Title of Invention

"METHOD FOR 2-D GEL ELECTROPHORESIS OF PROTEIN SAMPLE"

Abstract Present invention relates to a method for the two-dimensional gel electrophoresis of a protein mixture, which comprising the step of : adding sHSPs to the protein mixture, so as to prevent protein degradation and obtain gels with an increased number of spots; and subjecting the protein mixture containing the sHSPs to two-dimensional gel electrophoresis.
Full Text

WO 2005/023847 PCT/KR2003/002539
COMPOSITION FOR PROTECTING PROTEINS DEGRADATION
COMPRISING SMALL HEAT SHOCK PROTEINS (sHSPs) AND METHOD
OF TWO-DIMENSIONAL GEL ELECTROPHORESIS USING THE sHSPs
TECHNICAL FIELD
The present invention relates to a composition for preventing protein degradation, which contains small heat shock proteins (sHSPs), as well as a composition for use in two-dimensional gel electrophoresis. Moreover, the present invention relates to an improved method of two-dimensional gel electrophoresis, which is characterized by using the sHSPs.
BACKGROUND ART
As the base sequence of a human genome is reveled and genome information for numbers of microorganisms, lower animals and plants increases daily, proteomics becomes the focus of the next-generation research.
The proteomics that is a science field for studying proteomes systemically is distinguished from genomics. The proteomes signify complete information for the kind and amount of proteins which are expressed from genomes under specific condition. Thus, the proteomics simultaneously analyzes and identifies various proteins in cells or tissues that are involved in biological phenomenon. Since this proteomic analysis provides results that cannot be found in genome projects or DNA researches, there are studies being conducted to develop diagnostic reagents or therapeutic agents for adult diseases, such as cancer, diabetes, dementia, and heart and circulation system diseases, and mental diseases, using this analysis, and also studies to apply it in fields, such as organ transplantation.
Core technology that has most widely been used in proteomics studies is a

WO 2005/023847 PCT/KR2003/002539
two-dimensional gel electrophoresis technique. The two-dimensional gel electrophoresis technique is the best method capable of separating and quantifying total proteins in cells or tissues.
The two-dimensional gel electrophoresis technique is a method where a mixture of proteins is first separated according to the isoelectric point (pi) of each protein, and each of the separated samples is further separated according to its molecular weight in a vertical direction such that the separated proteins are two-dimensionally distributed on a plane. Namely, an isoelectric-focusing (IEF) method and a sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) method are used respectively.
Currently, two-dimensional gels using IEF were developed, and commercialized systems appeared one after another, to greatly improve reproducibility that is a problem of the prior two-dimensional gel (US 6,554,991; US 2002/157954; US 2002/133300; US 6,416,644; US 6,398,932; WO 02/25259; US 2001/032786; US 2001/023826; US 2001/015320; US 6,245,206; US 6,136,173; US 6,123,821; US 5,993,627; WO 98/59092; and WO 02/90966). Furthermore, the steps of staining individual proteins in the two-dimensional gel and digesting the stained proteins with protease were preformed using an automated system and a computer so that samples could be processed in an easy and simple way.
However, the automation of the two-dimensional gel electrophoresis which is the first step is not yet realized. Moreover, since there is protein loss in all the process of the two-dimensional gel electrophoresis, it is impossible to completely analyze complex proteomes in cells or tissues. If cells are lysated in a first step, as protease is released from the cells protein degradation occurs to reduce the total number of proteins.
For this reason, a variety of the following methods for inhibiting protease attack in a protein separation process were designed: (1) the direction addition of strong denaturants to samples; (2) the preparation of samples at a low temperature or an alkaline condition (above pH 9); and (3) the use of protease inhibitor.

WO 2005/023847 PCT/KR2003/002539
Examples of the protease inhibitor include phenylmethyl-sulphonyl fluoride (PMSF), aminoethyl benzylsufonyl fluoride or Pefabloc™ SC (AEBSF), ethylenediaminetetraacetic acid (EDTA), benzamidine, tosyl lysine chloromethyl ketone (TLCK), and tosyl phenylalanine chloromethyl ketone (TPCK). However, in such methods, proteolysis cannot be completely inhibited, and the kinds and origins of samples are very various such that an optimal process for preparing the samples should be empirically determined.
Meanwhile, sHSPs that are heat shock proteins (HSPs) with a low molecular weight of 15-30 kDa are induced by stress such as heat shock or the overproduction of certain proteins, and act to prevent protein denaturation. One or more of the sHSPs are present in each of all organisms from eukaryotes to prokaryotes, and the sHSPs known till now are given in Table 1 below.


WO 2005/023847 PCTVKR2003/002539

Such sHSPs have a conserved region in an evolutionary process and thus has been performing substantially similar functions. However, it was not yet known that these sHSPs prevent protein degradation.
Accordingly, the present inventors have conducted intensive studies to develop a method for preventing proteins from being degraded upon two-dimensional gel electrophoresis, and consequently, first found that the sHSPs had the effect of preventing protein degradation, and also if two-dimensional gel electrophoresis is performed using such sHSPs, gels with a significantly increased number of protein spots could be obtained, thereby achieving the present invention.
DISCLOSURE OF THE INVENTION
Therefore, a main object of the present invention is to provide a composition for preventing protein degradation.
Another object of the present invention is to provide a composition for use

WO 2005/023847 PCT/KR2003/002539
in two-dimensional gel electrophoresis, by which protein degradation is prevented and gels having an increased number of spots are obtained.
Still another object of the present invention is to provide a two-dimensional gel electrophoresis method in which protein degradation is prevented and gels with an increased number of spots are obtained.
To achieve the above objects, in one embodiment, the present invention provides a composition for preventing protein degradation, which contains an effective amount of small heat shock proteins (sHSPs).
In another embodiment, the present invention provides a composition for use in two-dimensional gel electrophoresis, which contains an effective amount of sHSPs.
In still another embodiment, the present invention provides a method for the two-dimensional gel electrophoresis for a protein mixture, which comprises the steps of: adding sHSPs to the protein mixture, so as to prevent protein degradation and obtain gels with an increased number of spots; and subjecting the protein mixture containing the sHSPs to two-dimensional gel electrophoresis.
In further another embodiment, the present invention provides a method for the analysis of proteomes by two-dimensional gel electrophoresis, which is characterized by using the inventive composition.
In the present invention, the sHSPs are preferably one or more selected from the proteins set forth in Table 1 above, and more preferably one or more selected from the group consisting of inclusion body-associated protein A (IbpA), IbpB,IbpABandHSP26.
In the present invention, the protein mixture, which is used in the two-dimensional gel electrophoresis method, is preferably total protein in certain cells. The certain cells are preferably prokaryotes or eukaryotes. The prokaryotes are preferably E. coli or Pseudomonas sp. microorganisms, and the eukaryotes are preferably human-derived cells.
In the present invention, the amount of the sHSPs that is added for the prevention of protein degradation is preferably in a range of 0.1 to 50 parts by

WO 2005/023847 PCT/KR2003/002539
weight, and more preferably 0.5 to 20 parts by weight, relative to 100 parts by weight of the total protein of an electrophoresis sample. If the sHSPs are added at the amount of less than 0.1 part by weight of the sHSPs are added, it is absolutely insufficient for the prevention of protein degradation, and if they are added at the amount of more than 20 parts by weight of them are added, an excess of the sHSPs either interferes with the separation of the proteins of certain cells to be separated, or cause an adverse effect in view of the purification cost of the sHSPs.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a gene map of plasmid pTac99IbpAH.
FIG. 2 is a gene map of plasmid pTac99IbpBH.
FIG 3 is a gene map of plasmid pTac99PPIbpAH.
FIG 4 is a gene map of plasmid pTac99HSP26H.
FIG. 5 is an electrophoretic picture showing the result of protein purification of IbpA, IbpB or HSP26 expressed from recombinant E. coli XL1-Blue transformed with recombinant plasmid pTac99IbpAH3 pTac99IbpBH, pTac99pPIbpAH or pTac99HSP26H. In (A), lane M shows the molecular mass standard, lane 1 and 2 show purified IbpA, lane 3 and 4 show purified IbpB, lane 5 and 6 show purified ppIbpA. In (B), lane M shows the molecular mass standard, lane 1 to 3 show purified HSP26.
FIG. 6 represents two-dimensional gel electrophoretic pictures of transformed E, coli WIB101 in which IbpA and/or IbpB is overexpressed in vivo. (A) represents E. coli WIB101 (p 184 A Cm), (B) represents E. coli WIBlOl(pACTacIbpA), (C) represents E. coli WIBlOl(pACTacIbpB) and (D) represents E. coli WIBlOl(pACTacIbpAB).
FIG. 7 represents two-dimensional gel electrophoretic pictures of purified [bpA and IbpB protein. (A) and (B) represent IbpB and IbpA, respectively.
FIG. 8 represents two-dimensional gel electrophoretic pictures of E. coli

WO 2005/023847 PCT/KR2003/002539
W3110 adding IbpA, IbpB or HSP26 in vitro. (A) represents E. coli W3110 as a control, (B) is the case of adding 10µg of IbpB protein to E. coli W3110, (C) is the case of adding 10fig of IbpA protein to E. coli W3110, (D) is the case of adding 10#g of IbpA protein derived from Pseudomonas to E. coli W3110, and (E) is the case of adding 10//g of HSP26 protein derived from Saccharomyces cerevisiae to
FIG. 9 represents two-dimensional gel electrophoretic pictures of Pseudomonas putida KT2440 adding IbpA in vitro. (A) represents Pseudomonas putida KT2440 as a control, and (B) represents the case of adding 10µg of IbpA protein to Pseudomonas putida KT2440.
FIG. 10 represents two-dimensional gel electrophoretic pictures of human serum adding IbpA in vitro. (A) represents human serum as a control, and (B) represents the case of adding 10µg of IbpA protein to human serum.
DETAILED DESCRIPTION OF THE INVENTION
The present invention will hereinafter be described in further detail by examples. It will however be obvious to a person skilled in the art that the present invention is not limited to the examples.
Particularly, the examples herein are intended to illustrate IbpA or IbpB derived from E. coli, IbpA derived from Pseudomonas and HSP26 derived from Saccharomyces cerevisiae as sHSPs, however it should be borne in mind the sHSPs of Table 1 can be used to the present invention without limitation.
Example 1: Preparation of recombinant plasmid containing ibpA. ibpB or HSP26 gene
Chromosomal DNAs of E. coli W3110(ATCC 39936), Pseudomonas putida KT2440(ATCC 47054) and Saccharomyces cerevisiae were isolated and purified according to a method of Sambrook et al. (Molecular Cloning, 2nd ed., Cold Spring Harbor Laboratory Press, NY, 1989).

WO 2005/023847 PCT/KR2003/002539
E. coli W3110, Pseudomonas putida KT2440 and Saccharomyces cerevisiae were cultured in 500mL LB(Luria-Bertani) medium for 24 hours, respectively. The strains of early log phase were collected by centrifugation, and then, suspended in 50 ml TE solution (lOmM Tris, lmM EDTA; pH 7.6) containing 10 mg/ml lysozyme (Sigma Co., USA). The strain suspensions were cultured at room temperature for 24 hours with slow stirring.
In order to disrupt the strain and remove proteins, the culture broth was added with 16 ml of 10% SDS (sodium dodecyl sulfate) solution and 570 nl of 20 mg/ml Proteinase K (Sigma Co., USA), followed by reaction at 37 °C for one hour.
Next, 14 ml of 5M NaCl solution and 10.66 ml of 10% CTAB(cetyltrimethylammoniumbromide, Sigma Co., USA) dissolved in 0.7M NaCl solution were added and then reacted at 65 °C for 10 minutes. After this, chloroform-isoamylalcohol (24:1) of the same volume as the reaction solution was added to the reaction solution and carefully mixed at room temperature for 2 hours. The mixed solution was centrifuged at 6,000 rpm for 10 minutes, and the supernatant was transferred into a beaker, to which cooled ethanol that is 2-fold larger volume than the supernatant was added slowly to precipitate chromosomal DNA. The precipitated DNA was rolled up around a glass rod. The glass rod was air-dried to remove ethanol, and the chromosomal DNA was dissolved in 1 ml TE solution.
RNase(Sigma Co., USA) was added to the DNA solution to a final concentration of 50/µg/mL, followed by reaction at 37 °C for one hour. After the reaction, chloroform-isoamylalcohol (24:1) of the same volume as the reaction solution was added, and carefully mixed at room temperature for 2 hours.
The mixed solution was centrifuged at 6,000 rpm for 10 minutes, and the supernatant was transferred into a beaker, to which cooled ethanol that is 2-fold larger volume than the supernatant added slowly to precipitate chromosomal DNA. The precipitated DNA was rolled up around a glass rod. The glass rod was air-dried to remove ethanol, and finally, the chromosomal DNAs of purified E. coli

WO 2005/023847 PCT7KR2003/002539
W3110, Pseudomonas putida KT2440 and Saccharomyces cerevisiae were dissolved in 1 ml TE solution, respectively.
For easy expression and purification of IbpA, IbpB or HSP26 protein, the recombinant plasmids, pTac99IbpAH, pTac99IbpBH, pTac99PPIbpAH, and pTac99HSP26H, were constructed as follow.
Using the chromosomal DNA of E. coli W3110 as a template, PCRs were conducted with primers of SEQ ID NOs: 1 and 2, and primers of SEQ ID NOs: 3 and 4, thereby obtaining ibpA-6his and ibpB-6his genes derived from E. coli, respectively.
Furthermore, using the chromosomal DNA of Pseudomonas putida KT2440 as a template, PCRs were conducted with primers of SEQ ID NOs: 5 and 6, thereby obtaining P?ibpA-6his gene derived from Pseudomonas. In Pseudomonas putida KT2440 genome, ibpB gene is not known, yet.
Using the chromosomal DNA of Saccharomyces cerevisiae as a template, PCRs were conducted with primers of SEQ ID NOs: 7 and 8, thereby obtaining US?26-6his gene derived from Saccharomyces cerevisiae.
All PCRs conducted by the following conditions: initial denaturation at 95 °C for 5 minutes; 30 cycles of denaturation at 95 °C for 50 seconds, annealing at 55 °C for one minute, and extension at 72 °C for one minute and 30 seconds; and final extension at 72 °C for 5 minutes.
Each of the obtained ibpA-6his, ibpB-6his, ppibpA-6his and HSP26-6his genes were inserted into recombinant plasmid pTac99A digested with EcoRl and Hindlll, thereby constructing plasmids pTac99IbpAH, pTac99IbpBH, pTac99PPIbpAH and pTac99HSP26H, respectively (FIG. 1, FIG. 2, FIG. 3 & FIG.
4).
Recombinant plasmid pTac99A was obtained as follows: The trc promoter of pTrc99A (Pharmacia Biotech., Uppsala, Sweden) was converted into the tac promoter of pKK223-3 (Pharmacia Biotech., Uppsala, Sweden). The tac promoter of pKK223-3 was digested with restriction enzymes Pvull and EcoRI, and then the gene fragment of the tac promoter was inserted into pTrc99A digested

WO 2005/023847 PCT/KR2003/002539
with the same restriction enzymes.
SEQ ID NO: 1 : 5'-ggaattcatgcgtaactttgatttatccccg-3f
SEQ ID NO: 2 : 5f-cccaagcttttaatggtgatgatggtgatggttgatttcgatacggcgcgg-3f
SEQ ID NO: 3 : 5'-ggaattcatgcgtaacttcgatttatccccactg-3!
SEQ ID NO: 4 : 5'-cccaagcttttaatggtgatgatggtgatggctatttaacgcgggacgttcgct3'
SEQ ID NO: 5: 5'-ggaattcatgaccatgactactgctttc-3'
SEQ ID NO: 6: 5'-cccaagcttttaatggtgatgatggtgatggttcagcgctggttttt-3'
SEQ ID NO: 7: 5'-ggaattcatgtcatttaacagtccatttt-3'
SEQ ID NO: 8: 5'-cccaagcttttaatggtgatgatggtgatggttaccccacgattcttgaga-3'
Example 2: Purification of IbpA. IbpB or HSP26 protein
The recombinant E. coli XLl-Blue(Stratagene, USA) transformed with recombinant plasmid pTac99IbpAH, pTac99IbpBH, pTac99ppIbpAH or pTac99HSP26H, containing the gene encoding IbpA, IbpB or HSP26 protein prepared in example 1 was cultured in LB medium(yeast extract 5g/L, tryptophan lOg/L, NaCl lOg/L) containing 50mg/L ampicillin, respectively.
The expressions of IbpA, IbpB and HSP26 protein were induced by adding 1 mM IPTG(isopropyl-p-thiogalactoside) at an optical density(OD) of 0.7 at 600 nm. 4 hours after induction, 1 ml of each of the culture solutions was taken and centrifuged at 4 °C and 6,000 rpm for 5 minutes, the obtained precipitate was washed one time with 0.5 ml TE solution and centrifuged at 4 °C and 6,000 rpm for 5 minutes to obtain a precipitate. The precipitate was suspended in 0.2 ml equilibrium solution(urea 8M, NaH2PO4 lOOmM, Tris lOmM, pH 8.0), and subjected to ultrasonic homogenization and fractionation.
The above suspended solution was centrifuged at 4 °C and 10,000 rpm for 10 minutes, and the supernatant was collected and passed through Ni-NTA spin column(Qiagen, USA) pre-equilibrated with the equilibrium solution. And then, the solution was centrifuged at 2,000rpm for 2 minutes. 600 µl washing solution(urea 8M, NaH2PO4 lOOmM, Tris lOmM, pH 6.3) was passed through the

WO 2005/023847 PCT/KR2003/002539
column two times. 200 µl eluent(urea 8M, NaH2PO4 lOOmM, Tris lOmM, pH 4.5) was inserted into column to purify IbpA, IbpB and HSP26 proteins.
200 fd of each of the solution containing the purified IbpA, IbpB and HSP26 proteins was taken and mixed with 50 fd SDS-PAGE sample solution(25% glycerol, 2% SDS, 14.4mM 2-mercaptoethanol, 0.1% bromophenol blue, 60mM Tris-HCl). The mixed solution was boiled for 10 minutes and was subjected to SDS-PAGE gel electrophoresis in 12% separating gel. Next, the gel was soaked in a staining solution(methanol 40%, acetic acid 10%, 0.25 g/L Coomassie brilliant blue R) for over 2 hours to be stained and soaked two times in a decolorizing solution(40% methanol, 7% acetic acid) for over 2 hours each time to be decolorized (FIG. 5).
FIG. 5 is an electrophoretic picture showing the result of protein purification of IbpA, IbpB and HSP26 expressed from recombinant E. coli XL1-Blue transformed with recombinant plasmid pTac99IbpAH, pTac99IbpBH, pTac99PPIbpAH or pTac99HSP26H. In FIG. 5(A), lane M shows the standard molecular weight of protein, lane 1 and 2 show purified IbpA, lane 3 and 4 show purified IbpB, lane 5 and 6 show purified PPIbpA. In FIG. 5(B), lane M shows standard molecular weight of protein, lane 1 to 3 show purified HSP26. As shown in FIG. 5, the purity of the purified IbpA, IbpB and HSP26 protein was almost 100%.
Example 3: The effect of IbpA and/or IbpB upon two-dimensional gel electrophoresis for proteome studies
The known IbpA and/or IbpB expression plasmid pACTacIbpA, pACTacIbpB or pACTadbpAB and the plasmid pl84ACm as a control were introduced into the ibpAB gene-deleted mutant E. coli WIB101(PCT/KR03/01371), respectively, and then cell-cultured according to the method described in example 2. The expression of IbpA and/or IbpB protein was induced by adding 1 mM IPTG(isopropyl-/3-thiogalactoside) at OD of 0.7 at 600 nm. 4 hours after induction, 1 ml of each of the culture broth was taken and centrifuged at 4 °C and 6,000 rpm

WO 2005/023847 PCT/KR2003/002539
for 5 minutes, the obtained precipitate was kept at -20°C.
The two-dimensional gel electrophoresis for each of transformed E. coli was performed as follows. Two-dimensional gel electrophoresis is the method of spreading all proteins in a cell using the differences of molecular weight and electric charge, which is the characteristic property of proteins (Hochstrasser et aly Anal Biochem., 173: 424-35, 1988; Han et ai, J. BacterioL, 183:301-8, 2001).
The two-dimensional gel electrophoresis were performed using PROTEAN IEF cell and PROTEAN II xi cell(Bio-Rad Laboratories Inc., Herculules, CA) in the examples herein.
The sample for two-dimensional gel electrophoresis was prepared by treating as follows. The culture broth was centrifuged at 4°C and 6,000rpm for 5 minutes and the supernatant was spilled out. Then, remaining medium of the precipitate was washed by 500 µd low sodium buffer solution(KCl 3mM, KH2PO4 1.5mM, NaCl 68mM, NaH2PO4 9mM). The precipitate was suspended in 100 fd cell lysis buffer(urea 8M, CHAPS 4%(w/v), DTT 65mM, Tris 40mM) and centrifuged at 4.C and 12,000 rpm for 10 minutes, thereby obtaining full proteins.
Proteins were weighed using the Bradford method (Bradford MM, Anal. Biochem., 72:248-54, 1976). 200µg protein was dissolved in 34Q(d IEF denaturation solution(urea 8M, CHAPS 0.5%(w/v), DTT lOmM, Bio-lyte pH 3-10 0.2%(w/v), bromophenol blue 0.001%(w/v)) and inserted into 17cm ReadyStrip™ IPG Strips pH 3-10(Bio-Rad Laboratories Inc., Herculules, CA) to be hydrolyzed for 12 hours at 20 °C, then subjected to the isoelectric focusing.
The strip was shaken in equilibrium buffer I(urea 6M, SDS 2%(w/v), Tris-HCl(pH 8.8) 0.375M, glycerol 20%(v/v), DTT 130mM) for about 15 minutes and shaken again in equilibrium buffer II(urea 6M, SDS 2%(w/v), Tris-HCl(pH 8.8) 0.375M, glycerol 20%(v/v), iodoacetamide 135mM, bromophenol blue 3.5M) for 15 minutes. Then, the strip was separated on an SDS-PAGE gel depending on molecular weight.
Proteins were stained by silver staining kit(Amersham Biosciences,

WO 2005/023847 PCT/KR2003/002539
Uppsala, Sweden) and two-dimensional gel was scanned by GS710 Calibrated Imaging Densitometer(Bio-Rad Laboratories Inc., Herculules, CA). The number of proteins or spots on gel was measured by software of Melanie II(Bio-Rad Laboratories Inc., Herculules, CA) (FIG. 6).
FIG. 6 is two-dimensional gel electrophoretic pictures of transformed E. coli WIB101 in which IbpA and/or IbpB is overexperssed in vivo. In FIG. 6, (A) represents E. coli WIB101 (pi 84 A Cm), (B) represents E. coli WIB101(pACTacIbpA), (C) represents E. coli WIB101(pACTacIbpB), and (D) represents E. coli WIB101(pACTacIbpAB). The circles on the two-dimensional gel represent IbpA and/or IbpB protein.
As shown in FIG 6, the two-dimensional gel having many protein spots was obtained from transformed E. coli WIB101(pACTacIbpA), WIB101(pACTacIbpB) or WIB 101 (pACTacIbpAB), compared to the gel obtained from E. coli WIB101(pl84ACm) as a control.
Example 4: The effect of IbpA, IbpB and HSP26 upon the two-dimensional gel electrophoresis of E. coli W3110
Two-dimensional gel electrophoresis for E. coli W3110 was performed according to the method described in example 3. First, two-dimensional gel electrophoresis was carried out to observe the purity of lOjUg purified IbpA or IbpB protein (FIG. 7).
FIG. 7 represents two-dimensional gel electrophoretic pictures of purified IbpA and IbpB protein. In Fig. 7, (A) and (B) represent IbpB and IbpA, respectively. As shown in FIG. 7, no other proteins except for IbpA and IbpB proteins exist as a result of the two-dimensional gel electrophoresis. Therefore, it suggests that the purity of IbpA and IbpB is almost 100%.
Two-dimensional gel electrophoresis was carried out to observe the effect of sHSPs by adding 10µg of each of IbpA, IbpB and HSP26 protein to 200µg of quantified E. coli W3110 protein (FIG. 8). 200µg of quantified E. coli W3110 protein was used as a control.

WO 2005/023847 PCT/KR2003/002539
FIG. 8 represents two-dimensional gel electrophoretic pictures of E. coli W3110. In Fig. 8, (A) represents E. coli W3110 as a control, (B) is the case of adding 10µg of IbpB protein to E. coli W3110, (C) is the case of adding 10µg of IbpA protein to E. coli W3110, (D) is the case of adding 10µg of IbpA protein derived from Pseudomonas to E. coli W3110, and (E) is the case of adding 10µg of HSP26 protein derived from Saccharomyces cerevisiae to E. coli W3110. As shown in FIG. 8, the two-dimensional gel electrophoresis added with IbpA, IbpB or HSP26 protein was observed to have many protein spots comparing to the known method.
Example 5: The effect of IbpA upon the two-dimensional gel electrophoresis of Pseudomonas
The two-dimensional gel electrophoresis for Pseudomonas putida KT2440 was performed according to the method described in example 3.. The two-dimensional gel electrophoresis was carried out to observe the effect of IbpA by adding 10µg of IbpA protein to 20µg of cpiantifed. Pseudomonas putida Y.T2440 protein (FIG. 9). 200µg of quantified Pseudomonas putida KT2440 protein was used as a control.
FIG. 9 represents two-dimensional gel electrophoretic pictures of Pseudomonas putida KT2440. In FIG. 9, (A) represents Pseudomonas putida KT2440 as a control, and (B) represents the case of adding 10µg of IbpA protein to Pseudomonas putida KT2440. As shown in FIG. 9, the two-dimensional gel electrophoresis added with IbpA protein was observed to have much more protein spots.
Example 6: The effect of IbpA upon the two-dimensional gel electrophoresis of Human serum
The two-dimensional gel electrophoresis for human serum was performed according to the method described in example 3. The two-dimensional gel electrophoresis was carried out to observe the effect of IbpA by adding 10µg of

WO 2005/023847 PCT/KR2003/002539
IbpA protein to 200µg of quantified human serum protein (FIG. 10). 200µg of quantified human serum protein was used as a control.
FIG. 10 represents two-dimensional gel electrophoretic pictures of human serum. In FIG. 10, (A) represents human serum as a control, and (B) represents the case of adding 10µg of IbpA protein to human serum. As shown in FIG. 10, the two-dimensional gel electrophoresis added with IbpA protein was observed to have much more protein spots.
INDUSTRIAL APPLICABILITY
As described above, the present invention has the effect of providing an inventive composition containing sHSPs for prevention of protein degradation and a composition for two-dimensional gel electrophoresis. Furthermore, decreasing of protein spots was prevented in the two-dimensional gel electrophoresis using sHSPs such as IbpA, IbpB, IbpAB, HSP26 etc., thereby obtaining two-dimensional gel with much more protein spots. Therefore, the present invention is expected to provide improvement of studies on proteome in cells.

WO 2005/023847 PCT/KR2003/002539
WHAT IS CLAIMED IS:
1. A composition for preventing protein degradation, which contains an effective
amount of small heat shock proteins (sHSPs).
2. The composition according to claim 1, wherein the sHSPs are one or more
selected from proteins set forth in Table 1.
3. The composition according to claim 2, wherein the sHSPs are one or more
selected from the group consisting of IbpA, IbpB, IbpAB and HSP26.
4. A composition for use in two-dimensional gel electrophoresis, which contains
an effective amount of sHSPs.
5. The composition according to claim 4, wherein the sHSPs are one or more
selected from the proteins set forth in Table 1.
6. The composition according to claim 5, wherein the sHSPs are one or more
selected from the group consisting of IbpA, IbpB, IbpAB and HSP26.
7. A method for the two-dimensional gel electrophoresis of a protein mixture,
which comprising the steps of:
adding sHSPs to the protein mixture, so as to prevent protein degradation and obtain gels with an increased number of spots; and
subjecting the protein mixture containing the sHSPs to two-dimensional gel electrophoresis.
8. The method according to claim 7, wherein the sHSPs are one or more selected
from the proteins set forth in Table 1.

WO 2005/023847 PCT/KR2003/002539
9. The method according to claim 8, wherein the sHSPs are one or more selected
from the group consisting of IbpA, IbpB and IbpAB derived from E. coli, IbpA
derived from Pseudomonas and HSP26 derived from Saccharomyces cerevisiae.
10. The method according to claim 7, wherein the amount of the sHSPs that is
added is in a range of 0.1 to 50 parts, relative to 100 parts by weight of the total
protein of an electrophoresis sample.
11. The method according to claim 10, wherein the amount of the sHSPs that is
added is 0.5 to 20 parts, relative to 100 parts by weight of the total protein.
12. The method according to claim 7, wherein the protein mixture is total protein
in specific cells.
13. The method according to claim 12, wherein the specific cells are prokaryotes
or eukaryotes.
14. The method according to claim 13, wherein the prokaryotes are E. coli or
Pseudomonas sp. microorganisms, and the eukaryotes are human-derived cells.
15. A method for the analysis of proteomes by two-dimensional gel
electrophoresis, which is characterized by using the composition of any one of
claims 1 to 6.


Documents:

0801-chenp-2006 abstract-duplicate.pdf

0801-chenp-2006 claims-duplicate.pdf

0801-chenp-2006 description (complete)-duplicate.pdf

0801-chenp-2006 drawings-duplicate.pdf

801-CHENP-2006 ABSTRACT.pdf

801-CHENP-2006 CLAIMS.pdf

801-CHENP-2006 CORRESPONDENCE OTHERS.pdf

801-CHENP-2006 CORRESPONDENCE PO.pdf

801-CHENP-2006 FORM-1.pdf

801-CHENP-2006 FORM-18.pdf

801-CHENP-2006 FORM-2.pdf

801-CHENP-2006 POWER OF ATTORNEY.pdf

801-chenp-2006-abstract.pdf

801-chenp-2006-claims.pdf

801-chenp-2006-correspondnece-others.pdf

801-chenp-2006-description(complete).pdf

801-chenp-2006-drawings.pdf

801-chenp-2006-form 1.pdf

801-chenp-2006-form 3.pdf

801-chenp-2006-form 5.pdf

801-chenp-2006-pct.pdf


Patent Number 232634
Indian Patent Application Number 801/CHENP/2006
PG Journal Number 13/2009
Publication Date 27-Mar-2009
Grant Date 20-Mar-2009
Date of Filing 06-Mar-2006
Name of Patentee KOREA ADVANCED INSTITUTE OF SCIENCE AND TECHNOLOGY
Applicant Address 373-1,GUSEONGDONG, YUSEONG-GU, DAEJEON 305-338,
Inventors:
# Inventor's Name Inventor's Address
1 LEE, SANG-YUP EXPO APT. 212-702, JEONMIN-DONG, JUSEONG-GU, DAEJEON 305-761,
2 HAN, Mee Jung 373-1, Guseong-dong, Yuseong-gu, 305-338 Daejeon,
3 PARK, Si Jae 149-31 Pungnab 1- dong Songpa-gu, 138-873 Seoul,
PCT International Classification Number C07K14/00
PCT International Application Number PCT/KR03/02539
PCT International Filing date 2003-11-24
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 10-2003-0062756 2003-09-08 Republic of Korea