Title of Invention

THERAPEUTIC BINDING MOLECULES

Abstract

The present invention relates to a humanised antibody comprising (a) a first domain comprising in sequence the hypervariable regions CDRI, CDR2 and CDR3, said CDRI having the amino acid sequence Asn- Tyr-lIe-lle-His (NYIIH), said CDR2 having the amino acid sequence Tyr-Phe-Asn-Pro- Tyr-Asn-His-Gly- Thr-Lys- Tyr- Asn-Glu-Lys-Phe-Lys-Gly (YFNPYNHGTKYNEKFKG) and said CDR3 having the amino acid sequence Ser-Gly-Pro- Tyr-Ala- Trp-Phe-Asp- Thr (SGPY A WFDT); and (b) a second domain comprising in sequence the hypervariable regions CDRI', CDR2' and CDR3', CDRl' having the amino acid sequence Arg-Ala-Ser-Gln-Asn- lIe-Gly-Thr-Ser-lIe-Gln (RASQNIGTSIQ), CDR2' having the amino acid sequence Ser-Ser-Ser-Glu-Ser-lIe-Ser (SSSESIS) and CDR3' having the amino acid sequence Gln-Gln-Ser-Asn- Thr- Trp-Pro-Phe- Thr (QQSNTWPFT).

Full Text

Therapeutic binding molecules Field of the Invention The present invention relates to organic compounds, such as to binding molecules against CD45 antigen isoforms, such as for example monoclonal antibodies (mAbs). Backqround of the Invention One approach in the treatment of a variety of diseases is to achieve the elimination or the inactivation of pathogenic leukocytes and the potential for induction of tolerance to inactivate pathologlcal immune responses. Organ, cell and tissue transplant rejection and the various autoimmune diseases are thought to be primarily the result of T-cell mediated Immune response triggered by helper T-cells which are capable of recognizing specific antigens which are captured, processed and presented to the helper T cells by antigen presenting cell (APC) such as macrophages and dendritic cells, in the form of an antigen-MHC complex, Le. the helper T-cell when recognizing specific antigens is stimulated to produce cytokines such as IL-2 and to express or upregulate some cytokine receptors and other activation molecules and tQ prdiferate. Some of these activated helper T-cells may act directly or indirectly. I.e. assisting effector cytotoxk; T-cells or B cells, to destroy cells or tissues expressing the selected antigen. After the terminatk>n of the immune response some of the mature clonally selected cells remain as memory helper and memory cytotoxk: T-cells, with circulate In the body and rapidly recognize the antigen if appearing again. If the antigen triggering this response is an innocuous environmental antigen the result is allergy, if the antigen is not a foreign antigen, but a self antigen, it can result is autoimmune disease; if the antigen is an antigen from a transplanted organ, the result can be graft rejection. The immune system has developed to recognize self from non-self. This property enables an organism to survive in an environnnent exposed to the daily diallenges of pathogens. This specificity for non-self and tolerance towards self arises during the development of the T cell repertoire in the thymus through processes of positive and negative selection, which also comprise the recognition and elimination of autoreactive T cells. This type of tolerance Is referred to as central tolerance. However, some of these autoreactive cells escape this selective mechanism and pose a potential hazard for the development of autoimmune diseases. To control the autoreactive T cells that have escaped to the periphery, the immune system has peripheral reg ulatory mechanisms that provide protection against autoimmunity. These mechanisms are a basis for peripheral tolerance. Cell surface antigens recognized by specific mAbs are generally designated by a CD (Cluster of Differentiation) number assigned by successive International Leuicocyte Typing workshops and the temi CD45 applied herein refers to the cell surface leukocyte common antigen CD45; and an mAb to that antigen is designated herein as antl-CD45". The leukocyte common antigen (LCA) or CD45 is the major component of anti-tymphocyte globulin (ALG). CD45 belongs to the famity of transmembrane tyrosine phosphatases and is both a positive and negative regulator of cell activation, depending upon receptor interaction. The phosphatase activity of CD45 appears to t>e required for activation of Src-fam3y kinases associated with antigen receptor of B and T lymphocytes (Trowbridge IS et al. Annu Rev Immunol. 1994; 12:85-116). Jhus, in T cell activattion, CD45 is essential for signal 1 and CD45-deficicient cells have profound defects In TCR-mediated activation events. The CD45 antigen exists in different isoforms comprising a family of transmembrane glycoproteins. Distinct isofomis of CD45 differ in their extracellular domain stnicture which arise from attemative splicing of 3 variat)ie exons coding for part of the CD45 extracellular region (Streuli MF. et al, J. Exp. Med. 1987; 166:1548-1566). The various isofonns of CD45 have different extra-cellular domains, but have the same transmembrane and cytopiasmk: segments having two homok3gous, highly cor^erved phosphatase domains of approximate 300 reskiues. Different isofomn combinations are differentiany expressed on subpopulatfons of T and B lymphocytes (Thomas ML et al, Immunol. Today 1988; 9:320-325). Some monock)nal antilKxlies recognize an epitope common to ad the different isofonns, while other mAbs have a restricted (CD45R) speciTidty, dependent on whk:h subset of activated T cells, memory cells and cortical thymocytes and is not detected on B cells (Terry LA et al, Immunol. 1988; 64:331-336). Description of the Figures Figure 1 shows thatthe inhibition of primary MLR by the "candidate mAb" is dose-dependent in the range of 0.001 and 10 pg/mi. "Concentration" is concentration of the "candidate mAb". Figure 2 shows the plasmid map of the expression vector HCMV-G1 IHuAb-VI-IQ comprising the heavy chain having the nucleotide sequence SEQ ID N0:12 (3921-4274) in the complete expression vector nucleotide sequence SEQ ID N0:15. Figure 3 shows the plasmid map of the expression vector HCMV-G1 HuAb-VHE comprising the heavy chain having the nucleotide sequence SEQ ID N0:11 (3921-4274) in the complete expression vector nucleotide sequence SEQ ID NO: 16. ^Figure 4 shows the plasmid map of the expression vector HCMV-K HuAb-humVI comprising 'the light chain having the nucleotide sequence SEQ ID NO: 14 (3964-4284) in the complete expression vector nucleotide sequence SEQ ID NO: 17. Figure 5 shows the plasmid map of the expression vector HCMV-K HuAt>*humV2 comprising the light chain having the nucleotide sequence SEQ ID N0:13 (3926-4246) in the complete expression vector nucleotide sequer>ce SEQ ID N0:18. Description of the Invention We have now found a binding molecule which comprises a polypeptide sequence which binds to CD45RO and CD45RB. hereinafter also designated as a "CD45R0/RB binding molecule'. These binding molecule according to the invention may induce immunosuppression, inhibit primary T cell responses and induce T cell tolerance. Furthermore, the binding molecules of the invention inhibit primary mbced lymphocyte responses (MLR). Cells derived from cultures treated with CD45RO/RB binding molecules prefen^dty also have impaired proliferative responses in secondary MLR even in the absence of CD45RO/RB binding molecules in the secondary MLR. Such impaired proliferative responses in secondary MLR are an indication of the ability of binding molecules of the invention to induce tolerance. Additbnaiiy, In vivo administration of CD45RO/RB binding molecule to severe combined immunodeficiency (SCID) mice undergoing xeno-GVHD following Injection with human PBMC may prolong mice survival, compared to control treated mice, even though circulating human T cells may still be detected in CD45RO/RB binding molecule treated mice. By "CD45RO/RB binding molecule" is meant any molecule capable of binding specifically to the CD45RB and CD45RO isoforms of the CD45 antigen, either alone or associated with other molecules. Jhe binding reaction may the shown by standard rr>ethods (qualitafive assay) including for example any kind of binding assay such as direct or indirect immunofluorescence together with fluorescence microscopy or cytofluorimetric (FACS) analysis, enzyme-linked immunosorbent assay (ELISA)or radtoimmunoassay in which binding of tAe molecule to cells expressing a particular CD45 isoform can be visualized. In additton. the binding of this molecule may result in the alteration of the furrction of the cells expressing these isoforms. For example inhibition of primary or secondary mixed lymphocyte response (MLR) may t>e determined, such as an in vitro assay or a bioassay for detenmining the inhibition of primary or secondary MLR in the presence and in the absence of a CD45RO/RB binding molecule and determining the differences in primary MLR inhibitk>n. Altematively, the in vitro functtonal oKxiulatory effects can also be determined by measuring the PBMC or T cells or CD4* T cells proliferation, production of cytokines, change In the expression of cell surface molecules e.g. following cell activation in MLR, or following stimulatton with specifk: antigen such as tetanus toxoid or other antigens, or with polyclonal stimulators such as phytohemagglutinin (PHA) or anti-C03 and anti-CD28 antitTodies or phorbol esters and ca2 ionophores. The cultures are set up in a similar manner as described for MLR except that instead of allogenek; cells as stimulators soluble antigen or polyclonal stimulators such as those mentioned above are used. T cell proliferatton is measured preferably as described above by -thymkline incorporation. Cytokine production is measured preferably by sandwk:h ELISA where a cytokine capture antibody is coated on the surface of a 96-well plate, the supematants from the cultures are added and incubated for 1 hr at room temperature and a detecting antibody specific for the particular cytokine is then added, following a second-step antibody conjugated to an enzyme such as Horseradish peroxidase followed by the corresponding substrate and the absortbance is measured in a plate reader. The change in cell surface molecules may be preferably measured by direct or indirect immunofluorescence after staining the target cells with antibodies spetific for a partk;ular cell surface molecule. The antibody can be either directly labeled with flourochrome or a fluorescently labeled second step antibody specific for the first antibody can be used, and the cells are analysed with a cytofluorimeter. The binding molecule of the invention has a binding specificity for both CD45RO and CD45RB rCD45RB/RO binding molecule"). Preferably the binding molecule binds to CD45RO isoforms with a dissociation constant (Kd) 4; .■ ■ ■■ - In a further preferred embodiment the binding molecule of the invention binds those CD45 isoforms which 1) include the A and B epitopes but not the C epitope of the CD45 molecule; and/or 2) include the B epitope but not the A and not the C epitope of the CD45 molecule; and/or 3) isofonms which do not include any of the A, B or C epitopes of the CD45 molecule. In yet a further preferred emtxxliment the binding molecule of the invention does not bind CD45 isoforms which iridude 1) all of the the A, B and C epitopes of the CD45 molecule; and/or 2) tx>th the B and C epitopes but not the A epitope of the CD45 molecule. In further preferred embodiments the binding molecule of the invention further 1) recognises memory and In vivo alloactivated T cells; and/or 2) binds to its target on human T cells, such as for example PEER cells; wherein said binding preferably is with a Kd 3) inhibits in vitro alloreactive T cell function, preferably with an IC50 of about 5nM, more preferably with an IC50 of about InM, most preferably with an IC50 of about 0,5nM or even 0,1 nM; and/or 4) induces alloantigerv-specific T cell tolerance in vitro; and/or 5) prevents lethal xenogeneic graft versus host disease (GVHD inaucea in SCID mice oy injection of human PBMC when admistiered in an effective amount. In a further preferred embodiment the binding molecule of the invention binds to the same epitope as the monoclonal antibody "A6" as described by Aversa et al., Cellular Immunology 158,314-328(1994). Due to the above-described binding properties and biological activities, such binding * "' - ■ molecules the the Invention are particularly useful in medicine, for therapy and/or prophylaxis. ■ ,*' '■ Diseases in which binding molecules of the invention are particulariy useful include autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease and allergies, as will be further set out t>elow. We have found that a molecule comprising a polypeptide of SEQ ID NO: 1 and a polypeptide of SEQ ID NO: 2 is a CD45RO/RB binding molecule. We also have found the hypen^ariabie regions CDRV, CDR2' and CDR3 in a CD45RO/RB binding molecule of SEQ ID N0:1, CDRV having the amino acid sequence Arg-AIa-Ser-Gln-Asn-lle-Gly-Thr-Ser-lle-GIn (RASQNIGTSIQ), CDR2* having the amino acid sequence Ser-Ser-Ser-Glu-Ser-lle-Ser (SSSESIS) and CDR3' having the amino add sequence Gln-Gln-Ser-Asn-Thr-Trp-Pro-Phe-Thr (QQSNTWPFT). We also have found the hypervariable regions CDR1, CDR2 and CDR3 in a CD45RO/RB binding molecule of SEQ ID N0:2, CDR1 having the amino add sequence Asn-Tyr-lle-lle-HIs (NYIIH), CDR2 having the amino add sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe -Lys-Gly (YFNPYNHGTKYNEKFKG) and CDR3 having the amino add sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phe-Asp-Thr (SGPYAWFDT). CDRs are 3 specific complementary determining regions which are also called hypen^ariable regions which essentially determine the antigen binding characteristics. These CDRs are part of the vdrlal)le region, e.g. of SEQ ID NO: 1 or SEQ ID NO: 2, respectively, wherein these CDRs altemate with frameworic regions (PR's) e.g. constant regions. A SEQ ID NO: 1 is part of a light chain, e.g. of SEQ ID NO: 3, and a SEQ 10 NO:2 is part of a heavy chain, e.g. of SEQ ID NO: 4, in a chimeric antibody according to the present invention. The CDRs of a heavy diain together with the CDRs of an associated light chain essentially constitute the antigen binding site of a molecule of the present invention. It is known that the contribution made by a light chain variable region to the energetics of binding is small compared to that made by the associated heavy chain variable region and that isolated heavy chain variable regions have an antigen binding activity on their own. Such molecules are commonly referred to as single domain antibodies. In one aspect the present invention provides a molecule comprising at least one antigen binding site, e.g. a CD45RO/RB binding molecule, comprising in sequence the hypervariable regions CRI, CDR2 and CDR3, said CDR1 having the amino acid sequence Asn-Tyr-ile-lle-His (NYIIH), said CDR2 having the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe -Lys-Gly (YFNPYNHGTKYNEKFKG) and said CDR3 having the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phe-Asp-Thr (SGPYAWFDT); e.g. and direct equivalents thereof. In another aspect the present invention provides a molecule comprising at least one antigen binding site, e.g. a CD45RO/RB binding molecule, comprising a) a first domain comprising in sequence the hypervariable regions CDR1, CDR2 and CDR3, said CDR1 having the amino acid sequence Asn-Tyr-ite-lle-His (NYIIH), said CDR2 having the amino add sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-GIu-Lys-Phe -Lys-Gly (YFNPYNHGTKYNEKFKG) and said CDR3 having the amino acW sequence Ser-Gly-Pro-Tyr-AIa-Trp-Phe-Asp-Thr (SGPYAWFDT); and b) a second domain comprising in sequence the hypervariable regions CORV, CDRZ* and CDR3'. CDRV having the amino acid sequence Arg-AIa-Ser-Gln-Asn-lle-Gly-Thr-Ser-lle-Gln (RASQNIGTSIQ), CDR2 having the amino acid sequence Ser-Ser-Ser-GhJ-Ser-lle-Ser (SSSESIS) and CDR3' having the amino acid sequence Gin-Gln-Ser-Asn-Thr-Trp-Pro-Phe-Thr (QQSNTWPFT). e.g. and direct equivalents thereof. In a prefen-ed embodiment the first domain comprising in sequence the hypervariable regions CDR1, CDR2 and CDR3 is an immunoglobulin heavy chain, and the second domain comprising in sequence the hypenvailable regions CORV, CDR2 and CDR3' is an immunoglobulin light chain. In another aspect the present invention provides a molecule, e.g. a CD45RO/RB binding molecule, comprising a polypeptide of SEQ ID NO: 1 and/or a polypeptide of SEQ ID NO: 2. preferably comprising in one domain a polypeptide of SEQ ID NO: 1 and in another domain a polypeptide of SEQ ID NO: 2, e.g. a chimeric monoclonal antibody, and in another aspect A molecule, e.g. a CD45RO/RB binding molecule, comprising a polypeptide of SEQ ID NO: 3 and/or a polyptide of SEQ ID NO: 4, preferably comprising in one domain a polypeptide of SEQ ID NO: 3 and in another domain a polypeptide of SEQ ID NO: 4, e.g. a chimeric monoclonal antibody. When the antigen binding site comprises both the first and second domains or a polypeptide of SEQ ID NO: 1 or SEQ ID N0:3, respectively, and a polypeptide of SEQ ID NO: 2 or of SEQ ID N0:4, respectiely, these may be located on the same polypeptide, or, preferably each domain may be on a different chain, e.g. the first domain being part of an heavy chain, e.g. immunoglobulin heavy chain, or fragment thereof and the second domain being part of a light chain, e.g. an immunoglobulin light chain or fragment thereof. We have further found that a CD45RO/RB binding molecule according to the present invention is a CD45RO/RB binding molecule In mammalian, e.g. human, body environment A CD45RO/RB binding molecule according to the present invention can thus be designated as a monoclonal antibody (mAb), wherein the binding activity is determined mainly by the CDR regions as described above, e.g. said CDR regions being associated with other molecules without binding specifity, such as framework, e.g. constant regions, which are substantially of human orig in. In another aspect the present invention provides a CD45RO/RB binding molecule which is not the monodond antibody 'A6' as described by Aversa et d.. Cellular Immunology 158, 314-328(1994). In another aspect the present invention provides a CD45RO/RB binding molecule according to the present invention which is a chimeric, a humanised or a fully human monoclonal antibody. Examples of a CD45RO/RB binding molecules Include chimeric or humanised antibodies e.g. derived from antibodies as produced by B-cells or hybridomas and or any fragment thereof, e.g. F(ab'}2 and Fab fragments, as well as single chain or single domain antibodies. A single chain antibody consists of the variable regions of antibody heavy and light chains covalently bound by a peptide linker, usually consisting of from 10 to 30 amino acids, preferably from 15 to 25 amino acids. Therefore, such a structure does not include the constant part of the heavy and light chains and it is believed that the small peptide spacer should be less antigenic than a whole constant part. By a chimeric antibody is meant an antibody in whic^tt)0 constant regions of heavy and light chains or both are of human origin While the variable domains of both heavy and light chains are of non-human (e.g. murine) origin. By a humanised antibody is meant an antibody in which the hypervariable regions (CDRs) are of non-human (e.g. murine) origin while all or substantially all the other part, e.g. the constant regions and the highly conserved parts of the variable regions are of human origins. A humanised antibody may however retain a few amino acids of the murine sequence in the parts of the variable regions adjacent to the hypervariable regions. Hypervariable regions, i.e. CDR's according to the present Invention may be associated with any kind of framework regions, e.g. constant parts of the light and heavy chains, of human origin. Suitable frameworic regions are e.g. described in "Sequences of proteins of immunological interest", Kabat, E.A. et al, US department of health and human services, Public health service, National Institute of health. Preferably the constant part of a human heavy chain may be of the IgGI type, including subtypes, preferably the constant part of a human light chain may be of the K or X type, more preferably of the K type. A preferred constant part of a heavy chain is a poiypeptkie of SEQ ID NO: 4 (without the CDR1', CDR2' and CDR3' sequence parts which are specified above and a preferred constant part of a light chain is a polypeptide of SEQ ID NO: 3 (without the CDR1, CDR2 and CDR3 sequence parts which are specified atx)ve). We also have found a humanised antit>ody comprising a light chain variable region of amino acid SEQ ID N0:7 or of amino acid SEQ ID N0:8, which comprises CDR1, CDR2' and CDR3' according to the present invention and a heavy chain variable region of SEQ:ID N0:9 or of SEQ:ID NO:10, which comprises CDR1, CDR2 and CDR3 according to the present invention. In another aspect the present invention provides a humanised antibody comprising a polypeptide of SEQ ID N0:9 or of SEQ ID NO:10 and a polypeptide of SEQ ID N0:7 or of SEQ ID N0:8. In another aspect the present invention provides a humanised antibody comprising - a polypeptide of SCQ fb N0:9 and a polypeptide of SEQ ID N0:7, - a polypeptide of SEQ ID N0:9 and a polypeptide of SEQ ID N0:8, - a polypeptide of SEQ ID NO: 10 and a polypeptide of SEQ ID N0:7, or - a polypeftide of SEQ ID NO:10 and a polypeptide of SEQ ID N0:8. A polypeptide according to the present invention, e.g. of a herein specified sequence, e.g. of CDR1, CDR2, CDR3, CDR1. CDR2', CDR3', or of a SEQ ID N0:1, SEQ ID N0:2, SEQ ID N0:3, SEQ ID NO:4, SEQ ID N0:7, SEQ ID NO:8, SEQ ID N0:9 or SEQ ID NO:10 includes direct equivalents of said (poly)peptide (sequence); e.g. including a functional derivative of said polypeptide. Said functional derivative may include covalent modifications of a specified sequence, and/or said functional derivative may include amino acid sequence variants of a specified sequence. 'Polypeptide*, If not otherwise specified herein, includes any peptide or protein comprising amino adds joined to each other by peptide bonds, having an amino acid sequence starting at the N-terminal extremity and ending at the C-terminal extremity. Preferably the polypeptide of the present invention is a monoclonal antibody, more preferred is a chimeric (V-grafted) or humanised (CDR-g rafted) monoclonal antibody. The humanised (CDR-grafted) monoclonal antibody may or may not include further mutations introduced into the framework (FR) sequences of the acceptor antibody. A functional derivative of a polypeptide as used herein includes a molecule having a qualitative biological activity in common with a polypeptide to the present invention, i.e. having the ability to bind to CD45RO and CD45RB. A functional derivative includes fragments and peptide analogs of a polpypeptide according to the present invention. Fragments comprise regions within the sequence of a polypeptide according to the present invention, e.g. of a specified sequence. The term "derivative" is used to define amino acid sequence variants, and covalent modifications of a polypeptide according to the present invention, e.g. of a specified sequence. The furictional derivatives of a polypeptide according to the present invention, e.g. of a specified sequence, preferably have at least about 65%, more preferably at least about 75%, even more preferably at least about 85%, most preferably at least about 95% overall sequence homology with the amino acid sequence of a polypeptide according to the present invention, e.g. of a specified sequence, and substantially retain the ability to bind to CD45RO and CD45RB. ■f:' The term covalent modification" includes modifications of a polypeptide according to the present invention, e.g. of a specified sequence; or a fragment thereof with an organic proteinaceous or non-proteinaceous derivatizing agent, fusions to heterologous polypeptide sequences, and post-translational modifications. Covalent modified polypeptides, e.g. of a specified sequence, still have the ability bind to CD45RO and CD45RB by crosslinking. Covalent modifications are traditionally introduced by reacting targeted amino acid residues with an organic derivatizing agent that is capable of reacting with selected sides or temninal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deaminated under mildly acidic conditions. Other post-translational modifications include hydroxylation of prolir^ and lysine, phosphorylation of hydroxy! groups of seryl, tyrosine or threonyl residues, methylation of the a-amino groups of lysine, arginine, and histidine side chains, see e.g. T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Frar>cisco, pp. 79-86 (1983). Covalent modifications e.g. include fusion proteins comprising a polypeptide according to the present invention, e.g. of a specified sequence and their amino acid sequence variants, such as immunoadhesirts, and N-terminal fusions to heterologous signal sequences. "Homology" with respect to a native polypeptide and its functional derivative is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues of a corresponding native polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and ru^t considering any conservative substitutions as part of the sequence identity. Neither N- or C-terminal extensions nor insertions shall be construed as reducing identity or homology. Methods and computer programs for the alignment are well known. "Amino acid(s)' refer to all naturally occurring L-a-amino acids, e.g. and including D-amino acids- The amino acids are identified by either the well known single-letter or three-letter designations. The term "amino acid sequence variant" refers to molecules with some differences in their amino acid sequences as compared to a polypeptide according to the present invention, e.g. of a specified sequence. Amino acid sequence variants of a polypeptide according to the present invention, e.g. of a specified sequence, still have the ability to bind to CD45RO and CD45RB. Substitutional variants are those that have at least one amino acid residue removed and a different amino acid inserted in its place at the same position in a polypeptide according to the present invention, e.g. of a specified sequence. These substitutions may t>e single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule. Insertional variants are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a polypeptide according to the present invention, e.g. of a specified sequence Immediately adjacent to an amino acid means connected to either the a-carboxy or a-amino functional group of the amino acid. Deletional variants are those with one or more amino acids in a polypeptide according to the present invention, e.g. of a specified sequence, removed. Ordinarily, deletional variants will have one or two amino acids deleted in a particular region of the molecule. We also have found the polynucleotide sequences of - GGCCAGTCAGAACATTGGCACAAGCATACAGTG. encoding the amino acid sequence of CDR1. - TTCTTCTGAGTCTATCTCTGG; encoding the amino acid sequence of CDR 2, . ACAAAGTAATACCTGGCCATTCACGTT encoding the amino acid sequence of CDR 3, - TTATATTATCCACTG, encoding the amino add sequence of CDR1. TTTTAATCGTTACAATCATGGTACTAAGTACAATGAGAAGTTCAAAGGCAG encoding the amino acid sequence of CDR2\ AGGACCCTATGCCTGGTTTGACACCTG encoding the amino acid sequence of CDR3- SEQ ID N0:5 encoding a polypeptide of SEQ ID NO: 1, i.e. the variable region of a Tight chain of an mAb according to the present invention; • SEQ ID N0:6 encoding a polypeptide of SEQ ID NO-.2, i.e. the variable region of the heavy chain of an mAb according to the present invention; - SEQ 10 NO:11 encoding a polypeptide of SEQ ID N0:9. i.e. a heavy chain variable region including CDR1, CDR2 and CDR3 according to the present invention; - SEQ ID N0:12 encoding a polypeptide of SEQ ID NO:10, i.e. a heavy chain variable region including CDR1, CDR2 and CDR3 according to the present invention; - SEQ ID N0:13 encoding a pdypeptide of SEQ ID NO:7, I.e. a light chain variable region including CDRV, CDR2' and CDR3' according to the present invention; and ' SEQ ID N0:14 encoding a polypeptide of SEQ ID N0:8, i.e. a light chain variable region including CDR1', CDR2' and CDR3' according to the present invention. In another aspect the present invention provides isolated pdynudeotides comprising polynucleotides encoding a CD45RO/RB binding molecule, e.g. encoding the amino acid sequence of CDR1, CDR2 and CDR3 according to the present invention and/or, preferably and, polynucletides encoding the amino acid sequence of CDR1', CDR2' and CDR3' according to the present invention; and Polynucleotides comprising a polynucleotide of SEQ ID NO: 5 and/or, preferatMy and, a polynucleotide of SEQ 10 NO: 6; and Polynucleotides comprising polynucleotides encoding a polypeptide of SEQ ID NO:7 or SEQ ID NO:8 and a polypeptide of SEQ ID NO:9 or SEQ ID NO: 10; e.g. encoding - a polypeptide of SEQ ID N0:7 and a polypeptide of SEQ 10 N0:9, - a polypeptide of SEQ ID N0:7 and a polypeptide of SEQ 10 NO: 10, - a polypeptide of SEQ ID N0:8 and a polypeptide of SEQ 10 NO:9, or - a polypeptide of SEQ ID NO:8 and a polypepfide of SEQ 10 NO:10; and Polynucleotides comprising a polynucleotide of SEQ ID N0:11 or of SEQ ID N0:12 and a polynucleotide of SEQ ID N0:13 or a polynudeotide of SEQ ID N0:14, preferably comprising - a polynucleotide of SEQ ID N0:11 and a polynucieotkie of SEQ ID NO: 13, - a potynudeotide of SEQ ID NO:11 and a polynucleotide of SEQ ID NO:14, - a polynudeotide of SEQ ID N0:12 and a polynudeotide of SEQ ID NO:13, or - a polynudeotide of SEQ ID N0:12 and a polynudeotide of SEQ ID NO:14. "Polynudeotide", if not othenvise specified herein, indudes any polyribonucleotide or polydeoxyribonudeotide, which may be unmodified RNA or DNA, or modified RNA or DNA, induding without limitation single and double stranded RNA, and RNA that is a mixture of single- and double stranded regions. A polynucleotide according to the present invention, e.g. a polynucleotide encoding the amino acid sequence CDR1, CDR2, CDR3, CDRV, CDR2', CDR3', or of SEQ ID N0:1, SEQ ID N0:2, SEQ ID N0:3, SEQ ID N0:4, SEQ ID N0:7, SEQ ID N0:8, SEQ ID N0:9 or SEQ ID NO:10, respectively, such as a polynucleotide of SEQ ID N0:5, SEQ ID N0:6, SEQ ID N0:11, SEQ ID NO:12, SEQ ID N0:13 or SEQ ID N0:14, respectively, includes allelic variants thereof arid/or their complements; e.g. Including a polynucleotide that hybridizes to the nucleotide sequence of SEQ ID NO: 5, SEQ ID N0:6, SEQ ID NO:11, SEQ ID NO:12, SEQ ID N0:13 or SEQ ID NO:14, respectively; e.g. encoding a polypeptide having at least 80% Identity to SEQ ID N0:1, SEQ ID N0:2, SEQ ID NO:3, SEQ ID N0:4, SEQ ID NO:7, SEQ ID N0:8, SEQ ID N0:9 or SEQ ID NO:10, respectively, e.g. including a functional derivative of said polypeptide, e.g. said functional derivative having at least 65% homology with SEQ ID N0:1, SEQ ID N0:2, SEQ ID N0:3, SEQ ID N0:4, SEQ ID N0:7. SEQ ID N0:8, SEQ ID N0:9 or SEQ ID NO:10, respectively, e.g. said functional derivative including covalent modifications of SEQ ID N0:1. SEQ ID N0:2, SEQ ID NO:3. SEQ ID N0:4, SEQ ID N0:7, SEQ ID N0:8, SEQ ID N0:9 or SEQ ID NO:10. respectively, e.g. said functional derivative including amino acid sequence variants of SEQ ID N0:1, SEQ ID N0:2, SEQ ID N0:3, SEQ ID NO:4. SEQ ID NO:7, SEQ ID N0:8, SEQ ID NO:9 or SEQ ID NO:10, respectively; e.g. a SEQ ID NO:5, SEQ ID N0:6, SEQ ID N0:11, SEQ ID N0:12, SEQ ID N0:13 or SEQ ID NO:14, respectively includes a sequence, which as a r^ult of the redundancy (degeneracy) of the genetic code, also encodes a polypeptide of SEQ ID N0:1, SEQ ID NO:2, SEQ ID N0:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID N0:8, SEQ ID N0:9 or SEQ ID NOrlO, respectively, or encodes a polypeptide with an amino acid sequence which has at least 80% identity with the amino acid sequence of SEQ ID NO:1, SEQ ID N0:2, SEQ ID NO:3. SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, respectively. A CD45RO/RB birKling molecule, e.g. which is a chimeric or humanised antilxxly, may be produced by recombinant DNA techniques. Thus, one or more DNA molecules encoding the CD45RO/RB may be constructed, placed under appropriate control sequences and transferred into a suitable host (organism) for expression by an appropriate vector. In another aspect the present invention provides a polynucleotide which encodes a single, heavy and/or a light chain of a CD45RO/RB binding molecule according to the present invention; and the use of a polynucleotide according to the present invention for the production of a CD45RO/RB binding molecule according to the present invention by recombinant means. A CD45RO/RB binding molecule may be o|>tained according, e.g. analogously, to a method as conventional together with the information provided herein, e.g. with the knowledge of the amino acid sequence of the hypervariable or variable regions and the polynucleotide sequences encoding these regions. A method for constructing a variable domain gene is e.g. described in EP 239 400 and may be briefly summarized as follows: A gene encoding a variable region of a mAb of whatever specificity may be doned. The DNA segments encoding the framework and hypervariable regions are determined and the DNA segments encoding the hypervariable regions are removed. Double stranded synttietk; CDR cassettes are prepared by DNA synthesis according to the CDR and CDR* sequences as specified herein. These cassettes are provided with sticky ends so that they can be Hgated at junctions of a desired framework of human origin. Polynucleotides encoding single chain antibodies may also t>e prepared accordirig to, e.g. analogously, to a method as conventional. A polynucleotide according to the present inventton thus prepared may be conveniently transferred into an appropriate expresston vector. Appropriate cell lines may be found according, e.g. analogously, to a method as conventional. Expression vectors, e.g. comprising suitable prorrK)tor(s) and genes encoding heavy and light chain constant parts are known e.g. and are commercially available. Appropriate hosts are known or may be found according, e.g. analogously, to a method as conventional and include cell culture or transgenk: animals. In another aspect the present invention provides an expression vector comprising a polynucleotide encoding a CD45RO/RB binding molecule according to the present invention, e.g. of sequence SEQ ID N0:15, SEQ ID NO:16,. SEQ ID N0:17 or SEQ ID N0:18. In another aspect the present invention provides - An expression system comprising a polynucleotide according to the present invention wherein said expression system or part thereof is capable of producing a CD45RO/RB binding molecule according to the present invention, when said expression system or part thereof is present in a compatible host cell; and - An isolated host cell which comprises an expression system as defined above. We have further found that a CD45RO/RB binding molecule according to the present invention inhibit primary alloimmune responses in a dose-dependent fashion as determined by in vitro MLR. The results indicate that the cells which had been alloactivated in the presence of a CD45RO/RB binding molecule according to the present invention are impaired in their responses to alloantigen. This confirms the indication that a CD45RO/RB binding molecule according to the present invention can act directly on the effector alloreactive T cells and modulate their function. In addition, the functional properties of T cells derived from the primary MLR were further studied in res timulation experiments in secondary MLR, using specific stimulator cells or third-party stimulators to assess the specificity of the obsen^ed functional effects. We have found that the cells derived from primary MLRs in which a CD45RO/RB binding molecule according to the present invention is present, were impaired in their ability to respond to subsequent optimal stimulation with specific stimulator cells, although there was no antibody added to the secondary cultures. The specificity of the inhibition was demonstrated by the ability of celts treated with a CD45RO/RB binding molecule according to the present invention to respond normally to stimulator cells from 'J - unrelated third-party donors. Restimulation experiments using T cells derived from primary MLR cultures thus indicate that the cells which had been alloactivated a Ct)45RO/RB binding molecule according to the present invention are hyporesponsive, i.e. tolet. to the original alloantigen. Furthermore we have found that cell proliferation in cells pre-treated with a CD45RO/RB binding molecule according to the present invention could t>e rescued by exogenous IL-2. This indicates that treatment of alloreactive T ceils with a CD45RO/RB binding molecule according to the present invention induces a state of tolerance. Irdeed, the reduced proliferative responses obsen/ed in cells treated with a CD45RO/RB binding molecule according to the present invention, was due to impairement of T cell function, and these cells were able to respond to exogenous IL-2, indicating that these cells are In an anergic, true unresponsive state. The specificity of this response was shown by the ability of cells treated with a C045RO/RB binding molecule according to the present invention to proliferate normally to unrelated donor cells to the level of the control treated cells. In addition experiments indicate that the binding of a CD45RO/RB binding molecule according to the present invention to CD45RO and CD45RB may inhibit the memory responses of peripheral blood mononuclear cells (PBMC) from Immunized donors to specific recall antigen. Binding of a CD45RO/RB binding molecule according to the present invention to CD45RO and CD45RB thus is also effective in inhibiting memory responses to soluble Ag. The ability of a CD45RO/RB binding molecule according to the present invention to inhibit recall responses to tetanus in PBMC from immunized donors indicate that the a CD45RO/RB binding molecule according to the present invention is able to target and modulate the activation of memory T cells. E.g. these data indicate that a C045RO/RB binding molecule according to the present invention in addition to recognizing alloreactive and activated T cells is able to modulate their function, resulting in induction of T ceil anergy. This property may be important in treatment of ongoing immune responses to autoantigens and allergens and possibly to alloantigens as seen in autoimmune diseases, allergy and chronic reJecHon, and diseases, such as psoriasis, Inflammatory bowel disease, where memory responses play a role in the maintenance of disease state. It is believed to be an Important feature in a disease situation, such as in autoimmune diseases in which memory responses to autoantigens may play a major role for the disease maintenance. We have also found that a C045RO/RB binding molecule according to the present invention may modulate T cell proliferative responses in a mixed lymphocyte response (MLR) in vivo, i.e. a CD45RO/RB binding molecule according to the present invention was found to have corresponding inhibitory properties in vivo testirtg. A CD45RO/RB binding molecule according to the present invention may thus have immunosuppressive and tolerogenic properties and may be useful for in vivo and ex-vivo tolerance irKluctlon to alloantigens, autoantigens, allergens and bacterial flora antigens, e.g. a CD45RO/RB binding moiecuie according to the present invention may be useful in the treatment and prophylaxis of diseases e.g. including autoimmune diseases, such as, tnit not limited to, rheumatoid arthritis, autoimmune thyroditis, Graves disease, type i and type II diabetes, multiple sclerosis, systemic lupus erytheniatosus, Sjogren syndrome, scleroderma, autoimmune gastritis, glomerulonephritis, transplant rejection, e.g. organ and tissue allograft and xenograft rejection, graft versus host disease (GVHD), and also psoriasis, inflammatory bowel disease and allergies. In another aspect the present Invention provides the use of a CD45RO/RB binding molecule according to the present invention as a pharmaceutical, e.g. in the treatment and prophylaxis of autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease and allergies. In another aspect the present invention provides a CD45RO/RB binding molecule according to the present invention for the production of a medicament in the treatment and prophylaxis of diseases associated with autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease and allergles. in another aspect the present invention provides a phamiaceutical composition comprising a CD45RO/RB binding molecule according to the present invention in association with at least one pharmaceuticaiiy acceptable canier or diluent. A pharmaceutical composition may comprise further, e.g. active, ingredients, e.g. other immunomodulatory antibodies such as, but not confined to anti-ICOS, anti-CD154, anti* CD134L or recombinant proteins such as, but not confined to rCTl-A-4 (CD152), rOX40 (CD134), or immunomodulatory com pounds such as, but not confined to cyclosporin A, FTY720, RAD, rapamycin, FK506, 15-deoxyspergualin, steroids. In another aspect the present invention provides a method of treatment arid/or prophylaxis of diseases associated with autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease and allergies comprising administering to a subject in need of such treatment and/or prophylaxis an effective amount of a CD45RQ/RB binding molecule according to the present invention, e.g. in the form of a pharmaceutical composition according to the present invention. Autoimune diseases to be treated with binding molecule of the present invention further include, but are not limited to, rheumatoid arthritis, autoimmune tiiyrodrtis, Graves disease, type I and type It diabetes, multiple sclerosis, systemic lupus erythematosus, Sjogren syndrome, scleroderma, autoimmune gastritis, glomerulonephritis; transplant rejection, e.g. organ and tissue allograft and xenograft rejection and graft-versus-host disease (GVHD). EXAMPLES The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention. In the following examples all temperatures are in degree Celsius. The "candidate mAb" or "chimeric antibody" is a CD45RO/RB binding molecule according to the present invention comprising light chain of SEQ ID N0:3 and heavy chain of SEQ ID NO:4. The following abbreviations are used: ELiSA enzyme linked immuno-sorbant assay FACS fluorescence activated cell sorting FITC fluorescein isothiocyanate PBS foetal bovine serum GVHD graft-vs-host disease HCMV human cytomegalovirus promoter IgE immunoglobulin isotype E IgG immunoglobulin Isotype G PBS phosphate-buffered saline PCR polymerase chain reaction xGVHD xerK>-graft-vs4x)St disease Example 1: Primary mixed lymphocyte response (MLR) Cells Blood samples are obtained from healthy human donors. Peripheral blood mononuclear cells (PBMC) are isolated by centrifugation over FicoB-Hypaque (Pharmacia LKB) from leukocytes from whole peripheral blood, leukopheresis or buffy coats with known blood type, but unknown HLA type. In some MLR experiments, PBMC are directly used as the stimulator ceils after the irradiation at 40 Gy. In the other experiments, T cells were depleted from PBMC by using CD2 orCD3 Dynabeads (Dynal, Oslo, Norway). Beads and contaminating cells are removed by magnetic field, T cell-depleted PBMC are used as simulator cells after the irradiatton. PBMC, CD3* T cells or CD4* T cells are used as the responder cells in MLR. Cells are prepared from different donors to stimulator cells. CD3* T cells are purified by negative selectfon using anti-CD16 mAb (Zymed, CA), goat anti-mouse IgG Dynabeads, anti-CD14 Dynabeads, CD19 Dynabeads. In additk>n anti-CD8 Dynat>eads are used to purify CD4^ T cells. The cells obtained are analyzed by FACScan or FACSCalibur (Becton Dickinson & Co,, CA) and the purity of the cells obtained was >75%. Cells are suspended ifi RPMI1640 medium, supplemented with 10 % heat*4nactivated FBS, penk^iUin, streptornycin and L-glutamine. Reagents The chimeric anti-CD45R0/RB mAb "candidate mAb" and an isotype matched control chimeric antibody is also generated. Mouse (Human) control igGi antibody specific for KLH (keyhole limpet hemocyanin) or recombinant human IL-10 is purchased from BD Pharmingen (San Diego, CA). Anti-human CD154 mAb 5c8 is according to Lederman et al 1992. Primary Mixed tymphocyte response (MLR) AHquots of 1 X105 PBMC or 5X10* of CDS* orCD4+ cells are mixed with 1 x 10* inadiated PBMC or 5 X104 T cetls*depleted irradiated (50 Gy) PBMC tn the each well of 96-well culture plates (Costar, Cambridge, MA) in the presence of the indicated mAb or absence of Ab. In some experiments, F(ab')2fragment of goat anti-mouse Ig or goat antt-human Ig specific for Fc portion (Jackson ImmunoResearch, West Grove, PA) is added at 10 pg/ml in addition to the candidate mAb To ensure optimal in vitro cross-linking of the target CD45 molecules. The mixed cells are cultured for 4 or 5 days at 37C in 5% CO2 and proliferation is detemiined by pulsing the cells with 3H-thymidine for the last 16-20 hours of culture. Other experiments are similar to those described above, but with the following exceptions: 1) Medium used is EX-VIVO (Bio-Whittaker) containing 10% FBS and 1% human plasma; 2) Anti-mouse total IgG (5 pg/ml) is used as secondary cross-linking step; 3) Inradiation of stimulator cells is 60 Gy. Primary MLR is perfonmed in the presence of the "candidate mAb" or control chimeric IgGi (10 g/ml) both with a second step reagent, F(ab')2 fragment of goat anti-human Ig specific for Fc portion (10 ^g/ml). Percentage inhibition by the "candidate mAb" is calculated in comparison with the cell proliferation in the presence of control IgG1 Results are shown in TABLE 1 below: A candidate mAb according to the present invention inhibits primary MLR as can be seen from TABLE 1. The average inhibitory effect fe 60.83 + 6.83 % in four different donors-derived CD4+ T celis and statistteally signifk:ant. The inhibitton of primary MLR by the "candkiate mAb" is shown to be dose-dependent in the range of 0.001 and 10 pg/mi of the "candidate mAb" as shown in Figure 1. The IC50 for the inhibition of primary MLR by a "candkiate mAb" is determined from the results of three separate MLR experiments using one donor PBMC as responder celis. Thus, responder CD4+ T cells from Donor #229 and #219 and irradiated PBMC depleted of T cells as stimulators are mixed in the presence of a "candkiate mAb" or control chimeric Ab with 10 pg/mi of F(ab')2 fragment of goat anti-human Ig. Experiments are repeated 3 times and percentage of proiferation in the presence of a "candkiate mAb' is calculated in comparison with the T cell proliferation in the presence of control Ab. IC50 value is determined using Origin (V. 6.0®). The cellular activity IC50 value is calculated to be 0.87 + 0.35 nM (0.13 + 0.052 pg/ml). Example 2: Secondary MLR In order to assess whether a "candidate mAb" induces unresponsiveness of CD4* T cells to specific alloantigens, secondary MLR is performed in the absence of any antibodies after the primary MLC. CD4* T cells are cultured with inadiated allogeneic stimulator cells (T cells-depleted PBMC) In the presence of the indicated antibody in 96-well culture plates for 10 days (primary MLC). Then, cells are collected, layered on a Ficoll-Hypaque gradient to remove dead cells, washed twice with RPMI, and restimulated with the same stimulator, 3"^ party stimulator cells or IL-2 (50 U/ml). The cells are cultured for 3 days and the proliferative response is detenmined by pulsing the cells with ^H-thymidine for the last 16-20 hours of culture. Specifically, CD4+ T cells are cultured with irradiated allogeneic stimulator cells (T cells-depleted PBMC taken from other donors) In the presence of 10 (ig/ml of the "candidate mAb", control IgGI chimeric Ab and F(ab')2fragment of goat anti-human Ig. Primary MLR proliferation is determined on day 5. For secondary MLR, the responderaruJ stimulator cells are cultured for 10 days in the presence of the "candidate mAb", then the cells are harvested, washed twice in RPMI1640 and restimulated with specific stimulator, third-party stimulators or IL-2 (50 U/mi) in the absence of any Ab. Cell prdifeFation is determir\ed on day 3. Results set out in TABLE 2: TABLE 2 Responder CCM-*- T cells Donor # % Inhibition of 2*^ MLR #211 49.90* #220 59.33* #227 58.68* * Significantly different from control value (p= in order to test whether the impaired proliferation is due to unresponsivess as a consequence of the treatment with a "candidate mAb", the cells derived from primary MLR are cultured in the presence of IL-2 (50 U/mi). Addition of IL-2 results in the rescue of proliferative responses of the T cells which had been treated with a "candidate mAb" in primary MLR, to levels similar to those observed in the presence of IgGi control Ab. These data indicate that the impaired secondary response in T cells treated with a candidate mAb** is due to to functional alteration of the responder T cells which become unresponsive to the specific stimulator cells. Percentage inhibition is calculated according to the following formula: c.p.m. with control Ab - c.p.m. with "candidate mAb x100 c.p.m. with control Ab Statistical analysis is performed using SigmaStat (Vers. 2.03). The data is analyzed by two-way ANOVA followed by Dunnett method. In all test procedures probabilities Example 3: In vivo survival studies in SCID-mice Engraftment of hu-PBL in SCID mice Human peripheral blood mononuclear cells (PBMC) are injected intraperitoneally into SCID > ■ ■ - ,_ mice C.B 17 /GbmsTac-Prictescid Lysi!*^ mice (Taconic, Germantown, NY) in an amount sufficient to induce a lethal xenogeneic grafl-versus-host disease (xGvHD) in >90% of the mice within 4 weeks after cell transfer. Such treated SCID mice are hereinafter designated as hu-PBL-SCID mice Mab-treatment of huPBLSCID mice Hu-PBL-SCID mice are treated with a "candidate mAb" or mouse or chimeric isotype matched mAb controls at day 0, immediately after PBMC injection, at day 3, day 7 and at weekly intervals thereafter. Mabs are delivered subcutaneously in 100 pi PBS at a final concentration of 5 mg/kg body weight The treatment was stopped wlien all control mrce were dead. Evaluation of treatment results The main criterion to assess the effteacy of a "candate mAb" in this study was the survival of the hu-PBL-SCID mice. The significance of the results is evaluated by the statistical method of surival analysis using the Log-rank test (Mantel method) with the help of the Systat v9.01 software. The method of survival analysis is a non-parametric test, which not only consider whether a particular mouse is still alive but also whether if A was sacrificed for reasons irrelevant to the treatment/disease such as the requirement of perfonm in vitro analysis with its organs/cells. Biopsies of liver, lung, kidney and spleen are obtained from dead mice for further evaluation. In addition, hu-PBL-SCID mice are weighed at the beginning (before cell transfer) and throughout (every two days) the experiment as an indirect estimation of their health status. Linear regression lines were generated using the body weight versus days post-PBMC transfer values obtained from each mouse and subsequently, their slopes (control versus anti-CD45 treated mice) were compared using the non-parametric Mann-Whitney test. Results All hu-PBL-SCID mk:e treated with mouse mAb controls had infiltrated human leukocytes in the lung, liver and spleen and died (4/4) within ca. 2 to 3 weeks after cell transfer. Death is a likely consequence of xGvHD. Control mAt>-treated mk:e furthermore lost weight in a linear manner, ca. 10% and moro within 3 weeks. All hu-PBL-SCID mice treated with a "candidate mMf survived (4/4) without any apparent sign of disease more than 4 weeks, even although "candidate mAb'-treatment was stopped after 3 weeks. "Candidate mAb*-treated mk:e increased weight in a linear manner, up to ca. 5% within 4 weeks. Example 4: Expression of antibodies of the invention Exoresskan of humanised antibody comorisinq a SEQ ID NO:7, SEQ ID NO:8, SEQ ID N0:9. orSEQIDNO:10 Expression vectors according to the piasmkl map shown in Figures 2 to 5 are constructed, comprising the corresponding nucleotides encoding the amino ackl sequence of humanised light chain variable regton humVI (SEQ ID N0:7), humanised light chain variable regk>n humV2 (SEQ ID N0:8), humanised heavy chain variatrie regton VHE (SEQ ID N0:9), or humanised heavy chain variat)le regton VHQ (SEQ ID NO:10), respectively. These expresston vectors have the DNA (nucleotkie) sequences SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17, or SEQ ID NO 18, respectively. BamHI restricted PCR fragment encoding the variable region into the Hindlll and BamHI sites of C21-HCMV gamma-1 expression vector which was created during constmction of the humanised anti-lgE antibody TESC-21 (Kolblnger et al 1993) and which was also originally received from M. Bendig (MRC Collaborative Centre, London, UK) (Maeda et al. 1991). Transient expression in COS cells The following transfection protocol is adapted for adherent COS cells in 150 mm cell culture dishes, using SuperFect™ Transfection Reagent (Cat. N*301305, Qiagen). The four different expression vectors described above are used for transient transfection of cells. For expression of humanised antibody, each of two clones containing heavy chain inserts (VHE VHQ, respectively) are co-transfected into cells with each of the two clones encoding for the light chains (humVI or humV2, respectively), In total 4 different combinations of heavy and light chain expression vectors (VHE/humVI, VHE/humV2, VHQ/humVI and VHQ/humV2). Before transfection, the plasmids are linearized with the restriction endonuclease Pvul which cleaves in the region encoding the resistance gene for ampidllin. The day before transfection, 4x10 COS cells in 30 ml of fresh culture medium are seeded in 150 mm cell culture dishes. Seeding at this cell density generally yielded 80% confluency after 24 hours. On the day of transfection, four different combinations of linearized heavy-and light-chain DNA expression vectors (15 pg each) are diluted In a total volume of 900 pi of fresh medium without secum and antibiotics. 180 pi of SuperFect Transfection Reagent is then mixed thoroughly with the DNA solution. The DNA mixture Is Incubated for 10 min at room temperature to allow complex formation. While complex formation takes place, the growth medium is removed from COS celt cultures, and cells are washed once with PBS. 9 ml of fresh culture medium (containing 10% FBS and antibiotics) are then added to each reaction tube containing the transfection complexes and well mixed. The final preparation is immediately transferred to each of 4 cultures to be transfected and gently mixed. Cell cultures are then Incubated with the DNA complexes for 3 hours at 37C and 5% C02. After incubation, the medium containing transfection complexes is removed and replaced with 30 ml of fresh culture medium. At 48 hr post transfection, the culture supematants are han^ested. Concentration of culture supematants For ELISA and FACS analysis, the culture supematants collected from cos cells transfected with heavy- and light- chain plasmids are concentrated as follows. 10 ml of each supernatant are added to Centriprep YM-50 Centrifugal Filter Devices (Cat. N* 4310, Millipore) as described by the manufacturer. The Centriprep filters are centrifuged for 10 min at 3000 rpm at room temperature. The centrifugation step is then repeated again with the remaining 20 ml of supernatant using only 5 min of centrifugation and supervising the concentration evolution. The intermediate 500 pi of concentrated supernatant is recovered, transferred to new Microcon Centrifugal Filter Devices (Cat. N* 42412, Microcon) and further concentrated following the manufacturer's protocol. The concentrated supematants are centrifuged four times for 24 min at 3000 rpm at room tenftperature, one time for 10 min at 6000 rpm and then, three times f(y 5 min, always supervising the concentration evolution. The final volume of concentrated conditioned medium achieved is 100-120 pi corresponding to a 250 to 300-fold concentration of original culture medium and is stored at 4C until use. For comparison and control, culture medium from untransfected cells is similariy concentrated, using the same centrifugation protocol described above. Example 5; Determination of recombinant human IgG expression by ELISA To determine IgG concentrations of recombinant human antibody expressed in the culture supematants, a sandwich ELISA protocol has t)een developed and optimized using human IgG as standard. Rat bottom 96-well microtiter plates (Cat N* 4-39454, Nunc Immunoplate Maxisorp) are coated overnight at 4C with 100 pi of goat anti-human IgG (whole molecule. Cat N** 11011, SIGMA) at the final concentration of 0.5 pg/ml in PBS. Weils are then washed 3 times with washing buffer (PBS containing 0.05% Tvi^een 20) and bloclced for 1.5 hours at 37C with blocking buffer (0.5% BSA in PBS). After 3 washing cycles, the antibody samples and the standard human IgG (CatNo. 14506, SIGMA) are prepared by serial 1.5-fold dilution in blocking buffer. 100 pi of diluted samples or standard are transfered in duplicate to the coated plate and incubated for 1 hour at room temperature. After incubatton, the plates are washed 3 times with washing buffer and subsequently incubated for 1 hour v^th 100 pi of horseradish peroxidase-conjugated goat anti-human IgG kappa-light chain (Cat. N* A-7164, SIGMA) diluted at 1/4000 in bk)cking buffer. Control wells received 100 pi of bkx^ing buffer or concentrated nonnal culture medium. After washing, the cok>rimetric quantificatk>n of bound peroxidase in the sample and standard wells is performed, using a TMB Peroxklase EIA Substrate Kit (Cat. N* 172-1067, Bk>-Rad) according to the manufacturer's instructions. The peroxidase mixture is added at 100 pl per well and incubated for 30 min at room temperature in the dark. The colorimetric reaction Is stopped by addition of 100 pi of 1 M sulfuric acid and the absorbance in each well is read at 450 nm, using an ELISA plate reader (Model 3350-UV, BioRad). With a con-elation coefficient of 0.998 for the IgG standard cun/e. the following concentrations are determined for the four different culture concentrates (ca, 250-300 fold concentrated): VHE/humVI supernatant = 8.26 pg/ml VHE/humV2 supernatant = 6.27 pg/ml VHQ/humV1 supernatant = 5.3 pg/ml VHQ/humV2 supernatant = 5.56 pg/ml Example 6; FACS competition analysis (binding affinity) The human T-ceil line PEER is chosen as the target cell for FACS analysis because it expressed the CD45 antigen on its cell surface. To analyze the binding affinity of humanised antibody supematants, competition experiments using FITC-iat>eled chimeric antitxxiy as a reference are performed and compared with the inhibition of purified mouse dntibody and of chimeric antibody. PEER cell cultures are centrifuged for 10 seconds at 3000 rpm and the medium is removed. Cells are resuspended in FACS buffer (PBS containing 1% FBS and 0.1% sodium azide) and seeded into 96-weil round-bottom microtitter plate at a cell density of 1x10' ceils per well. The plate is centrifuged and the supernatant is discarded. For blocking studies, 25 pi of concentrated untransfected medium or isotype matched control antibody (negative controls), unlabeled mouse antibody or chimeric antibody (positive controls) as well as concentrated supernatant containing the various combinations of humanised antibody (samples), is first added in each well at the indicated concentrations in the text. After 1 hour of incubation at 4*C, PEER cells are washed with 200 pi of FACS buffer by centrifugation. Cells are subsequently incubated for 1 hour at 4C with chimeric antibody conjugated with FITC in 25 pi of FACS buffer at the final concentration of 20 pg/ml. Cells are washed and resuspended in 300 pi of FACS buffer ODntaining 2 pg/ml propidium iodide which allows gating of viable ceils. The cell preparations are analyzed on a flow cytometer (FACSCalibur, Becton Dickinson). FACS analysis indicates a dose-dependent blockade of fluorochrome-labeled chimeric antibody by the concentrated humanised antibody culture supematants. No dose-dependent blockade of chimeric antibody binding is seen with the isotype matched control antibody, indicating that the blocking effect by the different humanised antibody combinations is epitope specific and that epitope specificity appears to be retained after the humanisation process. Example 7: Biological activities of CD45RB/RO binding molecules In this study, we have addressed whether CD45RB/RQ binding chimeric antibody, when present in cultures of polycionally activated primary human T cells (i) supports the differentiation of T cells with a characteristic: Treg phenotype, (ii) prevents or enhances apptosis following T cell activation, and (iii) affects expression of subset-specific antigens and receptors after restimulation. CD45RB/RO binding chimeric antibody enhances cell death in polycionally activated T cells Primary T cells (mbrture of CD4+ and CD8+ T subsets) were subjected to activation by anti-CD3 plus anti-CD28 mAb (200 ng/mj each in the presence or absence (=control) of C045RB/RO binding chimeric antitxxly. Excess antibodies were removed by washing on day 2, 7-amino-actlnomycln 0 (7-AAD) as a DMA-staining dye taken up by apoptotk: and necrotic cells was used to measure cell death following activation. The results show that activation of T cells in the presence of CD45RB/RO binding chimeric antibody increased the fraction of 7-AAD posith^e cells than two-fold on day 2 after activation.. On day 7, the portion of 7-AAD positive cells was again similar in CD45RB/RO binding chimeric antibody-treated and contrc^ cultures. CD45RB/RO binding chimeric antilbody but not control mAb treated T cells display a T regulatory cell (Treg) phenotype Increased expression of CD25 and the negative regulatory protein CTLA-4 (CD152) is a maricer of Treg cells* Functional suppression of primary and secondary T cell responses by CD45RB/RO binding chimeric antibody may be due to the induction of Treg cells. To address this issue, T cells were activated by anti-CD3 -^ CD28 nrtAbs and cultured in the presence of CD45RB/RO binding chimeric antibody or antl-LPS control mAb. The time course of CTLA-4 and CD25 expression reveals marked differences between controls and CD45RB/RO binding chimeric antibody-treated T cells on days 1 and 3 after secondary stimulation. Intracellular CTLA-4 expression is sustained in the presence of C045RB/RO binding chimeric antibody It has been reported that substantial amounts of CTLA-4 can also be found intracellularly. Therefore, in parallel to surface CTLA-4 staining, intracellular CTLA-4 expression was analyzed. Moderate differences between T cell cultures were seen on day 4 after stimulation. After prolonged culture, however, high levels of intri:ellular CTLA-4 were sustained only in CD45RB/RO binding chimeric antibody*treiied but not In control T cells. [5RB/RO binding chimeric antibody -treated T cells become double positive for CD4 and CD8 Following stimulation, T cells induce and upregulate the expression of several surface receptors, such as CD25, CD152 (CTLA-4), CD154 (CD40-Ligand) and others. In contrast, the level of expression of C04 or CDS is thought to stay relatively constant. We reproducibly observed a strong increase of both CD4 and CDS antigens on CD45RB/RO binding chimeric antitibody-treated but not on control AB4riated T ceils after activation. The emergence of a CD4/CD8 double-positive T cell population seems to be due to the upregufaHon of CD4 on the CD8- subset and conversely, CDS on the CD4+ subset This contrasts with a moderately low percentage of double positive T cells in control cultures. High IL-2 receptor alpha-chain, but very low beta-chain expression by CD45RB/RO binding chimeric antibody-treated T cells Treg cells are known to be constitutivety positive for CD25, the IL-2 receptor alpha-chain. The regulation of other subunits of the trimeric IL-2 receptor on Treg cells is not i^nown. Recently we have compared tfie expression of the beta-chain of iL-2 receptor, e.g. CD122, on T cells activated and propagated in the presence or absence of CD45RB/RO binding chimeric antibody. The results show that CI345RB/RO binding chimeric antibody-treated T cells have about ten-fold lower CD122 expression as compared to T cells in control cultures. This difference may indicate that Treg ceils require factors other than IL-2 to proliferate. GACATTCTGCTGACCCAGTCTCCAGCCATCCTGTCTGTGAGTCCAGGAGAAAGAGTCA GTTTCTCCTGCAGGGCCAGTCAGAACATTGGCACAAGCATACAGTGGTATCAACAAAGA ACAAATGGTTCTCCAAGGCTTCTCATAAGGTCTTCTTCTGAGTCTATCTCTGGGATCCCT TCCAGGTTTAGTGGCAGTGGATCAGGGACAGATTTTACTCTTAGCATCAACAGTGTGGA GTCTGAAGATATTGCAGATTATTAGTGTCAACAAAGTAATACCTGGCCATTCACGTTCGG CTCGGGGACCAAGGTTGAAATCAAA SEQ»DN0:6' Nucleotide sequence encoding a polypeptide of SEQ ID N0:2 GAGGTGCAGCTGCAGCAGTCAGGACCTGAACTGGTAAAGCCTGGGGCTTCAGTGAAG ATGTCCTGCAAGGCCTCTGGATACACATTCACTAATTATATTATCCACTGGGTGAAGCA GGAGCCTGGTCAGGGCCTTGAATGGATTGGATATTTTAATCCTTACAATCATGGTACTA AGTACAATGAGAAGTTCAAAGGCAGGGCCACACTAACTGCAGACAAATCCTCCAACACA GCCTACATGGACCTCAGCAGCGTGACCTCTGAGGACTCTGCGATCTACTACTGTGCAA GATCAGGACCCTATGCCTGGTTTGACACCTGGGGCCAAGGGACCACGGTCACCGTCTC GTCA SEQ ID NO:7 Part of amino acid sequence of iiumanised light chain designated humV2 (humV2 = VLm) DILLTQSPAT LSLSPGERAT FSCRASQNIG TStQWYQQia NGAPRLLIRS SSESISGIPS RFSGSGSGTD FTLTISSI^P EDFAVYYCQQ SNTWPFTFGQ GTKLEIK SEQ ID NO:8 Part of amino acid sequence of humanised light chain designated humVI (humVI - VLh) DILLTQSPAT LSLSPGERAT LSGRASQNiG TSIQWYQQKP GQAPRLLIRS SSESISGIPS RFSGSGSGTD FTLTISSLEP EDFAVYYCQQ SNTWPFTFGQ GTKLEIK SEQ ID NO;9 Part of amino acid sequence of humanised heavy chain designated VIHE EVQLVESGAE VKKPGASVICV SCKASGYTFT NYIIHWVKQE PGQGLEWIGY FNPYNHGTKY NEKFKGRATL TANKSISTAY lylELSSLRSED TAVYYCARSG PYAWFDTWGQ GTTVTVSS SEQ ID NO:10 Part of amino acid sequence of humanised heavy chain designated VHQ QVQLVESGAE VKKPGASVKV SCKASGYTR NYHHWVKQE PGQGLEWIGY FNPYNHGTKY NEKFKGRATL TANKSISTAY MELSSLRSED TANATCARSG PYAWFDTWGQ GTTVTVSS SEQ1DN0:11 Nucleotide sequence encoding amirto acid sequence SEQ ID NO:9 GAGGT6CAGCTGGTGGAGTCAGGAGCCGAAGTGAAAAAGCCTGGGGCTTCAGTGAAG GTGTCCTGCAAGGCCTCTGGATACACATTCACTAATTATATTATCCACTGGGTGAAGCA GGAGCCTGGTCAGGGCCTTGAATGGAtTGGATATTTTAATCCTTACAATCATGGTACTA AGTACAATGAGAAGTTCAAAGGCAGGGCCACACTAACTGCAAACAAATCCATCAGCACA GCCTACATGGAGCTCAGCAGCCTGCGCTCTGAGGACACTGCGGTCTACTACTGTGCAA GATCAGGACCCTATGCCTGGTTTGACACCTGGGGCCAAGGGACCACGGTCACCGTCTC CTCA SEQIDN0:12 Nucleotide sequence encoding amino acid sequence SEQ ID NO:10 CAGGTGCAGCTGGTGGAGTCAGGAGCCGAAGTGAAAAAGCCTGGGGCTTCAGTGAAG GTGTCCTGCAAG6CCTCTGGATACACATTCACTAATTATATTATCCACTGGGTGAAGCA GGAGCCTGGTCAGGGCCTTGAATGGATTGGATATTTTAATCCTTACAATCAT6GTACTA AGTACAATGAGAAGTTCAAAGGCAGGGCCACACTAACTGCAAACAAATCCATCAGGACA GCCTACATGGAGCTCAGCA6CCTGCGCTCTGAGGACACTGCGGTCTACTACTGTGCAA GATCAGGACCCTATGCCTGGTTTGACACCTGGGGCCAAGGGACCACGGTCACCGTCTC CTCA SEQ ID NO:13 Nucleotide sequence encoding amino acid sequence SEQ ID N0:7 GACATTCTGACCCAGTCTCCAGCCACCCTGrCTCTGAGTCCAGGAGAAAGAGCCA GTTTCTCCTGCAGGGCCAGTCAGAACATTGGCACAAGCATACAGTGGTATCAACAAAAA ACAAATGGTGCTCCAAGGCTTCTCATAAGGTCTTCTTCTGAGTCTATCTCTGGGATCCC TTCCAGGTTTAGTGGCAGTGGATCAGG GACAGATTTTACTCTTACCATCAGCAGT CTGG AGCCTGAAGATTTTGCAGTGTATTACTGTCAACAAAGTAATACCTGGCCATTCACGTTC GGCCAGGGGACCAAGCTGGAGATCAAA SEQ ID N0;14 Nucleotide sequence encoding amino acid sequence SEQ ID NO:8 GACATTCTGCTGACCCAGTCTCCAGCCACCCTGTCTCTGAGTCCAGGAGAAAGAGCCA CTCTCTCCTGCAGGGCCAGTCAGAACATTGGCACAAGCATACAGTGGTATCAACAAAAA CCAGGTCAGGCTCCAAGGCTTCTCATAAG6TCTTCTTCTGAGTCTATCTCTGGGATCCC TTCCAGGTTTAGTGGCAGTGGATCA6GGACAGATTTTACTCTTACCATCAGCAGTCTGG AGCCTGAAGATTTTGCAGTGTATTACTGTCAACAAAGTAATACCTGGCCAtTCACGTTC GGCCAGGGGACCAAGCTGGAGATCAAA SEQIDNO:15 Nucleotide sequence of the expression vector HCMV-G1 HuAb-VHQ (Complete DNA Sequence of a humanised heavy chain expression vector comprising SEQ ID NO:12 (VHQ) from 3921-4274) 1 AGCTTTTTGC AAAAGCCTAG GCCTCCAAAA AAGCCTCCTC AGTACTTCTG 51 GAATAGCTCA GAGGCCX3AGG CGGCCTCGGC CTCTGCATAA ATAAAAAAAA 101 TTAGTCAGCC ATGGGGCGGA GAATGGGCGG AACTGGGCGG AGTTAGGGGC 151 GGGATGGGCG GAGTTAGGGG CX3GGACTATG GTTGCTGACT AATTGAGATG 201 CATGCTTTGC ATACTTCTGC CTGCTGGGGA GCCTGGTTGC TGACTAATTG 251 AGATGCATGC TTTGCATACT TCTGCCTGCT GGGGAGCCTG GGGACTTTCC 301 ACACCCTAAC TGACACACAT TCCACAGCTG CCTCGCGCGT TTCGGTGATG 351 ACGGTGAAAA CCTCTGACAC ATGCAGCTCC CGGAGACX3GT CACAGCTTGT 2051 TGCATAATTC TCTTACTGTC ATGCCATCCG TAAGATGCTT TTCTGTGACT 2101 GGTGAGTACT CAACCAAGTC ATTCTGAGAA TAGTGTATGC GGCGACCGAG 2151 TTGCTCTTGC CCGGCGTCAA CACGGGATAA TACCGCGCCA CATAGCAGAA 2201 CTTTAAAAGT GCTCATCATT GGAAAACGTT CTTCGGGGCG AAAACTCTCA 2251 AGGATCTTAC CGCTGTTGAG ATCCAGTTCG ATGTAACCCA CTCGTGCACC 2301 CAACTGATCT TCAGCATCTT TTACTTTCAC CAGCGTTTCT GGGTGAGCAA 2351 AAACAGGAAG GCAAAATGCC GCAAAAAAGG GAATAAGGGC GACACGGAAA 2401 TGTTGAATAC TCATACTCTT CCTTTTTCAA TATTATTGAA GCATTTATCA 2451 GGGTTATTGT CTCATGAGCG GATACATATT TGAATGTATT TAGAAAAATA 2501 AACAAATAGG GGTTCCGCGC ACATTTCCCC GAAAAGTGCC ACCtGACGTC 2551 TAAGAAACCA TTATTATCAT GACATTAACC TATAAAAATA GGCGTATCAC 2601 GAGGCCCTTT CGTCTTCAAG AATTCAGCTT GGCTGCAGTG AATAATAAAA 2651 TGTGTGTTTG TCCGAAATAC GCGTTTTGAG ATTTCTGTCG CCGACTAAAT 2701 TCATGTCGCG CGATAGTGGT GTTTATCGCC 6ATAGAGATG GCGATATTGG 2751 AAAAATCGAT ATTTGAAAAT ATGGCATATT GAAAATGTCG CCGATGTGAG 2801 TTTCTGTGTA ACTGATATC6 CCATTTTTCC AAAAGTGATT TTTGGGCATA 2851 CGCGATATCT GGCGATAGCG CTTATATCGT TTACGGGGGA TGGCGATAGA 2901 CGACTTTGGT GACTTGGGCG ATrC*STGTG TCGCAAATAT CGCAGTTTCG 2951 ATATAGGTGA CAGACGATAT GAGGCTATAT CGCCGATAGA GGCGACATCA 3001 AGCTGGCACA TGGCCAATGC ATAXCGATCT ATACATTGAA TCAATATTGG 3051 CCATTAGCCA TATTATTCAT TGGTTATATA GCATAAATCA ATATTGGCTA 3101 TTGGCCATTG CATACGTTGT ATCCATATCA TAATATGTAC ATTTATATTG 3151 GCTCATGTCC AACATTACCG CCATGTTGAC ATTGATTATT GACTAGTTAT 3201 TAATAGTAAT CAATTACGGG GTCATTAGTT CATAGCCCAT ATATGGAGTT 3251 CCGCGTTACA TAACTTACGG TAAATGGCCC GCCTGGCTGA CCGCCCAACG 3301 ACCCCCGCCC ATIGACGTCA ATAATGACGT ATGTTCCCAT AGTAACGCCA 3351 ATAGGGACTT TCCATTGACG TCAATGGGTG GAGTATTTAC GGTAAACTGC 3401 CCACTTGGCA GTACATCAAG TGTATCATAT GCCAAGTACG CCCCCTATTG 3451 ACGTCAATGA CGGTAAATGG CCCGCCTGGC ATTATGCCCA GTACATGACC 3501 TTATGGGACT TTCCTACTTG GCAGTACATC TACGTATTAG TCATCGCTAT 3551 TACCATGGTG AT6CGGTTTT GGCAGTACAT CAATGGGCGT GGATAGCGGT 3601 TTGACTCACG GGGATITCCA AGTCTCCACC CCATTGACGT CAATGGGAGT 3651 TTGTTTTGGC ACCAAAATCA ACGGGACTTT CCAAAATGTC GTAACAACTC 3701 CGCCCCATTG ACGCAAATGG GCGGTAGGCG TGTACGGTGG GAGGTCTATA 3751 TAAGCAGAGC TCGTTTAGTG AACCGTCAGA TCGCCTGGAG ACGCCATCCA 3801 CGCTGTTTTG ACCTCCATAG AAGACACCGG GACCGATCCA GCCTCCGCAA 3851 GCTTGCCGCC ACCATGGACT GGACCTGGAG GGTGTTCTGC CTGCTGGCCG 3901 TGGCCCCCGG CGCCCACAGC CAGGTGCAGC TGGTGGAGTC AGGAGCCGAA I 3951 GTGAAAAAGC CTGGGGCTTC AGTGAAGGTG TCCTGCAAGG CCTCTGGATA 4001 CACATTCACT AATTATATTA TCCACTGGGT GAAGCAGGAG CCTGGTCAGG 4051 GCCTTGAATG GATTGGATAT TTTAATCCTT ACAATCATGG TACTAAGTAC 4101 AATGAGAAGT TCAAAGGCAG GGCCACACTA ACTGCAAACA AATCCATCAG 4151 CACAGCCTAC ATGGAGCTCA GCAGCCTGCG CTCTGAGGAC ACTGCGGTCT 4201 ACTACTGTGC AA6ATCAGGA CCCTATGCCT GGTTTGACAC CTGGGGCCAA 4251 GGGACCACGG TCACCGTCTC CTCAGGTGAG TTCTAGAAGG ATCCCAAGCT 4301 AGCTTTCTGG GGCAGGCCJiG GCCTGACCTT GGCTTTGGGG CAGGGAGGGG 4351 GCTAAGGTGA GGCAGGTGGC GCCAGCCAGG TGCACACCCA ATGCCCATGA 4401 GCCCAGACAC TGGACGCTGA ACCTCGCGGA CAGTTAAGAA CCCAGGGGCC 4451 TCTGCGCCCT GGGCCCAGCT CTGTCCCACA CC6CGGTCAC ATGGCACCAC 4501 CTCTCTTGCA GCCTCCACCA AGGGCCCATC GGTCTTCCCC CTGGCACCCT 4551 CCTCCAAGAG CACGTCTGGG GGCACAGCGG CCCTGGGCTG CCTGGTCAAG 4601 GACTACTTCC CCGAACCGGT GACGGTGTCG TGGAACTCAG GCGCCCTGAC 4651 CAGCGGCGTG CACACCTTCC CGGCTGTCCT ACAGTCCTCA GGACTCTACT 4701 CCCTCAGCAG CGTGGTGACC GTGCCCTCCA GCAGCTTGGG CACCCAGACC 4751 TACATCTGCA ACGTGAATCA CAAGCCCAGC AACACCAAGG TGGACAAGAA 4801 AGTT6GTGAG AGGCCAGCAC AGGGAGGGAG GGTGTCTGCT GGAAGCCAGG 4851 CTCAGCXXn'C CTGCCTGGAC GCATCCCGGC TATGCAGCCC CAGTCCAGGG 4901 CAGCAAGGCA GGCCCCGTCT GCCTCTTCAC CCGGAGGCCT CTGCCCGCCC 4951 CACTCATGCT CAGGGAGAGG GTCTTCTGGC TTTTTCCCCA GGCTCTGGGC 5001 AGGCACAGGC TAGGTGCCCC TAACCCAGGC CCTGCACACA AAGGGGCAGG 5051 TGCTGGGCTC AGACCTGCCA AGAGCCATAT CCGGGAGGAC CCTGCCCCTG 5101 ACCTAAGCCC ACCCCAAAGG CCAAACTCTC CACTCCCTCA GCTCGGACAC 5151 CTTCTCTCCT CCCAGATTCC AGTAACTCCC AATCTTCTCT CTGCAGAGCC 5201 CAAATCTTGT GACAAAACTC ACACATGCCC ACCGTGCCCA GGTAAGCCAG 5251 CCCAGGCCTC GCCCTCCAGC TCAAGGCGGG ACAGGTGCCC TAGAGTAGCC 5301 TGCATCCAGG GACAGGCCCC AGCCGGGTGC TGACACGTCC ACCTCCATCT Claims 1. A binding molecule comprising at least one antigen binding site, comprising in sequence the hypervariable regions CDR1, CDR2 and CDR3, said CDR1 having the amino acid sequence Asn-Tyr-lle-lle-His (NYIIH), said CDR2 having the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe-Lys-Gly (YFNPYNHGTKYNEKFKG) and said CDR3 having the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phe-Asp-Thr (SGPYAWFDT). 2. A binding molecule according to claim 1 comprising a) a first domain comprising in sequence the hypervariable regions CDR1, CDR2 and CDR3, said CDR1 having the amino acid sequence Asn-Tyr-lle-lle-His iNYIii|i), said CDR2 having the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe -Lys-Gly (YFNPYNHGTKVNEKFJKG) and said CDR3 having the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phe-Asp-Thr (SGPYAIWFDT); and b) a second domain comprising in sequence the hypervariable regions CDR1', CDR2' and CDR3', CDR1" having the amino acid sequence Arg-Ala-Ser-GIn-Asn-lle-GIy-Thr-Ser-lle-GIn (RASQNiGTSib), C0R2' having the |mino acid sequence Ser-Ser-Ser-Glu-Ser-lle-Ser (SSSESS) and CDR3' having the amino acid sequence Gln-Gln-Ser-Asn-Thr-Trp-Pro-Phe-Thr (QQSNTWPFT). 3. A binding molecule according to any one of claims 1 or 2, which is a chimeric or humanised monoclonal antibody. w' 4. A binding molecule according to any one of claims 1 or 2, comprising a polypeptide of SEQ ID N0:1 and/or a polypeptide of SEQ ID N0:2. 5. A binding molecule according to any one of claims 1 or 2, comprising a polypeptide of^ SEQ ID NO:3 and/or a polypeptide of SEQ ID N0:4. 6. A binding molecule according to any one of claims 4 or 5 which is a chimeric monoclonal antibody- 7. A binding molecule which is a humanised antibody comprising a polypeptide of SEQ ID N0:9 or of SEQ ID NO:10 and a polypeptide of SEQ ID N0:7 or of SEQ ID N0:8. 8. A binding molecule which is a humanised antibody comprising - a polypeptide of SEQ ID N0:9 and a polypeptide of SEQ ID N0:7. * a polypeptide of SEQ ID N0:9 and a polypeptide of SEQ ID N0:8, - a polypeptide of SEQ ID NO:10 and a polypeptide of SEQ ID N0:7, or * a polypeptide of SEQ ID NO:10 and a polypeptide of SEQ ID N0:8. 9. Isolated polynucleotides comprising polynucleotides encoding a binding molecule according to any one of claims 1 to 8. 10. Polynucleotides according to claim 9 encoding the amino acid sequence of CDR1, CDR2 and CDR3 according to claim 2 and/or polynucleotides encoding the amino acid sequence of CDRV, CDR2' and CDR3' according to claim 2. 11. Polynucleotides comprising a polynucleotide of SEQ ID NO: 5 and/or a polynucleotide of SEQ ID NO: 6. 12. Polynucletides comprising polynucleotides encoding a polypeptide of SEQ ID NO:7 or SEQ ID N0:8 and a polypeptide of SEQ ID N0:9 or SEQ ID NOrlO. 13. Polynucleotides comprising a polynucleotide of SEQ ID N0:11 or of SEQ ID N0:12 and a polynucleotide of SEQ ID N0:13 or a polynucleotide of SEQ ID N0:14. 14. An expresston vector comprising polynucleotides according to any one of claims 9 to 13. 15. An expresston system comprising a polynucleotide according to any one of claims 9 to 13, wherein said expression system or part thereof is capable of producing a polypeptide of any one of claims 1 to 8, when said expression system or part thereof is present in a compatible host cell. 16. An isolated host cell which comprises an expression system according to daim 15. 17. Use of a molecule or of a humanised antibody according to any one of claims 1 to 8 as a pharmaceutical. 18. Use according to claim 17 in the treatment and/or prophylaxis of autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease and allergies. 19. A pharmaceutical composition comprising a molecule or a humanised antibody according to any one of claims 1 to 8 in association with at least one pharmaceutically acceptable carrier or diluent. 20. A method of treatment and/or prophylaxis of diseases associated with autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease and allergies comprising administering to a subject in need of such treatment and/or prophylaxis an effective amount of a molecule or a humanised antibody according to any one of claims 1 to 8. 21. Use of a binding molecule having a binding specificity for both CD45RO and CD45RB in medicine. 22. The use according to claim 21, wherein the binding molecule is a chimeric, a humanised or a fully human monoclonal antibody. 23. The use according to claim 21 or 22, wherein the binding molecule binds to a CD45RO isoform with a dissociation constant (Kd) 24. The use according to any of claims 21 to 23, wherein the binding molecule binds to a CD45RB isoform with a dissociation constant (Kd) 25. The use according to any of claims 21 to 24, wherein the binding molecule binds CD45 isofonns which - include the A and B epitopes, but not the C epitope of the CD45 molecule; and/or - include the B epitope, but not the A and not the C epitope of the CD45 molecule; and/or - isoforms which do not include any one of the A, B or C epitopes of the CD45 molecule. 26. The use according to any of claims 21 to 25, wherein the binding molecule does not bind CD45 Isoforms which - Include ail of the A, B and C epitopes of the CD45 molecule; and/or - include both the B and C epitopes, but not the A epitope of the CD45 molecule. 27. The use according to any of claims 21 to 26, wherein the binding molecule binds to its target epitope on PEER cells, and wherein said binding is with a Kd 28. A binding molecule obstantially as herein descnoea with leference to the accompanying drawings. 29. A pharmaceutical composition substantially as herein described with reference to the accompanying drawings.

Documents:

1235-chenp-2003 abstract-duplicate.pdf

1235-chenp-2003 claims-duplicate.pdf

1235-chenp-2003 description (complete)-duplicate.pdf

1235-chenp-2003 drawings-duplicate.pdf

1235-chenp-2003-abstract.pdf

1235-chenp-2003-claims.pdf

1235-chenp-2003-correspondnece-others.pdf

1235-chenp-2003-correspondnece-po.pdf

1235-chenp-2003-description(complete).pdf

1235-chenp-2003-drawings.pdf

1235-chenp-2003-form 1.pdf

1235-chenp-2003-form 18.pdf

1235-chenp-2003-form 3.pdf

1235-chenp-2003-form 5.pdf

1235-chenp-2003-pct.pdf