Title of Invention	"MONOMERIC ANALOGUE OF HUMAN INSULIN"
Abstract	Monomeric analogues of human insulin have a single substitution of the amino acid in 12th, 16th or the 26th position of the B chain of human insulin and may also have a terminal deletion in the B chain.

Full Text

Field of the invention This invention relates to novel monomeric analogue of numan insulin (Hl) obtainable by recombinant DNA technology. BacKground of the Invention Insulin is highly effective in treating insulin-dependent diabetes, and has been usec clinically for nearly 80 years. With advances in DNA technology and the development of biotechnology industries, insulin extractea from animal pancreas is gradually being replaced by recombinant forms of human insulin, produced in microbial systems.This trend is encouraged by two observations; the number suffering from diabetes mellitus is on the increase globally and the clinical dose required to treat them is in milligram (mg) quantities. Currently, the organisms employed for the commercial production of recombinant human insulin are . colland S. cerevisiae. The expression levels in £. coll are high but difficulties associated with downstream purification often lead to loss of yield. These difficulties are not encountered with S. cerevisiae, because the insulin produced is secreted into the culture medium, facilitating purification. However, tne (eve! of expression observed in this organism is low and difficult to increase. Until recently, introduction of Uspro®, clinical preparations of human insulin contained polymeric forms of insulin which are slow-acting. Monomenc forms o* insulin, as described in US-A-561B913, by contrast, are relatively fast-acting and mimic more closely the natural situation. They therefore demonstrate a great potential for clinical application. A commercial monomeric insulin, available as Lispro®, comprises inversion of amino acids 26 and 29 of the B chain of human insulin, and may be abbreviated as B28Lys,B29Pro. Kristensen et a/, J. Biol. Chem. 272(20): 12978-83 (1997), discloses alanine substitution at various positions on the insulin molecule, including B12, B16 and B26. A single substitution with Ala affected the binding activity of the resultant insulin analogue in certain cases. Wang etal, Biochem. Mol. Bio!. Int. 39(6):1245-54 (1996), discloses Bl2Thr, i.e. an insulin analogue in which the 12tn amino acid of the B-chain of human insulin (Val) is substituted by Thr. Again, an effect on binding activity was observed. EP-A-0046979 discloses des-B30 derivatives of human insulin. EP-A-0291863 discloses des-B1 derivatives of human insulin. tc the present .nventoon. novel human ,nsui,r, analogues are monomeric variants of B12Tn, B16Aia anc B26Ala; the latter have not previously Deen recoon.sec as monomenc. In addition to replacement of any or all o. tne .. 16th and 26th amino acids on the B-chain. sucn that the analogue ,s monomenc, the B-1 and/or 5-30 terminal am.no adds may De absent Tne term "insulin analogue' as "used herer. means a compound hav.ng a molecular structure similartc that of human insu.ir induing d.suiphide bridges between A7Cys and B7Cys and between A20Cys and B19Cys, and an internal disulph.oe bridge between A6Cys and A11Dys, and havina insulin activity. " Without w,sh,na to be bound by theory, ii appears that, ,n the primary structure of the insulin molecule, a number of the am.no ac.ds in the B-cna.n are responsible for the poiymensation of insuim in dinical preparations. Tnese indude those in posifons B12 , B16 andB26. In particular, the replacement of Vai by Tnrin position B12 orTy-by ala in position B16 or B26 significantly reduces the tendency of tne .nsuhn analogues to polymerise even at h.gh concentrations (see Example 9). This enhanced tendency to exist as a monomenc structure is not affected by deletion of either one cr both of the termina; amino acids of the 5-chain. of the Invention Scheme below, shows the constructor, of the expression plasm.ds pNH, 2/AOX1 PNHI-3/AOX1, PNHI-4/AOX1and the engineering of recomb.nani ceils YP99/NHI-2 YP99/NHI-3 and YP99/NHM. It sets out a representative procedure for the prepared of compounds of the invention, by analogy with the use of the human insulin tarpet gene (HI) housed in the shuttle plasm.d PH,/PGK. Th.s shuttle vector is constructed from the plasmid pVT1 02-U (acqu.red from Canadian Research Insftute) and subsequently multiplied by PCR (ManiaHs at a/ (1989), Molecular Cion.ns A Laboratory Manual, 2nd ed. New York: Cold Spring Harbour Laboratory), to obtair muwpte cop.es of human insuim target gene (HI) and flan.ing alpha mafnc, fa^ leader (MFL) sequence. The target gene is then cloned into P!asm,d PPIC9 wh.cn ,s subseouently linearised with Bglll prior to being employed to transform P pastor* =e,i GS-15 by the spheroplast method. Once plasmid pPICB containing the target gene I5 .ntemaiised, it integrates into the chromosomal DMA of the host cell [1]. Transformed cells beanng a h,gh copy number of the HI gene are selected using the antibiotic G41B by the method described by Scover at a/ [2]. The presence of multiple ieC of the HI are ascertained by the dot blotting method [3], Cells beanng a hign copy number of the Hi gene are utilised to generate the human insulin precurso- by fermentation, and after purification converted to human insulin by tryptic transpeptidation. In order to obtain recombmant forms of human insulin analogues according to tnis invention, target genes were produced. THIS was accomplished by the "gap double-stranded DNA" method described by Li Yipmg ei al [5] which permits site-directed mutations in the HI target gene. Primers specifically designed to give B12Thr 316Ala and B26Ala were as follows; For B12Thr (NHI-2): refer to Wang et al, supra For B15Ala (NHI-3): 5' TGA GGC TTT GNN YTT GGT TTG CG 3' (SEG ID No.1) IP which N can be any nucleotide (G, A, T or C), and Y is C or G. For B26Ala (NHI-4): 5' GAA AGA GGTT TTC NNY ACT CCT AGG GC 2' (SEQ ID Mo.2) in which N and Y are as defined above. Novel human insulin analogues may be obtained by removing B30Thr and/o-31Phe, e,g. yielding a des-Bl and/or des-B30 analogue. Deletion may be achieved by known methodology. Rather than tryptic transpeptidation, to produce des-B30 human insulin, limited hydrolysis has been adopted, using trypsin in the preferred method, which further simplifies the process and increases the yield of insulin The methylotrophic yeast, Pichia pastons is the preferred host for use in this invention for the preparation o^ insulin analogues because, as the Examples sho\A, i! has the advantages of high expression, simple processing, low production cost ana high density culture. Furthermore it offers the advantages of a eukaryotic cell system; the correct folding and post-translational processing of secreted protein. These advantages greatly enhance tne possibility of utilizing P. pastons as the expression host in the scale-up of human insulin production. Its use in the expression of proteins of commercial importance has been documented elsewhere [3-5]. Human insulin analogues of the invention may be used in therapy. Their application and utility will be readily evident to those of ordinary skill in the art, e.g. in the treatment of diabetes mellitus. Brief Description of the Drawings Figure 1 shows the construction of pNHI-2/AOX' piasmid of Pichia psstons. The following Examples illustrate the invention. Example 1 Cloning of Mutated HI Gene Tne piasmid pVT102-U from Canadian Biotechnology Research Institute was used to construct the piasmid pHl/PGK according to the standard method described ir, Maniatis et al (1989). The construct pHI/DGK IE a shuttle plasmid with phcsphoglycerate kinase (PGK) promoter, followed by alpha mating factor leader sequence (MFL) to direct secretion of the product of the numan insulin target, gene (HI) flanked by a BamH! site at MFL 5' end and a Hindlll site at HI 3' end. Using pHI/PGK as template, together with TCCGGATCCATGAGATTT (SEQ ID NO. 3} as tne 5' primer and TGAATTCTTCTAGTTGCAGTAGTTT (SEQ ID NO. 4) as the 3' primer, DNA fragments containing MFL and HI with the BamHI site GGATCC at 5' end and the EcoRl site GAA'TTC at the 3' end were obtained by PCR. To obtain DNA fragments containing MFL and the target gene NHI-2 (B12Thr), NHI-3 (B16Ala) and NHi-4 (E26Ala) the HI target gene in pHI/PGK plasmid was first mutated by site-directed mutagenesis then replicated by PCR. By inserting these fragments behind the AOX1 promoter of the plasmid pPIC9 (Invitrogen), expression plasmids pNHI-2/AOX1, pNHI-3/AOXl and pNHI-4/AOX1 were obtained (see the Scheme and the accompany drawing; the latter shows the first plasmid, and the others may be prepared by the same procedure). The primers used to obtain the mutated genes in this invention have SEQ ID NOS. 1, 2 and 3. Example 2 Construction and Screening of Expression Cell The expression plasmids were linearised by Bglll and used to transform P. pastoris cell GS115 (Invitrogen) using the spheroplast method. The linearised plasmids, once internalized, integrate into the chromosomal DNA of the host cell [1], The recombinant cells, designated YP99/NHI-2, YP99/NHI-3 and YP99/HNI-4 with high copy number of the target gene, were selected by antibiotic G418 [2] and identified by the dot blotting method [3]. Example 3 Preparation of Precursors of HI analogues High density fermentation was carried out in a 15 litre fermenter [7]. The following salt solutions were used in the fermentation: BSM - H3PO., 26.7 ml/l, CaSO4H2O 0.93 g/l, K2SO4 18.2 g/l, MgSO4.7H2O 14.9 g/l, KOH 4.13 g/l; PTM1 -CuSO4.5H2O 6 g/l, Kl D.OB g/l, MnSO4H20 3.0 g/l, NaMo04.H2O 0.2 g/l, H3BO3 0.02 g/l, CoCl26H2O 0.5 g/l, ZnSO, 2C.O g/l, H2SO4 5 ml/l, FeSO4.7H2O 65.0 g/l. Fermentation medium containing 6 L of salt solution BSM and 300 mi of glycerol is sterilised in the5 fermenter. Its pH is adjusted to 5.5 with 50% ammonium hydroxide. A 5 ml aliquot of salt solution PTM1 containing 1 mg of biotin is added per 1 litre of culture medium. The expression cell is inoculated to 50 ml YPG and grown in a shake flask at 30°C for 24 hr. The broth is added to 600 ml of YPG, shaken in 3 flasks for 24 hr, added to the culture medium and fermented for 24 hr to deplete glyceroi. Methano! solution containing PTM1 (5 ml/1) and oiotin (1 mg/l) is addea to induce the expression. The inductive fermentation is continuec for 84 hr by feeding the above methanoi solution. During the fermentation, the pH is maintained at 5.5 by adding 50% ammonium hydroxide. The expression level is measured by radioimmunoassay, SDS-poiyacrylamide gel electrophoresis [8] and HPLC. Example 4 Separation and Purification of the Precursors The fermentation oroth is centrifuged to remove the cell bodies. The supernatant is applied to a C8 column and purified by HPLC. After a single step of purification, a product can be obtained that is homogeneous in native poiyacryiamide gel electrophoresis. Example 5 Transpeptidation of the Precursors Purified precursors of HI analogues from Example 4 are dissolved in DMSO/1,4-butanediol/H2O (15:70:15, v/v) to a concentration of 3D mg/ml. Thr(Bu) OBu! is added in excess, and the pH is adjusted to 6.5 by ammonium hydroxide. TPCK-trypsin is added (substrate:enzyme = 5:1) and the reaction mixture is incubated at 25°C for 6 hr. The reaction is stopped by acidification. The product is precipitated using acetone, and purified by HPLC using CB column. Example 6 Preparation of des-B30 analogues Purified precursors of HI-analogues are dissolved in pH 8, 0.1 Wi ammonium bicarbonate to a concentration of 10 mg/ml. TPCK-trypsin is added (substrate:enzyme = 200:1 i anc the reaction mixture is incubated at 25°C overnight. The product is analysed by native poiyacryiamide gei electrophoresis Example 7 Preparation of des-B1 analogues HI analogues are reacted with phenylisocyanate in a molar ratio of 1:2, prior to treatment with trifluoroacetic acid as described by Bradenburg & Hoppe-Seyler, Physiol. Chem. 350:471. The products of this reaction are separated and analysed by electrophoresis and found to be almost exclusively des-B1 forms of insulin analogues. Example 8 Preparation of des-61, des-B30 analogues Prepared by processing precursors of HI analogues as described in Example 6 followed sequentially by that described in Example 7. Example 9 Determination of structural forms The structural form of the recombinant human insulin analogues prior to deletion of the one or both terminal amino acids of the B-chain is determined electrophoretically. A preparation of each analogue is passed through Superdex G-75 column (HR 10/30). HI and [B28Lys, B29Pro] insulin (Lispro) are used as negative anc positive controls respectively. Phosphate buffered saline pH 7A is used as an eiution buffer and the flow rate fixed at 0.4 ml/mm. The concentration of the sample preparation is 1.2 mg/mi. The retention times and the peak profiles of human insulin analogues are shown in the following Table. (Table Removed) These results demonstrate that HI analogues B12Thr, B16Ala and B26Ala are all monomeric in form. They have a similar retention time and peak profile as the known positive control [B28Lys, B29Pro] human insulin. References 1. Cregg ei a! (1985), Mol. Cell. Biol. 5:3376 2. Scover ef al (1994), Bio/Technology 12:181 4. Hagenson et a! (1989), Enzy. Micro. Tech. 11:650 5. Steinlein et al (1995), Prot. Exp. Pur. 6:619 3. Clare et al (1991), Gene 105:205 6. Li YiPing et al (1987), Biotech. J. 3:90 7. Laroche et a/(1994), Bio/Technology 12:1119 E. Schagger et al (1987), Anal. Biochem. 166:368 Scheme (Scheme Removed) WE CLAIM: 1. A monomeric analogue of human insulin wherein the 16th amino acid of the B chain of human insulin (Tyr) is substituted by Ala (B16Ala).

Documents:

in-pct-2002-00227-del-abstract.pdf

in-pct-2002-00227-del-claims.pdf

in-pct-2002-00227-del-complete specification (granded).pdf

in-pct-2002-00227-del-correspondence-others.pdf

in-pct-2002-00227-del-correspondence-po.pdf

IN-PCT-2002-00227-DEL-Description (Complete).pdf

in-pct-2002-00227-del-drawings.pdf

in-pct-2002-00227-del-form-1.pdf

in-pct-2002-00227-del-form-13.pdf

in-pct-2002-00227-del-form-18.pdf

in-pct-2002-00227-del-form-2.pdf

in-pct-2002-00227-del-form-3.pdf

in-pct-2002-00227-del-form-5.pdf

in-pct-2002-00227-del-gpa.pdf

in-pct-2002-00227-del-pct-210.pdf

in-pct-2002-00227-del-pct-306.pdf

in-pct-2002-00227-del-pct-409.pdf

in-pct-2002-00227-del-pct-416.pdf

in-pct-2002-00227-del-petition-137.pdf