vector (commercially available fi«m Invitrcgen) according to the manufacturer'^ instruclions. DNA preparations, restricticn ca^ymc digestions, and prelimuiaiy DNA sequencing were performed according to .standard protocols. Full-length sequencing confimied the identity of the human VRl, Generation of inducible cell lines. Unless noted other-vi^e, cell culture reagents were purchased from Life Technologies of Rodcville, MD. HEK293-EcR cells sxpressing the ecdysone receptor (commercialiy avail:djle fitjm InvitrogsQ) were cultured in Growth Medium (Dulbecco's Modified Eagles Medium coataiiiing 10% fetal bovine serum [commercially available fix)m H>i'Cl-ONE, l,ogan, UT). Ix penicillin/streptomycin, Ix glutariiiic, l mM sodium pyruvate and 40O ng/mL Zeocin (commercially available fiiim Invilrogfin)). The VRl-pIND constructs were transfected into die HEK293-EcR cell line . mn% F'Jgene transfection reagent (commercially available fi:om Roche Applied Sciences," Basel, Switzerland). After 48 h, cells were transferred to Selection Medium (Growth VIediiim oontaining 300 jig'mL- G41S (commercially available fi-om hivitrogen)). ipjjroxi.rnalely 5 weeks later individual Zeocin/G418 resistant colonies were isolated and expanded. To identify functional clones, multiple colonies were plated into 96-well plates md sKpress'ion was induced for 4S h using Scilection Medium supplemented w-ith 5 jiM ponasterone A ('TonA") (commercially available from Invitrogen). On the day of assay, cell; were loaded with Fluo-4 (a calcium-sensitive dye that is commercially available from Molecular Probes, Eugene, OR) and CAP-mediated calcium influx was measured using a Fluorometric Imaging Plate Reader ("FLIPR'") (commercially available from Molecular Devices Corp., Sunnyvale, CA) as described below. Functional clones were re-assayed, expanded, and cr>'opreserved. pH-Based Assay. Two days prior to performing this assay, cells were seeded on poly-D-lysine-coated 96-weIl clear-bottom black plates (commercially available from Becton-Dickinson) at 75,000 cells/well in growth media containing 5 fiM PonA (commercially available from Irivib-ogen) to induce eicpression. On the day of the assay, the plates were washed with 0.2 mL Ix Hank's Balanced Salt Solution (connmercially available from Life Technologies) containing 1.6 mM CaCU and 20 niM HEPES, pH 7.4 ("wash buffer"), and loaded using 0.1 mL of wash buffer containing F1UCH4 (3 pM final concentraticn, commercially available from Molecular Probes). Afrer 1 h, the cells were washed twice with 0.2 mL wash buffer and resuspended tn 0.05 mL. Ix Hank's Balanced Salt Solution (commercially available irom Life Technologaes) containing 3.5 niM CaClj and -0 rru/! Citrate, pH 7.4 ("assay bufifer")- Plates were then craiisferred to a FLIPK. (commercially available from Molecular Devices) for assay. Compound DEY was diluted in assay buffer, and 50 mL of the resultant solution were added to tlie ceil plates and the solution monitored tor two minutes. The final coucenlration of Comp Cap.saicin-based Assay. Two days prior to performing this assay, cells were leeded in poly-D-lysine-coated 96-well clear-bottom black plates (50,000 cells/well) in gro'vth media containing 5 nM PonA (commercially available from Iu\itrogen) to induce ixprespion. On the day of the assay, the plates were washed with 0.2 mL Ix Hank's Balanced 5alt Solution (commercially available from Life Technologies) containing 1 niM CaClj and iO raM HEPES, pH 7.4, and cells were loaded using 0.1 mL of wash buffer containing Fluo-4 (3 tiM final). After one hour, the cells were washed twice with 0.2 mL of wash buffer and resuspended in 0.1 mL of wash buffer. The plates were traasferred to a FLIPR fcommercially available Jrom Molecular Devices) for assa>-. 50 ^L of Compound DEY diluted with assay buffer were added to the cell plates and incubated for 2 min. The fina) concentration of Compouad DEY ranged from about 50 pM to about 3 ^LM. Human VRl was activated by the addition of 50 \iL of capsaicin (400 TM), and the plates were mcubaled for an additional 3 rain. ■ Data were collected over the entire time course and analyzed using Excel and GraphPad Prism. Compound DEY when assayed according to this protocol had an ICjo of 59.4 ±13.1 nM(n-^3). The resuhs of the pH-based assay and the capsaicin-based as«ay demonstrate that Compound DEY, an illustrative Cyanoiminopiperazine Compound, binds to and raodulstes the activity of human VRl. The present invention is not to be limited in scope by the specific enibodimeois disclosed in the examples which are intended as illustrations of a few sheets of the invention and any embodiments that are functionally equivalent are v^ithin the scope of this invention. Indeed, various modijications of the invention in addition to those shown iirul described herein will become apparent to those skilled in the ait and are intended to fail within the scope of the appended claims. Anmnber of references have beeii cited, the entire disclosures of which are inc-orporated herein by refCTence. What is claimed is: 1. A compound of fonnula : i 5. . The compound of claim 3, wberein the R^ phenyl is substituted at the 4-posii:ion. 6. The compound of claim 5, wherein the R^ phenyl is subsiituted with a 7. The compound of claim 6, wherein the -(Ci-Cg) alkyl is a (ert-butyl group. 8. The compound of claim 6, wherein the -((2,-Cf;> alkyl is an iso-propyl group, 9. The compound of claim 5, wherein the R phenyl is substituted with a -CF3 group. 10. The compound of claim 3, wrierein R' is chloro or methyl. U. The compound of claim 10, wherein the R* phenyl is unsubstituted. 12- The compound of claim 10, wherein the R^ pheuji is sub^iluted at the 4-posilion. 13. The compound of claim 12, wherein the R* phenyl is substituted with a -CC-Cfi) alkyl. 14. ITie compound of claim 13, wherein the -(C\|-Cg) alkyl is a (ert-butyl group. 15. The compound of claim 13, wherein the -(Cy-C^) alkyl is an Lso-propyl group. 26. The compound of claim 25, wherein the R^ phenyl is unsubstitutai. 27. The compound of claim 25. wherein the R* phenyl is subslituted at tl 4-position. 28. The compound of claim 27, wherein the R* phenyl is substituted witt -(CrQ) alkyl. 29. The compound of claim 28, wbeiein the -(C^-C(,) alkyl is a tert-buty] group. 30. The compouiid of claim 2S, wherein the -(Ci-C^) alkyl is an ijopropj groiq). 31. The compound ofclaim 27, wherein the R" phenyl is substimled with. -CFjgroui). 32. The compound of claim 25, wherein R' is chlcffc or mexhyi. 33. The compoimd of claim 32, wherein the R* phenyl is unsiibstiluted. 3'1. The compound of claim 32, wherein the R* phenyl is substituted at thi 4-position. 35. The compound of claim 34, wherein the R^ phenyl is substituted with -(CrQ)aifcyi- 36. The compound of claim 35, wherein the -(Cj-Cg) alkyl is a /erf-butyl ^oup. 37. The compound of claim 35, wherein the -(Ci-CJ alkyi is an iso-propyl group. ?S. The compound of claim 34, whereir. the R' phenyl is substituted with a 42. A compound of formula: 48. Thecompound of claim 47, wherein the -(C\|-Cs) alkylis aferf-butyl gi-uup. 49. The compound of claim 47, wherein the -(Ci-C^) alki-l is an wo-propyl group- 50. The compound of claim 46, wherein the R" phenyl is substituted with a -CF3 group. 51. The compound of claim 44, wherehi R' is chloro or methyl. 52. The compound of claim 51, wherein the R phenyl is unsubstituted. 53. The compound of claim 51, ivheiein the R* phenyl is substituted at the 4-posilicn. 54. The compound of claim 53, wherein the R' phenyl is substituted with a -(CVOalkyl. 55. The compound of claim 54, wherein the -(Ci-Cs) alkylis aiert-butyl group. 56. The compound of claim 54, wherein the -(Ci-Cg) alkyl is an wo-propyl group. 57. The compound of claim 53, wherein the R^ phenyl is substituted with a -CFj group. 58. The compound of claim 42, wherein A is -C-. 67. The compound of claim 66, wherein the R^ phenyl is unsubstituted. 68. The compound of claim 66, wherein the R" phenyl is substiliued at the -position. 69. The compound of claim 68, wherein the R^ phenyl is substituted with a :CrC6)aIkyl. 70. The compound of claim 69, wherein the -(C\|-Cj,) alkyl is a r^ft-butyl roup. 71. The compound of claim 69, wherein the-{C,-Q) alkyl. is anLso-propyl roup. 72- The compound of claim 63, v/herein the R phenyl is substituled with a ZF-^ gi-oup. 73. Thecompoundof claim 66, wherein R' is chloro or methyl. 74. Ths compound of claim 73, wherein the R" phenyl is unsiihstituted. 75. The compound of claim 73 ,■ wherein the R" phenyl is substituted at the -position. 76. The compound of ciabn 75, wherein the R'^ phenyl is substituted with a [CrCj'aikyl. 77. The compound of claim 76, wherein the ~(C;-C^) alkyl is a (^rr-butyl roup. 83. A compound of fonnula : 87- The compound of claim 86, wherein the R phenyl is substituted "mxb i 88. The compound of claim 87, wherein the -(Ci-Ca) alfcyl is a rert-butyl group. 89. The coDipomid of claim 87, wherein the -(C,-Ct^ alky] is an ijc'-propy] group. 90. The compound of claim 84, wherein the R* phenyl is substituted with a -CTJ group. 91. The compound of claim 84, wherein F' ischlorc or methyl. 98. The compound of cliiim 83, wherein A is -0-. 99. The compound of claim 83, wherein A is -S-. 100. A compound of formula: 102. A composition comprising an effeclive-amount of the compound or a pharmaceiitically acceptable salt ofthe compound of claim 1 and a phamiaceutically acceptable carrier or excipient. 103. A composition comprising an effective amount of the compomid or a phannaceuticaily acceptable salt of the compound of claim 19 and a phannaceutically acceptable earner or excipient. 104. A composition comprising an effective amount of the compo'ind or a phamiaceutically acceptable sali of the cr;mpound of claim 21 and a phannaceuticaU}' scceptabie canier or excipient. 105. A composition comprioing an effective amoiml of the compound or a phaiTnaceuticaily acceptable salt of the compound of claim 22 and a pharmaceutically acceptable canier or excipiaiL 106. A composition comprising an effective amount of the compoimd or a pharm*;eutic3Uy accq)tab!e salt of the compound of claim 23 and a pharmaceutically acceptable canier or excipient. 107. A composition comprising an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 41 and a pharmaceutically acceptable earner or excipient. I !0S. A composition comprising an effective amount of the compound or a phannaceuticaliy acceptable sait of the compound of cJaim 42 and a pharmaceutically acceptable carrier or excipient. 109. A composition comprising an effective amount of the compound or a thai-maceuiically acceptable salt of the compound of claim 60 and a phaimaceutically cceptable carrier or excipient. 110. A composition comprising an effective amount of the compound or a ihamiaceutically acceptable salt of the compound of claim 62 and a pharmaceutically .cceptable carrier or excipient. ill. A composition comprising an effective amount of the corapomid or a iharmaceuticaHy acceptable salt of the compound of claim 63 and a phannaceutically icceptabie carrier or excipient. 112. A composition comprising an effectivo amount of the compound or a )hannaceutically acceptable salt of the compound of claim 64 and a pharmaceutically icceptabie carrier or excipient. 113. A composition comprising an effective amount of the compomid or a ihaimace;&cal!y acceptable salt of the compound of claim 82 and a pharmaceutically icceptabie carrier or excipient 114. A composition comprising an effective amount of the compound or a jhamiaceutically acceptable salt of the compound of claim S3 and a pharmaceutically icceptabie carrier or excipient. 115. A composition comprising an effective amount of the compoimd or a pharmaceuncally acceptable salt of the compound of claim 100 and a pharmaceutically acceptable carrier or excipient. 116. A composition comprising an effective amount of the compound or a phaTmaceutically acceptable salt of the compound of claim. 101 and a phannaceutically acceptable carrier or excipienl. 117. A method for treating pain in an animal, compiisLng administsMg to an animal in need thereof an effective amount of the compound or a phannaceutically acceptable salt of the compound of claim 1. 118. A method for treating pain in an animal, compnsing administering to an animal in aeed thereof an effective amount of the compound or apharmaceuticaliy acceptable salt of the compound of claim 19. 119. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a phannaceutically acceptable salt of the compound of claim 21. 120. A method for treating pain in an animal, comprising administering to an animal in aeed thereof an effective amount ofthe compound or a phannaceutically ^ acceptable salt ofthe compound of claim 22. 121. A method for treating pain in an animal^ conqjrising adniimstering to an animal in ceed thereof an effective amount ofthe compound or a phannaceutically acceptable salt ofthe compound of claim 23. 122. A method for treating pain in an animal, comprising administering to an ar.imal m need thereofan effective amount ofthe com^iound or a phannaceutically acceptable salt ofthe compound of claim 41. 123. A method for treating pain in an animal, comprising administering to I jn animal in need thereof an effective amount of the compound or a pharraacettically acci^table salt ofthe compound of claim 42, 124. A method for treating pain in an animal, comprising administeiing to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 60. 125. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 62, 126. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 63. 127. A method for treating pain in an animal, comprising admuiistering to an aniiaal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the coinpomid of claim 64. 12S. A method for treating pain in an animal, comprising administering to an animal in need theieof an effective amount of the compound or a pharmaceuticaUy acceptable salt of the corapoimd of claim 82. 129. A metbod for treating pain in an animal, comprising administering to an animai iu need thereof an effective amount of the compoimd or a phaimaceuticaUy acceptable salt of the compound of claim 83. 130. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compoimd or a pfaa.tmace«ticaily acceptable salt of the compound of claim 100. 131. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 101. 132. A method for treating urinary incontinence in an animal, comprising adininistering to an animal in need thereof an effective amount of the compound or a phaimaceutically acceptable salt of the compound.of claim 1. ] 33. A method for treating urinary incontinence in an animal, comprising idministericg to an animal in need thereof an effective amount of the compound or a Dharmaceuticaliy acceptable salt of the compound of claim 19- 134. A method for treating urinary incontinence in an animal, comprising idndnistering to an animal in need thereof an effective amount of the compound or a Dharcnaceuticaily acceptable salt of the compound of claim 21- 135. A method for treating minaiy incontinence in an aninjai, comprising idmini.^ering to an animal in need thereof ai] effective amount of the compound era Dhannaceiitically acceptable salt of the compound of claim 23. 136. A method for treating urinary incontinaice in an animal, comprising idministei'ing to ananimalinneedthereof an effective amount of the compound or a jharmaceutJcally acceptable salt of the compound of claim 23- 137. A method for treating arinary incontinence in an animal, comprising idrainistering to an animal in need thereof an effective amount of the compound or a jharmaceutically acceptable salt of the compound of claim 41. 138. A method for treating urinary incontinence in an animal, comprising idrairistoring to an animal in need thereof an effective amount of'iie compound or a Dharmaceutically acceptable salt of the compound of claim 42- 139. A method for treating urinary incontinence in an animal, comprising administering to an animal in need thereof an effective amount of the corapoiind or a ihannaceutically acceptable salt of tlie compound of claim 60. 140. A method for treating urinary incontmence in an animal, comprising drainistering to an animal in need thereof an elective amount of the compound or a ihannacsutically acceptable salt of the compound of claim 62. 141. A method for trealing urinary incontinence in an animal, comprismg dministering to an animal in need thereof an effective amount of the compound or a harmaceutically accqjtable salt of the compound of claim 63. 142. A method for treating lirinary incontinence in an aiiima), comprising ' dministering to an animal in need thereof an effective amount of the compound or a ■■' hannaceuticaiiy acceptable salt of the compound of claim 64. 143. A method for treating urinary incontinence in an ainimal, comprising diamisteiiag lo an animal in need thereof an effective amount of the compomid or a hanuaceutically acceptable salt of the compound of claim 82. ,144. A method for treating urinary incontinence in an animal, comprising dministCTing to an animal in need thereof an effective amount of the conqwund or a hanuaceutically acceptable salt of the compound of claim 83. 145. A method for treating uriuaiy incontinence in an animal, comprising dministering to an animal in need thereof an effective amount of the compound or a harmaceutically acceptable salt of the compoimd of claim 100. 146. A method for treating urinary incontinence in an aniinal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 101. i 147. A method for treating an ulcer in an animal., comprising administering to an aiiiroalin need thereof an effective iimotmt of the compound or a pharmaceutically acceptable salt of the compound of claim 1. 14S. A method for treating an ulcer in an animal, comprising adffiiiiistering t to ananimaiinneedthereof an effective aaiouut of the compound or a pharmaceutically , acceptable salt of the compound of claim 19. 149- A method for treating an ulcer in an animal, comprising administering to an animal in need thereof an effective amoiuit of tf;e compound or a pharmaceutically _f accepiable salt ofthe compound of claim 21. 150. A method for treating 311 ulcer iii an animal, comprising adininztrtciiiig ■■ to an ummal in need thereof an effective amount of the compoond or a phaimaceuticaliy ,; accept?,blt-. salt of the compotmd of claim 22. 151. A method for treating an ulcer in an animal, comprising administering to an snijHEii in need thereof an effective amount of thfc compound oc a pharmaceutically acceptable salt of the compound of claim 23. 152. A method for treating an iiJcei- in an animal, comprising administering xo im animal in need thereof an effective amoimt of the compound or a pharmaceiiiicalJy acceptable salt of the compound of claim 41. 153. A method for treating an ulcer in m animal, comprising administering to i-Ji animal in need thereof an. effective amount of the compoimd or a pharmaceviiically acceptable salt of the compound of claim 42. 154. A method for treating an ulcer in an. animal, comprising administering to ar. animal in need thereof an effective amount of the compound or a jiharmaceutically acceptable salt of the compound of claim 60. 155. A method for treating an ulcer in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 62. 156. A method foe treating an uLcer in an animsl, comprising administering to an animal in need thereof an effective amoimt of the compound or a phannaceutically acceptable salt of the compound of claim "53- .\51. A method for heating anulcer in ao animal, comprising administering to sin animal u\ need thereof an effective amount of the compound or a priaraiaceutically ^: accqitabie salt of the compound of claim 64. 158. A method for treating an ulcer in an animal, comprising administerijig to aij animal in need thereof an effective amount of the compound or a phannaceutically ■. acceptable salt of the compound of claim S2. 159. A method for treating an ulcer in an animal, .comprising administering to an animal in need thereof an effective amoimt of the compound or a pharmaceutically j:ccq;tab!e salt of the compound of claim 83, 160. .\ method for treating an ulcer in an animal, comprising administering to ari animal in need thereof an effective amount ofthecompoimd or a pharmaceutically acceptable salt of the compound of claim 100. 161. A method foi treating an ulcer iii an animal, comprising administering to ail animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim !01. 162. A method for treating irritable-bowel syndrome in an animal :omprising administering to an animal in need thereof an effective amount of the compound Dr a pharmaceutically acceptable salt of the compound of claim 1. 163. A method for treating irritable-bowel syndrome in an animal, ;oniprising administering to an animal in need thereof an effective amount of the compound Dr a pharmaceutically acceptable salt of the compound of claim 19. ] 64. A method for treating initable-bowel syndrome in an animal, roinprising administering to an animal in need thereof an elective amount of the compound :,-' ir a pharmaceutically acceptable salt of the compound of claim 21. 165. A method for iTeating irritable-bowel syndrome in an animal, ;oniprising iidministering to an animal in need thereof an effective amount of the compound ;, )r aphannaceutically acceptable salt of the compound of claim 22. 166. A method for treating iiritable-bowel syndrome in an animal, :on^rising admimstering to an animal in need thereof an effective amount of the compound >r a phannaceutically acceptable salt of tiie compound of claim 23. 167. A method for treating irritable-bowel syndrome in an animal, comprising administering to an animal in need fhereofan effective amount of the compound )r a phannaceutically acceptable salt of the compound of claim 41. 168. A method for treating imtable-bowel syndrome in an animal, ■orapri.siii'v administering to an animal in need thereof an effective amoimi of tlie compound )r a pharrnaceutically acceptable salt of the compound of claim 42. 169- A method for treating irritable-bowel sjiidrome in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceiiticaliy acceptable salt of the compound of claim 60. 170. A method for treating hritabie-bowel syndrome in an animal, ;omprising administering to an animal in need thereof an effective amount of the compound 'JT a phamiaceutically acceptable salt of the compound of claim 62. 171. A method for treating initable-bowel syndrome in an animal, :oraprising administering to an animal in need thereof an effective amount of the compound 31" a pharmaceutically acceptable salt of the compound of claim 63. 172. A method for treating imtable-bowel syndrome in an animal, romprisiiig administering to an animal in need thereof an effective amount o f the compound; 3r a phamiaceutically acceptable salt of the compound of claim 64. 173. A method for treating imtable-bowel syndrome in an animal, yjmprising administering to an anunal in need thereof an effective amount of the corapJiind; jj- a pharmaceutically acceptable salt of the compound of claim 82. 'c 174: A. method for treating irritable-bowel syndrome in an animal, :omprising administering to an animal in need thereof an effective amount of the compound IT apbaim^eutically acceptable salt of the conipoimd of claim 83. 175.. A method for treating iiritable-bowel syndrome in an animal, :omprismg administering to an animal in need thereof an effective amount of the compound 17 a pharmaceutically acceptable salt of the compound of claim 100. 176. A method for Creating irritable-bowel syndrome in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a phamiaceutically acceptable salt of the compound of claim 101. 177. A method for treating infiamniatory-bowel disease in ac animal, comprising administering to ananimalinneed thereof an effective amount of the compound or a phamiaceutically acceptable salt of the compound of claim 1. 178. A raetiiod for treating inflammatory-bov/el disease in an animal, comprbing administering to an aiimai in need thereof an effective amount of the compound or a pharmaceuticaJly acceptable salt of the compound of claim 19. 179. A method for heating inflammatory-bowel disease in an animal, cojuprisiiig administeriog to an animal in need thei'eof an effecrive amount of the compounf or apharraaceuticaily acceptable salt of the compound of ciaim 21. ISO, A np.etliod lor treating intlamraatory-bowel disease in an animal, comprising administering to an animal in need Uiereof an effective amount of the compouiK or a pharmaceutically acceptable salt of the compound of claim 22. 1S i. A metiiod for treating inflammatory-bowel disease in an animal, comprisLiig administering to an animal in need thereof an affective amount of the compount or a pharmaceutically acceptable salt of the compound of claim 23. 182. A method for treating inflamraatoiy-bowel disease in an animal, comprisii-g administering to an animal in need thereof an effective amoimt of the compouni or a pharmaceutically acceptable salt of the compound of claim 41. 1S3. A method for treating inflammatory-bowel disea.se in an animal, compri;;:(n£ administering to an animal in need thereof an effective amount of the coinpomi' or a pharmaceuticaHy acceptable salt of the compound of claim 42. 184. A method for treating inflammatory-bowe] disease in an animal, comprising administering to an animalin need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 60. 185. A method for treating inflammatory-bowel disease in an animal, comprising administering to an animal inneed thereof an effective amount of the compound-or a pharmaceutically acceptable salt of the compound of claim 62. 186. A method for treating inflammatory-bowel disease in an aiiiroal, comprising administering to an animal in need thereof an effective amount of the compound or a phannaceutically acceptable salt of the compound of claim 63. 187. A method for treating inflamraatory-bowel disease in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 64. 188. A method for treating inflammatory-bowel disease in an animal, , coniprisiog administering to an animal in need thereof an effeclivs amount of the corapoimd or a pharmaceutically acceptable salt of the compound of claim 82. ■-, 1S9: A method for treating inflammatory-bowel disease in an animal, comprising administering to an animal in need thereof an effective amount of the compotmd or a phsrmaceutically acceptable salt of the compound of claim S3. 190. A method for treating inflammatory-bowel disease in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 100. 191. A method for treating inflainniatory-bowel disease in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a phamiaceutically acceptable salt of the compouiid of claim 10). 192. A method for inhibiting VRl fimction in a cell, comprising contacting a cell capable of expressing VRI with an effective amount of the compound or a pharmacentically acceptable salt qf the compound of claim I. 193. A method for inhibiting VRl fonction in a cell, coinprisirtg contacting a cell capable of expressmg VRl with an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 19. 194. A method for inhibiting VRl fimction in a celj, comprising contacting a cell capable of expressing VKl with an effective amotmt of the compouud or a >:' pharmaceutically acceptable salt of the compound of claim 2\. 195. A method for inhibiting VRi function in a cell, comprising coataciiiig z. cell capable of expressing VRl with an effective amount of the compound or a -^-phaimaceutically acceptable salt of the compound of claim 22. 196. A method for inhibiting VRl fimction m a cell, comprising contacting a ceH capable of expressing VRl with an effective amoimt of the compound or a pharmaceutically acceptable salt of the compound of claim 23. 197. A method for inhibiting VR) fimction in a cell, comprising contacting a ceil capable cf expressing VRl with an effective amount of the compound or a pharmaceutically acceptable salt of the compoimd of claim 41. 198. A method for inhibiting VRl fimction in a cell, comprising contacting ;i ceU capable of expressing VRl with an effective amount of the compound or a pharmaceutically acceptable salt cf the compound of claim 42. 199. A method for inhibiting \TII function in a cell, comprisir.g contacting a cell capable of expressing VRi with an effective amount of the compound or a phaiTnaceutically acceptable salt of the compound of claim 60. 200. A method for inhibiting VRI function in a cell, comprising contacting a cell capable of expressing VRI with an effective amount of the compound or a pharraaceiitically acceptable salt of the compound of claim 62. 201. A method for inhibiting VRI function in a celL conip'.ising contacting a cell capable of expressing VRI with an effective amount of the compound or a pharrnacsuticaily acceptable salt of the compound of claim 63. 202. A raetiiod for inhibiting VRI function in a cell, comprising contacting a cell capable of expressing VRI with an efrective amount of the compound or a ^ j pharmaceutically acceptable salt of the compoimd of claim 64. 203. A method for Iniiibiting VRI fimction in a cell, comprising contacting a cell capable of expressing VRI with an effective mnoiint cf the compomid or a piiaimaceutically acceptable salt of the compound of claim 82. y 204. A method for inhibiting VRI fimction in a cell., comprising contacting a cell capable of expressing VRI with an effective amount of the compomid or a pharmaceutically accept'ibls salt of the compound of claim 83. 205. A method for inhibiting VRI function in a cell, comprising contacting a cell capable of expressing VRI with an effective amount of the compound or a ph;:^rmaccutica!ly acceptable salt of the compound of claim 100. 206. A method for inhibiting \Tll function in a cell, comprising contacting a cell capable of expressing VRl with an effective amount of the compound or a phannaceutically acceptable salt of the compound of claim 101. 207. A kit comprising a container containing an effective amount of a compound or a phannaceutically acceptable salt of the compound of claim 1. 208. A kit comprising a container containing an effective amount of a ;ompouncl or apharmaceutically acceptable salt of the compound of claim 19. 209. A kit comprising a container containing an effective amount of a :on7poimd or a pharmaceutically acceptable salt of the compound of claim 21. 210. A kit comprising, a container contELining an effective amount of a v-:ompnundor a pharmaceutically acceptable salt of the compound of claim 22. - v; .211. A kit comprising s.contaiuer containing an stfec.tive amount of a i; compound or a phannaceutically acceptable salt of the compoimd of claim 23. 212. A kit comprising a coniaiiier containing an effective amount of a ^ :ompoimd or apharmaceutically acceptable salt of the compoimd of claim 41. 213. A kit comprising a container containing an effective amount of a ::ompound or 3 pharmaceutically acceptable salt of the compound of claim 42. 214. A kit comprismg a container containing an effective amount of a ;ompound or a pharmaceutically acceptable salt of the compoimd of claim 60. 215. A Icit comprising a container containing an effective amount of a :ompouncl or a pJiai-maceuticaliy acceptable salt of the compoiinn of claim 62. 216. A kit comprising a container containing an effective amount of a compound or a phannaceutically acceptable salt of the compound of claim 63. 217. A kit comprising a container containing an effective amount of a compound or a phannaceutically acceptable salt of the compound of claim 64. 218. A kit comprising a container containing an effective amount of a cornpoimdorapharmaceutically acceptable salt of the compound of claim 82. 219. A kit comprising a container containing an effective amount of a compound or a pharmaceutically acceptable salt of the compound of claim 83. 220. A kit comprising a container containing an effective amount of a compound or a pharmaceutically acceptable .salt of the compomid of claim 100. ■> . 221. A kit comprising a container containing an effective ainotmi of a ;-compound oraphamiaceuticaily acceptable salt of the compound of claim 101, ;' 222. A method for preparing a composition, the method comprising ■. adinixingacompoimdorapharmaceuticallyacceptablesaUofthe confound of claim 1 and a phannaceutically acceptable carrier or excipient 223. A method for preparing a con^wsition, the method comprising adniirting a compound or a pharmaceutically acceptable salt of the compound of claim 19 and a pharmaceutically acceptable carrier or excipient 224. A method for preparing a composition, the method comprising admixing a compoun d or a pharmaceutically acceptable salt of the compound of claim 21 and a pharmacetitically acceptable carrier or excipient. 225. A method for preparing a composition, the method comprising admixing a compound or a pharmaceutically acceptable salt of the compound of clai^i 22 and a phannaceutically acceptable carrier or excipient. 226. A method for preparing a composition, the method comprising admixing a compomid or a pharmaceutically acceptable salt of the compound of claim 23 and a phannaceutically acceptable carrier or excipient. 227. A method for preparing a composition, the metliod comprising admixirig -a compound oi' a pharmaceutically acceptable salt of ihe compoimd of olaim 41 and-a pharmaceutically acceptable earner or excipient. 228. A method for preparing a composition, the method comprising admvxing acompoundorapharmaceutically acceptable salt of the compound of claim 42 and a pharmaceutically acceptable carriei" or excipient. v=::' 229. A miShotl for preparing a composition, the method conipiisiog r-admixing a compcriu or a pharmaceutically acceptable salt of the compound of claim 60 and a phiixinaceiitically acceptable carrier or excipient 230. A method for preparing a composition, the method comprising admixing a compound or a pharmaceutically acceptable salt of the ccmpouiid of claim 62 and, a pharmaceutically acceptable carrier or excipient 231. A method for preparing a composition, the method comprising admixing a compoimd or a pharmaceutically acceptable salt of the compound of clajjn 63 and ■ a pharmaceutically acceptable carrier or excipient. 232. A method for prepaiing a composition, the method comprising admixing a c 233. A method for prqjaring a composition, the method comprising aclniixing a compound or a pharmaceutically acceptable salt of the compomid of claim "2 and a pharmaceutically acceptable carrier or excipient. 234. A method for preparing a composition, the method comprising admixing a compound or a pharmaceuricallyacceptable-salt of the compound of claim 83 and a phannaceut'cally acceptable carrier or excipient. 235. A method for preparing a composition, the method comprising admixing a compound or a pharmaceutically acceptable salt of the compoimd of claim 100 and a pharmaceutically acceptable cairier or excipient. 236. A method for preparing a composition, the method comprising . admixing a compound or a pharmaceutically acceptable salt of the coroiraund of claim'l 01 a:.id a phannaceulicaEIy acceptable carrier or excipient.

Full Text

THERAPEUTIC AGENTS USEFUL FOR TRE.\TING PAJN
This application claims the benefit of U.S. Provisional Application No. 60/391.962, filed Jxme 28, 2002; U.S. Provisional Apphcation No. 60/411,030, filed September 17, 2002; U.S. Provisional Application No. 60/413,148, filed September 25, 2002; and U.S. Provisional Application No. 60/416,582, filed October S, 2002, each of which is incorporated herein by reference in its entirety.
1. FIELD OF THE INVENTION
The present invention relates to Cyanoiminopiperazine Compounds, compositions comprising an effective amount of a Cyanoiminopiperazine Compound and methods for treating or preventing pain, urinary incontinence (UT), an ulcer, inflanunatory-bowel disease (IBD), irritable-bowel syndrome (IBS), an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, amyotrophic lateral sclerosis (ALS), dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia or depression, comprising administering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound.
2. BACKGROUND OF THE INVENTION
Pam is the most common symptom for which patients seek medical advice and treatment. Pain can be acute or chronic. While acute pain is usually self-limited, chronic pain persists for 3 months or longer and can lead to significant changes in a patient's personality, lifestyle, fonctional ability and overall quality of life (KM. Foley, Pain, in Cecil Textbook of Medicine 100-107 (J.C. Bennett and F. Plum eds., 20th ed. 1996)).
Moreover, chronic pain can be classified as either nociceptive or neuropathic. Nociceptive pain includes tissue injury-induced pain and inflammatory pain such as that associated with arthritis. Neuropathic pain is caused by damage to the peripheral or cental nervous system and is maintained by aberrant somatosensory processing. There is a large body of evidence relating activity at both Group I metabotropic glutamate receptors, i.e., metabotiopic glutamate receptor 1 ("mGluRl") and metabotropic glutamate receptor 5

("mGIuRS") (M.E. Fundyms, CNSDntgs 15:29-58 (2001)), and vanilloid receptors ("VRl") (V. Di Marzo st al. Current Opinion in Neurobiology 12:372-379 (2002)) to pain processing. Inhibiting mGluRl or mGluR5 reduces pain, as shown by in vivo treatment with antibodies selective for either mGIuRl or mGluR5, where neuropathic pain in rats was attenuated (M.E. Fundytus et al, NeuroRepon 9:731-735 (1998)). It has also been shown that antisense oligonucleotide knockdown of mGluRl alleviates both neuropathic and inflammatory pain (M.E. Fundyms et al, British Journal of Pharmacology 132:354-367 (2001); M.E. Fundyms et al., Phannacohgy, Biochemsitiy & SeAav/o/-73:401-410 (2002)). Small molecule antagonists for mOluRS-attenuated pain in in vivo animal models are disclosed in, e.g., K. Walker et al. Neiirophamiacology 40:1-9 {2000) and A. X>o^ra\ et al, Neuroscience Letters 292:115-118(2000)).
Nociceptive pain has been traditionally managed by administering non-opioid analgesics, such as acetylsalicylic acid, choline magnesium trisalicylate, acetaminophen, ibuprofen, fenoprofen, diflusinal, and naproxen; or opioid analgesics, including morphine, hydromorphone, methadone, levoiphanoi, fentanyl, oxycodone, and oxymorphone. Id. In addition to ^e above-listed treatments, neuropathic pain, which can be difficult to treat, has also been treated with anii-epileptics (e.g. gabapentin, carbamazepine, valproic acid, topiiamate, phenytoin), NMDA antagonists (e.g. ketamine, dextromethorphan), topical Udocaine (for post-herpetic neuralgia), and tricyclic antidepressants (e.g. fluoxetine, sertraline and amitriptyline).
UI is uncontrollable urination, generally caused bybladder-detrusor-muscle nstability. UI affects people of all ages and levels of physical health, both in health care -.ettings and in the community at large. At present, UI aSlicts 15-30% of elderlypeople iving at home, one-third of those living in acute-care settings, and at least one-half of those iving in long-term care instimtions (R.M. Resnick, Lancet 346:94 (1995)). Persons having jl are predisposed to also having urinary-tract infections, pressure ulcers, perineal rashes and irosepsis. Psychosocially, UI is associated with embanassment, social stigmatization, .epression and a risk of instimtionalization (Herao et al, Annu. Rev. Gerontol. Geriatr. 9:74 1989)). Economically, the costs of UI are great; in the United States alone, health-care costs ssociated with UI are over S15 biUion per annum.

Physiologic bladder contraction results in large part from acetylcholine-induced stimulation of post-ganglionic muscarinic-receptor sites on bladder smooth muscle. Treatments for UI include the administration of drugs having bladder-relaxant properties, which help to control bladder-detrusor-muscle overactivity. For example, anticholinergics
5 such as propantheline bromide and glycopyrrolate. and combinations of smooth-muscle relaxants such as a combination of racemic oxybutynin and dicyclomine or an anticholinergic, have been used to treat UI (See, e.g., A.J. Wein, Urol Clin. N. Am. 22:557-577 (1995); Levin et al.,J. Urol 128:396-398 (19S2); Cooke el ai, S. Afi: Med. J. 63:3 (19S3); R.K. Mirakhur et ai. Anaesthesia 38:1195-1204 (19S3)). These drugs are not effective, however, in all
0 patients having umnhibited bladder contractions. Administration of anticholinergic medications represent the mainstay of this type of treatment.
None of the existing commercial drug treatments for UI, however, has achieved complete success in all classes of UI patients, nor has treatment occurred without significant adverse side effects. For example, drowsiness, dry mouth, constipation, blurred
) vision, headaches, tachycardia, and cardiac arrhythmia, which are related to the
anticholinergic activity of traditional anti-UI drugs, can occur frequently and adversely affect
patient compliance. Yet despite the prevalence of unwanted anticholinergic effects in many
patients, anticholinergic drugs are currently prescribed for patients having UL 77ie Merck
Manual of Medical Information 631-634 (R. Berkow ed., 1997).
' Ulcers are sores occurring where the lining of the digestive tract has been
eroded by stomach acids or digestive juices. The sores are typically well-defined round or oval lesions primarily occurring in the stomach and duodenum. About 1 in lO people develop an ulcer. Ulcers develop as a result of an imbalance between acid-secretory factors, also known as "aggressive factors," such as stomach acid, pepsin, and Helicobacter pylori infection, and local mucosal-protective factors, such as secretion of bicarbonate, mucus, and prostaglandins.
Treatment of ulcers typically involves reducing or inhibiting the aggressive factors. For example, antacids such as al\miinum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicarbonate can be used to neutralize stomach acids. Antacids, however, can cause alkalosis, leading to nausea, headache, and weakness. Antacids can also interfere with the absorption of other drugs into the blood stream and cause diarrhea.

HT antagonists, such as cimetidine, ranitidine, famotidine, and nizatidine, are also used to treat ulcers. H2 antagonists promote ulcer healing by reducing gastric acid and digestive-enzyme secretion elicited by histamine and other H. agonists in the stomach and duodenum. H, antagonists, however, can cause breast enlargement and impotence in men mental changes (especially LQ the elderly), headache, dizziness, nausea, myalgia, diarrhea, rash, and fever.
H, K"^ - ATPase inhibitors such as omeprazole and lansoprazole are also used to treat ulcers. IT, K* - ATPase inhibitors inhibit the production of enzymes used by the stomach to secrete acid. Side effects associated witli H*, K* - ATPase inhibitors include nausea, diarrhea, abdominal colic, headache, dizziness, somnolence, skin rashes, and transient elevations of plasma activities of aminotransferases.
Sucraflate is also used to treat ulcers. Sucraflate adheres to epithelial cells and is believed to form a protective coating at the base of an ulcer to promote healing. Sucraflate, however, can cause constipation, dry mouth, and interfere with the absorption of other drugs.
Antibiotics are used when Helicobacter pylori is the underlying cause of the ulcer. Often antibiotic therapy is coupled with the administration of bismuth compounds such as bismuth subsalicylate and colloidal bismuth citrate. The bismuth compounds are beheved to enhance secretion of mucous and HCO3", inhibit pepsin activitv, 2nd act as an antibacterial against H. pylori. Ingestion of bismuth compounds, however, can lead to elevated plasma concentrations of Bi"^^ and can interfere with the ^sorption of other drugs.
Prostaglandin analogues, such as misoprostal, inhibit secretion of acid and stimulate the secretion of mucous and bicarbonate and are also used to treat ulcers, especially ulcers in patients who require nonsteroidal anti-inflammatory drugs. Effective oral doses of prostz^landin analogues, however, can cause diarrhea and abdominal cramping. In addition, some prostaglandin analogues are abortifacients.
Carbenoxolone, a mineral corticoid, can also be used to treat ulcers. Carbenoxolone appears to alter the composition and quantity of mucous, thereby enhancing the mucosal barrier. Carbenoxolone, however, can lead to Na* and fluid retention, hypertension, hypokalemia, and impaired glucose tolerance.
Muscarinic cholinergic antagonists such as pirenzapine and telenzapine can also be used to reduce acid secretion and treat ulcers. Side effects of muscarinic cholinergic

antagonists include dry mouth, blurred vision, and constipation. Tlie Merck Manual of Medical Information 496-500 (R. Berkow ed., 1997) and Goodman and Oilman's Tlie Pharmacological Basis ofTJierapeulics 901-915 (J. Hardman and L. Limbird eds., 9* ed. 1996V
IBD is a chronic disorder in which the bowel becomes inflamed, often causina recurring abdominal cramps and diarrhea. The two types of IBD are Crohn's disease and ulcerative colitis.
Crohn's disease, which can include regional enteritis, granulomatous ileitis, and ileocolids, is a chronic inflammation of the intestinal wall. Crohn's disease occurs equally in both sexes and is more common in Jews of eastern-European ancestry. Most cases of Crohn's disease begin before age 30 and the majority start between the ages of 14 and 24. The disease typically affects the fill! thickness of the intestinal wall. Generally the disease affects the lowest portion of the small intestine (ileum) and the large intestine, but can occur in any part of the digestive tract.
Early symptoms of Crohn's disease are chronic diarrhea, crampy abdominal pain, fever, loss of appetite, and weight loss. Complications associated with Crohn's disease include the development of intestinal obstnictions, abnormal connecting channels (fistulas), and abscesses. The risk of cancer of the large intestine is increased in people wb-^ have Crohn's disease. Often Crohn's disease is associated with other disorders such as gallstones, inadequate absorption of nutrients, amyloidosis, arthritis, episcleritis, aphthous stomatitis, erythema nodosum, pyoderma gangrenosum, ankylosing spondylitis, sacroilitis, uveitis, and primary sclerosing cholangitis. There is no known cure for Crohn's disease.
Cramps and diarrhea, side effects associated with Crohn's disease, can be relieved by anticholinergic drugs, diphenoxylate, loperamide, deodorized opium tincture, or codeine. Generally, the drug is taken orally before a meal.
Broad-spectrum antibiotics are often administered to treat the symptoms of Crohn's disease. The antibiotic metronidazole is often administered when the disease affects the large intestine or causes abscesses and fistulas around the anus. Long-term use of metronidazole, however, can damage nerves, resulting in pins-and-needles sensations in the arms and legs. Sulfasalazine and chemically related drugs can suppress mild inflammation, especially in the large intestine. These drugs, however, are less effective in sudden, severe

flare-ups. Corticosteroids, such as prednisone, reduce fever and diarrhea and relieve abdominal pain and tenderness. Long-term corticosteroid therapy, however, invariably results in serious side effects such as iii^ blood-sugar levels, increased risk of infection, osteoporosis, water retention, and fragility of the skin. Drugs such as azathioprine and mercaptourine can compromise the immune system and are often effective for Crohn's disease in patients that do not respond to other drugs. These drugs, however, usually need 3 to 6 months before they produce benefits and can cause serious side effects such as allergy, pancreatitis, and low white-blood-cell count.
When Crohn's disease causes the intestine to be obstructed or when abscesses or tlstulas do not heal, surgery can be necessary to remove diseased sections of the intestine. Surgery, however, does not cure the disease, and inflammation tends to recur where the intestine is rejoined. In almost half of the cases a second operation is needed. Hie Merck Manual of Medical Information 52S-530 (R. Berkow ed., 1997).
Ulcerative colitis is a chronic disease in which the large intestine becomes inflamed and ulcerated, leading to episodes of bloody diarrhea, abdominal cramps, and fever. Ulcerative colitis usually begins between ages 15 and 30; however, a small group of people have their first attack between ages 50 and 70. Unlike Crohn's disease, ulcerative colitis never affects the small intestine and does not affect the full thickness of the intestine The disease nsuaUy begins in the rectum and the sigmoid colon and eventually spreads partially or completely through out the large intestine. The cause of ulcerative colitis is unknown.
Treatment of ulcerative colitis is directed to controlling inflammation, reducing symptoms, and replacing lost fluids and nutrients. Anticholinergic drugs and low doses of diphenoxylate or loperamide are administered for treating mild diarrhea. For more intense diarrhea higher doses of diphenoxylate or loperamide, or deodorized opium tincture DF codeine are administered- Sulfasalazine, olsalazie, prednisone, or mesalamine can be used to reduce inflammation. Azathioprine and mercaptopurine have been BSKI to maintain remissions in ulcerative-colitis patients who would otherwise need long-term corticosteroid Teatment. In severe cases of ulcerative colitis the patient is hospitalized and given ;orticosteroids intravenously. People with severe rectal bleeding can require transfusions and ntravenous fluids. If toxic colitis develops and treatments fail, surgery to remove the large ntestine can be necessary. Non-emergency surgery can be perforaied if cancer is diagnosed.

precancerous legions are detected, or unremitting chronic disease would otherwise make the person an invalid or dependent on high doses of corticosteroids. Complete removal of the large intestine and rectum permanently cures ulcerative coliris. Tlie Merck Manual of Medical Information 530-532 (R. Berkow ed., 1997) and Goodman and Gilman 's TJic Pharmacological Basis ofllterapetitics (J. Hardman and L. Limbird eds., 9"' ed. 1996).
IBS is a disorder of motihty of the entire gastrointestinal tract, causing abdominal pain, constipation, and/or diarrhea. IBS affects three-times more women than men. In IBS stimuli such as stress, diet, drugs, hormones, or irritants can cause the gastrointestinal tract to contract abnormally. During an episode of IBS contractions of the gastrointestinal tract become stronger and more frequent, resulting in the rapid transit of food and feces through the small intestine, often leading to diarrhea. Cramps result from the strong contractions of the large intestine and increased sensitivity of pain receptors in the large intestine.
There are two major types of IBS. The first type, spastic-colon type, is commonly triggered by eating, and usually produces periodic constipation and diarrhea with pain. Mucous often appears in the stool. Thepain can come in bouts of continuous dull aching pain or cramps, usually in the lower abdomen. The person suffering from spastic-colon type IBS can also experience bloating, gas, nausea, headache, fatigue, depression, anxiety, and difficulty concentrating. The second type of IBS usually produces painless diarrhea or constipation. The diarriiea can begin suddenly and with extteme urgency. Often the diairiiea occurs soon after a meal and can sometimes occur immediately upon awakening.
Treatment of IBS typically involves modification of an IBS-patient's diet-Often it is recommended that an IBS patient avoid beans, cabbage, sorbitol, and fiiictose. A low-fat, high-fiber diet can also help some IBS patients. Regular physical ^tivity can also help keep the gastrotntestiQal tract functioning properly. Drugs such as propantheline that slow the function of the gastromtestinal tract are generally not effective for treating IBS. Antidiarrheal drugs, such as diphenoxylate and loperamide, help with diarrhea: Tire Merck Manual of Medical Information 525-526 (R. Berkow ed., 1997).
Many drugs can cause physical and/or psychological addiction. Those most well known types of these drugs include opiates, such as heroin, opium, and morphine; sympathomimetics, including cocaine and amphetamines; sedative-hypnotics, including

alcohol, benzodiazepines and barbiturates; and nicotine, which has effects similar to opioids and sympathomimetics. Drug addiction is characterized by a craving or compulsion for taking the drug and an inability to limit its intake. Additionally, drug dependence is associated with drug tolerance, the loss of effect of the drug following repeated i administration, and withdrawal, the appearance of physical and behavioral symptoms when the drug is not consumed. Sensitization occurs if repeated administration of a drug leads to an increased response to each dose. Tolerance, sensitization, and withdrawal are phenomena evidencing a change in the central ner\'ous system resulting from continued use of the drug. This change can motivate the addicted individual to continue consuming the drug despite serious social, legal, physical and/or professional consequences. {See, e.g., U.S. Patent No. 6,109,269 to Rise era/.).
Certain pharmaceutical agents have been administered for treating addiction. U.S. Patent No. 5,556,838 to Mayer et al. discloses the use of nontoxic NMDA-bloctdng agents co-administered with an addictive substance to prevent the development of tolerance or withdrawal symptoms. U.S. Patent No. 5,574,052 to Rose et al. discloses co¬administration of an addictive substance with an antagonist to partially block the pharmacological effects of the substance. U.S.Patent No. 5,075,341 to Mendeison ei a^. discloses the use of a mixed opiate agonist/antagonist to treat cocaine and opiate addiction. U.S. Patent No. 5,232,934 to Downs discloses administration of 3-phenoxypyridine to treat addiction. U.S. Patents No. 5,039,680 and 5,198,459 to hnperato et al. disclose using a serotonin antagonist to treat chemical addiction. U.S. Patent No. 5,556,837 to Nastier et. al. discloses infiising BDNF or NT-4 grovrth factors to inhibit or reverse neurological adaptive changes that correlate with behavioral changes in an addicted individual. U.S. Patoit No. 5,762,925 to Sagan discloses implanting encapsulated adrenal medullary cells into an animal's central nervous system to inhibit the development of opioid intolerance. U.S. Patent No. 6,204,284 to Beer et al. discloses racemic (±)-l-(3,4-dichlDrophenyl)-3-azabicyclo[3.i.0]hexane for use in the prevention or rehef of a withdrawal syndrome resulting from addiction to drugs and for the treatment of chemical dependencies.
Parkinson's disease is a clinical syndrome comprising bradykinesia (slowness and poverty of movement), muscular rigidity, resting tremor (which usually abates during voluntary movement), and an impairment of postural balance leading to disturbance of gait

and falling. The features of Parkinson's disease are a loss of pigmented, dopaminergic neurons of the substantia nigra pars compacta and the appearance of intracellular inclusions known as Lewy bodies (Goodman and Gillman 's Tlie Pharmaceutical Basis of Tlierapeutics 506 (9* ed. 1996)). Without treatment, Parkinson's disease progresses to a rigid akinetic state in which patients are incapable of caring for themselves. Death frequently restUts from compiicalions of immobility, including aspiration pneumonia or pulmonary embolism. Drugs commonly used for the treatment of Parkinson's disease include carbidopa/levodopa, pergolide, bromocriptine, selegiline, amantadine, and trihexyphenidyl hydrochloride. There remains, however, a need for drugs useful for the treatment of Parkinson's disease and having an improved therapeutic profile.
Anxiety is a fear, apprehension, or dread of impending danger often accompanied by restlessness, tension, tachycardia, and dyspnea. Other symptoms commonly associated with anxiety include depression, especially accompanied with dysthymic disorder (chronic "neurotic" depression); panic disorder; agoraphobia and other specific phobias; eating disorders; and many personality disorders. Often anxiety is unattached to a clearly identified treatable primary illness. If a primary ilbiess is found, however, it can be desirable to deal with the anxiety at the same time as the primary illness.
Currently, benzodiazepines are the most commonly used anti-anxiety agents for generalized anxiety disorder. Benzodiazepines, however, carry the risk of producing impairment of cognition and skilled motor functions, particularly in the eldorly, which can result in confusion, deleriima, and falls with fractures. Sedatives are also commonly prescribed for treating anxiety. The azapirones, such as buspirone, are also used to treat moderate anxiety. The azapirones, however, are less usefiil for treating severe anxiety accompanied with panic attacks.
Epilepsy is a disorder characterized by the tendency to have recurring seizures. The etiology commonly consists of lesions in some part of the cortex, such as a timior; ievelopmental malformation; or damage due to trauma or stroke. In some cases the etiology :s genetic. An epileptic seizure can be triggered by repetitive sounds, flashing lights, video games, or touching certain parts of the body. Epilepsy is typically treated with anti-seizure Irugs. In epilepsy cases, where anti-seizure drugs are ineffective, and the defect in the brain .s isolated to a small area of the brain, surgical removal of that part of the brain can be helpful

in alleviating the seizures. In patients who have several sources for the seizures or who have seizures that spread quickly to all parts of the brain, surgical removal of the nerve fibers diat connect the two sides of the brain can be heipfiii.
Examples of drugs for treating a seizure and epilepsy include carbamazepine, ethosuximide, gabapentin, lamotrignine, phenobarbital, phenytoin, primidone, valproic acid, trimethadione, bemzodiaepines, 7-vinyl GABA. acetazoiamide, and felbamate. Anti-seizure drugs, however, can have side effects such as drowsiness; hyperactivity; hallucinations; inability to concentrate; central and peripheral nervous system toxicity, such as nystagmus, ataxia, diplopia, and vertigo; gingival hyperplasia; gastrointestinal disturbances such as nausea, vomiting, epigastric pain, and anorexia; endocrine effects such as inhibidon of antidiuretic hormone, hyperglycemia, glycosuria, osteomalacia; and hypersensitivity such as scarlatinifonn rash, morbilliform rash, Stevens-Johnson syndrome, systemic lupus erythematosus, and hepatic necrosis; and hematological reactions such as red-cell aplasia, agranulocytosis, thrombocytopenia, aplastic anemia, and megaloblastic anemia. The Merck. Manual of Medical Information 345-350 (R. Berkow ed., 1997).
A seizure is the result of abnormal electrical discharge in the brain. The discharge can involve a small area of the brain and lead to the person only noticing an odd taste or smell or it can involve a large area of the brain and lead to convulsions, i.e., a seizure ;hat causes jerking and spasms of the muscles throughout the body. Convulsions can also result in brief attacks of altered consciousness and loss of consciousness, muscle control, or jladder control. A seizures is often preceded by auras, i.e., unusual sensations of smell, taste, ■K vision or an intense feeling that a seizure is about to begin. A seizure typically lasts for ibout 2 to 5 minutes. When the seizure ends the person can have headache, sore muscles, musual sensations, confusion, and profound fatigue (postictal state). Usually the person :annot remember what happened during the seizure.
A stroke or cerebrovascular accident, is the death of brain tissue (cerebral nfarction) resniting from the lack of blood flow and insufficient oxygen to the brain. A Iroke can be either ischemic or hemorrhagic. In an ischemic stroke, blood supply to the jrain is cut off because of atherscierosis or a blood clot that has blocked a biood vessel. In a lemoirhagic stroke, a blood vessel bursts preventing nomial blood flow and allowing blood o leak into an area of the brain and destroying it. Most strokes develop rapidly and cause

brain damage within minutes. In some cases, however, strokes can continue to worsen for several hours or days. Symptoms of strokes vary depending on what part of the brain is effected. Symptoms include loss or abnormal sensations in an arm or leg or one side of the body, weakness or paralysis of an arm or leg or one side of the body, partial loss of vison or hearing, double vision, dizziness, slurred speech, difficulty in thinking of the appropriate word or saying it, inability to recognize parts of the body, unusual movements, loss of bladder control, imbalance, and falUng, and fainting. The symptoms can be permanem and can be associated with coma or stupor. Strokes can cause edema or swelling of the brain which can further damage brain tissue. For persons suffering fiom a stroke, intensive rehabilitation can help overcome the disability caused by impairment of brain tissue. Rehabilitation trains other parts of the brain to assume the tasks previously performed by the damaged part.
Examples of dmgs for treating strokes include anticoagulants such as heparin, drugs that break up clots such as streptokinase or tissue plasminogen activator, and drugs that reduce swelling such as mannitol or corticosteroids. The Merck Manual of Medical Information 352-355 (R. Berkow ed., 1997).
Pruritus is an unpleasant sensation that prompts scratching. Pruritus can be attributed to dry skin, scabies, dermatitis, herpetiformis, atopic denaaiitis, piitritus vulvae et ani, miliaria, insect bites, pediculosis, contact dermatitis, drug reactions, urticaria, urticarial ertiptions of pregnancy, psoriasis, hchen planus, Uchen simplex chronicus, exfoliative dermatitis, folliculitis, bullous pemphigoid, and fiberglass dermatitis. Conventionally, prurihjs is treated by phototherapy with ultraviolet B or PUVA or with th^apeutic agents such as naltrexone, nalmefene, danazol, tricychcs, and antidepressants.
Selective antagonists of the metabotropic glutamate receptor 5 ("mGluRS") have been shown to exert analgesic activity in in vivo animal models (K. Walker et ai. Neuropharmacology 40:1 -9 (2000) and A. Dogrul et al., Neiiroscience Letters, 292(2): 115-118(2000)).
Selective antagonists of the mGluR5 receptor have also been shown to exert anxiolytic and anti-depressant activity in in vivo animal models (E. Tatarczynska et al, Br. J. Pharmacol I32(7):1423-1430 (2001) and P.J.M. Will etal, Trends in Pharmacological 5c(e;jce5 22(7);331-37 (2001)).

Selective antagonists of the mGluR5 receptor have also been shown to exert ann-Parkinson activity in vivo (K. J. Ossowska et a!., Neurophaimacology 41_(4):413-20 (2001) and PJ.M. Will et ai. Trends in Pharmacological Sciences 22(7):331-37 (2001)}.
Selective antagonists of the mGliiRi receptor have also been shown to exert anti-dependence activity in vivo (C. Chiamulera et ai. Nature Neiiroscience 4{9):S73-74 (2001)).
International publication no. WO 02/16318 discloses a class of "N-cyanounines allegedly usefiil for treating a acute pain, urinary bladder hypersensitiveness, an ulcer, IBD, and IBS.
There remains, however, a clear need in the art for new drugs usefiil for treating or preventing pain, UI, an ulcer, BD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain fimcrion, Htmtington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression.
Citation of any reference in Section 2 of this application is not to be construed as an admission that such reference is prior an to the present application

-CH^Oialo);
each R- is independently:
(a) -halo, -CN, -OH, -NO;, or -NH,;
(b) -{C,-C,o)aBcyl, -(C,-C,o)alkenyI, -(C,-C,o)alkynyl, -(Cj-C,o)cycloalkyl, -(Cg-C|4)bicycloaDcyl, -(Cs-C,j)tricycloalkyl, -(C;-C,(,)cycloaikenyl,-(C5-C|d)bicycloalkenyL -(Cs-C,4)tiicycIoaikenyl, -(Cj-C7)heterocycle, or -(C7-C,o)bicycloheterocycle, each of which is imsubstituted or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyl, -(C,i)aryl, or -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one ormore R' groups;
each R^ is independently:
(a) -halo, -CN, -OH, -NO^, or -NH,; or
(b) -(Ci-Cio)allcyl, -(C,-C,o)alkenyl, -(C,-C,o)alkynyI, -(C3-Cio)cycloalkyl, -(Cs-C|4)b!cycloalkyl, -{Cs-C,j)tricycloalk>'!, -(C5-Cio)cycloalkenyl,-(Cg-Ci4)bicycloa!kenyi,-(Cs-Ci4)tricycloaIkenyi,-(C3-C7)heterocycIe, or -(C7-Ci[i)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups; or
(c) -phenyl, -n^hthyl, -(C,4)aryl or -{C5-C,o)heteroaiyl, each of which is unsubstituted or substituted with one or more R^ groups;
R-" is -(CrC^aikyl, or -0-(C,-Cs)aIkyI;
each R^ is independenUy -CN, -OH, -(C,-C6)alkyU -{C,-C6)alkenyl, -{C2-C5)alkenyl, -halo, -N3, -NO^, -NCR^);, -CH=NR*, -NR*OH, -OR*, -COR*- -CCOPR*, -OC(0)R^ -0C{O)0R*. -SRS -S(0)R*, or-S(0)3R^
R^ is -phenyl, -n^hthyl, -(C3-C8)cycloalliyl,-(C,4)aryl, or -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups;
each R^ is mdepeadently -(C,-C6)alkyl, -(C2-C6)alkenyl, -(Cj-Cgjalkynyl, -(Cj-Cg)cycloa!kyl, -(C5-CB)cycloalkenyI, -phenyl, -(C3-C5)heterocycle, -C0ialo)3, -CH:(halo), -CH(halo),, -CN, -OH, -halo, -Nj, -NO,, -N(R^),, -CH=NR*, -NR^OH, -OR*, -COR', -C(0)OR*, -OC(0)R*, -OC(0)OR^ -SR^ -S(0)R*, or -S(0),R^
each R^ is independently -H, -(C|-C6)alkyl, -{C2-C^)z]ksny\, -(C,-Ci)alkynyl, -(C3-Cg)cycloalkyt, -(C5-Cg)cycloalkenyl, -phenyl, -(C3-C5)heterocycle, -C(halo)3,

-CH2(haIo),or-CH(halo),;
each halo is independently -F, -CI, -Br or -I; n is an integer ranging from 0 to 3; and m is an integer ranging from 0 to 2.

(c) -phenyl, -naphtbyi, -{C,^)aryl, or -{Cs-C,o)heteroaiyl, each of which is unsubstituted or substituted with one or more R' groups; each R^ is independently:
(a) -halo, -CN, -OH, -NO,, or -NH,; or
(b) -(CrCm)aDcyl, ^(C;-C,o)alkenyl, -(C,-C,o)a5kynyl, -(C3-
C,o)cycloalkyl, -(Cg-C,4)bicycloalkyl, -(C3-Ci4)tricycloalkyi, -(Q-
C|(,)cycIoa!i-eny!,-(Cg-Ci4)bicycloalkeny!,-(Cs-Ci4)tncycIoaIkenyl,-(C3-

C-T)heterocycle, or -(C7-C|o)bicycloheterocycle, each of which is imsubstituted
or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyi, -(Ci4)aryl or -{C5-Cjo)heteroaryl, each of
which is unsubstituted or substituted with one or more R' groups;
each R= is independently -CN, -OH, -(C-C5)aa-yl, -(C2-C6)alkenyl, -(C:-Cs)alkeny], -halo, -Nj, -NO,, -N(R^),, -CH=NR^ -Ml^OH, -OR^ -COR^- -C(0)OR^ -OC(0)R^ -0C(0)0R^ -SR^ -S{0)R^ or -S(0),R^
R^ is:
(a) -naphthyi, -(C,4)ar>'l, or -(C3-C8)cycloaUcyi each of which is unsubstituted or substituted with one or more R' groups; or
(b) pyridyl, fiiryl, benzofuranyl, thiophenyl, benzothiophenyl, quinoiinyi, indoiyi, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyiidazioyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, ciimolinyl, phthalazinyl, or quinazolinyl, each of which is substituted with one or moie R^ groups; each R^ is independently -{C|-Cs)alkyl, -(C2-C6)alkenyl, -(C.-C6)alkynyl,
-{Cj-Cgjcycloalkyl, -(C5-Cg)cycloalkenyl, -phenyl, -(C3-C5)heterocycle, -Cthalo),, -CH;(halo), -CH(halo)2, -CN, -OH, -halo, -N3, -NO,, -N(R*)2, -CH=NR^ -NR^OH, -0R^ -COR^ -C(0)OR^ -OC(0)R^ -OC(0)OR\ -SR^ -S(0)RS or -S(0)2R^
each R" is independently -H. -(C,-C6)alkyl, -(C;-C6)alkenyl, -{C,-C6)alkynyl,, -(C3-C8)cycloalky], -(Cs-COcycloalkenyl, -phenyl, -(C3-C5)heterocycle, -Cflialo),, -CH,(halo), or -CHChalo);;
each halo is independently -F, -CI, -Br or -1;
n is an integer ranging from 0 to 3; and
m is an integer ranging from 0 to 2.
The present invention encompasses compounds having the formula (lb):

and phaimaceutically acceptable salts thereof, wherein: A is -NR"-, -0-, or -S-; each R^ is independently:
(a) -halo, -CN, -OH, -NO., or -NH,; or

(b) -(CrC,o)alkyl, -(CrC,o)alken>-I, -(C,-C,o)a!kynyl, -(C3-C,o)cyc!oalkyl, -{Cs-Ci,)faicycloalkyl, -(Cs-C,4)tricyc]oalkyl, -(C5-Cio)cycIoaIkenyl,-(Cs-C,4)bicycloalkenyl,-(Cj-C,4)tricycloaIkenyI,-(C3-C7)heterocycIe, or -(CTC|o)bicycloheterocycle, each of which is unsubstituted or substituted widi one or more R^ groups; or
(c) -phenyl, -naphdiyl -(C|4)aryi or -(C5-Cio)heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups;
R-" is -(C,-C6)alkyl, or-0-(C,-C6)alkyl;
each R' is independently -ON, -OH, -(C,-Cs)alkyl, -(a-C^jalkenyL -(C,-C6)aUceuyl, -halo, -N3, -NO,, -N(R^),, -CH=NR^ -NR^OH, -0R^ -COR^- -C(0)OR^ ^0C(0)R^ -0C(O)OR^ -SRl -S(0)R', or -S(0)3R^
R^ is -phenyl, -naphthyl, -(C3-Cs)cycloalkyl,-(Ci4)aiyl, or -(C5-Cio)heteroar>'i, each of which is unsubstituted or substituted with one or more R^ groups;
each R' is independently -(Ci-C6)alkyl -(C2-Cs)alkenyl, -(C,-C6)alk>'nyl, -(C3-C8)cycloallcyI, -{C5-Cs)cycloalkenyl, -phenyl, -(C3-C5)heterocycle, -C(halo)3, -CHChalo)^, -CH2(halo), -CN, -OH, -halo, -N3, -NO,, -N(K\ -CH=NR^ -NR^OH, -OR^ -COR^ -C(0)OR^ -0C(O)R^ -OC(0)0R^ -SR^ -S(0)R^ or -S(0)3R^
each R*' is independently -H, -(C|-C6)alkyl, -{C^-C^jalkenyl, -{C,-C(i)alkyny], -(C3-Cs)cycloaIkyl, -(C5-CE)cycloalkenyl, -phenyl, -(C3-C5)heterocycle, -C(haIo)3, -CH2(halo), or -CHOalo);;
R" is -hydrogen, -halo, -CH3, -NO,, -CN, -OH, -OCH3, -NHj, -C(halo)3, -CH(halo)., or -CH;(haIo);
each R" is independently:
(a) -halo, -CN, -OH, -NOj, or -NH^;
(b) -(C,-C,o)aUcyI, -(C3-Cio)alkeny!, -(Ci-C,o)aHcynyI, -(C3-Cio)cycloall£yl, -(Ca-Ci4)bicycloaIkyl, -(C8-Ci4)tricycloalkyI, -{C5-C,o)cycloalkenyl,-{Cg-C,4)bicycloalkenyl,-(C8-C|4)tricycIoalkenyl, -(Cj-C7)heterocycle, or -(C7-Cio)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R' groups; or
(c) -phenyl, -naphthyl, -(Cijjaryl, or -{C;-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups;

m is an integer ranging from. 0 to 2; and
q is an integer ranging from 0 to 3.
The present invention also encompasses compounds having the formula (11):

and phamiaceutically acceptable salts thereof, wherein;
A is -NR-*-, -0-, or -S-;
R' is -halo, -CH3, -NOj, -CN, -OH, -OCH3, -NH,, -C(halo)3, -CH(haio)2, or -CHj(halo);
each R^ is independently:
(a) -halo, -CN, -OH, -NO,, or -NH,;
(b) -(C,-C,o)alkyI, -(C3-C,o)aIkenyl, -(Q-Cio)aikynyl, -(Cj-C,o)cycloalkyl, -(Cs-CiJbicycloalkyl, -(Cg-C,4)tricycloalkyl, -(C5-C,o)cycloaJkenyI,-(C8-C,4)bicycloaIkenyl,-(Cs-C,4)tricycloalkenyI,-(Cj-C7)heterocycle, or -(C-7-C,o)bicycloheterocycle, each of which is imsubstituted or substituted with one or more R' groups; or
(c) -phenyl, -naphthyl, -(Ci4)aryl, or -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups;
each R^ is independently:
(a) -halo, -CN, -OH, -NO,, or -NH^;
(b) -(C,-C,o)alkyl, -(C2-C,o)alkeny!, -(Q-Cio)alkynyl, -(C3-Coycycioalkyl, -(C3-C|4)bicycloalkyl, -(Cs-C,4)tricycloalkyi, -(C,-C|,,)cycloalkenyl,-(C5-C,4)bicycloalkenyl -(Cj-C|4)tricycloaIkenyl,-(C3-

and pharmaceutically acceptable salts thereof, wherein:

C,)heterocycle, or -(C7-C,o)bicycloheterocycle, each of which is imsubstituted or substituted with one or more R5 groups; cr
(c) -phenyl, -naphthyl, -(CiJaryl. or -(C5-C]o)heteroaryl, each of which is unsufastituted or substituted with one or more R^ groups; and each halo is independently -F, -CI, -Br or -I: q is an integer ranging from 0 to 2; and m is an integer ranging from 0 to 2. The present invention also encompasses compounds having the formula (lH):

CHjChalo);
each R^ is independently:
(a) -halo, -CN, -OH. -NO,, or -NH,;
(b) -(C,-C,o)aIkyl, -(C-C,(,)alkenyi. -(C2-C,o)alkynyl, -(Cj-
Cio)cycloalkyl, -(Cg-C,4)bicycloalkyi, -(CB-C,Jtricycloalkyl, -(C,-
C,o)cycloalicenyl,-(C8-C,4)bicycloalkenyl,-(Cs-C,4)ticycloaIkenyl,-(C5-
C7)heterocycle, or -(C,-C,(,)bicycloheterocycle, each of which is unsubslituted
or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyl, -(C|4)aiyl, or -{C;-C|o)heteroaTyl, each of
which is unsuhstituted or substituted with one or more R' groups;
each R-' is independently:

(a) -halo, -CN, -OH, -NO;, or -NH,;
(b) -(C,-C,o)alkyI, -(C,-C,o)alkenyl, -(C^-C,o)alkynyl, -(C3-C,o)cycloaIIcyl, -(Cg-Ci4)bicycioaikyI, -(Cg-C|JtricycloaUcyl, -(C5-Cio)cycloalkenyl,-(Cs-C,4)bicycloalkenyl,-(Cs-C,4)tricycloalkenyi,-(C3-C7)heterocycle, or -(C--C]o)bicycloheterocycle, each of which is unsubstituled or substituted with one or more R^ groups; or
(c) -phenyl, -aaphthyl, -(C5^)aryl or -(C5-Ci(,)heteroaiyl, each of. which is unsubstituted or substituted with one or more R' groups;
R" is -(C-CJalkyl, or '0-(C,-Cs)alkyl;
each R^ is independently -CN, -OH, -(Ci-C6)a!kyl, -(C2-C6)aU;enyl, -C:-Cs)aikenyl, -halo, -Nj, -NO., -N(R^)„ -CH=N■R^ -NR'OH, -OR^ -COR^' -CCO)OR^ OC(0)R\ -OC(0)OR^ -SR\ 'S(0)R\ or -S(0),R*;
R* is -phenyl, -naphthyl, -(C3-Cs)cycIoalkyl,-(C,4)aryi, or -(C5-C,o)het6roaryl, lachof which is unsubstituted or substituted with one or more Regroups;
each R^ is independently -(Ci-C6)aikyl, -(C2-C6)alkenyl, -(C2-C6)alkynyl, (C3-Cg)cycioalkyl, -(C5-Cg)cycloalkenyI, -phenyl, -(C3-C5)heterocycle, -Cthalo),, CH(halo)., -CHi(halo), -CN, -OH, -halo, -Nj, -NO^, -NCR^),, -CH=NRS -NR^OH, -0R^ COR\ -C(0)OR^ -OC(0)R^ -0C(0)0R^ -SR^ -S(0)R*, or -S(0),R*;
each R^ is independently -H, -(C^-C^aikyl, -(C3-C6)alkenyi, -(C2-C6)alkynyl, [Cj-Cg)cycloalkyI, -(C3-C3)cycIoalkenyl, -phenyl, -(C3-C5)heterocycle, -C(halo)3, CH,(haIo), or -CH(haIo>,;
each halo is independently -F, -CI, -Br or -I;
n is an integer ranging from 0 to 2; and
m is an integer ranging from 0 to 2.
The present invention encompasses compounds having the formula (Ula):

each R^ is independently -CN, -OH, -(Ci-C6)ailcyl, -(C,-C6)alkenyl, -(C--C6)alkenyl, -halo, -N3, -NO,, -'^{^\ -CH=NR^ -NR^OH, -0R^ -COR*' -C(0)OR\ -OC(0)R^ -OC(:0)OR^ -SR^ -S(0)R^ or -S(0),R^
RMs;
(a), -naphthyl, -(C,^)aryl, or -(C5-Cs)cycloalkyl each of which is
unsubstiruted or substihited with one or more R' groups; or
(b) pyridyl, fUryi, benzofuranyl, thiophenyl, benzothiophenyl,
quinolinyl, indolyl, oxazolyl, beozoxazolyl, imidazolyl, benzimidazolyl,
thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyi, isothiazolyl, pyridazinyl,
pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl, or
quinazolinyl, each of which is substituted with one or more R' groups;
each R' is independently -{C,-Cs)alkyl, -(,C2-Ca)alkenyl, -(C2-C5)alkynyl, -(C3-Cs)cycloalkyi, -(C5-Cg)cycIoalkenyl, -phenyl, -{C3-C;)heterocycle, -C(halo)3, -CH(halo),, -CH,{halo), -CN, -OH, -halo, -N3, -NO,, -NCR')., -CH=NR*, -NR^OH, -0R^ -COR^ -C(0)OR^ -OC(0)R^ -OC(0)OR\ -SR«, -S{0)R\ or -S{0),R^
each R^ is independently -H, -(C,-C6)alfcyl, -(C2-Cfi)alkeny], -(C3-C^)alkynyl, -{C3-CB)cycloalkyl, -(C5-CE)cycloalkenyl, -phenyl, -{C3-C5)heterocycle, -C(halo)3, -CH;(halo), or -CHChalo);-,
each halo is mdependently -F, -CI, -Br or -I;
n is an integer ranging from 0 to 2; and
m is an integer ranging from 0 to 2.
The present invention encompasses compounds having the formula (IHb):

and pharmaceutically acceptable salts thereof, wherein;
R' is -halo, -CH3, -NO,, -CN, -OH, -OCH3, -NH,, -CChalo)3, -CH(halo);, or -CH2(halo);

(b) -(C,-C,o)aIkyl, -(C,-C,o)alkenyl, -(CrC,„)alkynyl, -(C3-C|o)cycloalkyl, -(Cs-C,4)bicycloaikyl, -(Cs-C,4)tricycloalkyl, -(C5-C,o)cycloaIkenyL-(C5-C,4)bicycloalkenyl, -(CrCiJtricycloalkenyl, -(Cj-C7)heterocycle, or -(C,-C,o)bicycloheterocycle, each of which is unsubstitured or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyl, -(C,j)aryl or -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups;
R-* is -(C,-C6)alkyl, or -0-{C;-Cs)alkyl;
each R^ is independently -CN, -OH, -(C,-Cs)alkyl, -(C2-C6)alkenyl, -(C,-C,)alkenyl, -halo, -N3, -NO,, -N(R^),, -CH=NR^ -NR^OH, -0R^ -COR^- -C(0)OR^ -OC(0)R^ -OC{0)OR^ -SR^ -S(0)R^ or -S{0),R^
R* is -phenyl, -naphthyl, -(C3-Cs)cycloaIkyI,-(Ci4)aiyl, or -(C^-C io)heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups;
each R" is independently -(Ci-C6)alkyl, -(C:-C6)aikenyi, -OR^ -OC(0)R', -OC(0)OR\ -SR^ -S{0)R^ or -S(0),R*;
each R^ is independently -H, -(C, -C6)alkyl, -(C^-Csjalkenyl, -(C,-C6)a!kynyl, -(C3-Cs)cycloalkyl, R'^ is -hydrogen, -halo, -CH3, -NG^, -CN, -OH, -OCH3, -NHj, -C{halo)3, -CH(halo),, or -CH,(halo);
each R'^ is independently:
(a) -halo, -CN, -OH. -NO,, or -NH,;
(b) -(C,-C,o)alkyl, -(C3-C,c)a]kenyl, -(C,-C,o)alkynyl, -(C3-C,o)cycloalkyl, -(Cg-CiJbicycloalkyl, -(Cs-CiJtricycloaikyl, -(C5-C,o)cyc!oalkenyl,-(Cg-C,4)bicycIoalkenyl,-{Ca-C,4)hicycIoalkenyl,-(Cj-CT)heterocycle, or -(C7-C,o)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R- groups; or
(c) -phenyl, -naphthyl, -(C.jjaryl, or -{C5-C,o)heteroaryl, each of which is unsubstituted or substimted with one or more R' groups;

and pharmaceutically acceptable salts thereof, wherein: A is -NR"-, -0-, or -S-; each R^ is independently:
(a) -halo, -CN, -OH, -NO., or -NH,;
(b) -(C,-C,o)alkyl, -(C-C,o)allcenyi, -{a-C,o)alkynyl, -(C3-C,o)cycioalkyl, -(C3-Cj^)bicycloaIkyI, -{Cg-CiJtricycloalkyI, -(C5-C,(,)cycloalkenyl,-(C3-C,4)bicycloalkenyl, -(Cs-C|4)tricycloalkenyl, -(C3-C7)heterocycle, or -(C7-C,o)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyl, -(C|4)aryl or -(Cj-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups;
R^ is hydrogen, -(C,-C6)alkyl, or -©-(C.-CJalkyl;
each R^ is independently -CN, -OH, -(C,-C6>alkyl, -(Cj-C5)alkenyl, -:3-C6)alkenyl, -halo, -N3, -NOj, -U(R% -CH=NR^ -NR'OH, -ORl -COR'- -C(O)0R^ )C(0)R^ -OC(0)OR^ -SR^ -S(0)R^ or -S(0)2R^
R^ is -phenyl, -naphthyl, -(C3-Cs)cycloancyI,-(C,4)aryl, or -(Cj-Cj(j)heteroaryl, ,ch of which is unsubstituted or substituted with one or more R' groups;
each R' is independently -(C,-C6)alkyl, -(C2-C6)alkenyl, -(C2-C6)alkynyl, "3-Cs)cycloaUcyI, -{C5-Cs)cycloalkenyl, -phenyl, -(C3-^5)heterocycle, -C(halo)3, :H(halo)2, -CH^Oialo), -CN, -OH, -halo, -Nj, -NO^, -NCR*);, -CH-NR^ -NR^OH, -0R^ :0R^ -C(0)OR^ -OC(0)R^ -0C(0)0RS SR\ -S(0)RS or -SiO)^^^
each R* is independently -H, -(Cj-Cjjalkyl, -(C2-C5)alkenyL -(C2-C6)alkynyl, -3-C8)cycloaIlcyl, -(Cs-Cs)cycioal]cenyl, -phenyl, -(C3-C3)heterocycle, -C(halo)3, ;H,(halo), or -CHChalo)^;
R" is -hydrogen, -halo, -CH3, -NO,, -CN, -OH, -OCH3, -NH,, -C(haIo)j, -^(lialo);, or -CH2(halo);
each R' is independently:
(a) -halo, -CN, -OH, -NO,, or -NH^;
(b) -(Ci-C,o)aU;yI, -(Q-C,o)alkenyl, -{C,-C,o)alkynyl, -(C3-C,o)cycJoalk:yl, -(Cs-C,.)bicycloalkyl, --(Cs-C,4)tricycloalkyI, -{C5-CiQ)cycloa!kenyl,-(Cs-C^.)bicycloalkenyl, -(Cg-Ci4)tricycloalkenyl, -(Cj-

C7)heterocycle, or-(C7-C|i])bicycloheterocycle, each of which is xmsubstituted or substituted ■with one or more R^ groups; or
(c) -phenyl, -naphthyi, -(C|^)aryl. or -{C;-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; each halo is independently -F, -CI, -Br or -I; q is an integer ranging from 0 to 2; and in is an integer ranging from 0 to 2.

:K(halo)j,or-CH3(halo);
each R^ is independently:
(a) -halo,-CN,-OH,-NOj,or-NH,;
(b) -(C,-C,o)alkyl, -(Cj-C„)a]kenyl, -(Ci-C,o)alkynyI, -(C3-C|o)cycloalkyl, -(C3-C,4)bicycloaIkyl, -(C3-C,4)tricycloalkyU -(C,-Cio)cycloalkenyl,-(Cs-C,4)bicycIoalkenyl,-(C3-Ci4)tricycloalkenyl,-(C3-C7)heterocycle, or -(C7-Cio)bicycloheterocycle, each of which is unsubstituied or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyi, -(C,4)aiyl or -{C5-C]o)heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups;
R^ is hydrogen, -(C,-C5)alkyl, or -O-CCj-CJalkyl;

R' is -H, -halo, -CH3, -NO2, -CN, -OH, -OCH3, -NH,, C(halo)3, -CHChalo)^, or -CH,(iiaio)-,
each R^ is independently:
(a) -halo, -CN, -OH, -NO,, or -NH,;
(b) -CCrC,o)aUcyl, -(Cj-C,o)aIkenyl, -(C,-C,,)allcynyl, -(Cj-C,o)cycloalkyl, -(Cs-C,4)bicycIoalkyl, -(Cg-CiJtricycioalky], -(C5-C,o)cycloalkenyl, -(Cj-C|4)bicycioalkenyl, -(Cg-C,4)tricycloalkenyl, -(3- to 7-membered)heterocycle, or -{7-to 10-membered)bicycioheterocycle, each of which is imsubstituted or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyl, -(C|4)aryl or -(5- to 10'membered)heteroaryl, each of which is unsubstitute or substituted with one or more R^ groups;
each R' is independently: (a) -halo, -CN, -OH, -NO,, or -NH,;
0) -{C,-C,o)alkyl, -(CrC,o)alkenyl, -(C;-C,o)alkynyl, -(C3-C,i,)cycloalkyl, -(Cg-C,4)bicycloalkyl, -(C3-C,4)tricycloallcyl, -(C;-Cio)cycloalkenyl, -(Cg-Ci4)bicycloalkenyl, -(Cg-Ci^itricycloalkenyl, -{3- to 7-membered)heterocycle, or -(7-to 10-membered)bicycIoheterocycle, each of which is unsubstituted or substituted with one or more R? groups; or
(c) -phenyl, -naphthyl, -(C,4)aryl or -(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R* groups;
each R^ is independently -(C,-C6)alkyl, -{C2-C6)alkenyl, -(C^-C^alkynyl, -(C3-C3)cycloaIkyl, -(C5-Cj)cycloaIkenyl, -phenyl, -(3- to 5-meinbered)heterocycle, -:(halo)3, -CH(haIo)2, or CH,(halo);
each R' is independently -CN, -OH, -(Ci-C6)aikyl, -(C3-C6)alkenyl, -:C,-C5)alkenyI, -halo, -N3, -NOj, -NCR^);, -CH=NR*, -NR^OH, -0R^ -COR^- -C(0)OR^ ■OC(0)R^ -OC(0)OR^ -SR^ -S(0)R^ or -S(0)2R*;
each R^ is independently -(C,-C6)alkyl, -(C2-Cs)alkenyl, -{Cj-CJalkynyl, ■(C,-C3)cycloalkyl, -(C5-C3)cycloallcenyl, -phenyl, -(3- to 5-membered)heterocycie, ■C(halo)3. -CH(halo)„ -CH,(haIo), -CN, -OH, -halo. -N3, -NO,, -CH-NR,, -NR,OH, -OR,, ■COR7, -CCO)OR„ -OC{0)R„ -OC(0)OR„ -SR„ -S(0)R„ or-S(0)2R,;

each R^ is independently -H, -{C|-C6)alkyl, -(C;-C6)alkenyl, -(C2-C6)alkynyi, -iC3-C3)cycloaIkyl, -{C5-Cj)cycIoalkenyl, -phenyl, -(3- to 5-membered)heterocycle, -C(halo)3, -CH(halo)j, or CH^Chalo);
each R^ is independently -(C,-C6)alkyl, -(C,-Cs)alkenyl, -{C,-C6)alkyuyl, -(Q-Cg)cycloalky!, -(C5-CB)cycloalkenyl, -phenyl, -C(haIo)3, -CH(halo)„ -CH,(halo), -CN, -OH, -halo, -N3, -NO,, -CH=NR„ -NR7OH, -OR,, -COR7, -C(0)OR7, -00(0)^-,, -OC(0)OR„ -SR„ -S{0)R7, or -S{0)3R,;
each R" is independently -CN, -OH, -(C,-C6)alkyl, -(C;-Q}al]fenyl, -halo, -N3, -NO,, -N(Rj\, -CH=NR^, -NR,OH, -OR,, -COR,, -C(0)OR„ -0C{O)R7, -OC(0)OR,, -SR,, -S(0)R„ or -S(0),R,;
each halo is independently -F, -CI, -Br, or -I;
mis 0 or 1;
n is an integer ranging from 0 to 3;
o is an integer ranging from 0 to 4;
p is an integer ranging from 0 to 2;
q is an integer ranging from 0 to 6;
r is an integer ranging from 0 to 5;
s is an integer ranging from 0 to 4; and
t is an integer ranging from 0 to 2.
The present invention encompasses compounds having the fonnula (VH):

C,a)bicycloaUcenyl, -(Cj-C, Jtricycloaikenyl, -(3- to 7-merabered)helerocycle, or -(7-to 10-inembered)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyl, -(CiJaryl or -(5- to 10-membered)heteroaiyl, each of which is unsubstitute or substituted with one or more R^ groups;
each R^ is independently:
(a) -halo, -CN, -OH. -NO,, or -NH,;
(b) -(CrC,o)alkyI, -(C2-C,o)alkenyl, -(C,-C,o)aIkynyI, -(Cj-C,o)cycloalkyl, -(Cj'C, Jbicycloalkyl, -{C3-C,4)tricycloaIkyl, -(C5-C|o)cycloalkenyl, -(Cs-C|4)bicycloalkenyl, -(C5-Ci4)tricycloalkenyl, -{3- to 7-membered)heterocycle, or -(1-to 10-membered)bicyc]oheterocycle, each of which is unsubstituted or substituted with one or more R^ groups; or
(c) -phenyl, -naphthyl, -(C,4)aryl or-(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R" groups;
eachR" is independently -(Cj-CsJalkyl, -(C;-C6)alkenyl, -(C2-C6)alkynyl, -(C3-Cg)cycloalkyl, -(C5-Cg)cycIoalkenyl, -phenyl, -(3- to 5-membered)heterocycle, -C(halo)3, -CH(halo),, or CH2{balo);
each R^ is independently -CN, -OH, -(Cj-C^lalkyl, -(C2-C6)alkenyl, -(C,-Cs)alkenyl, -halo, -N3, -NO,, -N(R^)j, -CH=NR^ -NR^OH, -OR*, -COR^- -C(0)OR\ -OC(0)R\ -OC(0)OR^ -SR^ -S(0)R^ or-S(0)jR*;
each R* is independently -(C,-C6)alkyl, -(C2-C6)alkenyl, -(C2-C6)alfcynyl, -(C3-Cg)cycloalkyl, -(C5-CE)cycIoalkenyl, -phenyl, -(3- to 5-membered)heterocycle, -CChalo)j, -CH(halo)2, -CH^Chalo), -CN, -OH, -halo, -N3, -NO,, -CH=NR7, -NR,0H, -OR,, -COR,, -C(0)0R7, -OC(0)R„ -0C(O)OR7, -SR„ -S(0)R„ or -S(0)2R7;
each R' is mdependently -H, -(Ci-C6)alkyl, -(C,-C6)alkenyl, -(C2~C6)alkynyl, -(Cj-Cs)cycloallcyl, -(C5-C8)cycloalkenyl, -phenyl, -(3- to 5-inembered)heterocycle, -C(halo)3, -CH(halo);, or CHjOialo);
each R' is independently -(C,-C6)a!kyl, -(C2-C6)alkenyl, -(C2-C6)alkynyl, -{C3-Cs)cycloalkyl, -{C5-Cs)cycloalkenyl, -phenyl, -C(haIo)3, -CH(halo)„ -CHjChalo), -CN, -OH, -halo, -N3, -NO,, -CH=NK„ -NR,OH, -OR,, -COR,, -C(0)0R7, -0C(O)R„ -0C(0)OR„ -SR„ -S(0)R„ or -S(0),R,;

each R" is independently -CN, -OH, -(C|-Q)aOcyl, -{C2-Q)aikenyl, -halo, -X,, -NO2, -N(R,)3, -CH=NE.„ -NR7OH. -OR,, -COR,, -C(0)OR,, -OC(0)R„ -OC(0)OR7, -SR„-S(0)R„or-S(0),R,;
each haio is independently -F, -CI, -Br, or -I;
m is 0 or 1;
n is an integer ranging fi"om 0 to 3;
o is an integer ranging from 0 to 4;
p is an integer ranging from 0 to 2;
q is an integer ranging from 0 to 6;
r is an integer ranging from 0 to 5;
s is an integer ranging from 0 to 4; and
t is an integer ranging from 0 to 2.
A compound of formula (I), (la), (lb), (Ic), (U), (Ha), (HI), (Ilia), (mb), (tQc), {TV), (IVa), (V), (VT), or (VII), or a pharmaceutically acceptable salt thereof (a "Cyanoiminopiperazine Compound") is useful for freating or preventing pain, UI, an ulcer, EBD, IBS, an addictive disorder, Parkinson's disease, parldiisomsm, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, TOmiting, dyskinesia, or depression (each being a "Condition") in an animal.
The invention also relates to compositions comprising an effective amount of a Cyanoiminopiperazine Compound and a pharmaceutically acceptable carrier or excipienl. The compositions are useful for treating or preventing a Condition in an am'mal.
The invention further relates to methods for treating a Condition, comprising idministering to an animal in need thereof an effective amount of a Cyanoiminopiperazine Compound.
The invention hrrther relates to methods for preventing a Condition, :omprising administering to an animal in need thereof an effective amount of a ^Cyanoiminopiperazine Compound.
The invention still further relates to methods for inhibiting Vanilloid Receptor 1 ('■VRI") function in a cell, comprising contacting a cell capable of expressing VRI with an effective amount of a Cyanoiminopiperazine Compound.

The invention stiU fuittier relates to methods for inhibiting mGltiRS fimction m a cell, comprising contacting a cell capable of expressing mGluRS with an effective amount of a Cyanoiminopiperazine Compound.
The invention still further relates to methods for inhibiting melabotropic giutamate receptor 1 ("mGIuRl") function in a cell, comprising contacting a cell capable of expressing mGluRl with an effective amotmt of a Cyanoiminopiperazine Compound.
The invention still further relates to a method for preparing a composition, comprising the step of admixing a Cyanoiminopiperazine Compound and a pharmaceutically acceptable carrier or excipient.
The invention still fiirther relates to a kit comprisiEg a container containmg an effective amount of a Cyanoiminopiperazine Compound.
The present invention may be understood more fiilly by reference to the following detailed description and illustrative examples, which are intended to exemphfy non-limiting embodiments of the invention.

ibove for the Cyanoiminopiperazine Compounds of formula (I). In one embodiment n is 0. In another embodiment, n is 1.

In another embodiment, n is 2.
hi another embodiment, n is 3.
in another embodiment, m is 0.
In another embodiment, m is 1.
In another embodiment, m is 2.
In another embodiment, A is -N((C,-Q)alk>-l)-.
In another embodiment, A is -N(0(C,-Cs)aIkyl)-.
In another embodiment, A is -0-.
In another embodiment, A is -S-.
In another embodiment, R' is halo.
In another embodiment, R' is -CI.
In another embodiment, R' is -Br.
In another embodiment, R' is -I.
In another embodiment, R' is -F.

In another embodiment, R' is -CH,.
■3-2 -
In another embodiment, n is 1 and R is -halo, -CN, -OH, -NOj, or -NHj-In another embodiment, n is 1 and R^ is -(C,-C,o)aikyl, -(C2-C,o)alkenyl, -(C2-C|o)alkynyl, -(C3-C,o)cycloalkyl, -(Cg-C,4)bicycloaikyi, -(C3-C,4)tricycloalkyl, -(C5-C[o)cycloalkenyU-(Cs-C,4)bicycloalkenyl, -(Cs-C,4)tricycloalkenyl, -(C3-C7)heterocycle, or -(C,-Cio)b:cycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups.
In another embodiment, n is 1 and R^ is -phenyl, -naphthyl, -(C,4)aryl, or -(C3-Cio)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups; In another embodiment, m is 1 and R' is -halo, -CN, -OH, -NO,, or -NHi-In another embodiment, m is 1 and R^ is -(C,-C,o)aIlcyl, -{C,-Cio)alkenyl, -(Cj-C,o)alkynyL -(C3-Cio)cycloalkyl, -(C8-C,4)bicycloalkyl, -(Ca-Ci4)tricycloalkyl, -(Cj-C|o)cycloaIkenyl,-(Cg-Cj4)bicycloa]kenyl, -(Cs-C[4)tricycloalkenyl, -(C3-C-j)heterocycle, or-(C7-Cio)bicycloheterocycie, each of which is unsubstituted or substituted with one or more R^ groups.
In another embodiment, m is 1 and R^ is -phenyl, -naphthyl, -(C|4)aryl or -{C5-C|o)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups.

In another embodiment, R*^ is -phenyl, -naphthyl, -(C-;-Q)cycloaDcyl,-(C, Jaryl, or -(C5-Cio)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups.
In another embodiment, R* is -phenyl.
' In another embodiment, m is 1 and R' is -CH^.
In another embodiment, m is 1, R-' is -CH,, and the carbon atom to which the -R^ is attached is in the (R)-configuration.
In another embodiment, m is 1, R^ is -CHj, and the carbon atom to which the -R"* is attached is in the (S)-coniiguration.
In one embodiment, a and m are 0 and R* is -phenyl. In another embodiment, n is 0, m is 1, R^ is methyl, and R* is phenyl. In another embodiment, the -phenyl is substimted with a -(Ci-Cg) alkyl group. In another embodiment, the -(CfCg) alky! group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Ci-Cj) alkyl group is a (-butyl group substituted at 4-position of the -phenyl. In another embodiment, the -(C,-Cg) alkyl group is an ijo-propyl group substituted at the 4-position of the -phenyl.
In another embodiment, R' is -CF3 or -CHF,.
In another embodiment, n and m are 0 and R* is -phenyl substituted at its 4-position with a -CF3 group.
In another embodiment, n and m are 0, R' is -halo or methyl; and R* is -phenyl. In one embodiment, -halo is -CI. In another embodiment, the -phenyl is substituted with a -(Cj-Cg) alkyl group. In another embodiment, the -(Cj-Cj) alkyl group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Cj-Cs) alkyl group is a /-butyl group or an wo-propyl group substituted at the 4-position of the -phenyl.
In another embodiment, n and m are 0, R' is -halo or methyl; and R* is -phenyl substituted with-CF3. In another embodiment,-halo is-CI. Li another embodiment, the-CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is -CI and the -CF3 is substituted at the 4-position of the -phenyl.
4.2 CVANOIMINOPIPERAZINE COMPOUNDS OF FORMULA (IA)
The present inveation also encompasses compounds of formula (la)

and pharmaceutically acceptable salts thereof, wherein R', Rl R^, R^, n, and m are defined above for the Cyanoimmopiperazine Compounds of formula (la).
In one embodiment, R' is -halo.
In another embodiment, R^ is -CI.
In another embodiment, R' is -Br.
In another embodiment, R' is -I.
in another embodiment, R' is -F.
hi another embodiment, R' is -CH3.
In another embodiment, n is 1 and R^ is -halo, -CN, -OH, -NOj, or -NHj.
In another embodiment, n is 1 andR^ is -{C,-C,(,)alkyl, -(C2-C,(,)alkenyl, -(€3-Cio)alkynyI, -(C3-Cio)cycloalkyl, -(Cg-C,4)bicycloalkyl, -{Ca-Cj4)tricycloalkyl, -(Cj-C,o)cycloalkenyl,-(C3-Ci4)bicycloalkenyl, -(Cg-C,4)tricycIoallcenyi, -(Cj-C7)heterocycle, or -{C7-C,o)bicycloh6terocycle, each of which is unsubstituted or substituted with one or more R^ groups.
In another embodiment, n is 1 and R^ is -phenyl, -naphthyl, -(CiJaiyl, or -(Cj-C,(|)heteroaryI, each of which is unsubstituted or substituted with one or more R' groups.
In another embodiment, m is I and R' is -halo, -CN, -OH, -NO2, or -NH;.
In another embodiment, m is 1 and R' is -{C,-Cio)alkyl, -(C,-C,o)alkenyi, -(C;-C,^)alkynyl, -(C3-C,o)cyc[oalkyl, -(Cs-CiJbicycloalkyl, -(Cg-C, Jti-icycloalkyl, -(C5-Cjo}cycIoalkenyI,-fCg-C,j)bicycloaikenyl, -(C5-C,j)tricycloalkenyi, -(C3-C7)heterocycle, or -

{C7-C,(,)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R' groups.
In another embodiment, m is 1 and R^ is -phenyl, -naphthyi, -(CiJaryl or -(C;-C,o)beteroaryl, each of which is unsubstituted or substituted with one or more R'groups.
In another embodiment, ra is 1 and R^ is -CH^.
In another embodiment, m is !, RMS -CH,, and the carbon atom to which the -R' is attached is m the (R)-configuration.
In another embodiment, m is 1, R-* is -CH^, and the carbon atom to which the -R-^ is attached is in the (S)-configuration.
In another embodiment, R^ is -naphthyi, -{Cjjaryl, or -(C3-Cg)cycloalkyl each of which is unsubstituted or substituted with one or more R' groups.
In another embodiment, R^ is pyridyl, fiiryl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, indolyl, oxazolyl, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiadiazolyl, triazinyl, cinnolinyi, phthalazinyl, or quinazolinyl, each of which is substituted with one or more R^ groups.
In another embodiment, R* is pyridyl, pyrazinyl, pynmidinyl, pyiidazinyl, or thiadiazolyl.
43 CYANOIMINOPIPERAZINE COMPOUNDS OF FORMULA ffB)
The present invention encompasses compounds having the formula (lb):

(lb)
nd pharmaceutically acceptable salts thereof, wherein R', R-, R\ R', R'", ii, m, p and halo re defined above for the Cyanoiminopiperazine Compounds of formula (lb).
In one embodiment, n is 0.
In another embodiment, n is I.
In another emHodimenl, n is 2.
In another embodiment, m is 0.
In another embodiment m is 1.
In another embodiment, m is 2.
In another embodiment, R' is -halo.
In another embodiment, R' is -CI.
In another embodiment, R1 is -Br.
In another embodiment, R1 is -I.
In another embodiment, R1 is -F.
In another embodiment, R1 is -CH3.
In one embodiment, n is 1 and R^ is -halo, -ON, -OH, -NO2, or -NHj-
In another embodiment, n is 1 and R' is -(C,'C|o)alkyi, -(C2-C,o)alkenyl, -(C^-io)alkynyL -(C,-C,o)cycloalkyl, -(CrCi4)bicycloaIk7l, -fCs-Ci,)tricycloa!kyl, -(C5-,o)cycloalkenyl, -(C;-C,4)bicycloalkenyl, -(Cg-Ci^)tricyc-loalkenyl, -(C3-C7)heterocycle, or

-(C7-Cni)bicycloheterocycle, each of which is unsubstltuted or substituted with one or more R' groups.
In another embodiment, n is 1 and R- is -phenyl, -naphthyl, -(C,4)aryl, or -(C5-C|o)heteroaryl, each of which is unsubstimted or substituted with one or more R^ groups.
bi another embodiment, m is land R^ is -halo, -CN, -OH, -NO-., or

In another embodiment, m is 1 and R^ is-phenyl, -naphthyl, -(Ci4)aTyl or (C5-C,(i)heteroaryl, each ofwhichisimsubstituted or substituted with one or more R' groups.
In another embodiment, m is 1 and R^ is -CHj.
In another embodiment, m is 1, R^ is -CH3. and the carbon atom to which the -;i^ is attached is in the (R)-configuration.
In another embodiment, m is 1, R^ is -CHj, and the carbon atom to which the -V is attached is in the (S)-configuration.
4.4 CVANOIMINOPIPERAZINE COMPOUNDS OF FORMULA aO
The present invention encompasses compounds having the formula (Ic):

and phannaceuticaiiy acceptable salts thereof, wherein A, R^, R*, R', R'-, m, and q are defined above for the Cyanoiminopiperazine Compounds of formula (Ic).
hi one embodiment, m is 0.
hi another embodiment, m is 1.
hi another embodiment, m is 2.
In another embodiment, q is Q.
Jn another embodiment, q is 1.
hi another embodiment, q is 2.
hi another embodiment, q is 3.
hi another embodiment, A is -N((CpC6)aUcyi)-.
hi another embodiment, A is -N(0{Ci-Co)alkyl)-.
In another embodiment, A is -0-.
hi another embodiment, A is -S-.
hi another embodiment, m is 1 and R' is -halo, -CN, -OH, -NO., or -NH,^ or
hi another embodiment, m is 1 and R- is -(C,-Cio)alkyI, -(C2-Cio)alk6nyl, -(Cj-Cio)alkynyl, -(C3-C,o)cycloalkyl, -(Cs-Ci4)bicycloa!lcyl, -(Cs-C,4)tricycloalkyl, -{C5-"io)cycloaIkenyl,-(C3-C,4)bicycIoalkenyl, -(C5-C|4)tricycioalkenyI, -(Cj-C7)heterocycle, or -'C,-C,o)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ jroups.
hi another embodiment, m is 1 and R' is -phenyl, -naphthyl, -(C,4)aryl or -(C,-i;io)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups.
In another embodiment, m is 1 and R' is -CH3.
Li another embodiment, m is 1, R' is -CHj, and the carbon atom to which the -i? is attached is in the (R)-configuration-
In another embodiment, m is 1, R^ is -CH3, and the carbon atom to which the -X' is attached is in the (S)-configuration.
hi another embodiment, R* is -phenyl, -naphthyl, -(C3-C8)cycloalkyl,-(C|4)ary!, r -(C5-C,o)heteroaryl, each of which is unsubstituted or substituted with one or more R' roups.
hi another embodiment, R^ is -phenyl.

in another embodimeat, R' is -hydrogen, -halo, -CHj, -NO^, -CN, -OH, -OCH3, ~NH,, -Caia!o)3, -CH(halQ)., or -CH,(ba!o).
In another embodiment, R" is -halo.
In another embodiment, R" is -CI.
In another embodiment, R^^ is -Br.
In another embodiment, R^' is -F.
In another embodiment, R" is -I.
In another embodiment, R" is -CH3.
In another embodiment, q is 1 and R'- is -halo, -CN, -OH, -NO^, or -NH,.
In another embodiment, q is 1 and R'- is -(C|-C],i)alkyJ, -(C3-C|(|)alkenyl, -(Q-C,o)aIkynyl, '(C3-Cio)cycloalkyl, -(Cg-Ci4}bicycloaIkyi, -(Cg-CiJtricycIoalkyl, -(C5-C;]Q)cycloaIkenyI,'(Cg-C,j)bicycIoalkeayI, -{Cj-Ci4)tricycloalkenyI, -(C3-C7)heterocycle, or -'C7-C io)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R' p-oups.
In one embodiment, q is 1 and R'- is -phenyl, -naphthyl, -(C,4)ai7l, or -(C5-Diojheteroaryl, each of which is unsubstituted or substituted with one or more R' groups.
4.5 CYANOIMINOPtPERAZINE COMPOUNDS OF FORMULA gi^
The present invention also encompasses compounds of formula (E)

hi another embodiment, n is 1.
In another embodiment, n is 2.
In another embodiment, m is 0.
In another embodiment, m is 1.
In another embodiment, m is 2.
In another embodiment, R' is -halo.
In another embodiment, R' is -CI.
In another embodiment, R' is -Br,
In another embodiment, R' is -I.
In another embodiment, R' is -F.
In another embodiment, R' is -CH3.
In another embodiment, A is -NH-.
In another embodiment, A is -N((C,-C6)aIkyI)-.
In another embodiment, A is -N(0(Ci-C5)alkyl)-.
In another embodiment, A is -0-.
In another embodiment, A is -S-.
In another embodiment, n is 1 and R.~ is -halo, -CN, -OH, -NOj, oi -NH,.
In another embodiment, n is 1 and R^ is -{C,-C,i,)alkyl, -{C2-C,o)aIkenyI, -(C,-,o)alkynyl, -(C3-C,o)cycloalkyl, -(Cs-C,4)bicycloaIkyI, -(Cg-C,4)tricycloalkyl, -(Cj-,o)cycloalkenyl,-(Cs-Ci4)bicycloaIkenyi, -(Cg-Ci4)tricycloalkenyl, -{C3-C7)heterocycIe, or -'7-Cio)bicycIoheterocycle, each of which is unsubstituted or substituted with one or more "R? oups.
In another embodiment, n is 1 and R^ is -phenyl, -naphthyl, -(C,4)aryl, or -(C5-[o)heteroaiyl, each of which is unsubstituted or substituted with one or more R' groups.
In another embodiment, m is 1 and R^ is -halo, -CN, -OH, -NOj, or -NHj.
In another embodiment, m is 1 and R^ is -{C|-C,o)aIkyI, -(C2-C,o)alkenyl, -{C,-,o)alkynyl, -(C3-C,o)cycloalkyl, -{Cs-C,4)bicycloalkyl, -(C3-C„)tricycloalkyl, -(C;-io)cycloalken3'],-(Cs-Ci4)bicycIoalkenyl, -{Cs-C|4)tricycloaIkenyI, -(C3-C7)heterocycle, or -'^-C|(i)bicycIoheterocycle, each of which is unsubstituted or substituted with one or more R^ ouos.

In another embodiment, m is 1 and R-* is -phenyl, -Daphthyl, -(C,4)aryl or -(Cj-C|o)heteroaryl, each of which is unsubstituied or substituted with one or more R^ groups. In another embodiment, m is I and R'^ is -CHj.
In another embodiment, m is 1, R^ is -CH3, and the carbon atom to which the -R' is attached is in the (R.)-configuration.
In another embodiment, m is 1, RMS -CH3, and the carbon atom lo which the -R^ is attached is in the (S)-configuration.
In another embodiment, R^ is -phenyl, -naphthyl, -(Cj-Cs)cycloalicyI,-(Ci4)aryl, or -(Cs-C5o)heteroaryl, each of which is unsubstituted or substihited with one or more R' groups.
In another embodiment, R^ is -phenyl.
In one embodiment, n and m are 0 and R^ is -phenyl. In another embodiment, n is 0, m is 1, R^ is methyl, and R^ is phenyl. In another embodiment, the -phenyl is substituted with a -(C,-Cg) alkyl group. In another embodiment, the -(C,-C^) alkyi group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Cj-CJ alkyl group is a r-butyl group substituted at 4-position of the -phenyl. In another embodiment, the -(C,-Cg) alkyl group is an ijo-piopyl group substituted at the 4-position of the -phenyl. In another embodiment, R' is -CF^ or -CHF^.
In another embodiment, n and m are 0 and R' is -phenyl substituted at its 4-iosition with a -CF3 group.
In another embodiment, n and m are 0, R' is -halo or methyl; and R* is phenyl. In one embodiment, -halo is -CI. In another embodiment, the -phenyl is substituted vith a -(Cj-Cj) alkyl group. In another embodiment, the -(Cj-C^ alkyl group is substituted at be 4-position of the -phenyl. In another embodiment, the -(Cj-Cg) alkyl group is a ^butyl joap or an iso-propyl group substituted at the 4-position of the -phenyl.
In another embodiment, n and m are 0, R' is -halo or methyl; and R* is -phenyl ubstituted with -CF3. In another embodiment, -halo is -CI. In another embodiment, the -CF3 i substituted at the 4-position of the -phenyl. In another embodiment, -halo is -CI and the 3F, is substituted at the 4-position of the -phenyl.

4.6 CVANOlMrNOFIPERAZINE COMPOUNDS OF FORMULA (HAThe present invenrion also encompasses compounds having the formula (Ha):

ifined above for the Cyanoiminopiperazine Compounds of fomiula {Ha).
In one embodiment, q is 0.
In another embodiment q is 1.
In another embodiment q is 2.
In one embodiment, m is 0.
In pziuthei embodiment, m is 1.
In another embodiment, m is 2.
In another embodiment, A is -N((Ci-C4)alkyI)-.
In another embodiment, A is -N(0(C1-C6)alkyl)-.
In another embodiment, A is -0-.
ia another embodiment, A is -S-.
In another embodiment, m is 1 and R' is -halo, -CN, -OH, -NO,, or -NHj-
In another embodiment, m is 1 and R' is -(C,-C,n)allcyl, -(C2-C,(,)aikenyl, -( ,)alkyny!, -(C3-C|o)cyclo3lkyl, -(C8-C,4)bicycloaUcyl, -(C3-Ci,)tricycloaIkyl, -(C5-,)cycloalkenyl,-(Cs-C,4)bJcycloa]kenyl, -(C8-C,4)tricycIoaIkenyI, -(C3-C7)heterocycle, or rC|o)bicycloheterocycle, each of which is unsubstimted or substituted with one or more lups.
In another embodiment, m is 1 and R^ is -phenyl, -naphthyl, -(Ci4)aiyl or -(( )heteroaTyI, each of which is unsubstituted or substituted with one or more R' ^oups.

In another embodiment, m is 1 and R-' is -CHj.
In another embodiment, m is 1, R^ is -CH,, and the carbon atom to which die -R^ is attached is in the (R)-configuration.
hi another embodiment, m is 1, R' is -CH„ and the carbon atom to which the -K^ is attached is in the (R)-configuration.
In another embodiment, R^ is -phenyl, -naphthyl, -(C;-Cs)cycloalJcyI,-(C) Jaryl, or -(C5-C10)heteroaryl, each of which is unsubstituted or substituted with one or more R" groups.
In another embodiment, R* is -phenyl.
In another embodiment, R' is -hydrogen, -halo. -CH,, -NO^, -CN, -OH, -OCH3, -NH,, -C{haIo)3, -CH(halo),, or -CH,(haIo).
In another embodiment, R' is -halo.
In another embodiment, R" is -CI.
In another embodiment, R" is -Br.
In another embodiment, R" is -F.
In another embodiment, R" is -I.
(n another embodiment, R' is -CH,.
3-
12
In anothc. embodiment, q is 1 and R' is -halo, -CN, -OH, -NOj, or -NH;.
In another embottoient, q is 1 and R'^ is -(C,-Cio)alkyl, -(C2-C,o)alkenyl, -(C,-C,(,)alkynyl, -(C3-C,o)cycloallcyl, -(C3-C,4)bicycloaIkyl, -(C3-C,4)tricycloaIkyl, -(Cj-C,o)cycloalkenyl,-(Ca-C|4)bicycloalkenyI, -(Cg-Ci4)tricycIoaIkenyl, -(C3-C,)heterocycle, or -(C7-Cio)bicycloheterocycle, each of which is unsubstituted or substituted with one or more R^ groups.
In another embodiment, q is 1 and R'^ is -phenyl, -naphthyl, -(C,4)aryl, or -(C,-C,(i)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups.
4.7 CVANOIMINQPIPERAZINE COMPOUNDS OF FORMULA giO
The present invention also encompasses compounds of formula (TO)

(C7-C,o}bicycloheterocycle, each of which is unsubstituled or substituted with one or more R^ groups.
In one embodiment, n is I and R- is -phenyl, -naphthyl, -(Cja)aryl, or -(C-C]Q)heteroary!, each of which is unsubslituted or substituted with one or more R^ groups.
In one embodiment, m is 1 and R^ is -halo. -CN, -OH, -NO^, or -NH,.
In one embodiment, m is 1 and R^ is -(CrC]o)alkyi, -(Cj-C|(,)alkenyl, -(C,-C,o)alk7nyl, -(C3-C,o)cycloalk7l, -{Cs-C,4)bicycloalkyI, -(Cs-C,JtricycloaIkyl, -(Q-CiQ)cycloalkenyl,-(C3-C,4)bicycloal}ceny!, -(Cj-CtJtricycloalkenyl, -(C3-C7)heterocycle, or -(C7-C,o)bicycloheteracycle, each of which is unsubstituted or substituted with one or more R^ groups.
In one embodiment, m is 1 and R^ is -phenyl, -naphthyl, -{CiJaryl or -(C5-Cij)heteroaryl, each of which is unsubstimied or substituted with one or more R' groups.
In another embodiment, m is 1 and R^ is -CH3.
In another embodiment, m is I, R'^ is -CHj, and the carbon atom to which the -R^ is attached is in the (R)-configuration.
In another embodiment, m is 1, RMS -CH3, and the carbon atom to which the -R^ is attached is in the (S)-configuration.
In one embodiment, R^ is -phenyl, -naphthyi, -(C3-C3)cycloalkyi,-(C,4)aryi, or -(C3-C|o)heteroaiyl, each of which is unsubstituted or substituted with one or more R' groups.
In one embodiment, R* is -phenyl.
In one embodiment, n and m are 0 and R^ is -phenyl. In another embodiment, n is 0, m is 1, R' is methyl, and R* is phenyl. In another embodiment, the -phenyl is substituted with a -{C,-Cs) alkyl group. In another embodiment, the -(Cj-Cg) alkyi group is substituted at the 4-position of tie -phenyl. In another embodiment, the -(Ci-C^) alkyl group is a (-butyl group substituted at 4-position of the -phenyl. In another embodiment, the -(C,-Cg) alkyl group is an wo-propyl group substituted at the 4-position of the -phenyl.
bi another embodiment, R' is -CF3 or -CHFj.
In another embodiment, n and m are 0 and R* is -phenyl substituted at its 4-losition with a -CF3 group.
In another embodiment, n and m are 0, R' is -halo or methyl; and R^ is

-phenyl. In one embodiment, -halo is -CI. In another embodiment, the -phenyl is substituted with a -(C|-Cs) alkyl group. In another embodiment, the -(Cj-Cs) alky! group is substituted at the 4-position of the -phenyl. In another embodiment, tlie -{C,-C^) altyl group is a f-butyl group or an iso-propyl group substituted at the 4-position of the -phenyl.
In another embodiment, n and m are 0, R' is -halo or methyl; and R° is -phenyl substituted with -CF3. In another embodiment, -halo is -CI. In another embodiment, the -CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is -Ci and the -CF3 is substituted at the 4-position of the -phenyl

nd phamiaceutically acceptable salts thereof, wherein R', R^, R^, R*, n, and m are defined bove for the Cyanoiminopiperazine Corapoimds of formula (Illa).
In one embodiment, n is 0.
In another embodirtieni, □. is 1.
In another embodiment, n is 2.
In another embodiment, m is 0.
ID another embodiment, m is 1.
In another embodiment, m is 2.
In another embodiment, R' is -halo.
In another embodiment, R' is -CI.
hi another embodiment, R' is -Br.

4.9 CVANOnviINOPIPERAZINE COMPOUNDS OF FORMULA ailB)
The present invention encompasses compounds having the formula (IDb):

The present invention encompasses compounds having the formula (IHc):

and phaimaceutically acceptable salts thereof, wherein A, R^, R^, R"', R'", m, and q are defined above for the Cyanoiminopiperazine Compounds of fonnula (IIIc).

4.11 CYANOIMINOPIPERAZINE COMPOUNDS OF FORMULA (TV)
The present invention also encompasses compounds of formula (IV):

losilion with a -CF3 group.

In another embodiment, n and m are 0, R' is -halo or methyl; and R* is -phenyl. In one embodiment, -halo is -CI, In another embodiment, the -phenyl is substituted

defined above for the Cyanoimiaopiperazine Compounds of fonnula (IVa). Li one embodiment, q is 0.
ki another embodiment, q is 1. In another embodiment, q is 2. In one embodiment, m is 0. In another embodiment, m is L In another embodiment, m is 2. In another embodiment, A is -NH-.

In one embodiment, m is 0.
In another embodiment, m is 1.
In another embodiment, m is 2.
In another embodiment, A is -NH-
In another embodiment, A is -N((C,-Ce)a!kyl)-,
In another embodiment, A is -N(0{C,-C6)al]cyl)-.
In another embodiment, A is -0-.
In another embodiment, A is -S-.
In another embodiment, R' is -hydrogen.

groups.
In another embodiment, m is 1 and R^ is -phenyl, -naphthyl, -{Ci4)aryi or -(C5-C,o)heteroaiyl, each of which is unsubstituted or substituted with one or more R' groups.
In another embodiment, m is 1 and R^ is -CHj.
In another embodiment, m is 1, RMS -CH3, and the carbon atom to which the R-' is attached is in the (R)-configuration.
In another embodiment, m is I, R^ is -CH,, and the carbon atom to which the -R^ is attached is in the (S)-configuration.
In another embodiment, R* is -phenyl, -naphthyl, -(C3-C8)cycloalkyU-(C|4)aryl, or -(C5-Cio)heteroaryl, each of which is unsubstituted or substituted with one or more R' groups.
In another embodiment, R* is -phenyl.
In one embodiment, m is 0 and R" is -phenyl. In another embodiment, m is 1, R' is methyl, and R* is phenyl. In another embodiment, the -phenyl is substituted with a -(Ci-C^) aikyi group. In another embodiment, the -(Cj-Cg) alkyi group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Cj-Cg) alkyl group is a r-butyl group substituted at 4-position of the -phenyl. In another embodiment, the -{C,-Cg) alkyl group is an iso-propy] group substituted at the 4-posit.ion of the -phenyl.

In another embodiment, R' is -CFj or -CHF,.
In another embodiment, m is 0 and R' is -phenyl substituted at its 4-position with a -CF5 group.
hi another embodiment, m is 0, R' is -halo or methyl; and R^ is -phenyl. In one embodiment, -halo is -CI. In another embodiment, the -phenyl is substituted with a -(CfCg) alkyl group. In another embodiment, the -(Ci-C^) alfcyl group is substituted at the 4-position of the -phenyl. In another embodiment, the -(Ci-Ce) alkyl group is a t-butyl group or an wo-propyl group substituted at the 4-position of the -phenyl.
In another embodiment, m is 0, R' is -halo or methyl; and R^ is -phenyl substituted with -CF3. In another embodiment, -halo is -CI. In another embodiment, the -CF3 is substituted at the 4-position of the -phenyl. In another embodiment, -halo is -CI and the -CF3 is substituted at the 4-position of the -phenyl.

and pharmaceutically acceptable salts thereof, wherein Ar„ A12 R^, R'*, m, and t are defined above for the Cyanoiminopiperazine Compound of formula (VI).
In one embodiment AT, is a pyridyl group.
In another embodiment, Ai, is apyrimidinyl group.
In another embodiment, Ar, is a pyridazmyl group.
In another embodiment. Ar. is a nvrazinvl sroun.

In another embodiment, ATJ is a thiadiazoiyi group. In another embodiment, ATJ is a benzothiazolyl group. In another embodiment, Ar2 is a benzoimidazolyl group. In another embodiment, Ai, is abenzooxazolyl group. In another embodiment, Ar, is

4.15 CVANOIMINOPIPERAZINE COMPOUNDS OF FORMULA (VXD
The present invention also encompasses compounds of fonnula (VH):

In another embodiment, R, is -H.
In another embodiment, R, is -halo.
In another embodiment, R, is -CI.
In another embodiment, Ri is -Br.
In another embodiment, Rj is -I.
In another embodiment, R, is -F.
In another eitibodiment, R, is -CH3.
In another embodiment, R, is -NO-j.
In another embodiment, R, is -CN.
In another embodiment, R, is -OH.
In another embodiment, R, is -OCH3.
In another embodiment, R^ is -NH;.
In another embodiment, R, is -C(halo)3.
In another embodiment, Rj is -CHChalo);-
In another embodiment, R, is -CB2(halo).
In another embodiment, R, is -halo, -CN, -OH, -NOj, or -NH;;.
In another embodiment, R; is -(C,-Cio)alkyI, -(C2-Cn))aikenyl, -(C^-Cjo)alk:ynyI, -(C3-Cio)cycloalkyl, -(Cg-CiJbicycloalkyl, -(C5-C,4}tricycloaIkyl, -(C5-C,|,)cycIoalkenyl, -(Cs-C,4)bicycloalkenyl, -(Cs-C,4)tricycloaIkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is misubstituted or substituted with one or more R5 groups; or
In another embodiment, R2 is -phenyl, -naphthyl, -(Ci4)aryl or -(5- to 10-membered)lieteroaryl, each of which is imsubstilute or substituted with one or more R^ groups;
In another embodiment, R3 is -halo, -CN, -OH, -NO3, or -NHj.
In another embodiment, Rj is -(Ci-C|o)alkyl, -(Ci-C,o)alkenyl, -(C,-C,o)ali-ynyl, -(Cj-CioXycloalkyl, -(Cj-CiJbicycloalkyl, -{C3-C,4)tricycloalkyl. -(C5-C,o)cycloalkenyl, -(Cs-CiJbicycIoalkenyl, -(Cj-CJtricydoalkenyl, -(3- to 7-membered)heterocycle, or -(7- to 10-membered)bicycloheterocycle, each of which is unsubstituled or substituted with one or more R^ groups.

In another embodiment, R3 is -phenyl, -naphthyl, -{CiJaryl or -(5- to 10-membered) heteroaryl, each of which is unsubstituted or substituted with one or more R^ groups.

therefore exist in different enantiomeric and diastereomic forms. This invention relates to the use of all optical isomers and stereoisomers of the Cyanoiminopiperazine Compounds, and mixtures thereof, and to all pharmaceutical compositions and methods of treatment that may employ or contain them.
In the Cyanoiminopiperazine Compounds each R^ can be on any carbcn of the piperazine ring. In one embodiment, the Cyanoiminopiperazine Compounds have only one R' group, and that R^ group is attached to a carbon atom adjacent to the nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group. In another embodiment, the Cyanoiminopiperazine Compound has only one R' group, and that R' group is attached to a carbon atom adjacent to the nitrogen atom attached to the -C(=N-CN)-A-R* group, -C(=N-CN>NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-{R')-phenyl.
In another embodiment, two R' groups are on a single atom of the piperazine ring. In another embodiment, an R^ group is attached to a carbon atom adjacent to the nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group and another R' group is attached to a carbon atom adjacent to the nitrogen atom attached to the -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethyl group, 'C(=N-CN)-NH' phenpropyl group, or -C(=N-CN)-NH-(R^)-phenyl.
In another embodiment, the Cyanoiminopiperazine Compound has uvo R' groups, each being attached to a different carbon atom adjacent to a nitrogen atom attached to

the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group. In another embodiment, the Cyanoiminopiperazine Compound has two R^ groups, each being attached to a different carbon atom adjacent to a nitrogen atom attached to the -C{=N-CN)-A-R' group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or-C(=N-CN)-NH-(R^)-phenyI.
hi one embodiment, wherein the Cyanoiminopiperazine Compound has one or two Ji? groups, the carbon atom to which an R^ group is attached has the (R) configuration. In another embodiment, wherein the Cyanoiminopiperazine Compound has one or two K? groups, the carbon atom to which the K^ group is attached has the (S) configuration, hi another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, and at least one of die carbon atoms to which an R' group is attached has the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R"* groups, and at least one of the carbon atoms to which an R^ group is attached has the (S) configuration.
In another embodiment, the Cyanoiminopiperazine Compound has one or two R"' groups, an R-' group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazmyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R- group is attached is in the (R) configuration. In another embodiment the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -{C|-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the B? group is attached is in the (R) configuration, and R^ is -CH3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R-* groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached'is in the (R) configuration, and R' is -CFj. In another embodiment, the Cyanoiminopiperazine Compound has one or two R-' groups, an R-' group is attached to a carbon atom adjacent to a nitrogen

attached to the pyridy!, pyrimidinyl, pyrazinyl, pyridazinyl, or ttiiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CHiCH^.
hi another embodiment, the Cyanoiminopiperazine Compound has one or two R"* groups, an R' group is attached to a carbon atom adjacent to a nitrogen atom attached to the ■C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethy! group, -C(=N-CN)-NH-phenpropyI group, or -C(=N-CN)-NH-(R')-pheny!, and the carbon to which the R^ group is attached is in the (R) configuration. In another embodiment, the Cyanoirainopiperazine Compound has one or two R^ groups, an R' group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R^ group,-C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C{=N-CN)-NH-(R')-phenyI, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -{Ci-C4)alkyl unsubstituted or substituted with one or more halo groups, hi another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN>NH-phenpropyl group, or -C(=N-CN)-NH-(R')~phenyI, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CHj. In another embodiment, the Cyanoiminopiperazine Compound has one or two R' groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenetiiyI group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R^-phenyl, the carbon to which the R^ group is attached is in the CR) configuration, and R^ is -CF3. In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group,-C(=N-CN)-NH-phenethyl group, -C(=N-CN>-NH-pheiipropyI group, or -C{=N-CN>NH-CR'>phenyl, the carbon to which the R^ ^oup is attached is in the (R) configuration, and R^ is -CHjCHj.
In another embodiment, the Cyanoiminopiperazine Compound has one or two B? groups, an R-' group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R^ group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one or two R' groups, an R^ group is attached lo a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazmyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R' group is attached is in the (S)

configuration, and R^ is -(Ci-CJalkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R-* groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyi group, the carbon to wliich the R-^ group is attached is in the (S) configuration, and R^ is -CHj. In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyi group, the carbon to which the R-* group is attached is in the (S) configuration, and 'R? is -CF^, In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyi group, the :arbon to which the R"' group is attached is in the (S) configuration, and R-" is -CHjCH,.
Jn another embodiment, the Cyanoiminopiperazine Compound has one or two R.' groups, an R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to :he -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl 5roup, or -C(=N-CN)-KH-(R')-phenyi, and the carbon to which the R^ group is attached is in he (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has one )r tw'c R^ groups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to he -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl jroup, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the R' group is attached is in the S) configuration, and R"' is -(Ci-C4)alkyl unsubstituted or substituted with one or more halo ^Dups. In another embodiment, the Cyanoiminopiperazine Compound has one or two R^ jroups, an R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-::N)-A-R* group, -C(=N-CN>-NH-phenethyI group, -C(=N-CN)-NH-pfaenpropyl group, or -X=N-CN)-NH-(R')-phenyl, the carbon to which the R' group is attached is in the (S) onfiguration, and R^ is -CH3. In another embodiment, the Cyanoiminopiperazine llompound has one or two R' groups, an R' group is attached to a carbon atom adjacent to a dtrogen attached to the -C(=N-CN)-A'R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-l!N)-NH-phenpropyl ^oup, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the 'B? group ; attached is in the (S) configuration, and R-' is -CF3. hi another embodiment, the Cyanoiminopiperazine Compound has one or two R^ groups, an R"^ group is attached to a

carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-phenyI, the carbon to which the R^ group is attached is in the (S) confi^ration, and R^ is -CH2CH3.
In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyiimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, and the carbon to which the R^ group is attached is in the (R) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pynmidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -(Ci-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CH,. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R-' group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, or thiadiazolyl group, tlie carbon t^j which the R^ group is attached is in the (R) configuration, and R^ is -CF3. In another embodunent, the Cyanoiminopiperazine Compound has only one R-' group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to tiie pyridyl, pyrimidinyl. pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CH2CH3.
In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to the -C(=N-C:N)-A-R^ group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-phenyl, and the carbon to which the R^ group is attached is in the (R) configuration, hi another embodiment, the Cyanoiminopiperazine Compound has only one R^ gi'oup, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C{=N-CN)-A-R' group, -C(=N-CN)-NH-phenethyi group, -C(=N-C1S0-NH-phenpropyl group, or -C(=N-CN)-NH-(R")-phenyl, the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -{C,-C4)alkyl unsubstituted or substituted with

one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C{=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R^)-phenyi. the carbon to which the R^ group is attached is in the (R) configuration, and R^ is -CH3. In another embodiment, the Cyanoiminopiperazine Compound has only one R' group, the R-' group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R' group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the R^ group is attached is m the (R) configuration, and R^ is -CFy In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R' group is attached to a caibon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R^)-phenyl, the carbon to which the R' group is attached is in the (R) configuration, and R^ is -CH3CH3.
In another embodiment, the Cyanoiminopiperazine Compoxmd has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to the pyridyl, pyrimidmyi, pyrazinyl, pyridazinyi, or thiadiazoiyl group, and the carbon to which the R^ group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazuayl, or thiadiazoiyl group, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -(Ci-C4)alky] unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one Ti? group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, pyrimidinyl, pyrazinyl, pyridazinyi, or thiadiazoiyl group, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -CHj. In another embodiment, the Cyanoiminopiperazine Compound has only one R-* group, the R^ group is attached to a carbon atom adjacent to a nittogen attached to the pyridyl, pyrimidinyi, pyrazinyl, pyridazinyi, or thiadiazoiyl group, the carbon to which the R' group is attached is in the (S) configuration, and R^ is -CF;. In another embodiment, the Cyanoiminopiperazine Compound has only one R' group, the 'R? group is attached to a carbon atom adjacent to a nitrogen attached to the pyridyl, p>TimidinyI,

pyrazinyl, pyridazinyl, or thiadiazolyl group, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -CHiCH,.
hi another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen atom attached to the -C(=N-CN)-A-R^ group, -C(=N-CN)-NH-phenethyl group, -C{=N-CN)-NH-phenpropyl group, or -C{=N-CN)-NH-{R')-phenyl, and the carbon to which the R-' group is attached is in the (S) configuration. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R^ group, -C(=N-CN}-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN>NH-(R^-phenyi, the carbon to which the R^ group is attached is ui the (S) configuration, and R-* is -(C|-C4)alkyl unsubstituted or substituted with one or more halo groups. In another embodiment, the Cyanoiminopiperazine Compound has only one R' group, the R' group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -CH,. In another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent tc *i nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyl group, or -C(=N-CN)-NH-(R')-pheny!, the carbon to which the R^ group is attached is in the (S) configuration, and R^ is -CF3. Jix another embodiment, the Cyanoiminopiperazine Compound has only one R^ group, the R^ group is attached to a carbon atom adjacent to a nitrogen attached to the -C(=N-CN)-A-R* group, -C(=N-CN)-NH-phenethyl group, -C(=N-CN)-NH-phenpropyI group, or -C(=N-CN)-NH-(R')-phenyl, the carbon to which the R^ group is attached is in the (R) configuration, and K' is -CH3CH3.
The present invention includes the Cyanoiminopiperazine Compounds, and the phannaceutically acceptable salts thereof, wherem one or more hydrogen, carbon or other atoms are replaced by isotopes thereof. Such compounds maybe useful as research and diagnostic tools in metabolism phannacokinetic studies and in binding assays.
Illustrative Cyanoiminopiperazine Compounds are listed below in Tables 1 -8:

4.17 DEFINITIONS
As used herein, the ternis used above having following meaning:
"-(C,-C|r))alkyl" means a straight chain or branched non-cyclic hydrocarbon laving firom 1 to 10 carbon atoms. Representative straight chain -(C,-C,o)alky!s include methyl, -ethyl, -n-propyl, -n-butyl, -n-pentvi, -n-hexyl, -n-heptyl, -n-octyl, -n-nonly and -n-lecyl. Representative branched -(C,-C,o)atkySs include -isopropyl, -sec-butyl, -isobutyl, tert-butyl, -isopentyi, -neopentyi, I-methy!but\^i, 2-methyIbutyl, S-methylbutyl, ,,1-diinetbylpropyl, 1,2-dimethylpropyl. 1-methylpentyI, 2-methylpentyl, 3-methylpentyi,. t-insthylpentyl, 1-eihylbutyl, 2-ethyIbutyL 3-eth\'Ibutyl, 1,1-dimethtylbutyL :,2-diniethy]bi!tyl. 1,3-dimethylbutyl, 2,2-dimediyIhutyL 2,3-dimethylbutyI and i,3-dimethylbutyl. -isopropyl, -jec-butyl, -isobutyl, 1-methylhexyl, 2-methylhexyl, 3-nethylh.exyl 4-niethyIhexyl, 5-methylhexyl, 1,2-dimethylpeniyl, 1,3-dimethylpentyl, 1.2-hmethylhexyl, l,3-dimethylhexyh3,3-diniethylhexyl, l^Z-dimethylheptyl, 1,3-iimeihylheptyl, siid 3,3-dimethylheptyl.
"-(C,-C(;)a]lc>'l" means a straight ch;-iin or branched non-cyclic hydi-ocarbon lavina; .fi-om I to 6 carbon atoms. Rrprsscntative ijtraight chain -(C|-C-)alkyIs include me'Jiyi; -ethyl, -fi-propyi, -ii-butj'l, -n-pentyl and -n-hexyl. Representative branched -(C,-3fi)?II(yb include -isopropyl, -sec-butyi, -isobutyl, -tert-butyl. -isopentyi, -neopentyi, l-eic!hylbut>i, 2-tnethylbutyl, 3-metliyibutyl, 1,1-diniethylpropyl. 1 ;2-dnnethylpropyI, i-inelhy!pentyl, 2-methylpentyi, 3-methylpentyl, 4-methylpentyl, 1-ethylbtityl, 2-ethyIbut>-l, i-efliylbutyl, 1,1-dimethtylbutyI, l^-thmethylbutyl, 0-diinethy!butyl,2;2-dimethyibutyL >,3-dimethylbuti'l and 3,3-dimethylbiityl.
"-(C2-C|o)alkenyr' means a straight chain or branched non-cyclic hydrocarbon la^dtir; fecim 2 to 10 carbon atoms and including at least one carbon-carbon double bond. [representative straight chain and branched (Ci-C,o)aIkeiiyls include -vinyl, -allyl, -1-butenyI. ■2-buieuyi, -isobutylenyl, -1-pentenyl, -2-pentenyl, -3-methyl-I-butenyi, -2-metby!-2-butenyl, ■2,3-ciunethyi-2-butenyI, -1-hexenyl, -2-hexenyl, -3-hexenyl, -1-heptenyl, -2-heptenyl, -3-hiepteiiyl, - [-octenyl, -2-octsiiyl, -3-octenyl, -l-noneJiyl, -2-nqnenyi. -3-nonenyl, -!-deceiiyl, ■2-deceTiy!, -3-decenyl and the like.

"-(C2-C6)aikenyl" means a straight chain or branched non-cyclic hydrocarbon ha'/ingfiom 2 to 6 carbon atoms and including a: least one carbon-carbon double bond. Representative straiglit chain and branched (C.-C,)alkenyls include -vinyi, -ally!, -1-butenyl, -2-butenyI, -isobutylenyl, -l-pentenyl, -2-pentenyl. -3-methyl-l-butenyl. -2-methyl-2-butenyl, -2,3 -dimetliyI-2-butenyl, -1-hexenyl, 2-hexenyl, 3-hexenyi and the like.
'-(C2-C,o)alkynyr' means a straight chain or branched non-cyclic hydrocarbon having from 2 to 10 carbon atoms and including at lease one carbon-carbon triple bond. Representative straight chain and branched -(C;-C,o)aIkynyis include -acetylenyl, -propyny!, -1-butynyl, -2-butynyl, -1-pentynyi,-2-pent}'nyL -3-methyl-l-butynyl, -4'pentynyl, -1-iiexynyl, -2-hexynyl -5-hexynyl, -1-heptynyL -2-hept>Tiyl. -6-hept5.-nyl, -1-octynyl, -2-octynyl, -7-octynyl, -1-nonynyl, -2-nonynyl, -8-nonyny!, -1-decynyl, -2-decynyl, -9-decynyl and the iiia".
"-(C2-Cs)alkynyr' means a straight chain or branched non-cyclic hydrocarbon having from 2 to 6 carbon atoms and including at lease one carbon-carbon triple bond. Representative straight chain and branched (Ci-C,,)alkyiiyls include -acetylenyl, -p^op>^^yI. -1-butyiiy!, -2-butynyl, -1-pentynyl, -2-pe3tynyl, -3-methyl-l-butynyl, -4-pent\iiyl. -I-hexwyl, -2-hexyiiy], -S-hexynyl and the like.
"-{C3-C,o)cyc]oalkyl" means a saturated cyclic hydrocarbon having from 3 lo 10 carbon atoms. Representative (C3-Cio)cycloalkyls are -cyclopropyl, -cyclobutyl, -cyclopsntyl, -cyclohexyl, -cyciohept>'l, -cyclooctyl, -cyclononyl and -cyclodecyL
"-{C3-Cs)cycloall:yr' means a saturated cyclic hydrocarbon having from 3 to 8 carbon atoms. Representative (C3-CB)cycloalkyls include -cyciopropyl, -cyclobutyl, -cyclopentyl, -cyclohexyl, -cycloheptyl and -cyclooctyl.
"-(Cg-C,4)bicycloalkyl" means a bi-cyclic hydrocarbon ring s>^tem having from 8 to 14 carbon aioms and at least one saturated cyclic alkyl ring. Representative -f Cg-CiJbicycloalkyls include -indanyl, -1^,3.4-tetrahydronaphlhyl, -5,6,7,8-tetrahydronaphthyL -perhydronaphthy! and the like.
"-(Cg-C.JtricycIoalkyi" means a tri-cyclic hydrocarbon ring system having from S to 14 carbon atoms and at least one saturated ring. Representati\'e -(Cj-CijJLiicycloallcyis include -pyi-enyl, -1,2,3,4-tetrahydroanthracenyl, -perhydroanthraceny! -acspnthronsyl, -1,2,3,4-tetrahydropenanthrenyl, -5,6,7,8-tetrahydrophenanthrenyl..

-perhydrophenanthrenyl and the Hke.
"-(C5-Ci(,)cycloaIlcetiyl" means a cyclic non-aromatic hydrocarbon having at
least one carbon-carbon double bond in the cyclic system and from 5 lo 10 carbon atoms.
Representative (C5-C,o)cyc!oalkenyls include -cyciopentenyl, -cyclopentadienyl,
-cyclohexenyl, -cyciohexadienyL-cycloheptenyl. -cycloheptadienyl, -cycloheplatiienyl,
-cyciooctenyl, -cyclooctadienyl, -cyclooctatiienyi, -cyclooctatetraenyL -cyclononenyl
-cyclononadienyl, -cyclodecenyl, -cyclodecadienyl and the like.
"-(C;-Cs)cycloalkenyI" means a cyclic non-aromatic hydrocarbon having at
■ ;ast one carbon-carbon double bond in the cyclic system and from 5 to S carbon atoms. Lepresentative (C5-Cy)cycioaIkenyls include -cyciopentenyl, -cyclopentadienyl, :yclohexenyU -cyclohexadienyi, -cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl, :yclooctenyl, -cyclooctadienyl, -cyclooctatrienyl, -cyclooctatetraenyl and the like.
"-(Cj-C|4)bicycioalkenyr' means a bi-cychc hydrocarbon ring system having at iiist one carbon-carbon double bond in each nag and from 8 to 14 carbon atoms. Lepresentative -(CB-C]4)bicycloalkenyls include -indenyl, -pentalenyl, -naphtiialenyl, azulenyl, -beptalenyl, -1,2,7,8-tetrahydronaphthalenyl and the like.
"-(Cg-C,4)tric>'cloalkenyi" means a tri-cyciic hydrocarbon ring system having t least one carbon-carbon double bond in each ring and from 8 to 14 carbon atoms. Lepreseutativs -(Ca-Ci4)tricycIoalkeriyls include -anthracenyl, -phenanthrenyl, phenalenyl, -acsnaphthalenyl, iis-indacenyl, r-indacenyl and the like.
"-(C3-C7)heterocycle" or "-(C3-C,)heterocyclo" means a 3- to 7-membered aonocyclic Ueteroc>-clic ring which is either saturated, unsaturated non-aromatic, or aromatic. ^ 3-membered -(C3-C7)heterocycle can contain up to 3 heteroatoms, and a 4- to 7-membered (Cj-C7)beterocycle can contain up to 4 heteroatoms. Each heteroatom is independently elected from nitrogen, which can be quatemized; oxygen; and sulfur, including sulfoxide and ulfone. The -(C3-C7)heterocycle can be attached via a nitrogen, sulfur, or carbon atom. lepresentative -(C3-C7)heterocycles include pyridyl, fiiryl, tliiophenyl, pyrrolyl, oxazolyl, niidazolyl, thiazolyl, thiadiazolyl isoxazolyl, p>TazolyI, isothiazolyl, pyridazinyl, lyrimidinyl, pyrazinyl, tria2inyl, morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyi, jipsraziiiyl, hydantoinyl, valerolactamyl, oxinmyl. oxetanyl, tetrahydrofliranyl,

tetrahydropyranyl, tetrahydropyrindinyl, tetrahydrcpyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl and the like.
"-(C3-C5)heterocycle" or '-(C-Cj^iheterocyclo" means a 3- to 5-membered monocyclic heterocyclic ring which is either sanirated, unsaturated non-aroraatic, or aromatic. A 3-membered -(C3-C7)heterocycle can contain up tc 3 heteroatoms, and a 4- to 5-meinbered -(C3-C5)heterocycIe can contain up to 4 fieteroatcms. Each heteroatom is independently selected from nitrogen, which can be quaternized; oxygen; and sulfor, including sulfoxide and SLilfone. Tlie -(C,-C;)heterocycle can be attached via a nitrogen, sulfur, or carbon atom. Representative -(C;-C'5)heterocycles include fury!, thiophenyl, pyrrolyl. oxazoiyl, imidazoiyi, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, triazinyi. pvrrolidinonyl, pyrrolidinyl, hydantoinyl, oxiranyl, oxetanyl tetrahydrofiiranyl, tetrahydrothiophenyl and the like.
"-(C7-C,o)bicycloheterocycle" or "-{C7-C,5)bicycloheterocyclo" means a 7- to 10-meinbered bicyclic, heterocyclic ring which is either saturated, unsaturated non-aromatic, or aromatic. A -(C7-C,o)bicycloheterocycle contains from 1 to 4 heteroatoms independently selected fi om nitrogen, which can be quaiemized; oxygen; and sulfiir, including sulfoxide and sulfcne. '.rhe (CT-C,o)bicycioheterocyc!e can be attached via a nifrogen, sulflir, or caibon atom. Representative -(C7-C|£,)bicycloheterocycles include -quinolinyl, -isoquinoHnyl, -chromonyl, -coumarinyl, -indolyl, -indoHzinyl, -ben2o[b]furanyL, -benzo[b]thiopbeny], -iodazclyl, -purioyl, -4H-quinolizinyI, -isoquinolyl, -quinolyi, -phtlialaziayl, -oaphthyridinyl, -carbazolyl, -^-carbolinyl and the like. ■
"-(Ci4)aryr' means a 14-membered aromatic carbocyclic moiety such as -anthryl or -phenanliiiyl.
'■-(Cc-Cic)heteroar>(" means an aromatic heterocycle ring of 5 to 10 members, including both mono- and bicyclic ring systems, wherein at least one carbon atom of one or both of the rings is replaced with a heteroatom independently selected from nitrogen, oxygen and sulfrif. One or both of the -(C5-Cio)heteroaryrs rings contain at least one carbon atom. -R-ppiesentative (C5-C|o)heveroaryls include pyridyl, finyl, benzofui&nyl, thiophenyl, benzotiiiophcnyi, quinolinyl, pyrrolyl, indolyl, oxazoiyl, benzoxazolyl, imidazoiyi, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyriniidinyl, pyrazinyl thiadiazolyl, triazinyi^ cinnoUnyl, phihalazinyl, and quinazoliiiyl.

The term "animal," includes, but is not limited to, a cow, monkey, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, guinea pig and human.
The phrase "pharmaceutically acceptable salt," as used herein, is a sah formed from an acid and a basic nifrogen group of one of the Cyanoiminopiperazine Compounds. Illustrative salts include, but are not limited, to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nifrate, bisuifate, phosphate, acid phosphate, isonicotinate, lactate, sahcylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitarfrate, ascorbate, succinaie, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanes',;Ifonate. ethanesuifonate, benzenesulfonate.fi-toluenesulfonate, and pamoate (i.e., I.r-methylene-bis-(2-hydroxy-3-naphthoate)) sahs. The term'pharmaceutically acceptable salt" also refers to a salt prepared from a Cyanoiminopiperazine Compound having an acidic functional group, such as a carboxylic acid functional group, and a pnarmaceutically acceptable inorganic or organic base. Suitable bases include, but are not limited to, hydroxides of alkah metals such as sodium, potassium, and hthiura; hydroxides of alkaline : eaith metal such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammoma, and organic amines, such as unsubstituted or hydroxy-substituEed mono-, di-, or trialkyiaraines: dicyclohexy\amine; tributyl amine; pyridine; N-methyl,N-cthylamine;: dietliylamuie; triethylainine; mono-, bis-, or tris-(2-hydroxy-lower all^l amines), such as n\ono-, bis-, or tris-fZ-hydroxyethylJamine, 2-hydroxy-tert-butylamine, or tris-(hydroxymethyl)methylamine, N, N,-di-low6r alkyl-N-{hydroxy lower alkyl>-amiues, : such as N,N,-dimethyl-N-(2-hydroxyethyl)amine, or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine, lysine, and the like.
When a first group is "substituted with one or more" second groups, each of one or more of the first group's hydrogen atoms is replaced with a second group. In one embodiment, each carbon atom of a first group is independently substituted with one or two second groups. In another embodunent, each carbon atom of a first group is independently substituted with only one second group.
The term "UI" means urinary incontinence.
The term "IBD" means inflammatory-bowel disease.
The term "IBS" means iniiable bowel syndrome.
The tenn "DIEA" means diisopropylethylamine.

Scheme B
An amine of formula l^R^R"", wherein R"* and R^ are defmea above, i& reacted with dipiisiiylcyanocabonimidaxe (commercially available from Sigma-Aldrich, St. Louis, MO (w^-v\ .sigma-aldiicli.com)) in an aptotic solvent such as diethyl ether, tii-D-pTOvyl ether, tetrahycfrof^iraii, methylene chloride, or toluene to provide the compound of fonnula A. In one embodimetir. the aprotic solvent is DCM and the reaction mixture of NHR^'R' aud .-diphenylcyanocabonimidate is allowed to react at about room temperature. In another embodiment, the ^rohc solvent is toluene and the reaction mixture of NHR^R* and diphenylcyanocabonimidate is allowed to react at about UCC. The NHR^R"* and diphenylcyanocaboniraidare is typically allowed to react for a period of about 0.5 h to about 24 h. Topically the compound of foraiuia A is used without Parther purification.
Compounds of formuls B can be obtained as shown below in Scheme C:

wherein R-, R', m, and Ai are defined above for the Cyanoiminopiperazine Compounds.
A compound of formula B is reacted with a compound of fomiula E to provide tJie

wherein R' is defined above.
The compound of formula F can be obtained by reacting a compound of
formula G with PCI5. A representative procedure for obtaining a compound of formula F
from a compound of formula G is provided in R,L. Webb et al., J. HeierocycL Chem.
19(5)--1205-1206(19S2).
The compound of formula G can be obtained by reacting a compound of brmula R^-OH with COClj, triphosgene, or CO and a Pd catalyst as described in U.S. Patent \H). 6,175,01? to H. Buyschi et al; A. Gode et al., Chemistry-A Evropean JOWTIOI !(19):3522-30 (2lX)0); orH. Yasudaet al.: Organoi}ietanics,2\(6):l2\6-20 (2002), espectively. Compounds of formula R'-OH are commercially available or can be prepared ly (Tiethods -well known to those .^killed in the art.

wixrein R^ and SJ° are defined above.
A thiol of formula R*SH is reacted with a compound of formula J to provide lie conipouud of formula H. Representative procedures for obtaining compounds of formula t and for obtaining the compound of formula H by reacting a thiol with a compoxmd of ormula J are provided in R.L. Webb et a!., J. Heterocyci Che?n... 24(l):275-78 (1987); I. luid et al., Liebigs Ann. Chem. 6:599-601 (1988); and L.S. Wittenbrook et al., J. Heterocyci. Mem. .i2!;i)::37-42 (1975). Compounds of formula R*-SH are commercially available or can e prepared by methods well known to those skilled in the art.
The Cyanoiniinopiperazine Compounds of formula VI and VII can be obtained 5 describ.^d below in Scheme I.

/hcKirt AT,, 'R^, and t are defined above.
Scheme I ■ Anan-iineof foimulalorananaineoffonnula Jisreactedwith iphenylcyanocabonimidate (commercially avaiiahle from Sigma-Aldrich, St. Louis, MO v-v.nw.sigma-aldrichxom)) in an aprotic solvent such as diethyl ether, di-n-propyl ether, trahydroiuraii, methylene chloride, ov toluene to provide the compound of formula K or a impound of formula L, respectively. In one embodiment, the aprotic solvent is DCM and e reaction mixture of the amine of fonnula I or the amine of formula J and pheuylcyanocabonimidate is allowed to react at about room temperature, hi another ibodiment. the aprotic solvent is toluene and the reaction mixture of the amine of formula 3 tlte amine of fomiula J and diphenyicyanocaboniraidate is allowed to react ac about 0'C. The amine of formula i or the amine of formula J and diphenylcyanocaboniinidate is

typically allowed to react for a period of about 0.5 h to about 24 h. Typically the compound of formula K or the compound of formula L is used without inrther purification.
The compound of formula K or the compound of formula L is then reacted with a compound of formula B, obtained as described above in Scheme B, according to the 5 procedure described above in Scheme A to pro'-ide the Cjanoiminopiperazine Compound of formula (VT) or (VII) , respectively.
4.19 THERAPEUTIC USES OF THE CVANOIMUNOPIPERAZINE COMPOUNDS
In accordance with the invention, the Cyanoiminopiperazine Compounds are ) adminisiered to an animal in need of treatment or prevention of pain, Ul. an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, stroke, a seizure, a pnirilic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, dementia, retinopatiiy, a muscle spasm, a migraine,, vomiting, dyskinesia, or depression.
In one embodiment, an effective amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by inhibiting VRl. Examples ofconditions that are treatable or preventable by inhibiting VRl include, but are not limited to, pain, Ul, an ulcer, BD, and IBS.
Ill another embodiment, an effective amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by inhibiting mGluRS. Examples of conditions that are treatable or preventable by ioliibitiog mGItiRS inchwie, but are not limited to, pain, an addictive disorder, Paridnson's disease, parkinsonism,
■
anxiety, a pruritic condition, and psychosis.
In another embodiment, an efifectivs; amount of a Cyanoiminopiperazine Compound can be used to treat or prevent any condition treatable or preventable by mhibiting mGluRl. Examples of conditions that are treatable or preventable by inhibiting raGluRl
include, but are not limited to, pain, Ul, an addictive disorder, Parkinson's disease, pai'kinsomsra, anxiety, epilepsy, stroke, a seizure, a pruritic conditionj psychosis, a cognitive disorder, a memory deficit, restricted brain function, Hundngton's chorea, ALS, dementia, retinooatiw, a muscle spasm, a migraine, vomiting, dyskinesia, and depression.

The Cyanoiminopiperazine Compounds can be used to treat or prevent acute or chronic pain. Examples of pain treatable or preventable using the Cyanoiminopiperazme Compounds include, but are not limited to, cancer pain, central pain, labor pain, myocardial infarction pain, pancreatic pain, colic pain, post-operative pain, headache pain, muscle pain, 5 pain associated with intensive care, arthritic pain, neuropathic pain, and pain associated with a periodontal disease, including gingivitis and periodontitis.
The Cyanoiminopiperazine Compounds can also be used for inhibiting, preventing^ or treating pain associated with inflammation or wth an ioilammatory disease in an animal. The pain to be inhibited, treated or prevented may be associated with inflammation associated with an inflammatory disease, which can arise where there is an inllamniation of the body rissue, and which can be a local inflammatory response and/or a systemic inilammation. For example, the Cyanoiminopiperazine Compounds can be used to inhibit, treat, or prevent pain associated with inflammatory diseases including, but not limited to: organ transplant rejection; reoxygenation injury resulting from organ transplantation (see Giupp et al.. J. UoL Cell Cardiol. 31:297-303 (1999)) including, but not limited to, transplantation of the hean, lung, liver, or kidney; chronic inflammatory diseases of the joints, including arthritis, rheumatoid arthritis, osteoarthritis and bone diseases associated with increased bone resorption; inflammatory lung diseases, such as asthma, adult respiratory distress syndrome, and chronic obstructive ainvay disease; inflammatory diseases of the eye. including corneal dystrophy., trachoma, onchocerciasis, uveitis, sympathetic ophthalmitis and endophthalmitis; chronic inflammatory diseases of the gum, including gingivitis and periodontitis; tuberculosis; leprosy; inflammatory diseases of the kidney, including uremic complicaticns, glomerulonephritis and nephrosis; inflammatory diseases of the skin, including sclerodsrmafitis, psoriasis and eczema; inflammatory disease of the central nervous system, including chronic demyelinating diseases of the nervous sj^tem, multiple sclerosis, AIDS-celaied neurodegeueratioa and Alzheimer s disease, infectious meningitis, encephalomyehlis, Parkinson's disease, Huntington's disease, arcyotrophic lateral sclerosis and viral or lutoinmiimf; encephalitis; autoimmune diseases, including Type I and Type H diabetes nellitus; diabetic complications, inciudmg, but not limitea to, diabetic cataract, glaucoma, ■etiiiopaUiy, nepliropathy (such as microaluminuria and progressive diabetic aephropatliy). jolyneuropathy, mononeuropathies, autonc-mic neuropathy, gangrene of the f-^et.

atherosclerotic coronary arterial disease, peripheral arterial disease, nonketotic hyperglycemic-hyperosmolar coma, foot ulcers, joint problems, and a skin or mucous membrane complication (such as an infection, a shin spot, a candidal infection or necrobiosis lipoidica diabeticorum); immune-complex vasculitis, and systemic lupus erythematosus (SLE); inflammatory diseases of the heart, such as cardiomyopathy, ischemic hean disease hypercholesterolemia, and atherosclerosis; as well as various other diseases that can have sigmficant inflammatory components, including preeclampsia, chronic liver failure, brain and spinal cord trauma, and cancer. The Cyanoiminopiperazine Compomids can also be used for inhibiiing, treating, or preventing pain associated with inflammatory disease that can, for example, he a systemic inilanunation of the body, exemphfied by gram-positive or gram negative shock, hemorrhagic or anaphylactic shock, or shock induced by cancer chemotherapy in resiponse to pro-inflammatory cytokines, e.g., shock associated with pro¬inflammatory cytokines. Such shock can be induced, e.g., by a chemotheiapeutic agent that is adrainstered as a treatment for cancer.
The Cyanoiminopiperazine Compounds can be used to treat oi prevent Ul. E.xampies of XJI treatable or preventable using the Cyanoirainopiperazine Compounds uiclude. but are not limited to, urge incontinence, stress inconlinence, overflow incontinence, neurogemc incontinence, and total incontinence.
The Cjimoiminopiperazine Compounds can be used to treat or prevent an ulcer. Exairples of ulcers treatable or preventable using the Cyanoiminopiperazine Compounds include, but are not limited to, a duodenal ulcer, a gastric nicer, a marginal ulcer, an esophiigeal ulcer, or a stress ulcer.
The Cyanoiminopiperazine Compounds can be used to treat or prevent IBD, it^oluding Crohn's disease and ulcerative colitis.
The. Cyaooiminopiperazine Compounds can be used to treat or prevent IBS. Examples o^'IBS treatabia or preventable using the Cyanoiminopiperazine Compounds include, but are not limited to, spastic-colon-type IBS and constipation-predominant IBS.
The Cyanoiminopiperazine Compounds can be used to treat or prevent an iddiclive diijcrder, including but not limited to, :in eating disorder, an impulse-control iisordsi; an alcohol-related disorder, a nicotine-related disorder, an amphetamine-related iisyrder. a cannabis-relaied disorder, a cocaine-related disorder, an hallucinogen-related

disorder, an inhalant-related disorders, and aiY opioid-reiated disorder, all of which are further iiub-classified as listed below.
Eating disorders include, but are Bot limited to. Bulimia Nen'osa, Nonpurging Type; Bulimia Nervosa, Purging Type; Anorexia; and Eating Disorder not otherwise specified i (>fOS).
Impulse control disorders include, but are not limited to, Intermirtent Explosive Disorder, Kleptomania, Pyromania, Pathological Gambling, Trichotillomania, and impulse Coutro! Disorder not otherwise specified (NOS).
Alcohol-related disorders include, but are not limited to, Alcohol-hiduced l^sychotic Disorder with delusions. Alcohol Abuse, Alcohol Intoxication, Alcohol V/ithdrawal, Alcohol Intoxication Delirium, Alcohol Withdrawal Delirirun, Alcohol-Induced Persisting Dementia, Alcohol-Induced Persisting Amnestic Disorder, Alcohol Dependence, Alcohol-Induced Psychotic Disorder with hallucinations, Alcohol-Induced Mood Disorder, Alcohol-Induced Anxiety Disorder, .\lcohoI-Induced Sexual Dystiiiiction, A icohol-Induced" Sleep Disorder, Alcohol-Related Disorder not otherwise specified (NOS), Alcohol Intoxicraioii, and Alcohol Withdrawal.
Micotine-related disorders include, but are not limited co. Nicotine Dependence, Nicotine Withdrawal, and Nicotine-Related Disorder not otherwise specified : (MOS).
.\m{jhexaLiine-relaled disorders include, but are not Umited to, Ampht^taroine Dependence, Amphetamine Abuse, Amphetamine Intoxicatioii, Amphetamine Withdrawal, Amphetamine Intoxication Delirium, Amphetamine-Induced Psychotic Disorder with delusions, Amphetamine-Induced Psychotic Disorders with hallucinations, Amphefaiuine-Induced Mood Disorder, Amphetamine-Induced Anxiety Disorder, A-mphetamine-Induced Sexual Dysfimction, Amphetamine-Induced Sleep Disorder, (Amphetamine Related Disorder not otherwise specified (NOS), Amphelamine Intoxication, md Amphetamine Withdrawal.
Cannabis-related disorders include, but are not limited to, Cannabis :)ependence, Cannabis Abuse, Cannabis Intoxication, Cannabis Intoxication Delirium, ^'smnabis induced Psychotic Disorder with delusions, Cannabis-Induci^d Psychotic Disorder

with hallucinations, Cannabis-Induced Anxiet>- Disorder, Cannabis Related Disorder not otherwise specified (NOS), and Cannabis Intoxication.
Cocaine-related disorders include, but are not limited to. Cocaine Dependence, Cocaine Abuse, Cocaine Intoxication, Cocaine Withdrawal, Cocaine Inloxication Delirium, ' Cocaine-Induced Psychotic Disorder witli delusions, Cocaine-Induced Psychotic Disorders with hallucinations, Cocaine-Induced Mood Disorder, Cocaine-Induced Ajixiety Disorder, Cocaine-Induced Sexual Dysfunction,. Cocaine-Induced Sleep Disorder, Cocaine Related Disorder nor otherwise specified (NOS), Cocaine Intoxication, and Cocaine Withdrawal.
Hallucinogen-related disorders include, but ai-e not limited to, Hallucinogen Dependence. Hallucinogen Abuse, Hallucinogen Intoxication, Hallucinogen Withdrawal, Hallucinogen Intoxication Delirium, Hailucinogen-iiduced Psychotic Disorder with delusions, Hallucinogen-Induced Psychotic Disorders with hallucinatioas, Hallucinogen-Induced Mood Disoider, Hallucinogen-Induced Anxiety Disorder, Hallucinogen-Induced Sexual Dysfimction, Hallucinogen-Indxiced Sleep Disorder, Hallucinogen Related Disorder not otherwise specified (NOS), Hallucinogen Intoxication, and Hallucinogen Psrsisring Perception Disorder (Flashbacks).
Inhaiant-reiatp^ disoiders include, but aie not limited to. Inhalant Dependence, Inhalant Abuse, Lihalant Intoxication, Inhalant Intoxication Delirium, Inhalant-Induced Psychotic Disorder with delusions, Mialant-Induced Psychotic Disorder with haUucinations, Iiihalant-Iaduced Anxiet>- Disorder, Inhalant Related Disordet not otherwise specified (NOS), and Inhaiant Intoxication.
Opioid-related disorders include, but are not limited to, Opioid Dependence, Opioid Abiise, Opioid Intoxication, Opioid Intoxication Delirium, Opioid-Induced Psychotic Disorder -m-ii delusions, Opioid-Induced Psychotic Disorder with hallucinations, C>iiioid-Induced Anxiety Disorder, Opioid Related Disorder not o^erwise specified (NOS), Opioid Intoxication, snd Opioid Withdrawal.
The Cyanoiminopiperazine Compounds can be used to treat or prevent Parkinson's disease and parkinsonism and the symptoms associated with Parkinson's disease and parldnsonism; inciudiiig but not limited to, bradykinesia, muscular rigidity, resting [rernon and impairment of postural balance.

The Cyanoiminopiperazine Compounds can be used to treat or prevent generalized anxiety or severe anxiety and the symptoms associated with anxiety, including but not limited to, restlessness; tension: tachycardia; dyspnea; depression, including ciironic "neurotic" depression; panic disorder; agoraphobia and other specific phobias; eating disorders; and personality disorders.
The Cyanoiminopiperazine Compounds can be used to treat or prevent epilepsy, including but not limited to, partial epilepsy, generalized epilepsy, and the s^/mptoms associated with epilepsy, including but not limited to, simple partial seizures, jacfcsoman seizures, complex partial (psychomotor) seiziu-es, convulsive seizures (grand mai or tonic-cionic seizures), petit raal (absence) seizures, and status epilepdcus.
The Cyanoiminopiperazine Compounds can be used to treat or prevent strokes, including but not limited to, ischemic strokes and hemorrhagic strokes.
The Cyanoiminopiperazine Compounds can be used to treat or prevent a seizure, including but not limited to, infantile spasms, febrile seizures, and epileptic seizures.
The Cyanoiminopiperazine Compounds can be used to treat or prevent a pruritic condition, including but not limited to, pnirihis caused by dry skin, scabies, dermatitis, herpetifonnis, atopic dermatitis, _I3;-M/7/MJ vu.'vae et ani, mih'iiria, insect bites, aediculosis, contact dermatitis, drug reactions, urticaria, urticarial eniptions of pregnancy, jsoriasis, lichen planus, lichen simples chronicus, exfoliative dermatitis, folliculitis, bullous leniphiaoid, or fiberglass dennatitis.
The Cyanoiminopiperazine Compounds'can be used to treat or prevent tsychosis, including but not limited to, schizophrenia, including paranoid schizophrenia, lebephrenic or disorganized schizophrenia, catatonic schizophrenia, undifferentiated chizophrcnia, negative or deficit subtype schizophrenia, and non-deficit schizophrenia; a elusionaJ disorder, including erotomanic subtype delusional disorder, grandiose subtype elusional disorder, jealous subtype delusional disorder, persecutory subtype delusional isorder, and somatic subtype delusional disorder; and brief psychosis.
The Cyanoiminopiperazine Compo\md3 can be used to treat or prevent a Dgnitive disorder, including but not limited to, delirium and dementia such as multi-infarct trnitntia, dementia pugihstica, dimentia caused by AIDS, and dementia caused by Izheimer's disease.

The Cyanoiminopiperazine Compounds can be used to treat or prevent a menioi-y deficiency, including but not limited to. dissociative amnesia and dissociative fugue.
The CyauQiminopiperazine Compounds can be used to treat or prevent ■restricted brain function, including but not limited to, that caused by surgery or an organ iiansplant, restricted blood supply to the brain, A spinal cord injury, a head injury, hypoxia, cardiac arrest, or hypoglycemia.
The Cyanoiminopiperazine Compounds can be used to treat or prevent iluritington's chorea.
The Cyanoiminopiperazine Compounds can be used to treat or prevent ALS.
The Cyanoimiaopiperazine Compounds cm be used to treat or prevent retinopathy, including but not limited to, aneriosclerotic retinopathy, diabetic arteriosclerotic lelinopathy, hypertensive retinopathy, non-proliferative retinopatliy, und proliferative retinopathy.
The Cyanoiminopiperazine Compounds can be used to treat or prevent a miisc'./s spasm.
The Cyanoiminopiperazine Compound!; can be used to treat or prevcinl a migvaiue.
The Cyanoiminopiperazine Compounds ran be used to inhibit, treat or prevful vomiting, including but not limited to, nausea vomiting, dry vomiting (retching), and regrargitation.
The Cyanoiminopiperazine Compounds can be used to treat or prevent dyykineaia, including but not Jimited to, tardive dyskinesia and biliary dyskinesia.
The Cyanoiminopiperazine Compounds can be used to treat or prevent depresJ-ion, including but not limited to, major depression and bipolar disorder.
Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for VRl.
The invention also relates to methods for inhibiting VRl function in a cell, coiiipfising contacting a cell capable of expressing VRI with an effective amount of a Cyanoimiiiopipurazine Compound. This method can be used in vitw, for example, as an-assay to select c^^IIs that express VRl and, accordingly, are lisefiil as part of an assay to select coir.pC'imus useful for treating or preventing pain. LT, an ulcer, IBD, or IBS. The method is

also useful for inhibiting "VRl function in a cell in vivo, in an animal, a human in one embodiment, by contacting a cell, in an animal, with an effective amount of a Cyanoiminopiperazine Compound. In one embodiment, the method is useful for treating or preventing pain in an animal. In another embodiment, the method is useful for treating or i preventiirg Ul in an animal. In another embodiment, the method is useful for treating or preventing an ulcer in an animal, hi another embodiment, the method is useful for treating or preventing IBD in an animal. In another embodiment, the method is useful for treating or pre-v'enting IBS in an animal.
£xaraples of tissue comprising cells capable of expressing VRI include, but 1 are noc limited to, neuronal, brain, kidney, urothehura. and bladder tissue. Methods for assaying cells that express VRI are well known in the art.
Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for mGIuR5.
The invention also relates to methods for inhibiting mGliJl5 function in a cell, comprising contacting a cell capable of expressing mGluRS with an amount of a Cyanoirainopiper.isine Compound effective to inhibit mGluR5 function in the cell. This methori can be used in vitro, for example, as an assay to select cells thai express mGIuR5 and. accordingly, are useful as part of an assay to select compounds useful for treating or preventing pain, an addictive disorder, Parkinson's disease, paridnsonisni, anxiety, a pruritic ' condition, or psychosis. Tbe mefliod is also useful for inhibiting mGluRS nmction in a cell in vivo, in an animal, a human in one embodiment, by contacting a cell, in an animal, with an zmount of a Cyanoiminopiperazine Compound effective to inhibit mGIuR5 function in the cell. In one embodiment, the method is usefijl for treating or preventing pain in an animal in need thereof. In another embodiment, the method is usefiil for treating or preventing an addictive disorder in an animal in need thereof In another embodiment, the method is useful for treating or preventing Parkinson's disease in an animal in need thereof. In another embodiment, the method is useful for treating or preventing parkinsonism in an animal in need thereo-f. In another embodiment, the method is useful for treating or preventing anxiety in an animal in need thereof In another embodinaent, the method is useful for treating or preventing a pruntic condition in an animal in need thereof In another embodiment, the method is ust-fiil for treating or preventing psychosis in an animal in need ihereof

Examples of cells capable of expressing mGIuRi are neuronal and glial cells of the central nervous system, particularly the brain, especially in the nucleus accumbens. Methods for assaying cells that express mGluR5 are well known in the art.
Applicants believe that the Cyanoiminopiperazine Compounds are antagonists for mGluRl.
The invention also relates to methods for inhibiting mGluRl function in a cell, comprising contacting a cell capable of expressing mGluRl with an amount of a Cyanoiminopiperazine Compound effective to inhibit mGluRl function in the cell. This method can be used in vitro, for example, as an assay to select cells that express mGluRI an
disorder in an animal in need thereof. In another embodiment, the method is usefiil for treating or preventing a memory deficit in an animal in need thereof In another embodiment, the method is usefiil for treating or preventing restricted brain function in an animal in need thereof. In another embodiment, the method is use&l for treating or preventing Huntington's chorea in an animal in need thereof hi another embodiment, the method is useful for tieating or preventing ALS in an animal in need thereof In another embodiment, the method is useful for treating or preventing dementia in an animal in need thereof In another embodiment, the method is usefiil fortreating or preventing retinopathy in an animal in need thereof In another embodiment, the method is useful for treating or preventing a muscle spasm in sn animal in need thereof In another embodiment, the meihod is usefiil for treating or preventing a migraine in an animal in need thereof hi another embodiment, the method is useful for treating or preventing vomiting in an animal in need thereof. In another embodiment, the method is usefiil for treating or preventing dyskinesia in an animal in need thereof fii another embodiment, the method is useful for treating or preventing d^^ressiou in an animd in need thetsof.
Examples of cells enable of expiessiiig mGIuRl include, but are not limited to, cerebellar Pm'kinje neuron cells, Purkinje cell h(}dies (punctate), cells of spiue(s) of the cerebelluca; Ticurons and nearopMl cells of olfactory-bulb glomeruli; cells of the superficial: iaver of the cerebral cortex; hippocampus cells; thalamus cells; superior colliculus cells; and spinai trigeminal nucleus cells. Methods for assaying cells that express mGluRl are well Imowa in the art
4.19.1 THERAPEUTIC/PROPHYLACTIC ADMINISTR-ATION
A.\p COMPOSITIONS OF THE iNVENTroN
Due to fneir activity, the Cyanoimiuopiperazine Compounds are advantageously uEefiil in veterinar>' aaid human medicine. As described above, the Cyanoirrdnopiperazine Compounds are useful for treating or preventing pain, UI, an ulcer, IBD, lES, an addictive disorder, Parkin-^on's disease, parkinsonism, anxiety, epilepsy, stroke, a seiiure, a poii-Jtic condition, psychosis, :L cogniuve disorder, a memory deficit, restricted brain function. Huntin.gton's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, ■/oniiting, dyskinesia, or depression in an animal in need thereof

When administered to an animal, the Cyanoiminopiperazine Compounds are administered as a component of a composition that comprises a pharmaceutically acceptable carrier or escipient. The present compositions, which comprise a Cyanoiminopiperazine Compound, can be administered orally. The C>'anoiminopipera2ine Compounds of the invencion can also be administered by any other convenient route, for example^ by infusion or bolus injection, by absorption through epiiheiiai or mucocutaneous linings (e.g., oral, rectal, and intestinal mucosa, etc.) and can be administered together with another biologically active sgsnt. Adininistrationcanbe systemic or local. Various delivery systems are known, e.?., encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer tlie Cyanoiminopiperazine Compoimd.
Methods of administration include, but are not limited to, intradermal, inti'amuscuhir, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginai, transdermal, rectal, by inhalation, or topical, particularly io the eais, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the Telea>je of ±,e Cyanoimmopiperazine Com.pounds into the bloodstream.
In specific embodiments, it can be desirable to administer the Cy^anoiminopiper?i:ne Compounds locally. This can be achieved, for example, asw iwt by ivay cf limitation, by local infusion during surgery, topical ^plication, e.g., in conjunction .viih a wound dressing after surgery, by injection, by means of a catheter, by means of a * suppository or enema, or by means of an implant, said implant being of a porous, non-porous jr gelatinous material, including membranes, such as sialastic membranes, or fibers.
In certain anbodiments, it can be desirable to introduce the I^^tmoimij^cpiperazine Compounds into the central nervous system or gastrointestinaj tract b luy suitable route, including intraventricular, intrathecal, and epidural injection, and enema. niravGRtiicular injection can be facilitated by an intraventricular catheter, for example, Lttaehed to a reservoir, such as an Ommaya reservoir.
Pulmonary administration can also be employed, e.g., by use of an inhaler or itbulizer, and fomiulation with an aerosolizing agent, or via perfiision in a fluoiocarbon or yntheiic pulmonary surfactant. In certain embodiments, the Cyanoiminopiperazine

Compounds can be formulated as a suppository, with traditional binders and excipienls such as trigiycerides.
In anotber embodiment, the Cyanoiminopiperazine Compounds can be delivered in a vesicle, in particular a. liposome (see Langer, Science 249:1527-1533 (1990) and Treat st al.. Liposomes in the Tlierapy of Infections Disease and Cancer 317-327 and 353-365(1989)).
In yet another embodiment, the Cyanoiminopiperazine Compounds can be delivered in a controlled-release system or sustained-release system (see, e.g.. Goodson, in MedicnlApplicationsof Controlled Release, i-«pra, vol. 2, pp. 115-138(1984)). Other controlled- or sustained-release systems discussed in the review by Langer, Science 249:1527-1533 (1990) can be used. In one embodiment, a pump can be used (Langer, Science 249:1527-1533 (1990); Sefton, CRC Cril. Ref Biomed Eng. .14:201 (1987); Buchwald etal.. Surgery ^.501 (19S0); and Saudek et al, N. Engl. J. Med. 321:574 (1989)). 61 anoth':;r embodiment, polymeric materials can be used {see Medical Applications of ConiroUed Release (Langer ar,fl Wise eds., 1974); Controlled Drug Bioavailabilit); Dmg Product JJesign and Perfonnance (Smolen and Ball eds., 1984); Ranger and Peppas, ./-Mncromol. Sci. Re\'. Macromol. Chem. ^3:61 (1983); Uvy ei al.. Science 2.2S:l90 (I9S5): Diirin5era/.,.4ii!i. Neurol 25:351 (1989); and Howard eta/., 7. Neurostirg. 71:105 (t9S9i;. In yet ziiother embodiment, a controlled- or .sustained-release sj^em can be placed in proximity of 2 target of flieCj'anoimiDopiperazine Compounds, e.^., tbe spinal column, brain. 31 gastrointestinal tract, thus requiring only a fraction of the sj^temic dose.
The present compositions can optionally comprise a suitable amount of a iharmaceutically acceptable excipient so as to provide the form for proper administration to heaciimii.
Such phamiaceiitical excipient'? nan be liquids, such as water and oils, Dciading those of petroleum, aoimal, vegetable, oi- synthetic origin, such as peanut oil, ojteart oil mineral oil, sesame oil and the like.. The phamiaceutical excipienls can be atjne, giiTR acacia^ gelatin, starch paste, talc, keratin, colloidal silica, urea and the like. In ddition, aimliaiy-, stabilizing, thickening, lubricating, and coloring agents can be used. In mc emhcdinieni, the phaxmaceutically acceptable excipicnts are sterile ■v>.-hen administered to n animal. Water is a particularly useful excipient when the Cyanoiminopiperazine

Compound is administered intravenously. Saline solutions and aqueous dextrose and glycerol soiutions can also be employed as liquid excipients, particularly for injectable solutions. Suitable pliarmaceutical excipients also include starch, glucose, lactose, sucrose, gelatin, mall, rice, flour, chaik, silica gel, sodium stearaie, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The }>resent compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
The preseni compositions can take the fomi of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, suf-tained-release fonnulat?ons, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the composition is in the form of a capsule (see e.g.. U.S. Patent No. 5,698,155). Other examples of suitable piiamiaceutical excipients ais descnhed in Remington's Phannaceutical Sciences 1447-1676 (Alfonso R. Gennaro ed., l?thed. 1995). incorporated herein by reference.
In one embodiment, the Cyanoiminopiperazine Compounds are tbnnuiaced in accordance with routine procedures as a composition adapted for oral admiuistration to h'-im3ii. beings. Composidons tor oral delivery can be in the form of tablets, lozenges, aqueous or oily suspension"?, granules, powders, emulsions, capsules, syrups, or elixirs, fot example. Orally administered compositions can contain one or more asents^ for example, s'/veeiening agents such as ftuctose, aspartame or sacchaiin; ilavoring agents such as pcppennint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a phannaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract tliereby providing a sustained action over an extended period of time. Selectively permeable mambianes surroimding an osmotically active driving compound are also suitable for orally administered compositions, bi these latter plattbrms, fluid from the environment surroimding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. Tliese delivery platfomis can provide an essentially zero order deliveiY profile as opposed to the spiked profiles of immediate release formulations. A time-delay material such as glycerol monostearate or glycerol steaiate can also be used. Oral ccmpositions can include standard excipients such as mannitol, lactose, starch, magnesium

stearate, sodium saccharin, cellulose, and magnesium carbonate. In one embodiment, the excipients are of pharmaceutical grade.
In another embodiment, the C>"anoittiinopipera2ine Compounds can be formulated for intravenous administration. T>pically, compositions for intravenous adininistration comprise sterile isotonic aqueous buffer. Where necessary, the compositions can also include a solubilizing agent. Compositions for intravenous administration can optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry iyophiljzed powder or water free concentrate in a hermeticaliy sealed contaioer such as. an ampule ov sachette indicating the quantit>' of active agent. Where the Cyanoiminopiperazine Compounds are to be administered by infusion, they can be dispensed, for example, with an infusion bottle containing sterile phannaceutical grade water or saline. Where the Cyanoiminopiperazine Compounds are administered by injection, an ampule of sterile water for injei.;tior or saline can be provided so that the ingredients can be mixed prior to administration.
The Cyanoiminopiperazine Compounds can be administereti by controlled-release: oi sustained-release means or by delivery devices that are well Icnown to those of ordinary skill in the -an. Examples include, bm are not limited to, those described in U.S. : Patent Nos.; 3,845,770; 3,916,899; 3,536,809; 3,598,123; 4.008,719; 5,674,533; 5,059,595; 5,591,767; 5,120,548; 5,073,543; 5,639,476; 5354,556: and 5,733,566, each of which is incorporated herein by reference. Such dosage forms can be used to provide controlled- or sustained-release of one or more active ingredients using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coalings, microparticles, iiposoraes, microspheres, or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled- or sustained-release Ibrmulations known to those of ordinaiy skill in the art, including those describe-d herein, can be readily selected for use with the active ingredients of the invention. The invention thus SQcorapa-^ses single unit dosage forms suitable for oral administration such as, but not limited to, tablets, capsules, gelcaps, and caplets that are adapted for controlled- or sustained-release.
Controlled- or suslained-releass pharmaceutical compositions can have a ■:ommon goal of improving dmg ther?.\>y over ';hat achieved by '■heii non -controlled or non-

sustained counterparts. In one embodiment, a controlled- or sustained-release composition comprises a minimal amount of a Cyanoiminopiperazine Compound to cure or control the condition in a minimum amount of time. Ad\-antages of controlled- or susiained-relsase compositions include extended activity of the drug, reduced dosage frequency, and increased patient compliance. In addition, controlled- or sustained-release compositions can favorably affect the lime of onset of action or other chaiacleristics, such as blood levels of the Cyanoiminopiperazine Compound, and can thus reduce the occurrence of adverse side sffectE.
Conti'olled' or sustained-release compositions can initially release an amount >f a Cyanoiminopiperazine Compound thai promptly produces the desired therapeutic or prophylactic effect, and gradually and continually release other amounts of the !?yanoinimopiperazine Compound to maintain this level of therapeutic or prophylactic effecl )ver an extended period of time. To maintain a constant level of the Cyanoiminopiperazine 3r-rapound in the boiiy, the Cyanoiminopiperazine Compound can be released from the iosage form ai a rate tliat will replace the amoimt of Cyanoiminopiperazine Compound bein: netabolized and excreted from the body. Controlled- or sustairied-release or an active n.gredient can be stimulated by various conditions, including but not limited to, changes in iH, changes in temperature, concentration or availability of enzymes, concentration or vailabiiity of water, or other physiological conditions or compounds.
The amount of tlie Cyanoiminopiperazine Compotn?d that is eflective in the reatment or prevention of pain, UI, an ulcer, IBD, IBS, an addictive disorder, Parkinson's isease, paiidnsonism, snxietj', qjilepsy, stroke, a seizure, a pruritic conditioii, psychosis, a ognitive disorder, a memory deficit, restricted brain fimction, Himtington's chorea, ALS, ementia, reiinopalhy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression and an be determined by standard clinical techniques. In addition, in vitro or in vivo assays can ptionally bi smployed to help identify optimal dosage ranges. The precise dose to be mployed will also depend on the route of administration, and the seriousness of tlie sndiiion being treated and should be decided according to tlie judgment of the practitioner ■id each patient'.^ circumstances in view of, e.o.. published clinical studies. Suitable effectiv jGagu anoa:itt, however, range from about 10 micrograms to about 2500 milligrams about /er/ 4 b, uithouih they are topically about 100 mg or less. In one embodinif;nt, the effective

dosage amount ranges from about 0.01 milligrams to about 100 milligrams of a Cyanoiminopiperazine Compound about every- 4 h, in another embodiment, about 0.020 milligrams to about 50 milligrams about even' 4 h, and in another embodiment, about 0.025 milligrams to about 20 milligrams about ever>' 4 h. The effective dosage amounts described herein refer to total amounts administered; that is, if more than one Cyanoiminopiperazine Compound is administered, the effective dosage arnounts correspond to the total amount administered.
UTiere a ce'l capable of expressing VRl, rnGluR5, or mGJuRl ;s contacted with a Cyanoiminopiperazine Compound in vitro, 'Jie amount etfective for inhibiting the receptor ftinction in a cell will typically j-ange from about 0.01 jjg'L to about 5 nig/L, in one embodiment, &om about 0.01 fig/L to about 2.5 mg/L, in another embodiment, from about 0.0] \xg/L to about 0.5 mg/L, and in another embodiment, from about 0.01 pg/L to about 0.25 mg/L of a solution or suspension of a pharmaceutically acceptable carrier or excipient. In one embodiment the volume of .solution or suspension is from about 1 ^L to about 1 IFLL- In another embodiment, the volume of solution or suspension is about 200 nL.
VvTiere a celi capable cf expressing VRl, mGluR5, or mGluRl is contacted with a Cyanoiminopiperazine Compound in 'i'ivo, the amoimt effective foi inhibiting the receptor frinction in a cell will typically range from about 0.01 mg to about 100 mg/kg of body weight per day, in one embodiment, from about 0.1 mg to about 50 mg/kg body weight psr dsy, and in aaotber embodiment, from abdut 1 mg to about 20 rngp^kg of body R-ei^t per day.
The CyanoiminopiperdZine Compounds can be assayed in vitro or in vivo for the desired therapeutic or prophylactic activity prior to use in humans. Animal model si'Siems can be used to demonstrate safety and efficacy.
The present methods for treating or preventing pain, UI, an ulcer, IBD, IBS, an iddictii'e disorder. Parkinson's disease, parldnsonism, anxiety, ^ilepsy, stroke, a seizure, a :jruriiic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain fimction, ^'.mtingion's chorea, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, iyskinesia, or depression in an animal in need thereof can fiirther comprise administering to he animal being administered a Cyanoiminopiperazine Compound another therapeutic agent, n one embodiment, the other therapeutic agent is administered in an effective amount.
acetaminophen and phenacetin; indole and indene acetic acids, including indometfaacin, sulindac, and elodolac; heteroaryl acetic acids, including tolmetin, diclofenac, and ketorolac; anthiraiiilic acids (fenamates), including mefenamic acid and meclofenamic acid; enolic acids, including oxicams (piroxicam, tenoxicam), and pyrazolidinediones (phenylbutazone, oxyphenthartazone); and alkanones, including nabumetone. For a more detailed description of the NSAJDs, see Paul A. Insel, Analgesic-Antipyretic and A7iti'inflammatory Agents and Di-ugs Employed in the Treatment of Gout, in Goodman.& Gilman 's The Pharmacological Basis of Tlierapantics 617-57 (PerryB. Molinhoff and Raymond W.Ruddon eds., 9''ed 1996) and Glen R. ¥i.m&QT]., Analgesic, Antipyretic and Anti-Inflammato}y Drugs in Remington: TJie Science and Practice of Pharmacy Vol II1196-1221 (A.R. Gennaro ed. 19th :d. 1995) which are hereby incorporated by reference in their entireties.
Examples of useful Cox-H inhibitors and 5-hpoxygenase inhibitors, as well as combinations thereof, are described in U.S. Patent No. 6,136,839, which is hereby ncorporated by reference in its entirety. Examples of useful Cox-11 inhibitors include, but are lot limited to, rofecoxib and celecoxib.
Examples of usefijl antimigraine agents include, but are not limited to, lipiropride, dihydroeigotamine, dolasetron, ergocomine. ergocominine. ergocryptbie, ergot, Tgotamine, iluciedroxone acetate, fonazine, lisiiiije, lomerizine, methysergide oxetoroiic, )izotyline, and mixtures thereof
The other therapeutic agent can also be an agent use&l for reducing any lotential side effects of a Cyanoiminopiperazine Compounds. For example, the other herapeutic agent can be an antiemetic agent Examples of usefiil antiemetic agents include, lui are not limited to, metoclopromide, domperidone, prochlorperazine, promethazine, hlorpromazine, trimethobenzamide, ondansetron, granisetron, hydioxyzine, acetylleucine icnoetlianolamine, alizapride, azasetron, benzquinamide, bietanautine, bromopride, uclizine, clebopride, cyclizine, dimenhydrinate, diphenidol, dolasetron, meclizine, lethaljatal, metopimazine, nabilone, oxypemdyl, pipamazine, scopolamine, sulpiride, :U-a]iydrocamiabinoI, thiethylperazine, thioproperazine, uropisetron, and mixtures thereof.
Examples of useful i3-adrenergic blockers include, but are not limited to, ccbutolol, alprenolol, amosulabol, arotinolol, atenolol, beiunolol, beraxolol, bevantolol. iaoproiol. bopiiidr-Iol, bucunioloL bufetoloi, bufiiiaiol, bunitrolol, bupranolol, butidrine

hydrochloride, butofilolol, carazolol, carteolol, cai-veditol, celiprolol, cetamolol, cloranolol, dilevalol, epanolol, esmolol, indenolol, labetalol, levobunolol, mepindolol, metipraoolol, metoprolol, moprolol, nadolol, nadoxolo!, nebivaloj, nifeiiaioi. nipradilol, oxprenolol, penbutolol, pindolol, practolol pronefealol, propranolol, sotalol. sulfinalol, talinoiol, i tcrtatolol, tilisolcl, timolol, toliprolol, and xibenolol.
Examples of useful anticonvulsants include, but are not iimiied to, acetylpbenetunde, albutoin, aloxidone, aminogluiethimide, 4-amino-3-hydroxybutyric acid, atrolactamide, beclamide, buramate, calcium bromide, carbarnazepine, cinromide, clomethiazole, clonazepam, decimennide, diethadione, dimethadione, doxenitroin, eterobarb, ethadione. etlriosuximide, ethotoin, felbamate, fluoresone. gabapeniiti, 5-hydroxytryptophan, lamotrigine, magnesium bromide, magnesium sulfate, mephenytoin, mephobarbital, metharbital. methetoin. methsuxiinide, 5-methyl-5-(3-pheitanthryl)-hydantoin, 3-inethyl-5-phenylhydantoin, naicobaibital, nimetazepam, nitrazepam, oxcarbazepine, paramethadione, phenacemide, phenetharbital, pheneturide, phenobarbital, phensuximide. pbenylmethylbaibituric acid, phenytoin, phethenylate sodiiun, pofas-num bromide, prtgabaline, primidone, progabide, sodiran bromide, solanum, strontiom bromide, suciofenide, sulthimne, tetrantoin, tiagabine, topiramate, trimchadioue, valproic acid, valpromide, vigabatiin, and zonisamide.
Examples of useful antidepressants include, but are not limited to, binedaJine, caroxazone, citaloprara, dimethazan, fencainine, indalpine, indeloxazine hydrocholoride, nefopam, nomifensine, oxiiriptan, oxypertine, paroxetine, sertraline, fliiazesim, trazodone, betjmoxine, ipioclozide, ipxoniazid, isocaiboxazid, nialamide, octamoxin, phenelziiie, cotinine, rolicyprine, rolipram, maprotiline, metraliadole, mianserin, mirtazepine, adinazolaai, amitriptyline, amitriptylinoxide, amox^ine, butript>'Iine, clomipramine, demeyiptiline, desipranaine, dibeazepin, dimetaciine, dothiepin, doxepin, fluacizine, imipramine, imipramine N-oxide, iprindole, lofepramine, melitracea. metapramine, nortriptyline, noxiptilin, opipramol, pizotyiine, propizepine, protriptyline, quinupramine, lianepdne, trimipramine, adrafinil, benactyzine, bupropion, cutacetin, dioxadrol, duloxetine, etoperidone, febarbamate, femoxetine, fenpentadiol, fluuxetire, fluvoximiiue, heinatoporphyrin, hypericin, levophacetoperane, medifoxamins, niilnacipran, minaprine, racciobemidti, nefazodone, oxaflozaixe, piberaline, proUatane, pyrisuccideauoL. ritanserin.

The present methods for inhibiting VRI function in a cell capable of expressing VRl can further comprise contacting the cell with an effective amount of another therapeutic agent.
The present methods for inhibiting mGluil5 function in a cell capable of expressing mGiuR5 can further comprise contacting the cell with an effective amount of iii?,oi!ier therapeutic agent.
The present methods for inhibiting mGluRl function in a cell capable of expressing mOluRl can further comprise contacting the cell with an effective amount of another therapeutic agent.
The other Iherdpeutic agent includes, but is not iimiied to, an opioid agonist, a non-opioid analgesic, a non-steroid anti-inflanunatory agent, an antimigraine agent, a Cox-II inhibitor, an aniiemetic, a p-adrenergic blocker, an anticonvulsant, an antidepressant, a Ca2+-chaim6l blocker, an anticancer agent, an agent for treating or preventing UI, an agent tor treating or preventing an ulcer, sn agent for treating or preventing BD, an agent for ti'ealing or preventing IBS, an agent for h-ealing addictive disorder, an agent for treating PavkiiL^on's disease and parkinsonism, an ageut for hrcating anxiety, an agent for treating spt'.epsy, ao agent for treating a strokcj an agent for treating a seizure, an agent for treating a prj-rrtic condition, an agent for treating psychosis, an agent fcg- treating Huntington's cfiOieci, ai: ageur for treating ALS, an ageni for treating a cognitive disorder, an agent tor treating a tnigi'aiije, an agent for treating vomiting, an agent for treating dj^kinesia, or an agent for tieating depression, and mixtures thereof.
Effective amounts of the other thia^eutic ^ents are well known to those skilled in the art However, it is well within the skilled artisan's purview to determine the other iherapeutic agent's optimal effective-aniount range, hi one embodiment of the ■ invention, where another therapeutic agent is administered to an animal, the effective amount ■jf the Cyanoiniinopiperazine Compound is less than its effective amount would be where the Dther therapeutic agent is not administered. In this case, without being bound by theory, it is jslioved tl-.:-i.t tlie Cyanoiniinopiperazine Compomids and the other therapeutic agent act jvnergistically to treat or prevent pain, UI, an ulcer, IBD, IBS, an addictive disorder, ■"arkinson's disease, parkinsonism, anxiery, epilepsy, stroke, a seiztu-e, a pruntic condition, ;.=ychosii, a cognitive disorder, a memory deficit, rectricted brain function, Huntington's

chorea., ALS. dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression.
Examples of useflil opioid agonists include, but are not limited to, alfentanil, ailyiprodine, alphaprodine, anileridine, benz\'lmorpiiine, bezitraniide, buprenoiphine, biitorphanol, clonitazene, codeine, desomorphine, dextromoramide, dezocine, diampromide, diaraorphone, dihydrocodeine, dihydromorphine, dimenoxadol, dimepheptaiioi, dimethylthiambutene, dioxaphetyl butyrate, dipipanone, eptazocine, ethoheptazine, ethybnetliylthiambutene, ethylmorphine, etonitazene fentanyl, heroin, hydrocodone, bydromorphone, hydroxypethidine, isomethadone, ketobemidone, ievorphanol, ievophenacylmorphan, lofentanii, meperidine, meptazinol. metazocine, roethadone, metopon, morphine, myrophine, nalbuphine, narceine, nicomorphine, norlevorphanol, nonnethadone, ualorpliiiie, noimorphroie, norpipanone, opium, oxycodone, oxymorphone, papaveretum, pentazocine, phenadoxone, phenomocphan, phenazocine, phenoperidine, piminodine, piriiramide, proheptazine, promedoi, properidine, propiram, propoxypiieae, sufentanil, tilidine, UaiDadol, phannaceuticaLly acceptable salts thereof, and mixtures thereof
In ceitain embodiments, Ihe opioid agonist is selected from codeine, hydromorplioiie, nydrocodone, oxycodone, dihydiocodeine. (^lydToniurphmc. moipiiine, tramadol, oxjinorphone, pharmaceuticaliy acceptable salts thereot^ and inixtiiiei; thereof.
Examples ofusefulnou-opioid analgesics include non-steroidal. mti-inflamniatory agents, such as aspirin, ibuprofeh, diclofenac, naproxen, benoxaprofen, 3urbiprofen, fenoprofen, flubufen, ketoprofen, indoprofen, piroprofen, caiprofen, ox^rozin. jramoprofen, muroprofen, trioxaprofen, suprofen, aminoprofen, tiaprofenic acid, fluprofen, )ucloxic acid, icdomethacin, sulindac, tolmetin, zomepirac, tiopinac, zidometacin, icemstacii!. fsaliazac, clidanac, oxpinac, mefenamic acid, meclofenamic acid, flufenamic xid, niflumic acid, tolfenamic acid, diflurisal, flufemsai, piroxicam, sudoxicam, isoxicam, aid pharmaceutically acceptable salts thereof, and mixtures thereof- Other suitable :cr-opioid .-malgesics inchidc the following, non-limiting, chemical classes of analgesic, intip>TCtic, nonsteroidal anti-inflammatory drags: salicylic acid derivatives, including ispirLiL, liodiom salicylate, choline magnesium trisalicylate, salsalate. diflunisal, ■alicylsalicylic acid, sulfasalazine, and olsalazin; para-aminophennol derivatives including

roxindole, rubidium chloride, sulpiride, tandospirone, thozalinone, tofenacin, toloxatone, traQylcypromine, L-tryptophan, venlafaxine, %-iloxazine, and zimeldiiie.
Examples of useful Ca2+-chaimel blockers include, but are not limited to, bepridil, clentiazem, diltiazera, fendiline. gaUopamil, mibe&adil, prenylainine, semotiadil, terodiline, verapamil, amiodipine, aranidipine. baniidipine, benidipine, cilnidipine. efoDidipiiie, elgodipine, felodipine. isradipine, lacidipine, lercanidipine. tnanidipiiie, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipLne, nitrendipine, cinnarizine, flimarizine, iidoflazine, lomerizine, bencyclane, etafenone, fantofarone, and peibexiline..
Examples of useful anticancer agents include, but are not limited to, acivicin. icUirubicin, acoda^ole hydrochloride, acronine, adozelesin, aldusle'jkin, altretamine, . ■ ambomycin, ametantrone acetate, aminoglutethirmde^ amsacrine, anastrozole, anthramycin, asparaginase, asperlin, azaciiidine, azetepa, azocomycin, batiinastat. benzodepa, bicaiutamjde, bisantrene hydrochloride, bisnafide dimesylate, lazelesin, bleomycin sulfate, brequinar sodium, bropiriraincbusulfan, cacunomycin, calusterone, caracemide, carbeliraer. caiboplatin, carmustine, canibicin hydrochloride, carzelesin, cedeiiDgol, chlorambucil,, circieniycin, cisplatin, cladribine, crisnato! mesylate, cyclophosphamide, c;;,'tarabine, dacaib;izinc, dactinomycin, daunorubicin hydrochloride, decitabme, dcxormaplaiin, dezaguanine. dezaguanine mesylate, diaziquone, docetaxel, doxonibicL-i, doxorubicin hydrochloride, droloxifene, droloxifene citrate, dromostanolone propionate, duazomycin, edatrexate, efloinithine hydrochloride, elsamitrucin, enloplatin, eapromate, epipropidine, epimbicin hydrochloride, erbulozole, esorubicin hydrochloride, estramustine, estramustine phospliate sodium, etanidazole, etoposide, etoposide phosphate, etoprine, fadrozole hydrochloride^ fazarabine, fenretinide, floxuridine, fludarabine phosphate, fluorouracil, flmocitabine, fosqiridone, fosiriecin sodium, gemcitabine, gemcitabine hydrochloride, faydroxyurea, idarabicin hydrochloride, ifosfamide, ilmofostne, interleukin IE (including recombinant interleukin IT or rIL2), interferon aifa-2a, interferon alfa-2b, uiterferon alfa-nl interferon alfa-n3, interferon beta-1 a, interferon gamma-I b, iproplatin, hinotecan hydrochloride, lanreotide acetate, letrozole, leuprolide acetate, liarozole hydrochloride, !i;'inetrexoi sodium, loinusliue, losoxantrone hydrochloride, raasoprocol. maytansine, rnechicrtthamine hydrochloride, megestrol acetate, raelengestrol acetate, melphatan. menogaril, mercaptopurine, methotrexate, methotrexate sodium, metopiine, mtituredepa.

mitindomide, mitocarcin, mitocromin. milogiUin, mitomalcin, mitomycin, mitosper, mitotane, mitoxaotrone hydrochloride, mycophenolic acid, nocodazole, nogalaraycin, ormaplatiji, oxisuran, paclilaxel, pegaspargase, peliomycin, pentamustine, peplomycin sulfate, perfosfamide, pipobroman, piposulfan. piroxantrone hydrochloride, plicamycin, piomestane, porfimer sodium, porfiromycin, prednimustine. procarbazine hydrochloride, 3uromycin, puromycin hydrochloride, pyrazoiurin, riboprine, rogietimide, safingol, safingol iiydrochloride, semustine, simtrazene, sparfosate sodium, sparsomycin, spirogermanium lydrochloride, spiromustine, spiroplatin, streptonigrin. streptozocin, sulofenur, talisomycin, :ecogalan sodium, tegafiir, teloxantrone hydrochloride, temoporfin. teniposide, teroxirone, estolacione, thiamiprine, thioguanine, thiotepa, tiazofimn, tirapazamine, toremifeiie citrate, restolone acetate, triciribine phosphate, trimetrexate, trimetrexate glucuronate, triptorelin, ubulozole hydrochloride, uracil mustard, uredepa, vapreotide, verteporfin, vinblastine . iulfate, vincristine sulfate, vindesine, vindesine sulfate, vinepidine sulfate, vinglycinate iulfate, vinieurosina sulfate, vinocclbine tartrate, vinrosidine sulfate, viozolidine fnilfate, . 'orozole, zeniplatin, zinostatin, zorubicin hydrochloride.
Examples of other anti-cancer drugs include, but are not limited to, ;0-epi-],25 dihydrox>vifainin D3; 5-ethynyluracil; abiraterone; aolarubicin; acylfulvene; decypenol; adozelesin; aldesleukin; AIX-TK antagonists; altretamine; aisbajuudtine; midox; amifostine; aminolevulinic acid; anuubicin; amsacrine; anagrelide; anastrozols: ndrographoiide; angiogenesis inhibifcrs; antagonist D; antagonist G; antarelix; nti-dorsaljzing morpfaogenedc protein-1; antiandrogen, prostatic carcinoma; antjestrogen; ntineoplaston; antisense. oligonucleotides; aphidicolin glycioate; ^optosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; alaroestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin IE derivatives; balanol; batimastat; BCR/ABL antagonists; benzochloi'ins; benzoylstaurosporine; beta lactam derivatives; beta-aletbine; betaclamycin B: betuHnic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide: bistratene A; bi^elesin; breflate; bropiiimine; budotitane; buthionine suifoximine; calcipolricl; calphostin C; camptothecin derivatives; canarypox IL-2: capecitabine; ca-iboxamide-amino-triazole; carboxyamidotriazole; CaRestVB; CAiC
cetroreiix; chlorkis; chloroquinoxaUne sulfonamide; cicaprost; cis-porphyrin; cladribine; clomifene analogues; clotrimazole; collismycm A; colhsmycm B; combretastatm A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol, cryptophycin 8; cryptophycin A derivatives; curacin A; cyclop entanthraquiiiones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cyiostatin; dacliximab; decitabine; dehydrodideranin I desiorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethyhiorspermine; dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamyci diphenyl spiromustiiie; docetaxel; docosanol; dolasetron; doxitluridine; droloxifene; dronabinol; duocarmycin SA; ebseien; ecomustiiie; edelfosine; edrecolomab; efiomithine; elemene; emitefUr; epirubicin; epristeride; estraniu.'Jtine analogue; estrogen agonists; estroge: antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabioe; fenretinid' filgrastim; finasteride; ilavopiridol; flezelastine; fliiasterone; fiudarabine; fluorodaunorunicii hydrochloride; forfenimex; formestane; fostriecin;-fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; getatinase inhibitors; gemcitabtne; glutathione inhibitors; hepsulfam; heregulin; hexamethylenc bisacetamide; bypericin; ibandronic acid;' idarubicin; idoxifeiie; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquiincd; immunostimulant peptides; insulin-like growth factor-1 recepttsr irihibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, ^; iroplaci; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; Iqitolstatin; letrozole; leukemia inhibiting factor, leukocyte alpha interferon; leuproUderestrogen+progesterone; leuprorelin; ievamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; Upophilic platintnn compounds; lissoclinamide 7; lobaplaiin, lombricine; lometrexol; lonidaniine; losoxantrone; lovastatin; loxoribine; hutoi;ecan; lutelium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A: maiimastat: masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; raerbarone; metM"elin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltsfosine: roirimostim; mismatched double stranded RNA; mitoguazone; mitoiadol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; naitoxantrone: mofarotene; raolgramostira; monoclonal antibody, human chorionic gonadolTophin; monophosphoryl lipid A+myobacterium c^Al v^'all sk; mopidamol; m\iltiple

drug resistance gene inhibitor; multiple tumor suppressor 1-based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acet;/ldinaline; N-substiruted benzamides; nafarelin; nagrestip: naloxone+pentazocine; napavin; naphteipin; nartograstim; nedaplatin; nemorubicin; neridroruc acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitmllyn: 06-benz\-lguamne; octreotide; okicenone; oligonucleotides; onapristone; ondansen-on; ondansetron; oracin; oral cytokine inducer; onnaplatin; osaterone; oxaliplatin; oxaunomycin;pacIitaxel; paclitaxel analogues; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidroiiic acid; panaxytriol; panomifene; parabactin; pazeiiiptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubrnn; perfostamide; perillyl aicobol; pheoazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placeiiu A; piacetin B; plasminogen acrivator inhibitor, platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; prbteasom.^ inhibitoi's; protein A-cased immune moduiator: protein kinase C inhibitor; protein kinase C inhibitois, microalgal; -proieLn tyrosine phosphatase inhibitors; purine nucleoside phosphoiylase inhibitors; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf mtagonists; raltitrexed; ramosetron; ras fame-ryl protein transferase inhibitors; ras irii'.bitors: ras-GAP inhibitor; iBtelUptine demethylated; Thenixim Re 186 etidronaie; rhizosin; ibozyines; RH retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubigjnone Bl: ■uboxyl: safingol; saintopin; SatQNfU; sarcophytolA; sargramostim; Sdi 1 mimetics; lemustine; senescence derived inhibitor 1: sense oligonucleotides; signal transduction nhibitors; signal transduction modulators; single chain antigoi binding protein; stzofiran; obuOTxajie; sodium boroc^tate; sodium phenylacetate; solverol; somatomedin binding notein; sonennin; sparfosic acid; spicamycin D; spiromustiae; spienopentin; spongistatin 1; qualamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin ihibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; iiramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; iuromustb£; tazarotene; tecogalan sodium; tegatiir; reliurapyrylium; telomerase inhibitors; unoportin; temozoloniide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblasiine; lic-corali^e; ibrombopoietin; thtombopoietin mimetic; th^Tnalfasin; thymopoietin receptor

agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazaniine; titariOcene bichloride; topsemin; toremifene; totipotent stem ceil factor; translation inhibitoi tretinoin; triacetyluiidine: triciribine; trimetrexate; tiiptoreiin; tropisetrcn; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived > gi'ov/th inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocjae gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaitine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer. ,
Examples of usefiirtherapeutic agents for treating or preventing UI include,
b^it art not limited to, propantheline, imipramine. hyoscyamine, oxybutynin, and dicyclomm
I Examples of useful therapeutic agents for treating or preventing an ulcer
include, antacids such as aluminum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicaitionate; sucraflate; bismuth compounds such as bismuth subsalicylate and bismuth subcitrate; Hj antagonists such as cimetidine, ranitidine, famotidine, and nizatidine; IT", S.' - ATPase inhibitors such as omeprazole, iansoprazoie, and lansoprazole'. cnrbeocixolone; misprosiol; and antibiotics such as tetracycline, metionidazole. timidazole, claiitiiroir.i'cin, and amoxicillin.
Examples of useiul therapeutic agents for treating or preventing IBD JBclude, but are not limited to, anticholinergic drugs; diphenoxylate; loperamide; deodorized opium tincl-iire: codeine; broad-spectnim antibiotics snch as metronidazole; sulfasalazine; olsalazie; mesalamine; prednisone; azathioprine; mercaptcpurine; and methotrexate.
Examples of usefUl therapeutic agents for treating or preventing IBS include, but are not limited to, propantheline; muscarine receptor antogonists such as pirenzapine, methoctramine, ipratropium, tiotropium, scopolamine, methscopolamine, homatropine, homatropBif. methyibroroide, and tnethzntheline; and aatidiarrbeal drugs such as diphcuoxyiate and loperamide.
Examples of usefbl therapeutic agents for treating or preventing an addictive disorder include, but are not limited to, methadone, desipramine, amantadine, fluoxetine, buprenorpjiic'e, an opiate agonist, "'-phenoxypvndine, bvomethadyl acetate hydrochloride, and serotonin antagonists.
Examples of useful therapeutic agents for treating or preventing Parkinson's disease and parkinsonism include, but are not limited to, carbidopa/lev'odopa, pergolide.

bromocriptine, ropinirole, pramipexole, entac^one, tolcapone, selegiline, amantadine, and trihexyphenidyl hydrochloride.
Examples of useful therapeutic agents for treating or preventing anxiety-include, but are not limited to, benzodiazepines, such as alprazolam, brotizolam, chiordiazepoxide, clobazam, clonazepam, clorazepate, demoxepam, diazepam, esiazoiam, flumazenil, flurazepani, halazepam. lorazepam; midazolam, nitrazepam, nordazepam, oxazepam, prazepam, quazepam, temazepam, and triazolam; non-benzodiazepine agents,. such as buspirone, gepirone, ipsaprione, tiospirone, zolpicone, Zolpidem, and zaleplon; tranquihzers, such as barbituates, e.g.^ amobarbital, aprobarbital, butabarbital, butalbital, mephobaibhal, niethobexital, pentobarbital, phenobarbital, secobarbital, and thiopental; and propanediol carbamates, such as meprobamate and tybamate.-
Examples of useful therapeutic agents for treating or preventing epilepsy
include, but are not limited to, caibamazepine, ethosuximide, gabapentin, lamotrignine,
pheiiobarbital, phenj^oin, primidone, valproic acid- trimethadione, bemzodiaepines.
gabapentin, laraotrigine, y-vinyl GAB.\, acetazolamide. and felbamate. ' '-
Examples of useful therapeutic agents for treating or preventing stroke include,bui are not limited to, anticoagulants such as heiJarin, agents that breakup clots such as streptokinase or tissue plasminogen activator, agents that reduce swelling such as maniutcl or corticosteroids, and acetylsalicylic acid.
Examples of usefiil therapeutic agents for treating or preventing a seizure include, but are not limitedto, carbamazepine, ethosuximide, gab^entin, lamotrignine, 3henobarbital, phenytoiit, primidoae, valproic acid, trimethadione, betnzodiaepin«i, gabapentin, laraotiigine, 7-vuiyl GABA, acetazolamide, and felbamate.
Examples of usefiil therapeutic agents for treating or preventing a pruritic ;oQdilion inchide, but aie not limited to, naltrexone; nalmefene; danazol; tricyclics such as unittiptyline, imipramine, and doxepin; antidepressants such as those given below, menthol; :amphor; phenol; pramoxine; capsaicin; tar, steroids; and antihistamines.
Examples of useful therapeutic- agents for treating or preventing psychosis delude, bui are not limited to, phenothiazines such as chlorpromazine hydrochloride, tiesoridazine besylate. and thoridazine hydrochloride; thioxanthenes auch as hloToprothixenft and thiothixene hydrochloride; clozapine; risperidone; olaiizapuT,^:;

quetiapine; quetiapine fumarate; haloperidol; haloperidol decanoate; loxapine succinate; molindone hydrochloride; pimozide; and ziprasJdone.
Examples of usefiil therapeutic agents tor treating or preventing Huntington" :horea include, but are not limited to, haloperidol and pimozide.
Examples of usefUl therapeutic agents for treating or preventing ALS include )ut are not limited to, baclofen, nsurotrophic factors, rilii;:ole, tizanidine, benzodiazepines ■uch as cionazepan and dantrolene.
Examples of usefizl therapeutic agents for treating or preventing cognitive isoiders include, but are not limited to, agents for treating or preventing dementia such as icnne; dciepezil; ibuprofen; antipsychotic drugs such as thioridazine and halop^nidol; and niidepressant drugs such as those given below.
Examples of usefiil therapeutic agents for treating or preventing a migraine iclude, but are not limited to, sumatriptan; methysergide; ergotamine; caffeine; and beta-ockers 5uch as propranolol, verapamil, and divalproex.
Examples of useful therapeutic agents for treating or preventing vomiting elude, but are not limited to, 5-HTj receptor antagonists such as oudansetronj dolasetron, anisetron, and tropisetron; dopamine receptor antagonists such as prochlorperazine, iethylperazine. chlorpromazin, ffletoclopraniide, and doniperidone; glucocorticoids 3iich as xamethasone; and benzodiazepines such as lorazepam and alprazolam.
Examples of usefol vhen^ieuiic agents for treating or pieveoting dyskinesia :iude, but are not limited to, reseipine and tetrabenazine.
Examples of usefiil therapeutic agents for treating or preventing depression lude, but are act limited to, tricyclic antidepressants such as amitryplyliae, amoxapine. sropion, ciom^praniine, desipramine, doxepin, imipramine, m^rotilinr, nefazadone, triptjline, protriptyline.. trazodone, trimipramine, and venlaflaxine; selective serotonin ptake inhibitors such as fluoxetine, fiuvoxamine, paroxetine, and setraline; monoamine dase inhibitors such as isocarboxazid, pargyline, phenelzine, and tranylcypromine; and chostirculants such as dexti'oamphetamine and inethylphenidate.
A Cyanoiminopiperazine Compound and the other ther^euric agent can act i'iivcly \jr, in One embodiment, synergistically. In one ernbodinieiit, a uoirainopiperazine Compound is administered concurrently with another therapeutic

agent. In one embodiment, a composition comprising an effective amount of a Cyanoiminopiperazine Compound and an effective amount of another therapeutic agent can be administered. .Mtematively, a composition comprising an effective amount of a Cyanoiminopiperazine Compound and a different composition comprising an effective '; amount of another therapeutic agent can be conciurently administered. In another embodiment, an effective amount of a Cyanoiminopiperazine Compound is administered prior or subsequent to administration of an effective amount of another therapeutic agent. Ii thir. embodiment, the C>'anoiminopiperazine Compound is admimslered while the other therapeutic agent exerts its therapeutic effect, or the other therapeutic agent is administered vvMle the Cyanoiminopiperazine Compound exerts its preventative or th^apeutic etTeci for treating or preventing a Condition.
" A composition of Ihe invention is prepared by a method con:prismg admixing a Cyanoiminopiperazine Compound or a pharmaceuticaily acceptable salt and a pharmacetitlcally acceptable carrier or excipieut. Admixing can be accomplished ixsioe iitethods well known for admixing a compound (or salt) and a phaiinaceutically acceptable cai-rier or excipient. In one embodiment the Cyanoiminopiperazine Compound or the phAroiacc'itically dcceptable ?alt ci the Compound is present in the composition in an etfective amoimt.
4.19.2 Kitq
The invention encompasses kits that can simplify flie admimstiation of a Cyanoimhjopiperazine Compound to an animal.
A typical kit of the invention comprises a unit dosage form of a C>'anr'imLi.opiperazine Compound. In one embodinient, the unit dosage form is a container, which can t-s sterile, containing an effective amount of a Cyanoiminopiperazine Compound acd a piirtrma^eutically acceptable carrier or excipient 'ITie kit can further comprise a label a printed instructions instracting the use of the Cyanouninopiperazine Compound to treat pain, Ul, an ulcer, IBD. IBS, an addictive disorder, Parkinson's disease, parfdnsonism, anxiety, epilepsy, stroke, a seizure, a pruritic condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's chorea, ALS, demenrla, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depieisioo. Tnekit c&iialso fiirther comprise a

unit dosage form of another therapeutic agent, for example, a container containing an effective amount of the other ther^eutic agent, hi one embodimeat, the kit comprises a container containing an effective amount of a Cyanoiminopiperazine Compound and an effective amount of another therapeutic ageni. Examples of other therapeutic agents include, but are not limited to, those listed above.
Kits of the mvemion can further comprise a device that is useful for admiiastering the unit dosage forms. Examples of such a device includes, but are not limited to, a syringe, a drip bag, a patch, an inhaler, and an enema bag.
The following examples are set forth to assist in understanding the invention avi 5. EXAiWl'LES Examples 1 -i relate lo the synihesi? of illustrative Cyanoim.-nopiperazii Compounds.
5.1. Example 1: Synthesis of Componnd AAA

CI
H
CI

^ Tnethylamine,
"■^^ DMSO
SOV

CI

n
--^-^N
^N.

^N
NH^

+

P

N

H I
DCM
room !emp. a NH

A~~^ or toluene at 1 OO^C

O
cr

jp n
"rr
H

—CN
■NH {CH;0CH2CH2)20
75"C

1
ci-
.N..

Compouud AAA

2,3-Dichloropyridine (15.0 g, 101.6 mmol), piperazine(9.7S g, 113.70minoll and triethylamine (14.36 g, 141.95 nrniol) were dissolved in 300 mL of DMSO and the resulting mixture was heated at about 80°C for about 24- h. The reaction mixtuie war. then cooled to room temperature and extracted with a saturated aqueous sodium bicarbonate solution. The organic layer was dried, concentrated, and purified using a silica gel column eiuted with a gradient eJution from ethyl acetate to 2:1 ethyl acetate:inethano] to provide N-(3-chloropyridiii-2-yl)-pipera2ine (compound 1) as a yellow liquid.
A solution diphenylcyanocarbodunidate (Commercially available from Sigma Aldrich, St. 1-ouis, MO (www.sigma-aldrich.com)) (0.5 mmol) and 4-/err-butylani]ine (0.5 mmol) in 1.5 mL of DCM was stirred at room tejuperature tor aboui 12 h. The mixnire was concentrated under reduced pressure to provide compound 2, which was used directly in the nexi step v/ithout further purification.
A solution of compound 2, prepared as described above, and compound 1 (0.5 nmiol), prepared as described above, in ] .5 mL of .Z-methoxymethylethei" was stirred at about 75'C foraboul 12 h. The solution was cooled to room temperature and purified using d-Trect Gash chromatography on a silica gel column eiuted with a gradient elution from 1:10 ethyl acf;t:te:I>exai:eio 1:1 ethyl acemteihexane to provide Comp The identity of compound AAA was confirmed using 'H NMR.
Compound A.\A: 'HNMR (CDCIj) 5 9.19(dd, J = 13,4.7 Hz, IH), 6.62 (dd, J =--1,5, 7.S K2, IH), 7.3S (d, 3 = 8.5 Hz, 2H), 7.18 (b, IH), 7.01 (d, J = S3 Hz,. 2H), 6.91 (dd, J = 4.7, 7.8 Hz, IH), 3.58 (m, 4H), 3.34 (m, 4H), 1.33 (s, 9H) ppm.
5 J.. Example 2: Synthesis of Compound AAl
Compound AAI was prepared by a procedure analogous to that t-sed to irepare Compound AAA except that 4-trifluoTomethoxyamline was used in plaire oi'4-tert' jutylaniline feield 78%).
The identit}' of compound AAI was confirmed using 'H NMR.
CompoundAAI: 'HNMRfCDC!j)6 8.19(dd, J = 1.6,4.7llz, lH),7.62(dd, '■ - 1.6, 7.S Hz, IH), 7.26 (b, IH), 7.24 (d, J - 9.0Hz, 2H), 7.12 (d. J - S.O fiz, 2H), 6.92 (dd, = 4.7 Hz, iH), 3.59 (m, 4H), 3.35 (m, 4H) ppm.

5 )
To a solution of 2-(l-cyclohexenyl>ethybiiiine 3 {125.2 rag, 1-0 mmol) in 2-ciethoxyethyi etlier (3.0 luL) wa;3 added diphenykyanocarbodiniidate (commercially available from Sigma-Aldrich, St. Louis, MO (www.sigma-aldricii.com)) (238.2 mg, 1.0 mmol) at rcorc Itvinpeniture. The resultant reaction mixture was heated to about 80° C and allowed lo stir at 80" C for about 5 h. (R)-l-(3-chloro-pyridin-2-yI)-3-methylpiperazine4 (211.6mg, 1.0 mmol) was added to the reaction mixture and the reaction mixture was heated to about 140" C Mid allowsd to stir at about HO" C for about 12 h. The reaction mixture was dien cooled to room temperature and purified using flash chromatography on a silica gel column eluted with ^thvi acetate/hexane (10:90 to 50:50) to provide compound DEY as a slightly yellow product.
Cori]pouud 4 was prepared by a procedure analogous to that used to prepare Compound 1, as described above in Example 1, except that (R)-3-methylpiperazine (coronieTcially available from Sigma-Aldrich, Si. Louis. MO (www.sigma-aldrich.com)) was used in place ofpiperazins.
The ideniity of compound DEY was confirmed using 'H NMli and mass specu'O'icopy (MS).

Compound DEY; 'H NMR (CDCy 5 8.20 (dd, .T = 1.8, 4.9 Hz, IH), 7.63 (dd, J=1.8,7.8Hz, IH), 6.91 (dd, J=4.9, 7.8H2, 1H),5.61 (br,s, lH),4.S0(m, lH),432(m, IH). 3.S0 (m, 3H), 3.63 (m, 2H), 3,42 (m, IHl, 3.10 fm, IH), 3.00 (m, IH), 2.31 (m, IH), 2.05 (m, 2H), 1.96 (m, 2H), 1.64 (m,5H), 1.43 (m, 3H)ppm.
MS:m/e3S7.6
5.5. Example 5: Binding of Cvanoiminopiperazine Compounds to mGluRS
The following assay can be used to demonstrates Cyanoiminopipereazine
Corapoimds that bind to and modulate the activity of mG)uR5.
Cell cultures: Primary glial cultures are prepared from conices of Sprague-Dawiey IS days old,embryos. The cortices are dissected and then dissociated by trituration. The resulting ceil horaogenate is plated onto poly-D-lysine precoated T175 flasks (BIOCOAT. commercially available Jrom Becton Dickinson and Company Inc. of Franklin Lalces, NJ ) in Dulbelcco's Modified Eagle's Medium ("DMEM," pH 7.4), buffered with 25 mM HEPES> and siippiernenied witli 15% fetal calf sennn ('TCS." comiriercially available from Hyclone I-abcralories Inc. -jf Omaha, NE ), and incubated at 37°C and 5% CO,. .fVfter 24 hours. FCS sitppleojentarion is reduced to 10%. On day six, oligodendrocytes SJKI microgUa are removed by strongly tapping the sides of the Casks. One day following this purification step, secoadary astrocyte cultures are established by subplatii^ onto 96 poly-D-l^^ine precoated T175 fiasks (BIOCOAT) at a density of 65,000 cells/well inDMEM and 10% FCS- A/ter 24 hours, the astrocytes are washed with serum free medium and ttien cultured inDMEM, without glutamate,supplernented with 0.5% FCS/20mMHEPESJ.0ng/mL epidermal . -giowth factor ("EOF'), 1 roJv'I sodium pyruvate, and IX penicillin/streptomycin at pH 7.5 for 3 to 5 days at 37°C and 5% COj The procedure allows the expression of the mGiuB.5 receptor by astrocytes, as demonstrated by S. Miller el ai, J. Neurosdence IK9):6i03-6109 (1995).
Assay Protocol: Aiter 3-5 days incubation 'Mth EGF, the astrocytes are washed with 127 niM NaCi, 5 mM KCL 2 mM MgCK. 700 mM NaH,P04.2 mM CaCl^, 5 m>4 NaHCO^, . a mlvl HEPES, ] 0 mM Glucose at pH 7.4 ("Assay Buffer") and loaded with the dyfi Fluo-4 (connr.erc-ialii' available from Molecular Probes Inc. of Eugene, OR) using 0.1 nil. of Assay Buffer containing Fluo-4 (3 mM fmal). After 90 minutes of dye loading, the cells are then washed twicswith 0.2 mL Assay Buffer and resuspended in 0.1 nd. of iVssay Buffer. The

plates containing the astrocytes aie then transferred to a Fluorometric Imaging Plate reader (commercially available from Molecular Dewes Coiporation of Sunnyvale, CA) for the assessment of calcium mobilization flux in the presence of glutamate and in the presence or absence of antagonist. After monitoring fluorescence for 15 seconds to establish a base line, DMSO solutions containing various concentrations of a Cyanoiminopipereazine Compound diluted in Assay Buffer (0.05 mL of 4X dilutions for competition curves) ai-e added to the cell plate and fluorescence is monitored for 2 minutes. 0.05 mL of a 4X glutamate solution (agonist) is then added to each well to provide a final glutamate concentration in each well of 10 mM. Plate fluorescence is then monitored for an additional 60 seconds after agonist iddition- The final DMSO concentraTJon in the assay is 1.0%. In each experiment, [luorescence is monitored as a function of time and the datar-anal>'2ed using Microsoft Excel md GraphPad Prism. Dose-response curves are fit using a non-linear regressiou to determine C50 value. In each experiment, each data point is determined two times. The assay results vili demoELStrate thai Cyanoiminopipereazine Compounds bind to a'jd modulate the activity if:nG]iiR5.
5.6 EXAMPLE 6: BiNurNG OF CVANoiMiNOPiPERAzrNE COMPOUNDS TO MGLURS
.Mtematively, flie follouing assay can bs used to demonstrate that a Nanoiiainopiperiziiie Compound binds to and modulates the activity of mOluRS.
40,000 CHO-r^ mGiuR5 cells/well are plated into 96 well plate (Costar 3409, Black, lear bottom, 96 well, tissue culture treated) for an overnight incubation in Dulbecco's lodified Eagle's Medium (DMEM, pH 7.4) and supplemented with glutamine, 10% FBS, % Fen/'Slrep, and 5()Cmg/mL Geneticin. CHO-rat mGIuRS cells are washed and treated wth iptimem mediim: and were incubated for 1-4 hours prior to loading cells- Cell plaies are ashed with loading buffer (127 jnM NaCl, 5 mM KCl, 2 mM MgClj, 700 iM Na H,PO^, 2 M CaCl:, 5 mM NaHCOj, 8 mM Hepes, and 10 mM glucose, pH 7.4) and incubated with JM Pluo 4 (coininercially available from Molecular probes Inc. of Eugene, 0R> in 0.1 mL ■ loading bu£fei. After 90 minutes of dy*; loading, the cells are washed iwice wi\h 0.2 mL adiug buffer and resospended in, 0,1 niL loading buffer.

The plates containing the CHO-rat mGluR5 cells are transferred to a Fluorometric hnaging Plate Reader (FLIPR) (commercially available from Molecular Devices Corporation of Sunnyvale, CA) for the assessment of calcium mobilization flux in the presence of giulamate and in the presence or absence of test compounds. After monitoring fluorescence for 15 seconds to establish a baseline, DMSO solutions containing various concentrations of the test compound diluted in loading buffer (0.05 mL of 4X dilutions for the competition curves) are added to the cell plate and fluorescence was monitored for 2 minutes. 0.05 mL of 'VX glui:am3te solution (agonist) i& then added to each well lo provide a final glutamate concentration in each well of 10 uiM. Plate fluorescence is then monitored for an additional 60 seconds after agonist addition. The final DMSO concentration in the assay is 1.0%. In e3£h experiment, fluorescence is monitored as a fimction of time and the data analyzed using Microsoft Excel and GraphPad Prism. Dose-response curves are fit using a non-linear regression to determine the IC50 value. In each experiment, ea.ch data point is determined at least Uvo times.
5.7. Example 7: In i^'ivo Assays for PrevcBiion or Treacment of Pain
Test Animals: Each experiment uses rats weighing between 200-260 g at the start of thy experiment. The rats are group-housed and have free access to food and water at all ^mes, except prior to oral administration of a Cyanoiminopiperazine Conipoiicd when food is removed ibr 16 hoiirs before dosing. A control group acts as a comparison to rats treated with a CyanoiminopipCTazine Compouiid. The control group is administis-ed the earner for he Cyanoiminqpiperazine Corapoimd. The volume of carrier administered to the control ^up is the same as ttie volume of carrier and Cyanoiminopiperdzine Compound uindnistered to'the test gyoap.
Acute Pain: To assess the actions of the Cyanoiminopiperazine Compounds for the reatment or prevention of acute pain the rat tail flick test can be used. Kats are gently estrained by hand and the tail exposed to a focused beam of r^iant heat at a point 5 cm from he tip using a tail flick unit ^lodel 7360, commercially available from Ugo Basile of Italy). Tsij flick latencies are defined as the inters'al between the onset of the thermal stimulus and he flick of the tail. Animals not responding within 20 seconds are removed from tiie tail lick unit and assigned a withdrawal latency of 20 seconds. Tail flick latencies ai-e measured

immediately before (pre-treatment) and 1,3, and 5 hours following admiaistration of a Cyaiioiminopiperazine Compound. Data are expressed as tail flick ]atency{s) and the percentage of the maximal possible effect (% MPE), i.e., 20 seconds, is calculated as follow
[ (post administration latency) - (pre-administration latency) ]
%MPE= '■ X 100
(20 s pre-administration latency)
The rat tail flick tesi is described in F.E. D'Amoor et ai, "A Method for Detennining Loss c Pain Seiiealion/'J. Pharmacol. Exp. Tlier. 'ri:14-19 (1941). "i"he results show that Cyanyiminopiperazine Compounds are useftil for treating or preventing acute pain.
Acute pain can also be assessed by measuring the animal's response to noxious mechanical stiirxuli by determining the paw withdrawal threshold ("PWT'J, as described below.
Infjamniatorv Pain: To assess the actions of the Cyanoiminopiperazine Compounds for Ihe treatment or prevention-of inflammatoiy pain tlieFreund's complete adjuvant ('TCA' model ofinfiammatory pain is used. FCA-induced inflammation of die rat hind paw is associated with the development of persistent inflammatory mechanical hyperalgesia a.'id provides reliable prediction of ttie anti-hyperaigeslc acdon of clinically useftil analgesic drug (L. Bartho et al., 'Thvolvementof Capsaicia-sensitive Neurones in Hyperalgesia and , Enhanced Opioid Antinocicepticm in ^fiiflammation." Naunyn-Schmiedeberg 's Archives of Pharmacology Z^Md-Slf) (IS^O)). The left hind paw of each animal is adminislered a 50 Li.Lintraplantarinjectionof50%FCA- 24 hour post injection, the animal is assessed for ■ respc-riss to noxious mechanical stimuli by detennining the PWl", as described below. Rats .uetbvTi admim'stered a single injection of 1, 3, lOorSOmg/Kgofeithera Cyanofminopiperazine Compound, 30 mg/Kg of a control selected from indomethacin, Celebrex or naproxen or carrier. Responses to noxious mechanical stimuli are then determined 1, ?, 5, and 24 hours post admmistiation. Percentage reversal of hj-peralgesia for each animal is defined as:

[ (post administration PWT) - (pre-administration PWT) ]
% Reversal = — ~ x 100. ■
[(Baseline ?WT) - (pre-adminislratron PWT)]
The results shew that the Cyanoiminopiperazine Compounds are useful for trsaiing or preventing inflammatory pain.
Nem-ppathic Pain: To assess the actions of the Cyanoiminopiperazine Compounds for the treatment or prevention of neuropathic pain either the Seltrxr model or the Chung mode! cat- be vsed.
In the Seltzer model., the partial sciatic nerve ligation model of neuropathic pain is .. used to produce neuropathic hyperalgesia in rats (Z. Seltzer et a!., "A Novel Behavioral Model of Neuropathic Pain Disorders Produced in Rats by Partial Sciatic Nerve bjury," Pain 43:205-2 IS (1990)). Paitial ligation of the left sciatic uer/s is performed under isoflurane/0, inhalation anaesiiiesia. Following induction of anesthesia, tlie left thigh of the rat is shaved and the sciaiic nerve e'cposed at high thigh level tb ough a small incision and is carefaliy clejired of siuTOunding connective tissues at a site near ihc trocaiitherjust distal to tlae point at which ihe posterior biceps S'^imitendinosus nerve hraucbss off of the common sciatic nerv:e. A 7-0 silk suture {?. inserted into Ihe nerve with a 3/8 curved, re\'ersed-cutting miai-needle and tighlly ligatsd so that the dorsal 1.'3 to K of the nerve thickness is held withm the Ugahire. The wound is closed with a single muscle suture (4-0 nylon (Vicryl)) and a Vetbond surgical . glue. Following surgery, the wotmd area is dusted v/ith antibiotic powder. Sham-treated rats undergo an identical surgjcal procedure except that the sciatic nerve is not manipulated. Following surgery, animals are weighed and placed on a warm pad until they recover &om anesthesia. Afiimals are then returned to their home cages until behavioral testing begins. The animal la assessed for response to noxious mechanical stimuli by determining PWT, as described below, prior to surgery (baseline), then immediately prior to and 1, 3, and 5 hoiu-s sJler drugadministiationfortheleft rearpawof ihe animal. Percentage reversal of :ieuropatb'c hyperalgesia is defined as:

[(post administration PWT) - (pre-administration PWT) ]
% Reversal = X 100
[(Baseline PWT) - (pre-administration PWT)]
fn the Chung model, the spinal nerve ligation model of neuropathic pain is used to produce mechanical hyperalgesia, thermal hyperalgesia and tactile allodynia in rats. Surgery is performed under isoflurane/O, inhalation anaesthesia. Following induction of anaesthesia a 3 cm incision is made and the left paraspina! muscles are separated from the spinous process at the L, - S, levels. The Lg transverse process is caiefuUy removed with a pair of small rongeurs to identify visually the L^ - Lj spinal nerves. The left L5 (or L5 and Lj) spinal nerve(s) is isolated and tightly hgated with silk thread. A complete hemostasia is confirmed and the wound is sutured using non-absorbable sutures, such as nylon sutures or stainless steel stales. Sham-treated rats undergo an identical surgical procedure excqjt thai the spina nc'.ve(s) is aot manipulated. Following surgery viniraals are weighed, adrainistered a- • subcutaneous (s.c.) injection of saline or ringers lactate, the wouiid area is dusted with ac'iihiotic powder ajid they are kept on a warm pad until they recova' from the anesthesia. Animals sia then rehimed to their home cages until behavioral testing begins. The animals are aiisessed for response to noxious mechanical stimuU by determining PWT, as described below,priortosurgery (baseline), then immediately prior to and 1,3, and 5 hours alter being admimstered a Cyanoiminopiperazine Compound for the lefl rear paw of the animal. The animal car* also be assessed for response to noxious thermal stimuli or for tactile allodynia, tu described below. The Chung model forneuropalbic pain is described jnS-H. Kim, "An Hxperimcntal Model for Peripheral Neuropathy Produced by Segmental Spinal Nerve Ligation in the Rat," Pain 50(3):355-363 (1992). The results will show that Cyauoiminopiperazine Compounds are usefiii tor treating or preventing neuropathic pain.
Response to Mechanical Stimuli as an Assessment of Mechanical Hyperalgesia: The paw pressurs assay can ha used to assess mechanical hyperalgesia. For this assay, hind paw v.'ithdmvval thresholds (PWT) to a noxious mechanical stimulus are determined using an analg5.i;>'niet€T (Model 72t», commeroiaily available from Ugo Basile of Italy) as described ir. C. Stein, "Unilateral Inflammation of the Hindpaw in Rats as a Model of Prolonged Noxious Siimulation: Alterations in Behavior and Nociceptive Thresholds." Pharmacology

Biochemistry and Behavior 31:451-455 (1988). The maximum weight that can be applied to the hind paw is set at 250 g and the end point is taken as complete withdrawal of the paw. PWT is determined once for each rat at each time point and only the affected (ipsilateral) paw is tested.
Response to Thermal Stimuli as an Assessment of Thennal Hyperalgesia: The plantar test can be used to assess thermal hyperalgesia. For this lest, hind paw withdrawal latencies to a noxious thermal stimulus are determined using a plantar test apparatus (commercially a^'ailable fi-om Ugo Basile of Italy) following the technique described by K. Hargreaves et al., "A New and Sensitive Method for Measuring lliennal Nociception in Cutaneous Hyperalgesia.'/^gjn 32(n:77-88 (19S8)- The maximum exposuretimeisselat 32 second? to avoid tissue damage and any directed paw withdrav/al from the heat source is taken as the end point. Three Latencies are determined at each time point and averaged. Only the affected (ipsilateral) paw is tested.
Assessment of Tactile AJlodvnia: To assess tactile allodynia, rats are placed in cieai-, plexiglass compartments with a wire mesh floor and allowed to habiuiate for a period of at least 15 minutes. After habituation, a;?eries ofvonFreynM'no^anicnis are presented to the jlantai' surl'ace of the left (operated) foot of each rat The series of von Frey monoalaments lonsists of six monofilaments of increasing diameter, with the smallest diameter fiber )resented first Five trials are conducted with each Sl-'unent with each trial separateii by ipprqximately 2 minutes. Each presentation lasts for a period of 4-8 seconds or until a lociceprive withdrarral behavior is observed. Flinching, paw withdrawal or h'cking of the law are considered nociceptive behavioral responses.
5.8. Example ii: In Wvo Assays for Preveption or Treatment of Anaety
The elevated plus maze test or the shock-probe burying t^t can be used to ssess the anxiolytic activity of Cyanoiminopipereazine Compounds in rats or mice.
The Elevated Plus Maze Test: The elevated plus maze consists of a platform /irh 4 arms, t'A^o open and two closed (50x10x50 cm enclosed with an open roof). Rats (or lice) are placed in the center of the platform, at the crossroad of the 4 arms, facing one of the losed arms. Time spent in Hie open 3ims vs the closed .'ums and number of open zxm enhies

during the testing period are recorded. This test is conducted prior to drug administration and again after drug administration. Test results are expressed as the mean time spent in open arms, and the mean number of entries into open arms. Known anxioiytic drugs increase both the time spent in open arms and number of open arm eniries. The elevated plus maze test is described in D. Tr«t "Aijimai Models for the Study of Anti-anxiety Agents: A Review," NmroscisTice & BiobeliavioralRe\'iews %2):2G3-222 {\9H5).
The Shock-Probe Burving Test: For the shock-probe burying test the testing app:iratus consists ofapiexigiass box measuring 40x50x40 cm, evenly covered with approximately 5 cm of bedding material (odcr absorbent kitty litter) with a small hole in one end tb'ough which a shock probe (6.5 cm long ar.d 0.5 cm in diameter) is inserted. ITie plexiglass shock probe is helically wrapped with two copper wires through which an electric^ cuTsnt is administered. The current is set at 2 mA. Rats are habituated to the testing apparatus for 30 min on 4 consecutive days without the shock probe in the box. On test day, rats are placed in one comer of the test chamber followin&. drug administra! ion. The probe is not electrified imtiJ the rat touches it with its snout cr fore paws, at which point Lhe rat Tijceives » ':.^rief 2 m.A shock. Tht 15 min tesiing period begins once the rat receives itr. fiist i:hock and 'Jbe probe remains electrified for the Tem£Jn'ing behavior) is measured as well as the nunibei' of contact-induced shocks the rat receives from ttie probe. Known anxiolytic drugs reduce die amount of burying behavior. In addition, an index of the rat's reactivity to each shock is scored on a 4 point scale. The total time spent immobile during the 15 min testing period is used as an index of general activity. The shock-probe burying test is described in D. Treit, 1985, supra. The results of this test will demoustrate that Cyanoiminopipeieazine Compounds are n^efiil for treating or V'?t\eiititg soxieiy.
5.9. Example 9: In I'ivo Assays for Prevention or Treatment of an Addictive Disorder
The conditioned place preference test or dnig self-administration test cax\ be used to assess tlie. ability of Cyanoiminopipereazine Compounds to attenuate tl:e rewarding propeTtieE of kiiowu drugs of abuse.

The Conditioned Place Preference Test: The apparatus for the conditioned place preference test consists of two large compartments (45x45x30 cm) made of wood with a plexiglass ^ont wall. These two large compartments are distinctly different. Doors at the back of each large compartment lead to a smaller box (36x18x20 cm) box made of wood, painted grey, with a ceiling of wire mesh. The two large compartments differ in terms of shading (white vs black), level of illumination (the plexiglass door of the white compartment is covered with aimninum foil except for a window of 7x7 cm), texture (the white compartment has a 3 cm thick floor board (40x40 cm) with, nine equally spaced 5 cm diameter holes and the black has a wire mesh floor), and olfactory cues (saline in the white compaitRTen'. and I ml of 10% acetic acid in the black comparunerit). On habituation and testing days, the doors to the small box remain open, giving the rat free access to both large compartri'.ents.
The first session that a rat is placed in the apparatus is a habituation session and entrances to the smaller giey compartment remain o^ieri gi-Jina the rai free ^Ciss to both laige coinpartmcnts. During habituation, mts generally sJaow no preference for either companmear. FoUcwing habivuation, rats are given 6 conditioTiing sessions. Rats are divided . into 4 groups; car:i'^r pre-treatment + carrier (control group), Cyanoiminopipereazine C:ompouiV.i pre-treatment -^ carrier, carrier pre-treatment + morphine, Cyanoimmopipereazine Compound pre-treatment + morphine. During each conditioning session the rat is injected with one of the drug combinations and confined to one compartment for 30 min. On the following day, tiiexat receives a carrier + earner treatment and is amfiiied to fee oflier-large -■ompartmsnt. Each rat receives three conditioning sessions consisting of 3 drug ;ombinarionrcompaitment.and 3 carrier-compartment pairings. The older of injections and he drug/corapaitment pairings are counterbalanced within groups. On the test day, rats ai-e jijected prior to testing (30 min to 1 hour) with either morphine or carrier and fee rat is Placed in the ^^aratus, fee doors to the grey compartment remain open and the rat is allowed :o explore fee entire apparatus for 20 min. The time spent in each compartment is recorded. •Cnown drugs of abuse increase the time spent in fee drug-paiied compartment during fee estina sessioi:. If fee Cyanoiminopipereazine Compound blocks the act{uisition of morphine :onditioned place preference (reward), there will be no difference in time spent in each side .n rats pre-treated wife a Cyatioiriiinopipereazine Compound and the group will not be

different from the group of rats that was given carrier + carrier in both compartments. Data will be analyzed as time spent in each compartment (drug combination-paired vs carrier-paired). Generally, the experiment is repeated with a minimum of 3 doses of a Cyanoiminopipereazine Compound.
The Dmg Self-Administrarion Test: The apparatus for the drug self-administration test is a standard commercially available operant conditioning chamber. Before drug trials begin rats are trained to press 9 lever for a food reward. After stable lever pressing behavior is acquired, rats are tested for acquisition of lever pressing for drug reward. Rats are implanted w/ith chronically indwelling jugular catheters for i.v. administration of compounds and are allowed 10 recover for 7 days before training begins. Experimental sessions are conducted daily for 5 days in 3 hour sessions. Rats are trained to self-administer a known drug of abuse, such as moiphine. Rats are then presented with two levers, an "active" lever and an "inactive" lever. Pressing of the active lever results in drug infiision on a fixed ratio 1 (FRl) schedule (Le., oat lever press gives an infusion) followed by a 20 second time out period (signaled by iUuminatiou of a light above the levers). Pressing of the inactive lever results m infusion of excipient. Training continues until the total number of morphine infusions stabilizes to within ± 10% per session. Trained rats are then used to evaluate the effect of Cyanoimiiopipereazine Compounds pre-treatment on drag self-administration. On test day, nits are pte-treated with a Cj'anoiminopipereazine Compoimd or excipient and then are allowed to self-administer drug as usual. If the Cyanoiminopipereazine Compound blocks the rewarding effects of morphine, rats pre-trealed with the Cyanoiminopipereazine Compound will show a lower rate, of responding compared to their previous rate of responding and compared to excipient pre-treated rats. Data is malyzed as the change in number of drug infusions per testing session (immber of infusions luiing test session - number of infusions during training session). The results will iemonshate that Cyanoiminopipereazme Compounds are usefiil for treating or preventing an iddictive disorder.
5.10. Example IQ: Functional Assay for Characterizing mGluR 1 Aptagohistic Properties
Functional assays for the characterization of mGluRl antagonistic properties
r£ well known in the art. For example, the following procedure can be used.

cDNA encoding raf mGluRl a receptor is obtained from, e.g.. Prof. S. Nakatiishi (Kyoto, Japan). It is transiently transfected into HEK-EBNA cells using a procedure described by SchJaegere? a/.,.iVeu'/?ev. NewAppl. Anim. Cell Techn., Proc. ESACT Meet., 15*a (1998), 105-112 and U 7-120. [Ca-+] measurements are perforaied on mGluRla transfected HEK-EBNA ceils after incubation of the cells v/irh Fluo-3 AM (0.5 ^M final concentration) for 1 hour at 37 '^ C foUowed by 4 washes with assay butfer (DMEM supplemented with Hank's salt and 20 mM HEPES. [Ca^*] measurements are done using a fliuonietric imaging plate reader, e.g., FLIPR from Molecular Devices Corporation, La Jolla, CA. 10 uM glutamate as agonist is used to evaluate the potency of the antagonists.
Increasing concentrations of antagonists are applied to the cells 5 minutes prior to ^plication of the agonist. The inhibition (antagonists) on^'es are fitted with ippropriate software, for example, the four-paiameter logistic equation giving IC;o and Hill :oefficient using the iterative nonlinear curve fitting software Origin from Microcal Software inc., Northampton, MA- The results of this assay will demonstrate chat Jj-ajioiininopipereazine Compounds bind to and modulate the activity of mGluRl.
5.11. Example 11: Binding of Cvauoimipopiperazine Compounds to VRl
Methods for assaying compounds capable of inhibiting VRl are well ioio-sm to hose skilled in the art for example, those methods disclosed in U.S. Patent No. 6,239,267 to Duckworth ei a/.; U.S. Patent No. 6,406,908 to Mclntyre et al.; or U.S. Patent No. 6,335,180 0 JOUAK ef al. The results of fcese assays will demonstrate that Cyanoirainopiperazine iilorapounds bind to and modulate the activity of VRl.
Binding of Compound DEYto VRl: Assay Protocol
Human VRl cloning. Human spinal cord RNA (commercially available from rionisch. Palo Alto, CA) was used. Reverse transcription was conducted on 1.0 jig total INA using Thermoscript Reverse Transcriptase (commercially available from Invitrogen, ;iarlsbad„CA) and oHgo dT primers as detailed in its product description. Reverse ran.'scription reactions were incubated at 55°C for 1 h, heat-inactivated at S5'C lor 5 min, ml RKase H-treated at Zl'-'C for 20 min.

Human VRl cDNA sequence was obtained by comparison of the human genomic sequence, prior to annotation, to the published rat sequence. lutron sequences were removed and flanking exonic sequences were joined to generate the hypothetical human cDNA. Primers flanking the coding region of human VRl were designed as follows: forward primer, GAAGATCTTCGCTGGTTGCACACTGGGCCACA; and reverse primer. GAAGATCTTCGGGGACAGTGACGGTTGGATGT.
PCR of VRl was performed on one tenth of the Reverse transcription reaction mixture using. Expand Long Template Polymerase and Expand BuSer 2 in a final volume of 50 |.iL according to the manufacturer's instrucrions (Roche Apphed Sciences, Indianapolis, U-T). After denaturation at 94°C for 2 min PCR amplification was performed for 25 cycles at 94"C for 15 sec, 58°C for 30 sec, and 68°C for 3 min followed by a final incubation at 72 =C for 7 min to complete the amplification. A PCR product of-2.8 kb was gel-isolated using a 1.0% agarose, Tris-Acetate gel containing 1.6 fig^mL of crystal violet and purified with a S.NA.F. UV-Free Gel Purification Kit (commercialH available from fiivitrogen). TbeVRi PCR product was cloned into the pIND/V5-His-T0P0 vector (commercially available fi«m Invitrcgen) according to the manufacturer'^ instruclions. DNA preparations, restricticn ca^ymc digestions, and prelimuiaiy DNA sequencing were performed according to .standard protocols. Full-length sequencing confimied the identity of the human VRl,
Generation of inducible cell lines. Unless noted other-vi^e, cell culture reagents were purchased from Life Technologies of Rodcville, MD. HEK293-EcR cells sxpressing the ecdysone receptor (commercialiy avail:djle fitjm InvitrogsQ) were cultured in Growth Medium (Dulbecco's Modified Eagles Medium coataiiiing 10% fetal bovine serum [commercially available fix)m H>i'Cl-ONE, l,ogan, UT). Ix penicillin/streptomycin, Ix glutariiiic, l mM sodium pyruvate and 40O ng/mL Zeocin (commercially available fiiim Invilrogfin)). The VRl-pIND constructs were transfected into die HEK293-EcR cell line . mn% F'Jgene transfection reagent (commercially available fi:om Roche Applied Sciences," Basel, Switzerland). After 48 h, cells were transferred to Selection Medium (Growth VIediiim oontaining 300 jig'mL- G41S (commercially available fi-om hivitrogen)). ipjjroxi.rnalely 5 weeks later individual Zeocin/G418 resistant colonies were isolated and expanded. To identify functional clones, multiple colonies were plated into 96-well plates md sKpress'ion was induced for 4S h using Scilection Medium supplemented w-ith 5 jiM

ponasterone A ('TonA") (commercially available from Invitrogen). On the day of assay, cell; were loaded with Fluo-4 (a calcium-sensitive dye that is commercially available from Molecular Probes, Eugene, OR) and CAP-mediated calcium influx was measured using a Fluorometric Imaging Plate Reader ("FLIPR'") (commercially available from Molecular Devices Corp., Sunnyvale, CA) as described below. Functional clones were re-assayed, expanded, and cr>'opreserved.
pH-Based Assay. Two days prior to performing this assay, cells were seeded
on poly-D-lysine-coated 96-weIl clear-bottom black plates (commercially available from Becton-Dickinson) at 75,000 cells/well in growth media containing 5 fiM PonA (commercially available from Irivib-ogen) to induce eicpression. On the day of the assay, the plates were washed with 0.2 mL Ix Hank's Balanced Salt Solution (connmercially available from Life Technologies) containing 1.6 mM CaCU and 20 niM HEPES, pH 7.4 ("wash buffer"), and loaded using 0.1 mL of wash buffer containing F1UCH4 (3 pM final concentraticn, commercially available from Molecular Probes). Afrer 1 h, the cells were washed twice with 0.2 mL wash buffer and resuspended tn 0.05 mL. Ix Hank's Balanced Salt Solution (commercially available irom Life Technologaes) containing 3.5 niM CaClj and -0 rru*/! Citrate, pH 7.4 ("assay bufifer")- Plates were then craiisferred to a FLIPK. (commercially available from Molecular Devices) for assay. Compound DEY was diluted in assay buffer, and 50 mL of the resultant solution were added to tlie ceil plates and the solution monitored tor two minutes. The final coucenlration of Comp Cap.saicin-based Assay. Two days prior to performing this assay, cells were leeded in poly-D-lysine-coated 96-well clear-bottom black plates (50,000 cells/well) in gro'vth media containing 5 nM PonA (commercially available from Iu\itrogen) to induce ixprespion. On the day of the assay, the plates were washed with 0.2 mL Ix Hank's Balanced 5alt Solution (commercially available from Life Technologies) containing 1 niM CaClj and iO raM HEPES, pH 7.4, and cells were loaded using 0.1 mL of wash buffer containing Fluo-4

(3 tiM final). After one hour, the cells were washed twice with 0.2 mL of wash buffer and resuspended in 0.1 mL of wash buffer. The plates were traasferred to a FLIPR fcommercially available Jrom Molecular Devices) for assa>-. 50 ^L of Compound DEY diluted with assay buffer were added to the cell plates and incubated for 2 min. The fina) concentration of Compouad DEY ranged from about 50 pM to about 3 ^LM. Human VRl was activated by the addition of 50 \iL of capsaicin (400 TM), and the plates were mcubaled for an additional 3 rain. ■ Data were collected over the entire time course and analyzed using Excel and GraphPad Prism. Compound DEY when assayed according to this protocol had an ICjo of 59.4 ±13.1 nM(n-^3).
The resuhs of the pH-based assay and the capsaicin-based as«ay demonstrate that Compound DEY, an illustrative Cyanoiminopiperazine Compound, binds to and raodulstes the activity of human VRl.
The present invention is not to be limited in scope by the specific enibodimeois disclosed in the examples which are intended as illustrations of a few sheets of the invention and any embodiments that are functionally equivalent are v^ithin the scope of this invention. Indeed, various modijications of the invention in addition to those shown iirul described herein will become apparent to those skilled in the ait and are intended to fail within the scope of the appended claims.
Anmnber of references have beeii cited, the entire disclosures of which are inc-orporated herein by refCTence.

What is claimed is:
1. A compound of fonnula :
i

5. . The compound of claim 3, wberein the R^ phenyl is substituted at the
4-posii:ion.
6. The compound of claim 5, wherein the R^ phenyl is subsiituted with a 7. The compound of claim 6, wherein the -(Ci-Cg) alkyl is a (ert-butyl group.
8. The compound of claim 6, wherein the -((2,-Cf;> alkyl is an iso-propyl group,
9. The compound of claim 5, wherein the R* phenyl is substituted with a -CF3 group.
10. The compound of claim 3, wrierein R' is chloro or methyl.
U. The compound of claim 10, wherein the R* phenyl is unsubstituted.
12- The compound of claim 10, wherein the R^ pheuji is sub^iluted at the 4-posilion.
13. The compound of claim 12, wherein the R* phenyl is substituted with a -CC-Cfi) alkyl.
14. ITie compound of claim 13, wherein the -(C|-Cg) alkyl is a (ert-butyl group.
15. The compound of claim 13, wherein the -(Cy-C^) alkyl is an Lso-propyl group.

26. The compound of claim 25, wherein the R^ phenyl is unsubstitutai.
27. The compound of claim 25. wherein the R* phenyl is subslituted at tl 4-position.
28. The compound of claim 27, wherein the R* phenyl is substituted witt -(CrQ) alkyl.
29. The compound of claim 28, wbeiein the -(C^-C(,) alkyl is a tert-buty] group.
30. The compouiid of claim 2S, wherein the -(Ci-C^) alkyl is an ijopropj groiq).
31. The compound ofclaim 27, wherein the R" phenyl is substimled with. -CFjgroui).
32. The compound of claim 25, wherein R' is chlcffc or mexhyi.
33. The compoimd of claim 32, wherein the R* phenyl is unsiibstiluted.
3'1. The compound of claim 32, wherein the R* phenyl is substituted at thi
4-position.
35. The compound of claim 34, wherein the R*^ phenyl is substituted with -(CrQ)aifcyi-
36. The compound of claim 35, wherein the -(Cj-Cg) alkyl is a /erf-butyl
^oup.

37. The compound of claim 35, wherein the -(Ci-CJ alkyi is an iso-propyl group.
?S. The compound of claim 34, whereir. the R' phenyl is substituted with a

42. A compound of formula:

48. Thecompound of claim 47, wherein the -(C|-Cs) alkylis aferf-butyl gi-uup.
49. The compound of claim 47, wherein the -(Ci-C^) alki-l is an wo-propyl group-
50. The compound of claim 46, wherein the R" phenyl is substituted with a -CF3 group.
51. The compound of claim 44, wherehi R' is chloro or methyl.
52. The compound of claim 51, wherein the R* phenyl is unsubstituted.
53. The compound of claim 51, ivheiein the R* phenyl is substituted at the 4-posilicn.
54. The compound of claim 53, wherein the R' phenyl is substituted with a -(CVOalkyl.
55. The compound of claim 54, wherein the -(Ci-Cs) alkylis aiert-butyl group.
56. The compound of claim 54, wherein the -(Ci-Cg) alkyl is an wo-propyl group.
57. The compound of claim 53, wherein the R*^ phenyl is substituted with a -CFj group.
58. The compound of claim 42, wherein A is -C-.

67. The compound of claim 66, wherein the R^ phenyl is unsubstituted.
68. The compound of claim 66, wherein the R" phenyl is substiliued at the -position.
69. The compound of claim 68, wherein the R^ phenyl is substituted with a :CrC6)aIkyl.
70. The compound of claim 69, wherein the -(C|-Cj,) alkyl is a r^ft-butyl roup.
71. The compound of claim 69, wherein the-{C,-Q) alkyl. is anLso-propyl roup.
72- The compound of claim 63, v/herein the R* phenyl is substituled with a
ZF-^ gi-oup.
73. Thecompoundof claim 66, wherein R' is chloro or methyl.
74. Ths compound of claim 73, wherein the R" phenyl is unsiihstituted.
75. The compound of claim 73 ,■ wherein the R*" phenyl is substituted at the -position.
76. The compound of ciabn 75, wherein the R'^ phenyl is substituted with a
[CrCj'aikyl.
77. The compound of claim 76, wherein the ~(C;-C^) alkyl is a (^rr-butyl
roup.

83. A compound of fonnula :

87- The compound of claim 86, wherein the R* phenyl is substituted "mxb i
88. The compound of claim 87, wherein the -(Ci-Ca) alfcyl is a rert-butyl
group.
89. The coDipomid of claim 87, wherein the -(C,-Ct^ alky] is an ijc'-propy]
group.
90. The compound of claim 84, wherein the R* phenyl is substituted with a
-CTJ group.
91. The compound of claim 84, wherein F' ischlorc or methyl.

98. The compound of cliiim 83, wherein A is -0-.
99. The compound of claim 83, wherein A is -S-.
100. A compound of formula:

102. A composition comprising an effeclive-amount of the compound or a pharmaceiitically acceptable salt ofthe compound of claim 1 and a phamiaceutically acceptable carrier or excipient.
103. A composition comprising an effective amount of the compomid or a phannaceuticaily acceptable salt of the compound of claim 19 and a phannaceutically acceptable earner or excipient.
104. A composition comprising an effective amount of the compo'ind or a
phamiaceutically acceptable sali of the cr;mpound of claim 21 and a phannaceuticaU}'
scceptabie canier or excipient.
105. A composition comprioing an effective amoiml of the compound or a
phaiTnaceuticaily acceptable salt of the compound of claim 22 and a pharmaceutically
acceptable canier or excipiaiL
106. A composition comprising an effective amount of the compoimd or a
pharm*;eutic3Uy accq)tab!e salt of the compound of claim 23 and a pharmaceutically
acceptable canier or excipient.
107. A composition comprising an effective amount of the compound or a
pharmaceutically acceptable salt of the compound of claim 41 and a pharmaceutically acceptable earner or excipient.
I

!0S. A composition comprising an effective amount of the compound or a phannaceuticaliy acceptable sait of the compound of cJaim 42 and a pharmaceutically acceptable carrier or excipient.
109. A composition comprising an effective amount of the compound or a thai-maceuiically acceptable salt of the compound of claim 60 and a phaimaceutically cceptable carrier or excipient.
110. A composition comprising an effective amount of the compound or a ihamiaceutically acceptable salt of the compound of claim 62 and a pharmaceutically .cceptable carrier or excipient.
ill. A composition comprising an effective amount of the corapomid or a iharmaceuticaHy acceptable salt of the compound of claim 63 and a phannaceutically icceptabie carrier or excipient.
112. A composition comprising an effectivo amount of the compound or a )hannaceutically acceptable salt of the compound of claim 64 and a pharmaceutically icceptabie carrier or excipient.
113. A composition comprising an effective amount of the compomid or a ihaimace;&cal!y acceptable salt of the compound of claim 82 and a pharmaceutically icceptabie carrier or excipient
114. A composition comprising an effective amount of the compound or a jhamiaceutically acceptable salt of the compound of claim S3 and a pharmaceutically icceptabie carrier or excipient.
115. A composition comprising an effective amount of the compoimd or a pharmaceuncally acceptable salt of the compound of claim 100 and a pharmaceutically acceptable carrier or excipient.

116. A composition comprising an effective amount of the compound or a phaTmaceutically acceptable salt of the compound of claim. 101 and a phannaceutically acceptable carrier or excipienl.
117. A method for treating pain in an animal, compiisLng administsMg to an animal in need thereof an effective amount of the compound or a phannaceutically acceptable salt of the compound of claim 1.
118. A method for treating pain in an animal, compnsing administering to an animal in aeed thereof an effective amount of the compound or apharmaceuticaliy acceptable salt of the compound of claim 19.
119. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a phannaceutically acceptable salt of the compound of claim 21.
120. A method for treating pain in an animal, comprising administering to
an animal in aeed thereof an effective amount ofthe compound or a phannaceutically ^
acceptable salt ofthe compound of claim 22.
121. A method for treating pain in an animal^ conqjrising adniimstering to an animal in ceed thereof an effective amount ofthe compound or a phannaceutically acceptable salt ofthe compound of claim 23.
122. A method for treating pain in an animal, comprising administering to an ar.imal m need thereofan effective amount ofthe com^iound or a phannaceutically acceptable salt ofthe compound of claim 41.
123. A method for treating pain in an animal, comprising administering to
I jn animal in need thereof an effective amount of the compound or a pharraacettically
acci^table salt ofthe compound of claim 42,

124. A method for treating pain in an animal, comprising administeiing to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 60.
125. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 62,
126. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 63.
127. A method for treating pain in an animal, comprising admuiistering to an aniiaal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the coinpomid of claim 64.
12S. A method for treating pain in an animal, comprising administering to an animal in need theieof an effective amount of the compound or a pharmaceuticaUy acceptable salt of the corapoimd of claim 82.
129. A metbod for treating pain in an animal, comprising administering to an animai iu need thereof an effective amount of the compoimd or a phaimaceuticaUy acceptable salt of the compound of claim 83.
130. A method for treating pain in an animal, comprising administering to
an animal in need thereof an effective amount of the compoimd or a pfaa.tmace«ticaily acceptable salt of the compound of claim 100.

131. A method for treating pain in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 101.
132. A method for treating urinary incontinence in an animal, comprising adininistering to an animal in need thereof an effective amount of the compound or a phaimaceutically acceptable salt of the compound.of claim 1.
] 33. A method for treating urinary incontinence in an animal, comprising idministericg to an animal in need thereof an effective amount of the compound or a Dharmaceuticaliy acceptable salt of the compound of claim 19-
134. A method for treating urinary incontinence in an animal, comprising idndnistering to an animal in need thereof an effective amount of the compound or a Dharcnaceuticaily acceptable salt of the compound of claim 21-
135. A method for treating minaiy incontinence in an aninjai, comprising idmini.^ering to an animal in need thereof ai] effective amount of the compound era Dhannaceiitically acceptable salt of the compound of claim 23.
136. A method for treating urinary incontinaice in an animal, comprising idministei'ing to ananimalinneedthereof an effective amount of the compound or a jharmaceutJcally acceptable salt of the compound of claim 23-
137. A method for treating arinary incontinence in an animal, comprising idrainistering to an animal in need thereof an effective amount of the compound or a jharmaceutically acceptable salt of the compound of claim 41.
138. A method for treating urinary incontinence in an animal, comprising idrairistoring to an animal in need thereof an effective amount of'iie compound or a Dharmaceutically acceptable salt of the compound of claim 42-

139. A method for treating urinary incontinence in an animal, comprising
administering to an animal in need thereof an effective amount of the corapoiind or a
ihannaceutically acceptable salt of tlie compound of claim 60.
140. A method for treating urinary incontmence in an animal, comprising drainistering to an animal in need thereof an elective amount of the compound or a ihannacsutically acceptable salt of the compound of claim 62.
141. A method for trealing urinary incontinence in an animal, comprismg dministering to an animal in need thereof an effective amount of the compound or a harmaceutically accqjtable salt of the compound of claim 63.
142. A method for treating lirinary incontinence in an aiiima), comprising ' dministering to an animal in need thereof an effective amount of the compound or a ■■' hannaceuticaiiy acceptable salt of the compound of claim 64.
143. A method for treating urinary incontinence in an ainimal, comprising diamisteiiag lo an animal in need thereof an effective amount of the compomid or a hanuaceutically acceptable salt of the compound of claim 82. ,144. A method for treating urinary incontinence in an animal, comprising dministCTing to an animal in need thereof an effective amount of the conqwund or a hanuaceutically acceptable salt of the compound of claim 83.
145. A method for treating uriuaiy incontinence in an animal, comprising dministering to an animal in need thereof an effective amount of the compound or a
harmaceutically acceptable salt of the compoimd of claim 100.

146. A method for treating urinary incontinence in an aniinal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 101.
i 147. A method for treating an ulcer in an animal., comprising administering
to an aiiiroalin need thereof an effective iimotmt of the compound or a pharmaceutically acceptable salt of the compound of claim 1.
14S. A method for treating an ulcer in an animal, comprising adffiiiiistering t to ananimaiinneedthereof an effective aaiouut of the compound or a pharmaceutically , acceptable salt of the compound of claim 19.
149- A method for treating an ulcer in an animal, comprising administering
to an animal in need thereof an effective amoiuit of tf;e compound or a pharmaceutically _f
accepiable salt ofthe compound of claim 21.
150. A method for treating 311 ulcer iii an animal, comprising adininztrtciiiig ■■ to an ummal in need thereof an effective amount of the compoond or a phaimaceuticaliy ,; accept?,blt-. salt of the compotmd of claim 22.
151. A method for treating an ulcer in an animal, comprising administering to an snijHEii in need thereof an effective amount of thfc compound oc a pharmaceutically acceptable salt of the compound of claim 23.
152. A method for treating an iiJcei- in an animal, comprising administering xo im animal in need thereof an effective amoimt of the compound or a pharmaceiiiicalJy acceptable salt of the compound of claim 41.
153. A method for treating an ulcer in m animal, comprising administering to i-Ji animal in need thereof an. effective amount of the compoimd or a pharmaceviiically acceptable salt of the compound of claim 42.

154. A method for treating an ulcer in an. animal, comprising administering to ar. animal in need thereof an effective amount of the compound or a jiharmaceutically acceptable salt of the compound of claim 60.
155. A method for treating an ulcer in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 62.
156. A method foe treating an uLcer in an animsl, comprising administering to an animal in need thereof an effective amoimt of the compound or a phannaceutically acceptable salt of the compound of claim "53-
.\51. A method for heating anulcer in ao animal, comprising administering to sin animal u\ need thereof an effective amount of the compound or a priaraiaceutically ^: accqitabie salt of the compound of claim 64.
158. A method for treating an ulcer in an animal, comprising administerijig to aij animal in need thereof an effective amount of the compound or a phannaceutically ■. acceptable salt of the compound of claim S2.
159. A method for treating an ulcer in an animal, .comprising administering to an animal in need thereof an effective amoimt of the compound or a pharmaceutically j:ccq;tab!e salt of the compound of claim 83,
160. .\ method for treating an ulcer in an animal, comprising administering to ari animal in need thereof an effective amount ofthecompoimd or a pharmaceutically acceptable salt of the compound of claim 100.

161. A method foi treating an ulcer iii an animal, comprising administering to ail animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim !01.
162. A method for treating irritable-bowel syndrome in an animal :omprising administering to an animal in need thereof an effective amount of the compound Dr a pharmaceutically acceptable salt of the compound of claim 1.
163. A method for treating irritable-bowel syndrome in an animal, ;oniprising administering to an animal in need thereof an effective amount of the compound Dr a pharmaceutically acceptable salt of the compound of claim 19.
] 64. A method for treating initable-bowel syndrome in an animal, roinprising administering to an animal in need thereof an elective amount of the compound :,-' ir a pharmaceutically acceptable salt of the compound of claim 21.
165. A method for iTeating irritable-bowel syndrome in an animal, ;oniprising iidministering to an animal in need thereof an effective amount of the compound ;, )r aphannaceutically acceptable salt of the compound of claim 22.
166. A method for treating iiritable-bowel syndrome in an animal, :on^rising admimstering to an animal in need thereof an effective amount of the compound >r a phannaceutically acceptable salt of tiie compound of claim 23.
167. A method for treating irritable-bowel syndrome in an animal, comprising administering to an animal in need fhereofan effective amount of the compound )r a phannaceutically acceptable salt of the compound of claim 41.
168. A method for treating imtable-bowel syndrome in an animal, ■orapri.siii'v administering to an animal in need thereof an effective amoimi of tlie compound )r a pharrnaceutically acceptable salt of the compound of claim 42.

169- A method for treating irritable-bowel sjiidrome in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceiiticaliy acceptable salt of the compound of claim 60.
170. A method for treating hritabie-bowel syndrome in an animal, ;omprising administering to an animal in need thereof an effective amount of the compound 'JT a phamiaceutically acceptable salt of the compound of claim 62.
171. A method for treating initable-bowel syndrome in an animal, :oraprising administering to an animal in need thereof an effective amount of the compound 31" a pharmaceutically acceptable salt of the compound of claim 63.
172. A method for treating imtable-bowel syndrome in an animal, romprisiiig administering to an animal in need thereof an effective amount o f the compound; 3r a phamiaceutically acceptable salt of the compound of claim 64.
173. A method for treating imtable-bowel syndrome in an animal, yjmprising administering to an anunal in need thereof an effective amount of the corapJiind; jj- a pharmaceutically acceptable salt of the compound of claim 82. 'c
174: A. method for treating irritable-bowel syndrome in an animal, :omprising administering to an animal in need thereof an effective amount of the compound IT apbaim^eutically acceptable salt of the conipoimd of claim 83.
175.. A method for treating iiritable-bowel syndrome in an animal, :omprismg administering to an animal in need thereof an effective amount of the compound
17 a pharmaceutically acceptable salt of the compound of claim 100.

176. A method for Creating irritable-bowel syndrome in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a phamiaceutically acceptable salt of the compound of claim 101.
177. A method for treating infiamniatory-bowel disease in ac animal, comprising administering to ananimalinneed thereof an effective amount of the compound or a phamiaceutically acceptable salt of the compound of claim 1.
178. A raetiiod for treating inflammatory-bov/el disease in an animal, comprbing administering to an aiimai in need thereof an effective amount of the compound or a pharmaceuticaJly acceptable salt of the compound of claim 19.
179. A method for heating inflammatory-bowel disease in an animal, cojuprisiiig administeriog to an animal in need thei'eof an effecrive amount of the compounf or apharraaceuticaily acceptable salt of the compound of ciaim 21.
ISO, A np.etliod lor treating intlamraatory-bowel disease in an animal, comprising administering to an animal in need Uiereof an effective amount of the compouiK or a pharmaceutically acceptable salt of the compound of claim 22.
1S i. A metiiod for treating inflammatory-bowel disease in an animal, comprisLiig administering to an animal in need thereof an affective amount of the compount or a pharmaceutically acceptable salt of the compound of claim 23.
182. A method for treating inflamraatoiy-bowel disease in an animal, comprisii-g administering to an animal in need thereof an effective amoimt of the compouni or a pharmaceutically acceptable salt of the compound of claim 41.
1S3. A method for treating inflammatory-bowel disea.se in an animal, compri;;:(n£ administering to an animal in need thereof an effective amount of the coinpomi' or a pharmaceuticaHy acceptable salt of the compound of claim 42.

184. A method for treating inflammatory-bowe] disease in an animal,
comprising administering to an animalin need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 60.
185. A method for treating inflammatory-bowel disease in an animal, comprising administering to an animal inneed thereof an effective amount of the compound-or a pharmaceutically acceptable salt of the compound of claim 62.
186. A method for treating inflammatory-bowel disease in an aiiiroal, comprising administering to an animal in need thereof an effective amount of the compound or a phannaceutically acceptable salt of the compound of claim 63.
187. A method for treating inflamraatory-bowel disease in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 64.
188. A method for treating inflammatory-bowel disease in an animal, , coniprisiog administering to an animal in need thereof an effeclivs amount of the corapoimd or a pharmaceutically acceptable salt of the compound of claim 82. ■-,
1S9: A method for treating inflammatory-bowel disease in an animal, comprising administering to an animal in need thereof an effective amount of the compotmd or a phsrmaceutically acceptable salt of the compound of claim S3.
190. A method for treating inflammatory-bowel disease in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 100.

191. A method for treating inflainniatory-bowel disease in an animal, comprising administering to an animal in need thereof an effective amount of the compound or a phamiaceutically acceptable salt of the compouiid of claim 10).
192. A method for inhibiting VRl fimction in a cell, comprising contacting a cell capable of expressing VRI with an effective amount of the compound or a pharmacentically acceptable salt qf the compound of claim I.
193. A method for inhibiting VRl fonction in a cell, coinprisirtg contacting a cell capable of expressmg VRl with an effective amount of the compound or a pharmaceutically acceptable salt of the compound of claim 19.
194. A method for inhibiting VRl fimction in a celj, comprising contacting a cell capable of expressing VKl with an effective amotmt of the compouud or a >:' pharmaceutically acceptable salt of the compound of claim 2\.
195. A method for inhibiting VRi function in a cell, comprising coataciiiig z. cell capable of expressing VRl with an effective amount of the compound or a -^-phaimaceutically acceptable salt of the compound of claim 22.
196. A method for inhibiting VRl fimction m a cell, comprising contacting a ceH capable of expressing VRl with an effective amoimt of the compound or a pharmaceutically acceptable salt of the compound of claim 23.
197. A method for inhibiting VR) fimction in a cell, comprising contacting a ceil capable cf expressing VRl with an effective amount of the compound or a pharmaceutically acceptable salt of the compoimd of claim 41.
198. A method for inhibiting VRl fimction in a cell, comprising contacting ;i ceU capable of expressing VRl with an effective amount of the compound or a pharmaceutically acceptable salt cf the compound of claim 42.

199. A method for inhibiting \TII function in a cell, comprisir.g contacting a cell capable of expressing VRi with an effective amount of the compound or a phaiTnaceutically acceptable salt of the compound of claim 60.
200. A method for inhibiting VRI function in a cell, comprising contacting a cell capable of expressing VRI with an effective amount of the compound or a pharraaceiitically acceptable salt of the compound of claim 62.
201. A method for inhibiting VRI function in a celL conip'.ising contacting a cell capable of expressing VRI with an effective amount of the compound or a pharrnacsuticaily acceptable salt of the compound of claim 63.
202. A raetiiod for inhibiting VRI function in a cell, comprising contacting
a cell capable of expressing VRI with an efrective amount of the compound or a ^ j
pharmaceutically acceptable salt of the compoimd of claim 64.
203. A method for Iniiibiting VRI fimction in a cell, comprising contacting a cell capable of expressing VRI with an effective mnoiint cf the compomid or a piiaimaceutically acceptable salt of the compound of claim 82. y
204. A method for inhibiting VRI fimction in a cell., comprising contacting a cell capable of expressing VRI with an effective amount of the compomid or a pharmaceutically accept'ibls salt of the compound of claim 83.
205. A method for inhibiting VRI function in a cell, comprising contacting a cell capable of expressing VRI with an effective amount of the compound or a
ph;:^rmaccutica!ly acceptable salt of the compound of claim 100.

206. A method for inhibiting \Tll function in a cell, comprising contacting
a cell capable of expressing VRl with an effective amount of the compound or a
phannaceutically acceptable salt of the compound of claim 101.
207. A kit comprising a container containing an effective amount of a compound or a phannaceutically acceptable salt of the compound of claim 1.
208. A kit comprising a container containing an effective amount of a ;ompouncl or apharmaceutically acceptable salt of the compound of claim 19.
209. A kit comprising a container containing an effective amount of a :on7poimd or a pharmaceutically acceptable salt of the compound of claim 21.
210. A kit comprising, a container contELining an effective amount of a v-:ompnundor a pharmaceutically acceptable salt of the compound of claim 22. - v;
.211. A kit comprising s.contaiuer containing an stfec.tive amount of a i; compound or a phannaceutically acceptable salt of the compoimd of claim 23.
212. A kit comprising a coniaiiier containing an effective amount of a ^ :ompoimd or apharmaceutically acceptable salt of the compoimd of claim 41.
213. A kit comprising a container containing an effective amount of a ::ompound or 3 pharmaceutically acceptable salt of the compound of claim 42.
214. A kit comprismg a container containing an effective amount of a ;ompound or a pharmaceutically acceptable salt of the compoimd of claim 60.
215. A Icit comprising a container containing an effective amount of a :ompouncl or a pJiai-maceuticaliy acceptable salt of the compoiinn of claim 62.

216. A kit comprising a container containing an effective amount of a compound or a phannaceutically acceptable salt of the compound of claim 63.
217. A kit comprising a container containing an effective amount of a compound or a phannaceutically acceptable salt of the compound of claim 64.
218. A kit comprising a container containing an effective amount of a cornpoimdorapharmaceutically acceptable salt of the compound of claim 82.
219. A kit comprising a container containing an effective amount of a compound or a pharmaceutically acceptable salt of the compound of claim 83.
220. A kit comprising a container containing an effective amount of a compound or a pharmaceutically acceptable .salt of the compomid of claim 100. ■> .
221. A kit comprising a container containing an effective ainotmi of a ;-compound oraphamiaceuticaily acceptable salt of the compound of claim 101, ;'
222. A method for preparing a composition, the method comprising ■. adinixingacompoimdorapharmaceuticallyacceptablesaUofthe confound of claim 1 and a phannaceutically acceptable carrier or excipient
223. A method for preparing a con^wsition, the method comprising adniirting a compound or a pharmaceutically acceptable salt of the compound of claim 19 and a pharmaceutically acceptable carrier or excipient
224. A method for preparing a composition, the method comprising admixing a compoun d or a pharmaceutically acceptable salt of the compound of claim 21 and a pharmacetitically acceptable carrier or excipient.

225. A method for preparing a composition, the method comprising
admixing a compound or a pharmaceutically acceptable salt of the compound of clai^i 22 and a phannaceutically acceptable carrier or excipient.
226. A method for preparing a composition, the method comprising admixing a compomid or a pharmaceutically acceptable salt of the compound of claim 23 and a phannaceutically acceptable carrier or excipient.
227. A method for preparing a composition, the metliod comprising admixirig -a compound oi' a pharmaceutically acceptable salt of ihe compoimd of olaim 41 and-a pharmaceutically acceptable earner or excipient.
228. A method for preparing a composition, the method comprising admvxing acompoundorapharmaceutically acceptable salt of the compound of claim 42 and a pharmaceutically acceptable carriei" or excipient. v=::'
229. A miShotl for preparing a composition, the method conipiisiog r-admixing a compcriu or a pharmaceutically acceptable salt of the compound of claim 60 and a phiixinaceiitically acceptable carrier or excipient
230. A method for preparing a composition, the method comprising admixing a compound or a pharmaceutically acceptable salt of the ccmpouiid of claim 62 and, a pharmaceutically acceptable carrier or excipient
231. A method for preparing a composition, the method comprising admixing a compoimd or a pharmaceutically acceptable salt of the compound of clajjn 63 and ■ a pharmaceutically acceptable carrier or excipient.
232. A method for prepaiing a composition, the method comprising admixing a c
233. A method for prqjaring a composition, the method comprising aclniixing a compound or a pharmaceutically acceptable salt of the compomid of claim "2 and a pharmaceutically acceptable carrier or excipient.
234. A method for preparing a composition, the method comprising admixing a compound or a pharmaceuricallyacceptable-salt of the compound of claim 83 and
a phannaceut'cally acceptable carrier or excipient.
235. A method for preparing a composition, the method comprising admixing a compound or a pharmaceutically acceptable salt of the compoimd of claim 100 and a pharmaceutically acceptable cairier or excipient.
236. A method for preparing a composition, the method comprising . admixing a compound or a pharmaceutically acceptable salt of the coroiraund of claim'l 01 a:.id a phannaceulicaEIy acceptable carrier or excipient.

Documents:

2998-chenp-2004 abstract duplicate.pdf

2998-chenp-2004 claims duplicate.pdf

2998-chenp-2004 claims.pdf

2998-chenp-2004 correspondence others.pdf

2998-chenp-2004 correspondence po.pdf

2998-chenp-2004 description (complete) duplicate-1.pdf

2998-chenp-2004 description (complete) duplicate-2.pdf

2998-chenp-2004 description (complete) duplicate-3.pdf

2998-chenp-2004 description (complete) duplicate-4.pdf

2998-chenp-2004 description (complete) duplicate.pdf

2998-chenp-2004 description (complete)-1.pdf

2998-chenp-2004 description (complete)-2.pdf

2998-chenp-2004 description (complete)-3.pdf

2998-chenp-2004 description (complete)-4.pdf

2998-chenp-2004 description (complete).pdf

2998-chenp-2004 form-1.pdf

2998-chenp-2004 form-13.pdf

2998-chenp-2004 form-18.pdf

2998-chenp-2004 form-26.pdf

2998-chenp-2004 form-3.pdf

2998-chenp-2004 form-5.pdf

2998-chenp-2004 pct.pdf

2998-chenp-2004 petition.pdf

« Previous Patent

Next Patent »

Patent Number

225863

Indian Patent Application Number

2998/CHENP/2004

PG Journal Number

02/2009

Publication Date

09-Jan-2009

Grant Date

01-Dec-2008

Date of Filing

31-Dec-2004

Name of Patentee

EURO-CELTIQUE, S.A

Applicant Address

122, BOULEVARD DE LA PETRUSSE

Inventors:

#	Inventor's Name	Inventor's Address
1	ZHOU, XIAOMING	22 DOGWOOD DRIVE, PLAINSBORO, NJ 08536,
2	KYLE, DONALD, J	29 WEATHERFIELD DRIVE, NEWTOWN, PA 18940
3	SUN, QUN	19 ALDGAQTE COURT, PRINCETON, NJ 08540,
4	TAFESSE, LAYKEA	11 ABBINGTON LANE, ROBBINSVILLE, NJ 08691,
5	ZHANG, CHONGWU	503 YARROW CIRCLE, DAYTON, NJ 08810,

PCT International Classification Number

CO7D 401/00

PCT International Application Number

PCT/US03/20509

PCT International Filing date

2004-01-08

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1	60/391,962	2002-06-28	U.S.A.
2	60/411,030	2002-09-17	U.S.A.
3	60/413,148	2002-09-25	U.S.A.
4	60/416,582	2002-10-08	U.S.A.