Title of Invention

"A METHOD FOR MAKING A RECOMBINANT DNA"

Abstract

The present invention is directed to methods and compositions for DNA subcloning using bacterial recombinase-mediated homologous recombination. The invention relates to methods for cloning, compositions comprising polynucleotides useful as cloning vectors, cells comprising such polynucleotide compositions, and kits useful for cloning mediated by bacterial recombinases, such as RecE/T and Red$g(a)/$g(b).

Full Text

interest. Restriction sites must be found that cut the boundaries of, but not within, the desired DNA fragment Since most useful restriction enzymes cut fairly frequently, the size of the linear DNA fragment made is also limited. The increasing use of the polymerase chain reaction (PCR) for generating DNA fragments presents a second major drawback to conventional subcloning. The ends of PCR products are inefficient in ligation reactions due to non-texnplated nucleotides added to the 3' termini of amplified PCR products by thennostabile polymerase. Furthermore, the use of PCR entails a high risk of mutations. Thus, molecular biologists have searched for new, more effective methods for cloning fragments of DNA, particularly when such fragments are longer than those conveniently accessible by restriction enzyme or PCR methodologies. Homologous recombination is an alternative approach for cloning and subcloning DNA fragments. Methods for subcloning PCR products in £ coli that exploit the host's homologous recombination systems have been described (Oliner et aL> 1993, Nucleic Acids Res. 21:5192-97; Bubeck etal, 1993, NucL Acids. Res. 21:3601-3602). In such methods, PCR primers, designed to contain terminal sequences homologous to sequences located at the ends of a linearized vector, are used to amplify a DNA fragment of interest The PCR product and the linearized vector are then introduced into £ coli. Homologous recombination within the £ coli host cell results in insertion of the PCR -product sequences into the plasmid vector. Although these methods have been shown to be useful for subcloning PCR fragments, they have not been applied to subcloning long DNA fragments, or to cloning DNA fragments of any size. Another method describes an in vivo subcloning method in which two linear DNA molecules, one of which has an origin of replication, and which have long regions of homology at their ends, are used to transform an £ coli sbcBC host cell. Homologous recombination occurs in vivo, and results in circularization and propagation of the newly formed plasmid (Degryse, 1996, Gene 170:45). Subsequently, the ability of £ coli sbcBC host cells to mediate homologous recombination has been applied to subcloning large DNA fragments from adenovirus and herpes virus genomic DNAs (Chartier et a/., 1996, J. Virol. 70:4805; Mcsserle, era/., 1997, Proc. Natl. Acad. Sci. USA 94,14759-14763; He, 1998, Proc. Natl Acad. Sci. USA 95:2509-2514). As described, each subcloning by homologous recombination in £ coli sbcBC host cells requires at least two preparatory subcloning steps to position long homology regions either side of an £ coli origin of replication. Furthermore, DNA cloning in £ coli sbcBC strains has not been described. Recently, homologous recombination, mediated by either RecE/RecT (RecE/T) or Reda/Redp (Reda/p) has been shown to be useful for manipulating DNA molecules in£ coli (Zhang et al, 1998, Nature Genetics, 20,123-128; MuyrersetaL, 1999, Nucleic Acids Res. 27:1555-1557). These papas show that, in E. coli, any intact, independently replicating, circular DNA molecule can be altered by RecE/T or Rcda/p mediated homologous recombination with a linear DNA fragment flanked by short regions of DNA sequence identical to regions present in the circular molecule. Integration of the linear DNA fragment into the circular molecule by homologous recombination replaces sequences between its flanking sequences and the corresponding sequences in the circular DNA molecule. Citation of a reference herein shall not be construed as an admission that such is prior art to the present invention. 3. SUMMARY OF THE INVENTION The present invention provides methods and compositions for DNA cloning and subcloning using bacterial rccombinase-mediated homologous recombination. The bacterial recombinase is preferably RecE/T and/or Reda/p. Methods can be used to clone, subclone, propagate, and amplify a polynucleotide or mixture of polynucleotides of interest using a vector comprising short regions of DNA homologous to sequences flanking a designated target DNA sequence of interest and an origin of replication. In one embodiment, the invention provides a method for introducing a double-stranded target DNA into a vector comprising culturing a bacterial cell that expresses a functional recombinase, said bacterial cell containing (a) the target DNA comprising a first double-stranded terminus and a second double-stranded terminus, and (b) a vector DNA comprising, in the following order along the vector DNA strand: (i) a first double-stranded homology arm (ii) an origin of replication; and (Hi) a second double-stranded homology arm, such that the sequence of a vector DNA strand of the first homology arm is homologous to the sequence of a target DNA strand of the first terminus, and the sequence of a vector DNA strand of the second homology aim is homologous to the sequence of die target DNA strand of the second terminus, such that the target DNA is inserted into the vector DNA between the homology arms. In another embodiment, a method is provided for making a recombinant DNA molecule comprising: a) introducing a double-stranded vector into a cell,said cell containing a double-stranded target DNA and expressing a bacterial recombinase, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3r along a vector DNA strand: a first homology arm, one strand of the origin of replication, and a second homology arm; said target DNA comprising a target DNA sequence and two termini, in the following order, from 3' to S1 along a target DNA strand: a first terminus, the target DNA sequence, and a second terminus, such that the sequence of the first homology arm on said vector DNA strand is homologous to the sequence of the first terminus on said target DNA strand, and the sequence of die second homology arm on said vector DNA strand is homologous to die sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. In another embodiment, a method is provided for making a recombinant • DNA molecule comprising: a) introducing a double-stranded vector and first and second double-stranded oligonucleotides into a cell, said cell containing a double-stranded target DNA and expressing a bacterial recombinase, said vector comprising an origin of replication and two double-stranded homology arms, in die following order from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication, and a second homology arm; said target DNA comprising a target DNA sequence and two double-stranded termini, in the following order, from 3' to 51 along a target DNA strand: a first terminus, a target DNA sequence, and a second terminus; said first oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3' to 5': a first nucleotide sequence and a second nucleotide sequence, said first nucleotide sequence being homologous to the nucleotide sequence of the first homology armon said vector DNA strand, and said second nucleotide sequence being homologous to the nucleotide sequence of the first terminus on said target DNA strand; said second oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5', a third nucleotide sequence and a fourth nucleotide sequence, said third nucleotide sequence being homologous to the nucleotide sequence of the second homology aim on said vector DNA strand and said fourth nucleotide sequence being homologous to the nucleotide sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. In another embodiment, a method Is provided for making a recombinant DNA molecule comprising: a) introducing a double-stranded target DNA molecule into a cell, said cell containing a vector and expressing a bacterial recombinase, said target DNA comprising a target DNA sequence and two double-stranded termini, in the following order, from 3* to 5' along a target DNA strand: a first terminus, a target DNA sequence, and a second terminus; said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the sequence of the first homology arm on said vector DNA strand is homologous to the sequence of the first terminus on said target DNA strand, and the sequence of the second homology arm on said vector DNA strand is homologous to the sequence of the second terminus on said target, DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. In another embodiment, a method i$ provided for making a recombinant DNA molecule comprising: a) introducing a double-stranded target DNA molecule and a first and second double-stranded oligonucleotide into a cell, said cell containing a vector and expressing a bacterial recombinase, said target DNA comprising a target DNA sequence and two termini, in the following order, from 3* to 5' along a target DNA strand: a first terminus, a target DNA sequence, and a second terminus; said first oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3' to S1: a first nucleotide sequence and a second nucleotide sequence, said first nucleotide sequence being homologous to the nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence being homologous to the nucleotide sequence of the first terminus on said target DNA strand; said second oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5', a third nucleotide sequence and a fourth nucleotide sequence, said third nucleotide sequence being homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth nucleotide sequence being homologous to the nucleotide sequence of the second terminus on said target DNA strand; and said vector comprising an origin of replication and two homology arms, in the following order-from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; and b) subjecting the ceil to conditions that allow intracellular homologous recombination to occur. In another embodiment, a method is provided for making a recombinant DNA molecule comprising: a) introducing a double-stranded vector and a double-stranded target DNA into a cell expressing a bacterial recombinase, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm, said target DNA comprising a target DNA sequence and two termini, in the following order, from 31 to 5' along a target DNA strand: a first terminus! a target DNA sequence; and a second terminus; such that the nucleotide sequence of the first homology arm on said vector DNA strand is homologous to the nucleotide sequence of the first terminus on said target DNA strand, and the nucleotide sequence of the second homology arm on said vector DNA strand is homologous to the sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. In a specific embodiment of this method the host cell further contains a nucleotide sequence encoding a site-specific recombinase operatively linked to a promoter, and the vector further comprises a first and second recognition site for the site-specific recombinase, a first recognition site located outside the first and second homology arms, and a second site-specific recombinase recognition site located inside the first and second homology amis; and during or after step b), inducing expression of the site-specific recombinase. In another specific embodiment of this method, the host cell further contains a nucleotide sequence encoding a site-specific endonuclease opeiatively linked to a promoter, and the vector father comprises a recognition site for the she-specific endonuclease located inside the first and second homology arms; and during or after step b), inducing expression of the site-specific endonuclease. In another embodiment, the inventions provides a method for making a recombinant DNA molecule comprising: a) introducing a double-stranded vector, a double-stranded target DNA molecule, and a first and second double-stranded oligonucleotide into a cell expressing a bacterial recombinase, said vector comprising an origin of replication and two double-stranded homology arms, in the following order from Sf to 3* along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; said target DNA comprising target DNA sequence and two double-stranded termini, in the following order, from 3* to 5' along a target DNA strand: a first terminus, a target DNA . sequence, and a second terminus; said first oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 31 to 51: a first nucleotide sequence and a second nucleotide sequence, said first nucleotide sequence being homologous to the nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence being homologous to the sequence of the first terminus on said target DNA strand; said second oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5\ a third nucleotide sequence and a fourth nucleotide sequence, said third nucleotide sequence being homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth nucleotide sequence being homologous to the nucleotide sequence of the second terminus on said target DNA stiaad; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. In a specific embodiment of this method, the host cell further contains a nucleotide sequence encoding a site-specific recombinase operatively linked to a promoter, and the vector further comprises a first and second recognition she for the site-specific recombinase, a first recognition site located outside the first and second homology aims, and a second site-specific recombinase recognition site located inside the first and second homology arms; and during or after step b), inducing expression of the site-specific recombinase. In another specific embodiment of this method, wherein the host cell further contains a nucleotide sequence encoding a site-specific endonuclease operativeiy linked to a promoter, and the vector further comprises a recognition she for the site-specific endonuclease located inside the first and second homology arms; and during or after step b), inducing expression of die she-specific endonuclease. In specific embodiments the vector further comprises a selectable marker located outside the homology arms, such that the vector comprises, in cither of the following two orders from 5' to 3' along a vector DNA strand: i) the first homology arm, the selectable marker, the origin of replication and the second homology arm, or ii) the first homology aim, the origin of replication, the selectable marker, and the second homology arm. In a specific embodiment, the selectable marker confers antibiotic resistance to the cell containing the vector. In various specific embodiments, the bacterial recombinase is RecE/T or Redo/p recombinase or both RecE/T and Reda/p. In other specific embodiments, the cell is a bacterial cell. In other specific embodiments, the cell is an £ coli cell. In other specific embodiments, the cell eukaryotic cell that recombinantly expresses RecE/T and/or Redo/p protein. In other specific embodiments, the method further comprises isolating a recombinant DNA molecule that comprises the target DNA inserted into the vector. In another embodiment, the invention provides a double-stranded DNA vector useful for directed cloning or subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5* to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the nucleotide sequence of the first homology arm on a first vector DNA strand is homologous to the sequence of the first terminus on a first target DNA strand, and the nucleotide sequence of the second homology aim on the first vector DNA strand is homologous to the nucleotide sequence of the second terminus on the first arget DNA strand. IN a specific embodiment of the vector, the origin of replication is a pacterial origin of replication. In another specific embodiment, the origin of replication [unctions in £ colu In another specific embodiment, the origin of replication functions in a mammalian cell. The invention further provides a cell comprising a double-stranded DNA vector useful for directed cloning or subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3'along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the nucleotide sequence of the first homology arm on a first vector DNA strand is homologous to the sequence of the first terminus on a first target DNA strand, and the nucleotide sequence of the second homology arm on the first vector DNA strand is homologous to the nucleotide sequence of the second terminus on the first target DNA strand In a specific embodiment, the cell is a bacterial cell. The invention further provides a kit useful for directed cloning or subcloning of a target DNA molecule comprising in one or more containers: a) a double-stranded DNA vector useful for directed cloning or subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the nucleotide sequence of the first homology aim on a first vector DNA strand is homologous to the sequence of the first terminus on a first target DNA strand, and the nucleotide sequence of the second homology arm on the first vector DNA strand is homologous to the nucleotide sequence of the second terminus on the first target DNA strand; and b) a cell containing a bacterial recombinase. In a specific embodiment of the kit, the homology arms have sequence homology to a BAC, PAC, lambda, plasmid or YAC based cloning vector. In another specific embodiment of the kit, the first and second double-stranded oligonucleotide have nucleotide sequence homology to a BAC, PAC, lambda, plasmid or YAC based cloning vector. In another embodiment, a kit useful for directed cloning or subcloning of a target DNA molecule is provided comprising in one or more containers: a) a double-stranded DNA vector useful for directed cloning and subcloning of a target DNA molecule following order from Sv to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; b) a first double~stranded oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3l to 5': a first sequence and a second sequence, said first nucleotide sequence being homologous to the nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence being homologous to the nucleotide sequence of a first terminus on a target DNA strand; c) a second double-stranded oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5': a third nucleotide sequence and a fourth nucleotide sequence, said third nucleotide sequence being homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth nucleotide sequence being homologous to the nucleotide sequence ofa second terminus on said target DNA strand; and d) a cell containing a bacterial recombinase. In a specific embodiment ofthe kit, Ac cell is an £co/icelL In another specific embodiment of the kit, the cell is a frozen cell competent for uptake of DNA. In another embodiment, the invention provides a kit useful for directed cloning or subcloning of a target DNA molecule comprising in one or more containers: a) a double-stranded DNA vector useful for directed cloning and subcloning ofa target DNA molecule of interest, said vector comprising an origin ofreplication and two homology arms, in the following order from 5* to 3' along a vector DNA strand: a first homology arm, the origin ofreplication and a second homology arm; b) a first double-stranded oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3' to 5'; a first nucleotide sequence and a second nucleotide sequence, said first nucleotide sequence being homologous to the nucleotide sequence ofthe first homology arm on said vector DNA strand, and said second nucleotide sequence being homologous to the nucleotide sequence ofa first terminus on a target DNA strand; and c) a second double-stranded oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to S1; a third nucleotide sequence and a fourth nucleotide sequence, said third nucleotide sequence being homologous to the nucleotide sequence ofthe second homology arm on said vector DNA strand and said fourth sequence being homologous to the nucleotide sequence of a second terminus on said target DNA strand. In a specific embodiment of the kit, the DNA vector is purified* In another embodiment of the kit, the DNA vector, the first double-stranded oligonucleotide, and the second double-stranded oligonucleotide are purified In other specific embodiments of kits provided by the invention, the target DNA molecule comprises bacterial, viral, parasite, or protozoan DNA. In other specific embodiments, the target DNA molecule comprises a genetic mutation or polymorphism known or suspected to be associated with a disorder or disease* In other specific embodiments, the bacterial recombinase is RecE/T or Redcc/p recombinase or both RecE/T and Redα/β recombinases. The methods of the invention may be used in diagnostics. For example, plasmids or linear DNA fragments may be designed to capture a specific DNA target to detect its presence in a sample from a subject e.g., a viral DNA present in a patient's sample. In one embodiment, the invention provides methods for detection of target DNA known or suspected to be associated with a disorder or disease when genetically mutated. In specific embodiments, the target DNA is a bacterial, viral, parasite, or protozoan DNA. In a specific embodiment, a method is provided which further comprise detecting a recombinant DNA molecule that comprises the target DNA inserted into the vector. In another embodiment, the method further comprises detecting a recombinant DNA molecule that comprises the target DNA inserted into the vector. In another embodiment, the invention provides a method of detecting the presence of an infectious agent wherein the target DNA is derived from a patient suspected of having the infectious disease, and the sequences of the first and second homology arms are homologous to the sequences present in DNA of die infectious agent In a specific embodiment, the target DNA is derived from a patient suspected of having the infectious disease, and said second and fourth nucleotide sequences arc homologous to sequences present in DNA of the infectious agent In other specific embodiments, the infectious agent is a virus, bacteria, protozoa, fungus, or parasite. In another embodiment, a method is provided for detecting the presence of a genetic condition, disease, disorder, or polymorphic trait, wherein the target DNA is derived from a patient suspected of having a genetic condition, disease, disorder, or polymorphic trait, and the sequence of the first homology arm is homologous to the sequence upstream from a site known or suspected to be associated with the genetic condition, disease, disorder, or polymorphic trait, and the sequence of the second homology arm is homologous to the sequence downstream from a site known or suspected to be associated with the genetic condition, disease, disorder, or polymorphic trait In a specific embodiment, a method is provided for detecting the presence of a genetic condition, genetic disease, genetic disorder, or polymorphic trait wherein the target DNA is derived from a patient suspected of having the genetic condition, genetic disease, genetic disorder, or polymorphic trait, and the sequence of the first double-stranded oligonucleotide is homologous to the sequence upstream from a site known or suspected to be associated with the genetic condition, genetic disease, genetic disorder, or polymorphic trait, and the sequence of the second double-stranded oligonucleotide is homologous to the sequence downstream from a site known or suspected to be associated with the genetic condition, genetic disease, genetic disorder, or polymorphic trait In a specific embodiment, the genetic condition, genetic disease, genetic disorder, or polymorphic trait is or predisposes the patient to cancer, asthma, arthritis, drug resistance, drug toxicity, or a neural, neuropsychiatry, metabolic, muscular, cardiovascular, or skin condition, disease or disorder. 4. DESCRIPTION OF THE FIGURES Figure 1A-C Components of the homologous recombination cloning and subcloning methods. A* The vector, comprising an origin of replication (origin), a selectable marker (Sm), and two homology arms (labeled A and B). B, Optional doublc-strandcd oligonucleotide adaptors. Each adaptor comprises a region of homology (labeled A1 and B') to the homology aims (A and B, respectively); and a second region of homology (labeled C and D') to a terminus of the target DNA (respectively labeled C and D). C, The target DNA. The terminal nucleotide sequences of the target DNA © and D) can either be homologous to nucleotide sequences of one of the homology aims of the vector (respectively labeled A and B), or to nucleotide sequences of the optional adaptor oligonucleotides (respectively labeled C and D'). Figure 2. Experimental outline of Approach 1. The vector for subcloning by homologous recombination is introduced, e.g., by transformation, into an £ coli host within which the target DNA and RecE/T or Redo/p proteins are already present Hie diagram shows a linear DNA molecule carrying an £ coli replication origin, and a selectable marker gene (Sm), which is preferably a gene whose product confers resistance to an antibiotic, flanked by "homology aims". The homology arms, are shown as thick grey blocks at the ends of the linear DNA molecule, are short regions of sequence homologous to two regions in the target DNA that flank the DNA region to be subcloned, called target DNA termini, arc shown as thick lines flanked by the homology arms. After transformation, selection for expression of the Sm gene is imposed to identify those cells that contain the product of homologous recombination between the homology arms of the linear DNA molecule and the target Figure 3. Diagrammatic representation of Approach 2. The approach is similar to that used in Figure 1, except in this case the target DNA molecule is not already present in the £ coli host, but, rather, is co-introduced with the linear DNA vector molecule. The target DNA can be any source, either, as illustrated, a mixture from which the DNA region of interest is cloned, or a highly enriched DNA molecule from which the DNA region is subcloned. As in Figure 1, the homology arms are shown in thick grey blocks. Figure 4. Diagrammatic representation of an example of Approach 3. The cloning or subcloning vector includes an £ coli origin of replication and a selectable marker gene (Sm) flanked by two short homology arms, shown as thick grey blocks. Additionally, the vector includes two recombination target sites (SSRTs) one of which is between the origin and the selectable marker gene. Most simply, the vector is constructed first as a linear DNA fragment as shown in the figure. Upon circularization, the second SSRT is located between the homology arms oriented as a direct repeat with respect to the first SSRT, so that site-specific recombination between the two SSRTs results in the production of two different circular molecules, thereby separating the origin and the selectable marker gene. The circularized vector is transformed into an E. coli strain within which RecE/T or Redo/p proteins is expressed, or can be expressed. The £ coli strain also carries an inducible site-specific recombinase (SSR) gene, the product of which recognizes the SSRTs in the vector so that site-specific recombination between the SSRTs does not occur until the site-specific recombinase gene is induced for expression. The & coli cells carrying the vector and the regulated site-specific recombinase gene are prepared so that they contain RecE/T or Redo/p proteins and are competent for transformation. DNA molecules containing the region to be cloned is then introduced into a host cell. After homologous recombination between the homology arms, expression of the site-specific recombinase protein is induced and selection for expression of the selectable marker gene is imposed. Before site-specific recombination, cells will contain either unrecombined vector carrying two SSRTs or the intended homologous recombination product which carries only one SSRT, since homologous recombination results in deletion of the SSRT located between the homology arms. After expression of the site-specific recombinase is induced, and selection for expression of the selectable marker is imposed, cells containing the product of homologous recombination will survive, since this product is no longer a substrate for site-specific recombination. Figure 5. Use of adaptor oligonucleotides for cloning and subcloning by RecE/T or Redo/p homologous recombination. The diagram illustrates a variation of Approach 2, shown in Figure 3, above. Two adapter oligonucleotides each contain two regions of homology, one to one of the homology arms of the vector and a second region of homology to one of the two termini of the target DNA region of interest. Circularization of the vector and cloning of the DNA region of interest is accomplished by homologous recombination between the vector and the adapters and between the adapters and the target DNA. In this embodiment the vector and the target DNA do not share sequence homology. Thus, the same vector may be used to clone or subclone different target DNAs by using target-specific adaptor oligonucleotides for each target DNA. Adapter oligonucleotides can also be used in the methods of Approaches 1 and 3, as outlined in Figures 1 and 3, above. Figure 6. An ethidium bromide stained agarose gel depicting DNA digested with EcoRI isolated from 9 independent colonies (lanes 1-9) obtained from the mAF4 BAC experiment Lane M, lkb DNA size standards (BRL, Bethesda, MD), Lane 10, EcoRI digestion of the starting vector. The experiment is described in detail in the Example in Section 6. Figure 7A-B. Cloning of a DNA region from a total yeast genomic DNA. A. A PCR fragment made to amplify the pl5A origin, and flanked by 98 or 102 bp homology arms to 98 or 102 bps either side of an integrated ampicillin resistance gene in the yeast strain, MGD 353-13D, is illustrated. The PCR product (O.Smg) was mixed with total yeast genomic DNA (4.0mg) and coelectroporated into JC5519 E. coli containing Reda/p expressed from pBADapy. Clones were identified by selection for ampicillin resistance. B. An ethidium bromide stained gel to confirm the correct products from 10 chosen colonies. Figure 8A-C. Effect of repeats or 5' phosphates present on the ends of the linear vector on ET subcloning. A. The sequences of the oligonucleotides used for PCR amplification of the linear vector are shown. Italicized sequence indicates the part of the oligonucleotide which is required for PCR amplification of the linear vector; the other nucleotides constitute the Homology arm to the £ coli iacZ gene. Sequences in bold were present on both extremes of the linear vector, and thus make up the terminal repeats. The linear vector constructs a-x have sequence repeats of various lengths. He linear vector contains theplSA replication origin plus the chloramphenicol resistance gene CML7 flanked by homology arms and the indicated terminal repeats. B. A schematic diagram of the strategy used to test the vector constructs containing the various sequence repeats of panel A for efficiency in ET subcloning the £ colilacZ gene. G. Table showing the effect of repeat length and phosphorylation on efficiency of ET subcloning. The results of tests using the vectors containing the repeated sequences shown in panel A arc shown. Figure 9A-B. ET recombination subcloning usign pBAD^xBy(\ct) A. Diagram of the pR6K/BAD/ofly plasmid, which contains die R6K origin, i the pir-116 rcplicon, the tetracycline resistance gene from pBR322 (reO> and the arabinose repressor (araC). B. Comparison of ET recombination subcloning using pBAD-afly(tet) (ColEl oxi) versus pRSK/BAD/oBy. Figure 10A-B. Subcloning of a 19kb fragment of the AF-4 gene prcsenton a BAG. A* Plasmid constructs and subcloning strategy. itf% the tetracyclin resistance gene. araC, arabinose repressor. B. Analysis of 5 independent colonies. An cthidium bromide stained gel of HindUI digested DNA prepared from 5 independent, correct colonies and the linear vector alone. Correct subclones were confirmed by DNA sequencing. M, 1 kb DNA ladder. Figure 11A-B. ET subcloning using genomic DNA as a source for the target DNA. A. Genomic DNA isolated from £. coli was prelinearized by Xhol digestion. Hhe linear vector consisted of the ColEl origin and the kanamycin resistance gene torn, lanked by homology aims which direct recombination to the ladllacZlocus present on the s. coli chromosome. B. Restriction analysis of 16 independent colonics, Lanel7 shows the linear vector. M, 1 kb DNA ladder. Figure 12A-B. Subcloning of the neomycin gen neo from mouse ES cell genomic DNA. A. Diagram of subcloning strategy B. Restriction analysis of kaaamycin resistant colonies- Figure 13. Combination of ET cloning and subcloning. 5. DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to methods and compositions for DNA cloning and subcloning using bacterial recombinase-xnediated homologous recombination. The inventor has discovered that bacterial recombinases may be utilized in a particular manner to achieve high-efficiency targeted cloning and subcloning. Preferably, the bacterial recombinase used is RecE/T and/or Reda/p, The RecE/T pathway in £ coli has been described previously and its components have been partially characterized (Hall and Kolodner, 1994, Proc. Natl. Acad. ScL U.S.A. 91:3205-3209; Gillen et a/., 1981, J- BacterioL 145:521-532). Recombination via the RecE/T pathway requires the expression of two genes, recE and recT, the DNA sequences of which have been published (Halle/ al.71993, J. BacterioL 175:277-278). The RecE protein is functionally similar to X exo, which is also called Reda, and the RecT protein is functionally similar to Redp and erf of phage P22 (Gtilen et a/., 1977, J. MoL Biol 113:27-41; Little, 1967, J. BioL Chem. 242:679-686; Radding and Carter, 1971, J. Biol. Chem. 246:2513-2518; Joseph and Kolodner, 1983, Biol. Chem. 258:10411-17; Josephand Kolodner, 1983, BioL Chem. 258:10418-24; Muniyappaand Radding, 1986, J. BioL Chem. 261:7472-7478; Kmiec and Hollomon, 1981, J. BioL Chem. 256:12636-12639; Poteete and Fenton, 1983, J. MoL BioL 163:257-275; Passy et aL, 1999, Proc. Natl. Acad. Sci. USA 96:4279-4284, and references cited therein). Described herein are methods and compositions relating to the use of bacterial recombinases for directed DNA cloning and subcloning. As used herein, the term "DNA cloning" refers to the process of inserting DNA from any source into an autonomously replicating vector so that it can be propagated in the host cell. The term "DNA subcloning" refers to the process of shuttling of DNA fragments already present in an autonomously replicating vector into another autonomously replicating vector, or shuttling DNA fragments from a highly enriched DNA molecule, such as a purified viral genome or a DNA fragment previously amplified by PCR, into an autonomously replicating vector. The term "directed" or "targeted" cloning and subcloning refers to the use of homology arms and, in various embodiments, adaptor oligonucleotides, to select a target DNA, and to direct the orientation of the insertion of the target DNA by the choice and the orientation of the homology arms. It should be noted that all applications of the methods of present invention apply to methods for both cloning and subcloning DNA. The construction of the compositions and methods of the invention are described in detail herein. In particular. Section 5.1 describes mediated recombination cloning methods of the invention for targeted cloning of DNA fragments by homologous recombination. Section 5.2, below, describes compositions of the invention, including DNA constructs designed to target, capture and clone target DNA fragments of interest Also described are nucleic acid molecules encoding bacterial recombinases such as RccE/T and/or Reda/p protons, cells comprising such compositions, and the methods for constructing such nucleic acids and cells. Section 5.3, below, describes the use of bacterial recombinase-targeted cloning methods and kits for detection of gene expression and diagnosis of disease conditions. 5-1 METHODS FOR CLONING AND SUBCLONING BY HOMOLOGOUS RECOMBINATION The various methods described herein can be used for efficient and targeted cloning of any DNA of interest by bacterial recombinase-mediated homologous recombination. The three approaches described herein have as common components a cell expressing bacterial recombinase recombination proteins, and a vector. An example of the vector is shown in Figure 1 A. The vector comprises three essential elements: an origin of replication and two short regions of double-stranded DNA, herein called 'homology arms'. The homology arms are specifically designed to allow the vector to 'capture' a target DNA of interest between the homology arms by homologous recombination. The sequence, position, and orientation of the homology arms are important for correct insertion of the target DNA between the arms. In one embodiment, where the homology arms have sequence homology to the termini of target DNA, the two homology arms correspond in sequence to DNA flanking the target DNA of interest, one arm (indicated as A in Figure 1) corresponding to a DNA sequence upstream from the target DNA (indicated as C in Figure 1) and the second arm (indicated as B in Figure 1) corresponding to a sequence located downstream from die target DNA (indicated as D in Figure 1). The orientation of the two arms relative to the desired insert must be the same as is the orientation of the homologous sequence relative to the target DNA (see Figure 1), such that recombination between the homology arms and the target DNA results in the target DNA being inserted between, or 'inside' (see Figure 1), the two homology arms. As used herein, a position is defined as being 'inside9 the homology arms if it is positioned between the two homology arms, such that a first homology arm is between die origin of replication and itself in one direction, and a second homology arm is positioned between the origin of replication and itself in the other direction. On the other hand, a position is defined as being "outside" the homology arms if, in one direction, neither homology arm separates itself from the origin of replication. Thus, by definition, the replication origin and the selectable marker are located on the vector 'outside' the homology arms (see Figure 1), so that insertion of the target sequence preserves the origin of replication and the selectable marker on the plasmid. On the other hand, the target DNA is, by definition, inserted 'inside' the homology arms. Figure 1A depicts pictorially the meaning of'inside* and 'outside' of the homology arms. In an alternative embodiment, the homology arms have sequence homology to a set of double-stranded adaptor oligonucleotides. Such adapter oligonucleotides are illustrated in Figure IB. The sequence of each adaptor oligonucleotide comprises the sequence of one of the homology arms of the vector, and additionally, a sequence homologous to a sequence that flanks the target gene of interest (see Figure 1Q. Thus, one adaptor oligonucleotide contains homology to DNA sequence of one homology aim (indicated as A' in Figure 1), and a nucleotide sequence upstream from the target DNA (indicated as C in Figure 1). The second adaptor oligonucleotide contains homology to a DNA sequence of one homology arm (indicated as B' in Figure 1), as well as a nucleotide sequence located downstream from the target DNA (indicated as D' in Figure 1). In this way, adaptor oligonucleotides may be used to adapt a generic homology cloning vector to target a specific gene sequence of interest by varying the sequence of the adaptor oligonucleotide (see Figure S). The methods and compositions that can be used to cany out the various embodiments of the invention are described in detail herein. The methods described below include three alternative approaches to directed cloning by homologous recombination. As described in detail below, each of the three approaches has its own advantages that make it preferred for a particular cloning application. These methods and applications are described in detail below. In one approach, depicted in Figure 2, the cloning vehicle is introduced into a cell that contains the target DNA of interest This first approach may be used to conveniently shuttle an insert from one replicon to another, without die need for cumbersome restriction analysis and in vitro manipulations. This approach is useful for applications in which the target DNA already exists in an £ coli replicon and its further use requires the subcioning of a chosen part For example, the use of a DNA clone isolated from a cosmid, phage or BAC library is facilitated by subcioning chosen portions into a new vector in order to sequence the insert or to express the protein encoded by the gene. In a second approach, depicted in Figure 3, the cloning vector and the target DNA of interest are prepared and then added together into a cell. Alternatively, as shown in Figure 4, the DNA of interest can be added to a cell that already contains the cloning vector. The latter two approaches are useful for applications in which the target DNA is derived from any external source, such as, for example, DNA derived from a cancer cell 5.1.1 APPROACH 1: INTRODUCTION OF VECTOR INTO HOST CELL CONTAINING TARGET DNA In one embodiment, as depicted in Figure 2, the target DNA sequence is already present within a host cell that expresses a bacterial recombinase. For example, the target DNA may reside on an independently replicating DNA molecule, such as, but not limited to, a plasmid, a phage, bacterial artificial chromosome (BAC) or the £ coli chromosome in an £ coli host cell. Methods for constructing host cells that express a bacterial recombinase such as RecE/T or Reda/p recombinase are described in detail in Section 5.2.2. The vector DNA, comprising an origin of replication and two homology arms located on either side of the origin and the marker, is introduced into the host cell. Preferably, the vector is a linear molecule and the homology arms are located at the respective ends of the linear molecule, although they may be internal. After entry into the cell, homologous recombination between the homology arms of the vector DNA and the target sequences results in insertion of target DNA between the homology arms, and the resultant formation of a circular episome. Cells are then plated on selective media to select for the selective marker present on the vector. Since only circularized molecules are capable of replicating and being selected for in the host cell, many of the cells that grow on selective media will contain recombined molecules including the target DNA. In one embodiment, the ends of the linear vector DNA fragment may be blocked with modified nucleotides, to reduce the number of events produced by joining of the ends of the linear fragments by any means other than homologous recombination, i.e, illegitimate recombination- Such modified nucleotides, e.g., phosphothionate nucleotides, may be incorporated into the 5'-end nucleotide of the homology arm. Modified nucleotides may be incorporated during oligonucleotide synthesis of a primer used to construct the • vector (see Section 5,2.1, below), or, alternatively, may be added by enzymatic or chemical modification of the oligonucleotide or linear vector DNA after synthesis. Methods for such modification of oligonucleotides and linear DNA fragments are well known in the art, and are described in detail in Section 5.2.2, below. 5.1.2 APPROACH 2: CO-INTRODUCTION OF VECTOR AND TARGET DNA INTO THE HOST CELL _— In another embodiment, as depicted in Figure 3, the vector DNA and the target DNA are mixed in vitro and co-introduced into a cell containing the RecE/T or Reda/p recombinases. The target DNA may be derived from any source. For example, the target DNA can be obtained from a biological sample, such as, but not limited to, whole blood, plasma, serum, skin, saliva, urine, lymph fluid, cells obtained from biopsy aspirate, tissue culture cells, media, or non-biological samples such as food, water, or other material. Methods for preparation of DNA from such sources are well known to those of skill in the art (see, e.g., Current Protocols in Molecular Biology series of laboratory technique manuals, 1987-1994 Current Protocols, 1994-1997 John Wiley and Sons, Inc.). The vector and the target DNA are prepared, mixed in vitro, and then co-introduced into cells expressing bacterial recombinase proteins, preferably by transformation in E. coli by co-clectroporation. The vector DNA may be in the form of linear DNA or a circular piasmid DNA. In a preferred embodiment, the vector is a linear DNA molecule. Hie source of target DNA is mixed in weight excess to, or excess, relative to the vector DNA, in order to introduce as many copies of die target DNA region of interest into the cell as possible, thereby maximizing the yield of recombinant products. Cells are grown in selective media to select for circularized products. In a preferred embodiment the vector contains an antibiotic resistance marker, and cells are grown in the presence of antibiotic. Colonies that are capable of growth under such selection will contain circularized, recombined forms of the linear fragment. In one embodiment, the ends of the linear vector DNA fragment may be blocked with modified nucleotides, as described below in Section 5.2.1. Methods for such modification of oligonucleotides are well known in the art, as described below in Section* 5.2.2. This approach is particularly useful where the target DNA is obtained from a source external to R coli, such as yeast or eukaryotic cells. In one embodiment, this method may be used for diagnostic purposes to detect the presence of a particular DNA in any biological specimen. For example, the method may be used to detect the presence of a specific estrogen receptor or BRCA 1 allele in a biopsy sample extracted from a breast cancer patienL In another embodiment, the method may be used to amplify regions of DNA as an alternative to amplification by polymerase chain reaction (PCR) techniques. Amplification by homologous recombination, cloning and propagation in £ coli offers several advantages over PCR-based techniques. First, PCR error can be a substantial drawback for many purposes. Combinations of pairs of PCR primers tend to generate spurious reaction products. Moreover, the number of errors in the final reaction product increases exponentially with the each round of PCR amplification after an error is introduced into a DNA sample. On the other hand, amplification by homologous recombination cloning has the advantage of the cellular proofreading machinery in E. coli and is thus at least 1000 times more faithful. Second, there are fewer restrictions on the size of the DNA region that may be amplified using the present method. Amplification of DNA regions longer than a few kilobases (greater than 5-10 kb) is difficult using PCR techniques. The present method is suitable for cloning much larger regions, at least to approximately one hundred kilobases. At present, cloning a genome involves the tedious processes of creating a large, random library followed by sorting through and ordering individual clones. Using this method, homology arms can be designed and vectors constructed to direct the cloning of a genome into large, non-redundant, contiguous clones, called 'contigs*. Third, even after DNA is produced by a PCR technique, the PCR products need to be cloned in an extra processing step. Homologous recombination cloning techniques obviates the need for the extra subcloning step. The region of DNA that is to be amplified is simply inserted between homology anus and transformed with the vector DNA into a & coli host The homologous recombination in this embodiment may be carried out in vitro, before addition of the DNA to the cells. For example, isolated RccE and RecT, or cell extracts containing RecE/T may be added to the mixture of DNAs. When the recombination occurs in vitro the selection of DNA molecules may be accomplished by transforming the recombination mixture in a suitable host cell and selecting for positive clones as described above* 5JL3 APPROACH 3: INTRODUCTION OF TARGET DNA INTO HOST CELLS CONTAINING VECTOR DNA In another embodiment, target DNA is introduced into a cell which already contains vector DNA Target DNA may be from any source, as described in 5.1 J! above, and may be either linear or circular in form. As described above, once the target DNA is inside the cell, homologous recombination between the homology aims and the target DNA results in the insertion of the target DNA between the homology aims. However, in this case, counter-selection is needed to select against uniccombined vector since both the desired product and the unrecombined vector expresses the selectable marker gene. Various embodiments axe described in detail herein to accomplish this counter-selection. In one embodiment, for example, a method that utilizes a site-specific recombination and excision reaction can be used. This approach is depicted in Figure 5. In another embodiment, an inducible nuclease is induced that cleaves the unrecombined vector. In both embodiments, the vectors that do not contain recombination products are eliminated. The vector is first constructed as a plasmid, then introduced into the host cell, where it can be propagated As shown in Figure5, the vector contains (i) an origin of replication (any origin); (ii) a selectable marker (Sm); (Hi) the two homology arms; and (iv) a counter-selectable marker, such as, but not limited to, a pair of recognition for a site-_ specific recombinase, a first recognition site located outside the homology arms and a second recognition site located inside the homology arms, or a recognition site for an endonuclease, which can be used to select against the starting plasmid vector. As used herein, a site is located 'inside' the homology arms if h is positioned between the two homology arms, such that a first homology arm is between the origin of replication and itself in one direction, and a second homology arm is positioned between die origin of replication and itselfin the other direction. On the other hand, a position is defined as being 'outside* the homology arms if, in one direction, neither homology arm separates itself from the origin of replication. (See Figure 1 for a pictorial representation of the meaning of 'inside' versus 'outside* die homology arms.) The origin of replication and the selectable marker must be located outside the homology arms, as described in Section 5.1 above, such that insertion of the target sequence preserves die origin of replication and the selectable marker on the plasmid. The counter-selectable marker, endonuclease site or one of two she-specific recombinase target sites is preferably located 'inside* the homology arms (see Figure 5), on the other side of the origin of replication and die selectable marker. Any method known in the art that allows for counter-selection against the non-recombined vector can be used. For example, in one embodiment, counter-selection can be accomplished by an inducible site-specific recombinase (SSR). Site-specific recombinases are enzymes that recognize two target sites, called she-specific recombinase target sites (SSRTs), and act at these sites to mediate a DNA strand exchange and excision reaction (Hallet ctal, FEMS Microbiol Rev., 1997,21:157-78; Sauer, 1994, Curr. Opin. BiotechnoL 5:521-7; Stark et ai71992, Trends GencL, 8:432-9). Examples of site-specific recombinases are known in the art, including, but not limited to Crc, Flp, Kw, or R recombinases (Nunes-Duby et al., 1998, Nucleic Acids Res. 26:391 -406; Ringrosc et al, 1997, Eur. J. Biochem. 248:903-912; Utatsu et a/.,1987, J. Bacterid. 169:5537-5545). When two directly repeated SSRTs reside on a circular plasmid, site-specific recombination between the two SSRTs results in the formation of two circular plasmids. Only the product containing the origin of replication is maintained in die cell. Thus, site-specific recombination between two directly repeated SSRTs in a circular plasmid results in deletion of the DNA sequence located between the two SSRTs on the side that does not include the origin of replication. A DNA vector is constructed containing two SSRTs, oriented as direct repeats, one positioned inside the homology arms, and a second positioned outside the arms and between the selectable marker (SM) and the origin of replication. Recombination between SSRTs positioned in this way results in separation of the origin of replication from the selectable marker (see Figure 5). Thus, the SSR will act on non-recombined DNA vectors, which contain two SSRTs, resulting in the loss of such plasmids from the host cell Host cells are then transformed with vector DNA by standard methods. In this embodiment the host cell must contain: 1) RecE/T and/or Reda/p genes and 2) a gene encoding an SSR. Preferably, the expression of RecE/T and/or Reda/p genes is inducible, but constitutive expression is also possible. The gene encoding a site-specific recombinase (SSR) that recognizes the SSRTs must be inducible. Inducible and constitutive promoters are well known in the art; methods for their use in construction and expression of recombinant genes are described in Section 5.2.3, below. If the RecE/T and/or Reda/p genes require induction for expression, the vector containing cells are grown under conditions to induce expression immediately before competent cells are prepared Host cells containing vector DNA are selected for and maintained by plating and growing in selective media. Competent cells are then prepared from the host cells containing the vector. Cells are transformed with the target DNA, which can be prepared from any source, e.& total genomic DNA prepared from any cell* The cells are cultured briefly, to allow homologous recombination to occur. Homologous recombination results in deletion of the sequence between the homology arms containing one SSRT, and the insertion of the target gene sequence. The expression oftheSSR is then induced. The SSR will act on the directly repeated SSRTs in the un-recombined vector, separating the selectable marker from the plasmid origin of replication. Plasxnids containing insert targets have only one SSRT and remain intact Selection may or may not be maintained throughout this step, but does need to be imposed soon after induction of the SSR, i.e., soon after the site-specific recombination takes place. In this way, induction of the SSR results in selecting for plasmids containing insert target genes. In an alternative embodiment, an endonuclease can be used to linearize the vector between the homology arms in vivo, either just before, during, or after homologous recombination. Linearization of the vector before recombination will select for correct recombination products, since a linear plasmid will not survive in the cell unless it becomes . circularized. After the recombination, the continued activity of the endonuclease will help select for plasmids containing inserts because during homologous recombination the SSR* deletes the endonuclease recognition site and inserts the target DNA in its place. Since the endonuclease will cleave only non-recombincd vectors, leaving plasmids with inserted target sequences intact, the continued activity of the endonuclease after recombination, selects against non-recombined products. For this embodiment, an endonuclease with a very rare recognition site must be used, so that no other sites will be present in the host cell DNA. Examples of such 'rare-cutters' are known in the ait, including, but not limited to, the lambda cos, yeast HO or an intron-encoded endonuclease such as Pl-Scel. The recognition site for the endonuclease should be cloned between the two homology arms, so that enzymatic digestion by the endonuclease results in linearization of the vector between the homology aims. The expression of the endonuclease gene must be inducible. Constructs and methods for inducible protein expression are discussed below, in Section 5,23. In another embodiment, an SSR, for example, the Cre rccombinase can be used, instead of an endonuclease, to linearize the unrtcoxnbined vector in vivo (see Mullins et a/., 1997, Nucleic Acids Res.25:2539-40). In this case, the vector is constructed with only one SSRT site located inside the homology arms. An excess of oligonucleotide containing a copy of the same SSRT is oligonucleotide is mixed with the target DNA and co-transformed into the host with the target DNA. Preferably, the oligonucleotide is a short double-stranded DNA molecule. Where one oftherecombining molecules has an SSRT residing on a short oligonucleotide, the site-specific recombinase will linearize the vector at its SSRT (Mullins et aL, 1997, supra). In another embodiment, the site-specific recombination and endonuclease approaches described above can be combined In this case, the unrecombined vector is made to contain both an SSRT and an endonuclease site inside the homology arms. In one embodiment of this approach, the SSR and the endonuclease could be co-regulated under the control of a single inducible promoter. Constructs and methods for such co-regulated, inducible expression of proteins in discussed in Section 5.2.3, below. In another embodiment, a combination of these uses of site-specific recombination for counter-selection can be employed. In this embodiment, two pairs of SSR/SSRTs are employed, for example Cre/lox and Flp/FRT. The vector contains two sites for the first SSR, SSR1, one located inside the homology arms, and the second located outside the homology arms, between the origin of replication and the selectable marker. In addition, the vector contains a site for die second SSR, SSR2, located inside the homology aims. Another site for SSR2 is located on short double-stranded oligonucleotides and are added along with target DNA during cell transformation, at an amount in excess to the target DNA. In a specific embodiment, for example, one SSR/SSRT pair for the linearization step is Cre/IoxP and the second one for the deletion step is Flp/FRT. In another embodiment, a direct counter-selection against the cell may be used. In this case the plasmid origin of replication directs single-copy (or very low copy) maintenance in E. colt Origins of replication of this class include the iteron-class of origins such as the phage PI origin, and plasmids based on the £ coli chromosomal origin, oriC. For suitable origins of replication, sec Hciinski, D.R, Toukdarian, A.E, Novick, R.P. Chapter 122, pp 2295-2324 in "Escherichia coli and Salmonella, Cellular and Molecular Biology" 20d edition Frederick C Niedhardt, Ed ASM Press, Washington, 1996, ISBN 1-55581-084-5. Indus case, the vector can be constructed without any SSRTs, rather a counter-selectable gene is included between the homology aims. Such counter-selectable marker genes are known in the art, for example, the sacB, ccdB or tetracycline resistant genes may be used (see also, Rcyrat etdL, 1998, Infect, Immun. 66:4011-7 for a listing of suitable counter-selectable genes and methods). The intended homologous recombination reaction will delete the counter-selectable gene so that cells carrying the intended recombination product will survive under counter-selection pressure, whereas ceils carrying the unrecombined vector will be killed. 52 COMPOSITIONS FOR CLONING AND SUBCLONING BY HOMOLOGOUS RECOMBINATION Compositions for cloning by homologous recombination in the various embodiments are described herein. For each of the cloning methods described in Section 5.2 below, three components are required to coexist in a single cell: first, a vector carrying two short regions of DNA (herein called 'homology arms'), having sequence homology to a target sequence; second, RecE/T and/or Redoc/p protein pairs or other bacterial rccombinasr, and third, the target DNA sequence. Recombination between these homologous sequences present on the homology arms and the flanking regions of the target gene, mediated by a bacterial recombinase, results in the target DNA being inserted or 'captured' between the two homology arms. The compositions and the methods for their construction are described in detail herein. 5.2.1 THE HOMOLOGY CLONING VECTOR The homology cloning vector may be a linear or circular DNA vector comprising an origin of replication, a selectable marker, and two short regions of DNA designed to capture a target DNA of interest Several forms of cloning vehicles are possible, depending on the approach or method to be used. The preferred forms and methods for their construction are depicted in Figures 1-5* and described in detail herein. 52.LI THE QMCT* QF RBPLICATKON The vector requires an origin of replication, which is needed for replication and propagation of the plasmid. For cloning and propagation in £ coli, any E. coli origin of replication may be used, examples of which are well-known in the art (see, Miller, 1992, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, NY, and references therein). Non-limiting examples of readily available plasmid origins of replication are ColEl-derived origins of replication (Bolivar et al„ 1977, Gene 2:95-113; see Sambrook et a/., 1989, supra), pi 5A origins present on plasmids such as pACYC 184 (Chang and Cohen, 1978, J.BacterioL 134:1141-56; see also Miner, 1992, p. 10.4-10.11), and pSClOl origin available for low-copy plasmids expression are all well known in the art For example, in one embodiment, the origin of replication from a high-copy plasmid is used, such as a plasmid containing a ColEl-derived origin of replication, examples of which are well known in the art (see Sambrook et aL91989, supra; see also Miller, 1992, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, NY, and references therein). One example is an origin from pUCl 9 and its derivatives (Yanisch-Perron et a/., 1985, Gene 33:103-119). pUC vectors exist at levels of 300-500 copies per cell and have convenient cloning sites for insertion of foreign genes. For very * high expression, X vectors, such as Agtl 1 (Huynh et aL$ 1984, in MDNA Cloning Techniques:, Vol I: A Practical Approach", D. Glover, cd., pp 49-78, IRL Press, Oxford), or the T7 or SP6 phage promoters in cells containing T7 and Sp6 polymerase expression systems (Studier et al% 1990, Methods EnzymoL 185:60-89) can be used. When a lower level of expression is desired, an origin of replication from a medium or a low-copy may be used. Medium-copy plasmids are well known in the art, such as pBR322, which has a ColEl derived origin of replication and 20-100 copies per cell (Bolivar et aL, 1977, Gene 2:95-113; sec Sambrook et al, 1989, supra), or pACYCl84, one of the pACYClOO series of plasmids, which have a pi 5 A origin of replication and exist at 10-12 copies per cell (Chang and Cohen, 1978, J.Bacteriol. 134:1141-56; sec also Miller, 1992, p. 10.4-10.11), Low-copy plasmids arc also well known in the art, for example, pSClOl, which has a pSClOl origin, and approximately 5 copies per cell. Both pACYC and pSClOl plasmid vectors have convenient cloning sites and can co-exist in the same cell as pBR and pUC plasmids, since they have compatible origins of replication and unique selective antibiotic markers. Other suitable plasmid origins of replication include lambda or phage PI rcplicon based plasmids, for example the Lorist series (Gibson et al.t 1987, Gene 53:283-286). When even less expression is desired, the origin of replication may be obtained from the bacterial chromosome (see Miller, 1992, supra; Niedhardt, F.C., ed, 1 1987, Escherichia coli and Salmonella typhimurium, American Society for Microbiology, Washington, D.C; Yarmolinsky, M.B. and Sternberg, N., 1988, pp. 291*438, in Vol. 1 of The Bacteriophages, R. Calendar, ed., Plenum Press, New York). In addition, synthetic origins of replication may be used &2.L2 THE SELECTABLE MARKER To maintain the plasmid vector in the cell, the vector typically contains a selectable marker. Any selectable marker known in the art can be used. For construction of an £ coli vector, any gene that conveys resistance to any antibiotic effective in £ coli, or any gene that conveys a readily identifiable or selectable phenotypic change can be used Preferably, antibiotic resistance markers are used, such as the kanamycin resistance gene • from TN903 (Friedrich and Soriano, 1991, Genes. Dcv. 5:1513-1523), or genes that confer resistance to other aminoglycosides (including but not limited to dihydrostreptomycin, gentamycin, neomycin, paromycin and streptomycin), the p-lactamase gene from IS1, that confers resistance to penicillins (including but not limited to ampicillin, carbenicillin, methicillin, penicillin N, penicillin O and penicillin V). Other selectable genes sequences including, but not limited to gene sequences encoding polypeptides which confer zeocin resistance (Hegcdus et al 1998, Gene 207:241-249). Other antibiotics that can be utilized axe genes that confer resistance to amphenicols, such as chloramphenicol, for example, the coding sequence for chloramphenicol transacetylase (CAT) can be utilized (Eikmanns et al. 1991, Gene 102:93-98)* As will be appreciated by one skilled in the art, other non- antibiotic methods to select for maintenance of the plasmid may also be used, such as, for example a variety of auxotrophic markers (see Sambrook et aL, 1989, supra\ Ausubel et al,, supra). S.2,1.3 THE HOMOLOGY ARMS A required component of the vector is two short regions of double-stranded DNA, referred to herein as "homology arms1* In one embodiment, as shown in Figure 1, the two homology aims (labeled "A" and "B") art homologous to the sequence of the DNA flanking the target DNA of interest (labeled A1 and B')» one arm being homologous to a DNA sequence upstream from the target DNA and the second arm being homologous to a sequence located downstream from the target DNA. As used herein, two double-stranded DNA molecules axe "homologous" if they share a common region of identity, optionally interrupted by one or more base-pair differences, and are capable of functioning as substrates for homologous recombination. In a preferred embodiment, the homology arms contain approximately 22 to 100 base pairs or more of continuous identity to a double-stranded region flanking target DNA of interest Regions of homology can be interrupted by one or more non-identical residues, provided that the homology arms are still efficient substrates for homologous recombination. In & preferred embodiment, for optimum recombination efficiency, homology arms are approximately 50 nucleotides in length, with in the range of 20-30 (e.g., 25) base pairs of continuous, uninterrupted, sequence identity. Although shorter regions of continuous identity are also possible (e.g., at least 6,8, or 10 base pairs), lower efficiencies of recombination can be expected using such shorter regions of continuous identity. For example, in one embodiment, the length of continuous identity may be as short as 6 bp (Kcim and Lark, 1990, J. Structural Biology 104:97-106). There is 1 no upper limit to length of homology arms or the length of their continuous identity to the flanking target DNA sequence. Nucleotide sequences flanking a target DNA also are referred to herein as the "termini" of the target DNA. Thus, a target DNA will have two-termini, a first terminus and second terminus. The orientation of the two arms relative to the desired insert must be the same as is the orientation of the homologous sequence relative to the target DNA (see Figure 1), so that recombination between the homology arms and the first and second termini of the target DNA results in die target DNA being inserted between the two homology arms. The sequences of the two homology aims ait chosen according to the experimental design. The only limitations on the choice of an homology arm is that it should not be a sequence found more than once within the target DNA and should not be present elsewhere in the host cell during the homologous recombination reaction. In this case, the intended homologous recombination product can still be obtained, however amongst a background of alternative homologous recombinations events. In one embodiment, the sequence of the homology anus are two sequences flanking die polylinkcr of a commonly used cloning vehicle such as a BAC, PAC, YAC (yeast artificial chromosome), phage cloning vectors such as the &EMBL or A.GT series, phageznid, cpsmid, pBR322, pGEM, pGEX, pET, baculovirus vectors, viral vectors such as adenoviral vectors and adeno-associated viral vectors. Thus, a single vector can be used to subclone any insert that has been cloned in these vectors. Vectors containing such homology arms are particularly useful for subcloning inserts derived from positive clones from a DNA library, such as a BAC, PAC, YAC, cosmid or lambda library. In various embodiments, as described hereinbelow, the homology arms are positioned at the ends of a linear DNA molecule, or within a linear DNA molecule or circular DNA plasmid vector. Homology arms are oriented in the same orientation relative to their * orientation in the target nucleotide sequence. In other words, they are oriented so the desired DNA sequence is inserted between the arms after the recombination takes place. Where the homology arms are positioned at the ends of the linear DNA the inserted DNA sequence is captured and inserted between the two arms, thereby creating a circular and replicable plasmid 5.2J.4 ADAPTER OLIGONUCLEOTIDE HOMOLOGY ARMS In an alternative embodiment, the nucleotide sequence of the homology arms is homologous to nucleotide sequences present on adaptor oligonucleotides. Each of two adaptor oligonucleotides comprise a nucleotide sequence homologous to nucleotide sequences present on one of the homology arms, and a second region of homology that is homologous to one of the two termini of the target DNA. Adaptor oligonucleotides are depicted in Figure 1, The homology arms of the vector are labeled "A" and "BM, and regions of the adaptor oligonucleotide homologous to these sequences are labeled A' and B'. The two termini of target DNA arc labeled "C" and "D", and the corresponding homologous sequences present on the adaptor oligonucleotides are labeled C and D\ In this embodiment, recombination mediated by RecE/T or Redoc/p between the vector homology arms, the region of homology on the adaptor oligonucleotides, and the flanking termini of the target gene results in the target DNA being inserted or 'captured1 between the homology arms of the vector. 5.2.1.5 CONSTRUCTION OF THE VECTOR The linear fragment or circular vector may be constructed using standard methods known in the art (see Sambrook etal.,1989, supra; Ausubel et ai, supra). For example, synthetic or recombinant DNA technology may be used. In one embodiment, the linear fragment is made by PCR amplification. In this method, oligonucleotides are synthesized to include the homology arm sequences at their 5' ends, and PCR primer sequences at their 3' ends* These oligonucleotides are then used as primers in a PCR amplification reaction to amplify a DNA region including an origin of replication and a selectable genetic marker. In anotherembodiment, a plasmid may be constructed to comprise two appropriately oriented homology arms flanking an origin of replication and a selectable genetic marker by standard recombinant DNA techniques (see e.g., Methods in Enzymology, 1987, Volume 154, Academic Press; Sambrook et aly 1989, Molecular Cloning - A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, New York; and Ausubel et a/., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, New York). The plasmid is then linearized, for example, by restriction endonuclease digestion. In another embodiment, for example, the following method may be used to construct the vector DNA used in Section 5.1.3, above. Two oligonucleotides are synthesized, one of which includes, from 5' to 3' end, a restriction site unique to the vector, a left homology arm and a PCR primer. Hie other oligonucleotide includes, from 5* to 3' end, the same restriction site unique to die vector, an SSRT, a right homology arm and a PCR primer. The two homology arms are chosen to flank the target DNA. The SSRT is a site recognized by any site specific rccombinase (SSR) such as Cre, Flp, Kw, or R recombinases. Hie synthesis of the oligonucleotide must be designed so that the two SSRTs are orientated as directed repeats in die vector. Two PCR primers are used amplify a DNA template that includes a plasmid origin, a selectable gene and an identical SSRT between the origin and the selectable gene. The product of the PCR reaction is then cut with the restriction enzyme that recognizes the sites included at the 5 • ends of the oligonucleotides to permit efficient cixcularization by ligation. The circular product is then transformed into £1 coli for amplification to yield large amounts of the vector. In another embodiment, a linear fragment is constructed by taking plasmid with selectable marker, an origin and two cloning sites, and cloning in an oligonucleotide homology arm into each cloning site. Restriction enzymes are then used to cut the plasmid DNA to produce linear fragment bounded by die homology arms. This method is preferred for construction of more complex plasmids - e.g. plasmids containing eukaryotic enhancer and promoter elements in order to include eukaryotic expression dements. Additionally, other sequence elements may be subcloned into the vector. The vector may also contain additional nucleotide sequences of interest fox* protein expression, manipulation or maintenance of die inserted target DNA. For example, promoter sequences, enhancer sequences, translation sequences such as Shine and Dalgamo sequences, transcription factor recognition sites, Kozak consensus sequences, and termination signals may be included, in the appropriate position in the vector. For recombination cloning in cells other than bacterial cells, such as plant, insect, yeast or mammalian cells, other sequence elements may be necessary, such as species-specific origins of replication, transcription, processing, and translation signals. Such elements may include, but are not limited to eukaryotic origins of replication, enhancers, transcription factor recognition sites, CAT boxes, or Pribnow boxes. In an embodiment wherein RecE/T and/or Reda/p or other bacterial recombinase is produced recombinantly from an expression plasmid in the cell, the chosen vector must be compatible with the bacterial recombinase expression plasmid described in Section 5.2.3, below. One of skill in the art would readily be aware of the compatibility requirements necessary for expressing multiple plasmids in a single cell. Methods for propagation of two or more constructs in procaryotic cells are well known to those of skill in the art For example, cells containing multiple replicons can routinely be selected for and maintained by utilizing vectors comprising appropriately compatible origins of replication and independent selection systems (see Miller etat.,1992, supra; Sambrook etal.,l989, supra). 5-2.2 BACTERIAL RECOMBINASES The invention described herein is described mainly with reference to the use of RecE/T and/or Reda/p. However, as will be clear to the skilled artisan, the invention is equally applicable to the use of other bacterial recombinases that have the ability to mediate homologous recombination using a pair of homologous double-stranded DNA molecules as substrates. As used herein, a bacterial recombinase is a recombinase that is expressed endogenously in bacteria, whether of phage or bacterial origin, and is capable of mediating homologous recombination. In various embodiments, the bacterial recombinase is RecE/T and/or Reda/p recombinase. In another specific embodiment, a functionally equivalent system for initiating homologous recombination comprises erf protein from phage P22. Further, individual protein components of bacterial recombinases can be substituted by other functional components for use in the present invention. "RecE" and "RecT as used herein, refers first, to E. coli, e.g., E. coli KJ2, RecE or RecT. The E coli RecE and RecT nucleotide and amino acid sequences are well known (RecE, GenBank Accession No. M24905 and SWISS-PROT Accession No. P15033; RecT, GenBank Accession No. L23927 and SWISS-PROT Accession No. P33228). "Rediz" and "Redp" refer to the phage lambda encoded proteins. Reda has a 5' to 3f exonuclcase activity similar to the 5* to 3' exonucleasc of RecE, and Redp has a DNA annealing activity similar to that of RecT. Nucleotide and amino acid sequences are well known for both of these lambda proteins (sec GcnBank Accession Nos. J02459; M17233). As will be clear to the skilled artisan, reference to RecE/T and/or Reda/p herein shall also apply to a combination of RecET and Reda/p, unless indicated otherwise explicitly or by context In a specific embodiment, combination of the two enzyme complexes has a synergistic effect on the efficiency of recombination. Bacterial recombinases that can be used also include allelic variants of the components of the recombinases. For example, amino acid sequences utilized in the RecE/T and Reda/p recombination systems of the invention can also comprise amino acid sequences encoded by any allelic variants of RecE, RecT. Rcda, or Redp, as long as such allelic variants are functional variants, at least to the extent that they exhibit homologous recombination activity. Allelic variants can routinely be identified and obtained using standard recombinant ONA techniques (see e.g., Methods in Enzymology, 1987, volume 154, Academic Press; Sambrook et al.t 1989, Molecular Cloning - A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, New York; and Ausubel et a!., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, New York), or protein evolution approaches (Jennutus etal, 1998, Cum Opin. Biotechnol. 9:534*548). In general, nucleic acid encoding such allelic variants should be able to hybridize to the complement of the coding sequence of RecE, RccT, Rcda, or Redp under moderately stringent conditions (using, e.g., standard Southern blotting hybridization conditions, with the final wash in O^xSSC/0.1% SDS at 42°C; Ausubel ef a/., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York, at p. 2.10.3), or highly stringent hybridization conditions (using, e.g., standard Southern blotting hybridization conditions with the final wash in 0.1xSSC/(U%SDS at 68°C; Ausubel ef ai, supra). RecE, RecT, Redo, and Redp, as used herein also includes RecE, RccT, Rcda, and Redp homologs derived from the phages hosted by, or the cells ofc procaryotic cells of the family Enterobacteriaceae. Members of the family Enterobacteriaceae include, but are not limited to species of Escherichia, Salmonella, Citrobacter, Klebsiella^ and Proteus. Such RecE, RecT, Reda, or Redp homolog is, generally, encoded by a gene present in a phage genome whose product participates in a recombination-mediated step in the phage life cycle, such as Reda and Redp in the life cycle of lambda phage. RecBT homologs can routinely be identified and obtained using standard procaryotic genetic and recombinant DNA techniques (see e.g., Sambrook et al.t supra., and Ausubel et ai, supra). Recombinant DNA may be obtained from a cloned genomic or cDNA library, or by PCR amplification. For example, a genomic library may be produced by standard molecular biological techniques, or obtained from commercial or noncommercial sources. The genomic or cDNA library may then be screened by nucleic acid hybridization to a labeled R coli recE or reel probe (Grunstein and Hogness, 1975, Proc. 1 Natl. Acad. Sci. U.S.A. 72:3961) and positive clones can be isolated and sequenced. In a specific example, a RecE or RecT homolog can routinely be identified in Salmonella typhimurium. The recE and recT genes are well characterized in £ coli K-12; the nucleotide and protein sequences of both RecE (GenBank Accession No. M24905 and SWISS-PROT Accession No. PI 5033) and RecT (GenBank Accession No. L23927 and SWISS-PROT Accession No. P33228) are known; (see also Bachmann, 1990, Microbiol. Rev, 54:130-197; Rudd, 1992, in Miller, 1992, supra, pp. 2.3-2.43). A complete & typhimurium genomic cosmid or k library may be used. The S. typhimurium library may then be screened by hybridization with an E. coli RecE or RecT probe utilizing hybridization conditions such as those described above. For example, since the two genes are expected to be highly homologous, standard moderately stringent hybridization conditions are preferred. In one embodiment, such conditions can include the following; Filters containing DNA can be pretreated for 6 hours at 55 °C in a solution containing 6X SSC, 5X Denhart's solution, 0.5% SDS and 100 ng/ml denatured salmon sperm DNA. Hybridizations can be carried out in the same solution and 5*20 X 10* cpm "P-labeled probe is used Filters can be incubated in hybridization mixture for 18-20 hours at 55 °C, and then washed twice for 30 minutes at 60°C in a solution containing IX SSC and 0.1% SDS. Filters are then blotted dry and exposed to X-ray film for autoradiography. Other conditions of moderate stringency which may be used are well-known in the art. Washing of filters is done at 37°C for 1 hour in a solution containing 2X SSC, 0.1% SDS. Subsequent isolation, purification and characterization of clones containing the 51 typhimwium can be performed by procedures well known in the art (see Ausubel et al, supra). Such sequences can be used to construct the S. typhimurium RecE/Ts of the invention. Alternatively, the S. typhimurium gene can be isolated from 5. typhimurium mRNA. mRNA can be isolated from cells which express the RecE or RecT protein. A cDNA library may be produced by reverse transcription of mRNA, and screened by methods known in the art, such as those described above for screening a genomic library (see Ausubel et al., supra). Alternatively, recE or recT cDNA can be identified by PCR techniques, such as RACE (Rapid Amplification of cDNA Ends; Ausubel et al, supra), using two primers designed from the E coli recE or recT sequence: a "forward* primer having the same sequence as the 5r end of the E coli recE or recT mRNA, and a "reverse" primer complementary to its 3* end. The PCR product can be verified by sequencing, subcloned, and used to construct the RecE/T of the invention. Such cDNA sequences can also be used to isolate £ typhimurium genomic recE or recT sequences, using methods well known in the art (Sambrook et aL, 1989, supra; Ausubel etaL, supra): Nucleic acid molecules encoding the RecE/T recombination enzymes of the invention can, further, be synthesized and/or constructed according to recombinant and synthetic means well known to those of skill in the art (Sec e.g., Sambrook, supra and Ausubel et al, supra). As discussed below, the ability to control the expression of the sequences such that expression can be rcgulatable {e.g. inducible) and such that a wide range of expression levels can be achieved is beneficial to the performance of die methods of the invention. The nucleic acid molecules can, for example, be maintained extrachromosomally, e.g., on a plasmid, cosmid or a bacteriophage. Alternatively, the nucleic acid molecules can be integrated into the chromosome, e.g., £ coli chromosome, utilizing, for example, phage transduction or transposition. Thus, the RecE/T coding sequences can be engineered by standard techniques to be present in high copy, low copy or single copy within each cell. A variety of different regulatory sequences can be also utilized for driving expression of the recombination proteins. Each of these aspects of expression/strain construction can be manipulated to yield cells exhibiting a wide range of recombination protein expression levels. It is to be noted that single copy chromosomal versions of the recombination protein coding sequences are additionally advantageous in that such a configuration facilitates construction of strains. 5.2.2.1 PROTEIN EXPRESSION The bacterial recombinase may be expressed either constitutively or indutibly in bacterial, yeast, insect, or mammalian cells. In a preferred embodiment, recombination proteins are expressed in a bacterial, most preferably, £ coli strain. For example, die host cell may comprise the recE and red genes located on the host cell chromosome. Examples of £ coli strains in which the expression of RecE/T is endogenous are known, for example, £ coli sbcA strains (Zhang et al, 1998, supra). Alternatively RecE/T may be recombinant^ expressed from non-chromosomal DNA, preferably on a plasmid vector, e.g., pBADETy (Zhang et al., 1998, supra) or pGETrec (Narayanan et al., 1999, Gene Thcr. 6:442-447. Similarly Reda/p can be endogenous to strains that have integrated k prophage, or expressed from plasmids, for example pBADapy (Muyrers et a/., 1999, supra). RecE/T and/or Reda/p expression constructs can be constructed according to standard recombinant DNA techniques (see e.g., Methods in Enzymology, 1987, volume 154, Academic Press; Sambrook et aL 1989, Molecular Cloning - A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, New York; and Ausubel et al. Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, New York, each of which is incorporated herein by reference in its entirety). In one embodiment, RecE/T and/or Reda/p is expressed in £ coli from a high-copy plasmid such as a plasmid containing a ColEl-derived origin of replication, examples of which are well known in the ait (see Sambrook et al., 19S9, supra; see also Miller, 1992, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, NY, and references therein), such as pUC19 and its derivatives (Yanisch-Perron et al., 1985, Gcnc22:103-119). With respect to regulatory controls which allow expression (either regulated or constitutive) at a range of different expression levels, a variety of such regulatory sequences are well known to those of skill in the art The ability to generate a wide range of expression is advantageous for utilizing the methods of the invention, as described below. Such expression can be achieved in a constitutive as well as in a regulated, or inducible, fashion. Inducible expression yielding a wide range of expression can be obtained by utilizing a variety of inducible regulatory sequences. In one embodiment, for example, the loci gene and its gratuitous inducer IPTG can bp utilized to yield inducible, high levels of expression of RecE/T when sequences encoding such polypeptides are transcribed via the lacOP regulatory sequences. RecE and RecT may be expressed from different promoters, or alternatively, * the recE and recT genes may be expressed on a polycistronic mRNA from a single promoter. Such heterologous promoters may be inducible or constitutive. Preferably the expression is controlled by an inducible promoters. Inducible expression yielding a wide range of expression can be obtained by utilizing a variety of inducible regulatory sequences. In one embodiment, for example, the loci gene and its gratuitous inducer IPTG can be utilized to yield inducible, high levels of expression of RecE/T when sequences encoding such polypeptides are transcribed via the lacOP regulatory sequences. A variety of other inducible promoter systems are well known to those of skill in the art which can also be utilized. Levels of expression from RecE/T or Redoc/P constructs can also be varied by using promoters of different strengths. Other regulated expression systems that can be utilized include but are not limited to, the araC promoter which is inducible by arabinose (AraC), the TET system (Geissendorfer and HUlen, 1990, Appl. Microbiol. BiotechnoL 33:657-663), the pi promoter of phage X temperature and the inducible lambda repressor CISS7 (Pixrotta, 1975, Nature 254: 114-117; Petrcnko et al.y 1989, Gene 78:85-91), the trp promoter and trp repressor system (Bennett era/., 1976, Proa Natl. Acad. Sci USA 73:2351-55; Wamc etal., 1986, Gene 46:103-112), the lacUV5 promoter (Gilbert and Maxam, 1973, Pipe. Natl. Acad, ScL USA 70:1559-63), //p (Nokamura etal., etal., 1982,J.MoL AppLGen. 1:289-299), the T7gene-10 promoter, phoA (alkaline phosphatase), recA (Horii et a!. 1980), and the tac promoter, a trp-lac fusion promoter, which is inducible by tryptophan (Amann et a/., 1983, Gene 25:167-78), for example, arc all commonly used strong promoters, resulting in an accumulated level of about 1 to 10% of total cellular protein for a protein whose level is controlled by each promoter. If a stronger promoter is desired, the tac promoter is approximately tenfold stronger than lacUV5t but will result in high baseline levels of expression, and should be used only when overexpression is required If a weaker promoter is required, other bacterial promoters are well known in the art, for example, maltose, galactose, or other desirable promoter (sequences of such promoters are available from Genbank (Burks etaL 1991, Nucl. Acids Res. 19:2227-2230). Cells useful for the methods described herein are any cells containing RecE/T and/or Redo/p recombinases. Preferably, the host cell is a gram-negative bacterial celL More preferably, the host cell is an entero-bacterial celL Members of the family Emcrobacteriaceae include, but are not limited to, species of Escherichia, Salmonella* CUrobacter, Klebsiellae, and Proteus. Most preferably the host cell is an Escherichia coli celL Cells can also be derived from any organism, including, but not limited to, yeast, fly, mouse, or human cells, provided they can be engineered to express a suitable recombinase. The recombinase is preferably RecE/T recombinase derived from E coli, or Redo/p recombinase derived from phage X, or a functionally equivalent RecE/T or Redo/p recombinase system derived from Enierobacteriaceae or an Enierobacteriaceae phage, wherein such systems can mediate recombination between regions of sequence homology. Cells expressing RccE/T and/or Redo/p proteins may be made electrocompetent in advance and stored at -70°C. Alternatively, the methods of the invention may be carried out in any other cell type in which expression of RccE/T and/or Redo/p is possible. For example, a variety of host-vector systems may be utilized to express the protein-coding sequence. These include but are not limited to mammalian cell systems infected with virus {e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (eg., baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed with' bacteriophage, DNA, plasmid DNA, or cosmid DNA, The expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used In specific embodiments, the RecE/T and/or Redo/p genes are expressed, or a sequence encoding a functionally active portion of RecE/T and/or Reda/p, In yet another embodiment, a fragment of RecE/T or Redo/p comprising a domain of the RecE/T and/or Reda/p proteins are expressed. Any of the methods previously described for the insertion of DNA fragments into a vector may be used to construct expression vectors containing a chimeric gene consisting of appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of nucleic add sequence encoding a RecE/T or Reda/p protein or peptide fragment may be regulated by a second nucleic acid sequence so that the RecE/T or Redo/p protein or peptide is expressed in a host transformed with the recombinant DNA molecule. For example, expression of a RccE/T or Reda/p protein may be controlled by any promoter/enhancer element known in the art. Promoters which may be used to control RecE/T or Redo/p expression include, but are hot limited to, the SV40 early promoter region (Beraoist and Cbambon, 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamaraoto, et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al91981. °roc. Natl. Acad Sci. U.S A. 78:1441-1445), the regulatory sequences of the metallothioncin gene (Brinster et a/., 1982, Nature 296:39-42); plant expression vectors comprising the nopalinc synthetase promoter region (Hexrera-Estrella et al.f 1984, Nature' 303:209-213) or the cauliflower mosaic virus 3SS RNA promoter (Gardner, et a/., 1981, Nucl. Acids Res. 92871), and the promoter of the photosynthetic enzyme ribulose biphosphate carboxylase (Herrera-Estrella etal.t 1984, Nature 310:115-120); promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, FGK (phosphoglyceroyl kinase) promoter, alkaline phosphatase promoter, and the following animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et oL% 1984, Cell 38:639*646; Orziitz et aL9 1986, Cold Spring Harbor Symp. Quant BioL 50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene control region which is active in pancreatic beta cells (Hanahan, 1985, Nature 315:115-122), immunoglobulin gene control region which is active in lymphoid cells (Gxosschedl et at., 1984, Cell 38:647-658; Adames er a/., 1985, Nature 318:533-538; Alexander et at., 1987, Mol. Cell. Biol. 7:1436-1444), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et at.,1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et aLt 1987, Genes and DeveL 1268-276), alpha-fetoprotcin gene control region which is active in liver (Krumlauf et a!., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et aJ.t 1987, Science 235:53-58; alpha 1-antitrypsin gene control region which is active in the liver (Kelsey erci, 1987, Genes and DeveL 1:161-171), beta-globin gene control region which is active in myeloid cells (Mogram et aLt 1985, Nature 315:338-340; Kollias et at., 1986, Cell 46:89-94; myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead et aL, 1987, Cell 48:703-712); myosin light chain-2 gene control region which is active in skeletal muscle (Sani, 1985, Nature 314:283-286), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et aLw 1986, Science 234:1372-1378). In a specific embodiment, a vector is used that comprises a promoter operably linked to a bacterial recombinase (e.g., RecE or RecT>cncoding nucleic acid, one or more origins of replication, and, optionally, one or more selectable markers (e.g, an antibiotic resistance gene). The chosen vector must be compatible with the vector plasmid described in Section 5.2*1, above* One of skill in the ait would readily be aware of the compatibility requirements necessary for maintaining multiple plasmids in a single celL Methods for propagation of two or more constructs in procaryotic cells are well known to those of skill in the art For example, cells containing multiple replicons can routinely be selected for and maintained by utilizing vectors comprising appropriately compatible origins of replication and independent selection systems (see Miller et aL, 1992, suprcr, Sambrook et al., 1989, supra). 5*2.3 HOST CELLS The host cell used for the cloning methods of the present invention and for propagation of the cloned DNA can be any cell which expresses the recE and recT and/or reda and redfigenc products, or any cell in which heterologous expression of these genes is possible. Examples of possible cell types that can be used include, but ate not limited to, prokaryotic cukaryoiic cells such as bacterial, yeast, plant, rodent, mice, human, insect, or mammalian cells. In a preferred embodiment, the host cell is a bacterial cell. In the most preferred embodiment, the host cell is an £ coli celL Examples of specific E. coli strains that can be used are JC 8679 and JC 9604. The genotype of JC 8679 and JC 9604 is Sex (Hfr, F+, F-, or F): F-JC 8679 comprises the mutations: rccBC 21, recC 22, sbcA 23, thr-1, ira-14. leu B 6, DE (gpt-proA) 62, lacYl, tsx-33, g!uV44 (AS), galK2 (Oc), LAM-his-60, ■elA 1, ips L31 (strR), xyl A5, mtl-1, argE3 (Oc) and thi-L JC 9604 comprises the same nutations and further the mutation recA 56. In an alternative embodiment, a eukaiyotic cell may be used as a host cell for be cloning and subcloning methods described herein. Any cell that expresses or can be oginecred to express a bacterial recombinase, or functional equivalents thereof; can be tsed. Cell lines derived from human, mouse, monkey, or any other organism may be used. 'or example, non-limiting examples of cell lines useful for the methods of the invention aclude CHO, VERO, BHK, HeLa, COS, MDCK, 293,3T3f and WI38 cells. A variety of host-vector systems may be utilized to introduce and express the rotein-coding sequence of RecE/T, Reda/p or a functionally equivalent system. Such lethods axe well known in the art (see Ausubel et al.y Current Protocols in Molecular iology, Greene Publishing Associates and Wiley Interscience, New York). TTiese include at are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, lenovirus, etc); insect cell systems infected with virus (e.g., baculovirus); microorganisms ich as yeast containing yeast vectors, or bacteria transformed with bacteriophage, DNA, asmid DNA, or cosmid DNA. Methods for protein expression are also discussed in xtion 5.2.2, above. 5.2.4 TARGET RMA The target DNA is chosen according to experimental design, and may be any double-stranded DNA as short as one base pair or over one hundred ldlobases in length. In a specific embodiment, the target is up to 100,125,200, or 300 kb in length. In another specific embodiment, the target DNA is 25 to 100 ldlobases, eg., as present in a BAC vector. Other specific embodiments of target DNAs are set forth in the Examples in Section 6. The target DNA may reside on any independently replicating DNA molecule such as, but not limited to, a plasmid, BAC or the £ coli chromosome. Hie target DNA may also reside on any source of DNA including, but not limited to, DNA from any prokaryotic, archaebacterial or eukaryotic cell, or from viral, phage or synthetic origins. For example, nucleic acid sequences may be obtained from the following sources: human, porcine, bovine, feline, avian, equine, canine, insect (e.g., Drosophila), invertebrate (eg., C. elegans), plant, etc The DNA may be obtained by standard procedures known in the art (see, e.g., Sambrook et aLf 1989, Molecular Cloning, A Laboratory Manual, 2d EdL, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Glovex (ed.), 1985, DNA Cloning; A Practical Approach, MRL Press, Ltd, Oxford, U.K. Vol. I, II). 53 METHODS FOR USE OF THE INVENTION 53.1 INTRODUCTION OF DNA INTO HOST CELLS Any method known in the ait for delivering a DNA preparation comprising the target DNA into a host cell is suitable for use with the methods described above. Such methods are known in the art and include, but are not limited to electroporation of cells, preparing competent cells with calcium or rubidium chloride, transduction of DNA with target DNA packaged in viral particles. For eukaryotic cells, methods include but are not limited to electroporation, transfection with calcium phosphate precipitation of DNA, and viral packaging. In a preferred embodiment, electroporation is used. Cells containing RecE/T or Reda/JJ proteins are treated to make them competent for electroporation by standard methods (see Ausubel et aL, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, New York). Preferably, about 50 yd of a standard preparation of electro-competent cells is used for electroporation by standard procedures. In experiments that require the transformation of a linear or circular vector, 0.3 jig or more of vector is preferably used In experiments that require the transformation of a DNA preparation containing the target DNA^OJjxg or more is preferably used Forco-transfbnnation experiments, the DNAs are preferably mixed before electroporation. After electroporation. the cells are preferably diluted in culture medium and incubated for an approximately 1 and a half hours recovery period before culturing under conditions to identify the phenotypic change conveyed by the selectable marker gene. In experiments utilizing site-specific recombination or endonuclease cleavage of the vector, expression of the SSR or Ac endonuclease, or combinations of an SSR and an endonuclease or two SSRs, is induced either before preparation of electrocompetent cells, during the recovery period after electroporation, or during culture to identify the selectable marker. Optimally the phenotypic change is resistance to an antibiotic and the cells are cultured on plates that contain the corresponding antibiotic. In this case, the antibiotic resistant colonies that appear after overnight culture will predominantly contain the desired subcloning product In another embodiment, DNA is delivered into the host cell by transduction ofDNA that has been packaged into a phage particle. PI or X transduction and packaging protocols are known in the art A packaging extracts are available commercially (e.g., from Promega, Madison, WI). 532 OLIGONUCLEOTIDES The oligonucleotide homology arms, primers, and adapter oligonucleotides osed in conjunction with the methods of the invention are often oligonucleotides ranging Tom 10 to about 100 nucleotides in length. In specific aspects, an oligonucleotide is 10 mcleotides, 15 nucleotides, 20 nucleotides, SO nucleotides, or 100 nucleotides in length, or ip to 200 nucleotides in length. In the preferred embodiment, the oligonucleotide is ipproximately 90 nucleotides in length. Oligonucleotides may be synthesized using any method known in the art (e.g., standard phosphoramidhe chemistry on an Applied Biosystems 392/394 DNA synthesizer). Further, reagents for synthesis may be obtained from any one of many commercial suppliers. An oligonucleotide or derivative thereof used in conjunction with die methods of this invention may be synthesized using any method known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Bioscarch, Applied Biosystems, etc). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et aL (1988, Nucl. Acids Res. 16,3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin etat., 1988, Proc, Nat'l Acad Sci. U.S-A. 85,7448-7451), etc An oligonucleotide may comprise at least one modified base, provided that such modification does not interfere with homologous recombination. For example, such modifications may include, but are not limited to 5-fluorouracil, 5-bromouxacil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine! 4-acetylcytosine, 5methyl-2-thiouracil, beta-' D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopcntcnyladcninc, uracil-5-oxyacetic acid (v), pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouiacil, 5-methyIuracil, uiacil-5-oxyacetic acid methylester, uracil-5-oxyacctic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. An oligonucleotide may comprise at least one modified phosphate backbone, provided that such modification does not interfere with homologous recombination. Such modification may include, but is not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alky 1 phosphotriester, and a foimacctal or analog thereof. SJJ DNA AMPLIFICATION The polymerase chain reaction (PCR) is optionally used in connection with the invention to amplify a desired sequence from a source (e.g., a tissue sample, a genomic or cDNA library). Oligonucleotide primers representing known sequences can be used as primers in PCR. PCR is typically carried out by use of a thermal cycler (e.g., from Perkin-Elmer Cetus) and a thermostable polymerase (eg., Gene Amp™ brand of Taq polymerase). The nucleic acid template to be amplified may include but is not limited to mRNA, cDNA or genomic DNA from any species. The PCR amplification method is well known in the art (see, e.g.,U.S.PatentNos.4,683,202,4,683,195and4,889,818;GyllensteinetaL, 1988, Proc. Natl. Acad. Sci. U.S.A. 85,7652-7656; Ochman et a/., 1988, Genetics 120.621-623; Lob et a!.. 1989, Science 243,217-220). 5.4 METHODS FOR DIAGNOSTIC APPLICATIONS The methods of the present invention may be used to detect, prognose, , diagnose, or monitor various infections, conditions, diseases, and disorders associated with the presence of a foreign DNA or variant DNA, or monitor the treatment thereof For example, as described in Section 5 A1, below, the methods may be used to detect, prognose, diagnose, or monitor various infections and diseases, such as diseases associated with a viral infection, a bacterial infection, or infection by a protozoan, parasite, or other known pathogen. As described in Section 5.42, below, the methods can also be used to detect, prognose, diagnose, or monitor various infections, conditions, diseases, and disorders associated with the presence of variant DNA, such as a genetic mutation or a single nucleotide polymorphism (SNP). Methods for such diagnostic purposes are described in detail hereinbelow. 5.4.1 DETECTION OF FOREIGN DNA The methods of the invention described hereinabove can be used to detect foreign DNA, such as a viral or bacterial DNA, stemming from exposure to a pathogen, in a patient exposed to the pathogen The patient may or may not exhibit the symptoms of infection by the pathogen or the presence of a disease or disorder associated by the presence of the pathogen. In one embodiment, for example, a target DNA sample can be prepared from the DNA from a patient having or suspected of having such a disease or infection. Homology arms having sequence homology to a foreign target. DNA can be designed and prepared. The sample DNA can then be introduced into an £1 co//host cell that expresses a bacterial reepmbinase and that contains the vector DNA, by any of the methods described in Section 5,1, above. In an alternative embodiment, adaptor oligonucleotides can be designed comprising a first sequence homologous to a vector sequence and a second sequence homologous to the foreign target DNA, oriented as described in detail in Section 5.1, above. Such adaptor oligonucleotides can be used either to co-transfect, together with the sample DNA and the vector DNA, an E. coli host cell that expresses RecE/T or Redcc/p, or can be transfected directly into cells that already comprise vector DNA and sample DNA Cells are then grown in selective media, as described in Section S. I above, and cells that resist selection can be analyzed for the presence of an insert of the appropriate size. The target DNA can be isolated from a patient or subject's biological sample, such as, but not limited to, whole blood, plasma, serum, skin, saliva, urine, lymph fluid, cells obtained from biopsy aspirate, tissue culture cells, media, or non-biological samples such as food, water, or other material. Methods for preparation of DNA from such sources are well known to those of skill in the art (see, e.g., Current Protocols in Molecular Biology series of laboratory technique manuals, 1987-1994 Current Protocols, 1994-1997 John Wiley and Sons, Inc.)* In one embodiment, for example, where it is desired to detect or diagnose a viral infection or disease, the homology arms can comprise DNA sequences homologous to DNA sequences of known viral DNA. The methods can be used to detect and isolate viral DNA either as a viral DNA stxand, or a DNA replicative intermediate of a DNA or an RNA virus. In one embodiment, for example, DNA genomes or replicative intermediates of DNA viruses may be directly targeted using homology aim sequences designed to be homologous to viral sequences of such DNA viruses including, but not limited to, hepatitis type B virus, parvoviruses, such as adeno-associated virus and cytomegalovirus, papovavimses such as papilloma virus, polyoma viruses, and 5V40, adenoviruses, herpes viruses such as herpes simplex type I (HSV-I), herpes simplex type II (HS V-II), and Epstein-Barr virus, and poxviruses, such as variola (smallpox) and vaccinia virus. In another embodiment, the replicative intermediates of retroviral RNA viruses that replicate through a DNA intermediate may be directly targeted using homology arm sequences designed to be homologous to viral sequences of such RNA viruses, including but not limited to human immunodeficiency virus type I (HTV-I), human immunodeficiency virus type II (HTV-II), human T-cell lymphotropic virus type I (HTLV-I), and human T-cell lymphotropic virus type II (HTLV-II). In another embodiment, in order to detect and isolate the genomic or replicative intermediates of RNA virus that replicate through an RNA intermediate, RNA may be isolated and transcribed into a cDNA copy of the RNA using reverse transcriptase according to methods well known in the art Such cDNA copies may be used as target DNA to detect the presence of RNA viruses such as influenza virus, measles virus, rabies virus, Sendai virus, picornaviruses such as poliomyelitis virus, coxsackieviruses, rhinoviruses, reoviruses, togaviruses such as rubella virus (German measles) and Sexnliki forest virus, arboviruses, and hepatitis type A virus. In another preferred embodiment, where it is desired to diagnose or detect bacterial infections, the homology arms can comprise DNA sequences homologous to DNA sequences of known bacteria. For example, in one embodiment, such homology arm DNA sequences may be homologous to cDNA or genomic DNA of a pathogenic bacteria including, but not limited to, Streptococcus pyogenes, Streptococcic pneumoniae, Neisseria gonorrhoea* Neisseria meningitidis, Corynebacterium diphtheria*, Clostridium Botulinum, Clostridium perfiingens, Clostridium tetania Haemophilus influenzae, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscUromotis, Staphylococcus aureus, Vibrio cholerae, Escherichia coli, Pseudomonas aeruginosa, Campylobacter (Vibrio) fetus, Campylobacter Jejuni, Aeromonas hydrophila, Bacillus cereus, Edwardsiella tarda, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Salmonella typhimurium, Treponema pallidum, Treponema pertenue, Treponema carateneum, Borrelia vincentii, Borrelia burgdorferi, Leptospira icterohemorrhagiae, Mycobacterium tuberculosis, Toxoplasma gondii, Pneumocystis carinii, Francisella tularensis, Brucella abortus, Brucella suis, Brucella melitensis, Mycoplasma spp., Rickettsia prowazeki, Rickettsia tsutsugumushi. Chlamydia spp., and Helicobacter pylori. In another embodiment, such homology arm DNA sequences may be homologous to cDNA or genomic DNA of a pathogenic ftmgi including, but not limited to, Coccidioides immitis, Aspergillusfumigatus, Candida albicans, Blastomyces dermatitidis, Cryptococcus neofarmans, and Histoplasma capsulatunu In another preferred embodiment, where it is desired to diagnose or detect protozoal infections, the homology arms can comprise DNA sequences homologous to DNA sequences of known protozoan. For example, such homology arm DNA sequences may be homologous to cDNA or genomic DNA of any known protozoan. Especially interesting axe pathogenic protozoans such as Emomoeba histolytica, Trichomonas tenas9 Trichomonas hominis, Trichomonas vaginalis, Trypanosoma gambienset Trypanosoma rhodesiense, Trypanosoma cruzi, Leishmania donovani, Leishmania tropica, Leishmania brazitiensis, Pneumocystis pneumonia, Plasmodium vivax, Plasmodium falciparum, and Plasmodium malaria. In yet another preferred embodiment, where it is desired to diagnose or detect parasitic infections, the homology arms can comprise DNA sequences homologous to DNA sequences of known parasite. For example, such homology ann DNA sequences may be homologous to cDNA or genomic DNA of any known parasite including, such as Helminths including, Eraerobius vermicularis, Trichwris trichiura, Ascaris lumbricoides, Trichinella spiralis, Strongyloides stercoralis, Schistosoma japonicum. Schistosoma mansom, Schistosoma haematobium, and hookworms. 5.4.2 DIAGNOSIS OF MUTATIONS AND POLYMORPHISMS IN CELLULAR DNA The methods of the invention can also be used to isolate and detect genetic disorders in a patient's sample, and to prognose, diagnose, or monitor various conditions, diseases, and disorders associated with the presence of variant DNA, such as a genetic mutation or a single nucleotide polymorphism (SNP), as well as to detect a genetic disposition for developing a disease or disorder. In one embodiment, for example, a target DNA sample can be prepared from DNA isolated from a sample from a patient having or suspected of having such a genetic disease or disorder. In a preferred embodiment, a vector comprising homology arms having sequence homologous to a particular gene of interest or genomic region of interest can be designed and prepared, and, introduced into an R co//host cell that expresses a bacterial recombinase such as RecE/T and/or Reda/p. The sample DNA can then be introduced into the host cell; In an alternative embodiment, adaptor oligonucleotides can be designed i comprising a first sequence homologous to a vector sequence and a second sequence homologous to the DNA of the target gene of interest, oriented as described in detail-in Section S.l, above. In a preferred embodiment, such adaptor oligonucleotides can be used either to co-transfect, together with the sample DNA, an £ colt host cell that expresses RccE/T and/or Reda/p and contains the vector DNA Alternatively, any of the other-methods for homologous recombination cloning described in detail in Section 5.1, above, can be used. Cells are then grown in selective media, as described in Section 5.1 above, and cells that resist selection can be analyzed for the presence of an insert of the appropriate size. DNA can then be analyzed for the presence of a mutation or DNA variation of interest by restriction analysis or sequencing techniques well known in the art (see, e.g., Current Protocols in Molecular Biology series of laboratory technique manuals, 1987-1994 Current Protocols. 1994-1997 John Wiley and Sons, Inc.). - In an alternative embodiment, the homology armor adaptor oligonucleotide may contain the sequence of the genetic mutation or DNA polymorphism of interest In this embodiment, recombination will only occur if the sample DNA contains the mutation. This may be useful for diagnostic screening of a large number of samples for a particular mutation or DNA polymorphism, since only cells containing a particular mutation will be resistant to selection. The target DNA may be obtained from any DNA sample, such as genomic DNA, cDNA, or mitochondrial DNA In one embodiment,; for example, the target DNA can be a region of a human chromosome. In another embodiment, the target DNA is present in a mixed population, e.g., a population of genomic DNAs derived from a plurality of subjects of interest, for example, subjects afflicted with a particular disorder. Such target DNA can be obtained from a biological sample, such as, but not limited to, whole blood, plasma, serum, skin, saliva, urine, lymph fluid, cells obtained from biopsy aspirate, tissue culture cells, media, or non-biological samples such as food, water, or other material. Methods for preparation of DNA from such sources are well known to those of skill in the art (see, e.g.. Current Protocols in Molecular Biology series of laboratory technique manuals, 1987-1994 Current Protocols, 1994-1997 John Wiley and Sons, Inc.). Non-limiting examples of genetic disorders that can be tested using this > method include mutations and SNPs associated with such hereditary diseases as Brca-1 associated with breast cancer, mutations implicated in cystic fibrosis, Tay-Sachs disease, sickle cell anemia, hemophilia, atherosclerosis, diabetes, leukemia, prostrate and other cancers, and obesity. Such hereditary diseases may include degenerative and non-degenerative neurological diseases such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Huntington's disease, Wilson's disease, spinal cerebellar ataxia, Friedreich's ataxia and other ataxias, prion diseases including Creutzfeldt-Jakob disease, dentatorubral pallidoluysian atrophy, spongiform encephalopathies, myotonic dystrophy, depression, schizophrenia, and epilepsy. Hereditary diseases may also include metabolic diseases such as, for example, hypoglycemia or phenylketonuria. Cardiovascular diseases and conditions are also included, non-limiting examples of which include atherosclerosis, myocardial infarction, and high blood pressure. The invention can further be used for detection and diagnosis of Lyme disease, tuberculosis, and sexually transmitted diseases. In another embodiment, the homologous recombination cloning methods of the invention can be used for determining the genetic basis of a disease or disorder. For example, target DNA can be isolated from a sample of a patient or patients afflicted with a disorder whose genetic basis is not known. In one embodiment, the cloning methods could be used to isolate a region of a chromosome known or suspected to be implicated in such a disease or disorder, from a group of patients known or suspected of having such a disorder. The recovered DNA can then be isolated and analyzed further for the presence of genetic mutations or polymorphisms, using techniques well known in the art for mapping variations in DNA, such as restriction fragment length polymorphism, or other SNP detection techniques (see, e.g., Nikiforov et a/., U.S. Patent No. 5,679,524 issued Oct 21,1997; Mcintosh et aL, PCT publication WO 98/59066 dated December 30,1998; Goelet et a/., PCT publication WO 95/12607 dated May 11,1995; Wang et at, 1998, Science 280:1077-1082; Tyagi etaL,1998,Nature BiotechnoL 16:49-53; Chen etaL, 1998, Genome;Res. 8:549-556; Pastinen et a!.,1996, Clin. Chexn. 42:1391-1397; Chen et aL, 1997, Proc. Natl. Acad. Sci. 94:10756-10761; Shuber et aL, 1997, Hum. Mol. Gen. 6337-347; Liu et al., 1997, Genome Res. 7:389-398; Livak et aL, 1995, Nature Genet 9:341-342; Day and Humphries, 1994, AnnaL Biochem. 222:389-395). Non-limiting examples of target disorders of clinical interest include asthma, arthritis, psoriasis, excema, allergies, drug resistance, drug toxicity, and cancers such as, but not limited to, human sarcomas and carcinomas, e.g.9 fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Evdng's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma/ choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias, e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblasts, promyelocyte, myelomonocytic, monocytic and erythroleukcrnia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non-Hodgkinrs disease), multiple myeloma, Waldenstrom's macroglobulincmia, and heavy chain disease. The homologous recombination cloning methods can further be useful in diagnosing and detecting genetic differences and diagnosis of patients with autoimmune diseases, including but not limited to, insulin dependent diabetes mellitus, multiple sclerosis, systemic lupus erythematosus, Sjogren's syndrome, scleroderma, polymyositis, chronic active hepatitis, mixed connective tissue disease, primary biliary cirrhosis, pernicious anemia, autoimmune thyroiditis, idiopathic Addison's disease, vitiligo, gluten-sensitive enteropathy, Graves1 disease, myasthenia gravis, autoimmune neutropenia, idiopathic thrombocytopenia purpura, rheumatoid arthritis, cirrhosis, pemphigus vulgaris; autoimmune infertility, Goodpasture's disease, bullous pemphigoid, discoid lupus, ulcerative colitis, and dense deposit disease. Homologous recombination cloning methods may also be used for isolating, diagnosing, and detecting DNA mutations, alterations, variations, and SNPs not associated with disease. Non-limiting examples include such DNA mutations, alterations, variations, and SNPs present in non-coding genomic sequences, or DNA mutations, alterations, variations, and SNPs associated with different human blood groups. In a preferred aspect of the invention, the methods of the invention may have particular utility in the isolation, detection, diagnosis, prognosis, or monitoring of human DNA mutations, alterations, variations, and SNPs. It is appreciated, however, that the methods described herein will be useful in isolating, detecting, diagnosing, prognosing, or monitoring diseases of other mammals, for example, farm animals including cattle, horses, sheep, goat, and pigs, household pets including cats and dogs; and plants including agriculturally important plants and garden plants. 5.5 KITS The invention further provides kits that facilitate the use of the homologous recombination cloning and subcloning methods described herein. In one embodiment, a kit is provided comprising, in one or more containers: A) a double-stranded DNA vector useful for directed cloning and subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the nucleotide sequence of the first homology arm on a first vector DNA strand is homologous to the sequence of the first terminus on a first target DN A strand, and the nucleotide sequence of the second homology arm on the first vector DNA strand is homologous to the nucleotide sequence of the second terminus on the first target DNA strand; and b) a cell containing a bacterial recombinasc. The cell can eadogenously or recombinantly express die recombinase. In another embodiment, a kit useful for directed cloning or subcloning of a target DNA molecule in one or more containers is provided, comprising: a) a double-stranded DNA vector useful for directed cloning and subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology anns,-in the following order from 5* to 3* along a vector DNA strand: a first homology aim, the.origin of replication and a second homology arm, such that the nucleotide sequence of the first homology ann on a first vector DNA strand is homologous to the sequence of the first terminus on a first target DNA strand, and the nucleotide sequence of the second homology arm on the first vector DNA strand is homologous to the nucleotide sequence of the second terminus on the first target DNA strand; and b) a first double-stranded oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3' to?: a first sequence and a second sequence, said first nucleotide sequence being homologous to die nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence being homologous to the nucleotide sequence of a first terminus on a target DNA strand; c) a second oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5': a third nucleotide sequence and a fourth nucleotide sequence, said third nucleotide sequence being homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth nucleotide sequence being homologous to the nucleotide sequence of a second terminus on said target DNA strand; and d) a cell containing bacterial recombinase proteins, e.g., RecE/T and/or Reda/p proteins. In a specific embodiment, the cell is an £ coli cell. In another embodiment, a kit is provided with one or more containers comprising: a) a double-stranded DNA vector useful for directed cloning and subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the nucleotide sequence of the first homology aim on a first vector DNA strand is homologous to the sequence of the first terminus on a first target DNA strand, and the nucleotide sequence of the second homology arm on the first vector DNA strand is homologous to the nucleotide sequence of the second terminus on the first target DNA strand; b) a first double-stranded oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3' to Sv: a first nucleotide sequence and a second nucleotide sequence, said first nucleotide sequence being homologous to the nucleotide sequence of the first homology aim on said vector DNA strand, and said second nucleotide sequence being homologous to the nucleotide sequence of a first terminus on a target DNA strand; and c) a second oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3V to 5T: a third nucleotide sequence and a fourth nucleotide sequence, said third nucleotide sequence being homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth sequence being homologous to the nucleotide sequence of a second terminus on said target DNA strand. In various specific embodiments, the target DNA of the kit is bacterial, viral, parasite, protozoan, or pathogenic DNA. In other specific embodiments, the kit's target DNA can comprise a genetic mutation or polymorphism known or suspected to be associated with a disorder or disease. In another specific embodiment, in oligonucleotide * adaptor sequences or vector homology arms have sequence homology to BAG, PAC, lambda, plasmid or YAC based cloning vectors. 6. EXAMPLE: RECE/T AND REDct/p CLONING AND SUBCLONING The Examples presented in this section describe a number of experiments which demonstrate the successful cloning and subcloning using the homologous recombination methods of the invention. Different approaches to subcloning methods are shown. Of particular note, one example shows the successful cloning of an insert larger than any described previously - the directed subcloning of a 25 kb DNA fragment from an approximately ISO kb BAC vector. 6.1 METHODS AND MATERIALS Preparation of Linear fragments Standard PCR reaction conditions were used to amplify linear DNA fragments. The 1972 bp of pl5A origin plus kanamycin-resistance gene (from Tn903) from pACYC177 was amplified. The origin plSA allows this plasmid or recombinant to co-exist in cells with other plasmids that carry a ColEl compatibility group origin. The 1934bp of chloramphenicol (from Tn9) resistant gene plus pi 5A origin was amplified from pACYClW. The oligonucleotides used in the PCR reaction comprised, at their 3' ends, and 18-30 nucleotide sequence to serve as a primer on pACYC plasmids, and at the 51 endsv a SO to 60 nucleotide stretch of sequence homologous to the flanks of the target DNA region. For long oligonucleotides, the PCR reaction annealing temperature used was 62°C. PCR products were purified by using QIAGEN PCR Purification Kit (QIAGEN) and eluted with dH20. The template DNA was eliminated by digesting PCR products with Dpn I. After digestion, PCR products were precipitated by etbanol and resuspended in dH20 at 0.5 jig/ul. Preparation of competent cells Electroporation competent cells were prepared by standard methods. Briefly, overnight cultures were diluted 100 times into LB medium with appropriate antibiotics. £ coli cells were grown to an optical density of OD 400=025-0.4 and were chilled on ice for 15 min. Bacterial cells were centrifuged at 7,000 rpm for 10 min at -5°C The bacterial cell pellet was resuspended in ice-cold 10% glycerol and pelleted by centnfugation at 7,000 rpm at -5°C for 10 min. After 3 times washing in ice-cold 10% glycerol and recentrifiigation, the cell pellet was suspended in a volume of ice-cold 10% glycerol equal to volume of cells. The competent cells were divided into 50 pi aliquots in eppendorf tubes, snap frozen in liquid nitrogen and stored at -70°C. Experiments with the plasmids pBAD-ETy or pBAD-apy involved transformation of these plasmids into E. coli hosts by standard means, followed by growth overnight to saturation in LB medium plus 02% glucose, 50 fig/ml ampicillin, the cultures were then diluted 100 fold into LB plus 50 (ig/ml ampiciliin and growth to OD coo of 0.15. L-Arabinosc was then added to 0.1% of final concentration. Tlxe cells were grown to OD^o of 0.25-0.4 before chilling on ice for 15 min. Electroporation A solution of DNA in 1 \d (containing approximately 0.5 \x% DNA or more for contransfbrmation, or approximately 0.3 ng vector DNA or more only for cells harboring the target, or approximately 0.5 |ig DNA or more containing the target for cells harboring the vector) was mixed with competent cells. The cells - DNA mixture was transferred into an ice-cold cuvette. Electroporation was performed using a Bio~Rad Gene Pulser set to 25 |iFD, 2.3 kV with Pulse Controller set at 200 ohms. LB medium (1 ml) was added after electroporation. The cells were incubated at 37°C for 1-1*5 hour with shaking and then spread on plates containing the antibiotic corresponding to the selectable marker gene in the vector. 62 RESULTS Table 1 summarizes six experiments in which various target DNA regions of interest were subcloned using different sources of RecBT or Redo/p expression. The first column* entitled "FT expression" refers to the source of RecE/T or Reda/p, either endogenous RecE/T in £ coli hosts JC8679 or JC9604, or from plasmids pBAD-recE/T of pBADaPy, as indicated. The second column indicates the & coli host used. The third column indicates the target genes. In the first experiment, the recETT gene resident in the £ coli chromosome was subcloned in the £ coli strain JC8679, in which expression of RecE/T is constitutive. This was accomplished using the strategy outlined in Figure 2. Oligonucleotides were designed and synthesized having the following sequence: S'-TTCCTCTGTATTAACCGGGGAATACAGTGTAATCGATAATTCAGAGGAATAG CTCGAGTTAATAAGATGATC1 lUnGAGATCG-3* (SEQ ID NO:l) and S'-CAGCAATGTCATCGAGCTGAGACTTACTGATACCGGGACCCGCGTGGTAATT CTCGAGTGATTAGAAAAACTCATCGAGCATC-r (SEQ ID N0:2) to amplify the pi 5 A origin of replication and Tn903 kanamycin resistant gene present in pACYC177. The results of this experiment arc summarized in the first row of Table 1. TABLEI ET Exoli Target Total % correct expression host genes colonies (of 18) Endogenous JC8679 recE/T in Ecoli chromosome 540 89 recE/T Endogenous JC8679 lacZ in E.coli chromosome 760 94 recBT Endogenous JC9604 lacZ in Exoli chromosome 290 100 recE/T pBAC- JC5519 Gentamicin in high copy plasmid >3,000 100 recE/T pBAD-aBy HB101 /acZ in E.coli chromosome 370 94 pBAD-oBy HS996 ih/wn3ofmAF4inBAC 160 83 In the second experiment, the lacZ gene resident in the £ colt chromosome was subcloned in die £ coli strain JC8679, in which expression of RecE/T b constitutive. This was accomplished using the strategy outlined in Figure 2. The vector was made by PCR using oligonucleotides of the following sequence: 5'-TCAACATTAAATGTGACK:GAGTAAC^UCCCGTCGGATTCTCCGTGGGAACAA ACGGGAATTCTGATTAGAAAAACTCATCGAGCATCAAATG-3, (SEQ IDNO:3) and y-TCAGGGGAAAACXITTATTTATCAC^CGGAAAACCTACCGGATTGATGGTAGG GATCCTTAATAAGATGATCTTCT^GAGATCG-3, (SEQ ID N0;4) to amplify the pi SA origin of replication and Tn903 kanamycin resistance gene present in pACYC177. Results arc summarized in the second row of Table 1. In the third experiment, the IacZ gene resident in the £. coli chromosome was subcloned in the E. coli strain JC9604, in which expression of RecE/T is constitutive. This was accomplished using the strategy outlined in Figure 2. The vector was made by PCR using oligonucleotides of the following sequence: ' ^-TCAACATTAAATOTGAGCGAGTAACA^ ACGGGAATTC^GATTAGAAAAACTCATCGAGCATCAAATG-3, (SEQ ID NO:5) and 5'-TCACKK}GAAAACCTTATTTATCAGCCGGAAAACCTACCGGATT^^ GATCCTTAATAAGATGATCTTCTTGAGATCG-3' to amplify the pi 5 A origin of replication and Tn903 kanazzxycin resistance gene present pACYC177. Results are summarized in the third row of Table 1. In the fourth experiment, the gentamicin gene resident on the high copy piasmid pFastBACl (Gibco) was subdoned in the £ coli strain JC5519 using the strategy outlined in Figure 3. Expression of RecE/T was provided by the piasmid pBAD-recE/T after this piasmid bad been transformed into JC5519, followed by arabinose induction before preparation of competent cells. The vector was made by PCR using oligonucleotides of the following sequence: y-TGCACTTTGATATCGACCCA^ GGATCCTTAATAAGATCATCT^CTGAGATCGTITTGG-3, (SEQ ID NO:7) and y-TGCATTAC^GTITACGAACCGAACAGGCTTATGTCAACTGGGTTCGTG^ CAGAATTCTGATTAGAAAAACTCATCGAGCATCAAATG-3, (SEQ ID NO:8) to amplify the plSA origin of replication and Tn903 kanamycin resistance gene present in pACYC177, the PCR product was mixed with BamHI digested pFastBACl for cotxansformation and plating onto gentamicin plus kanamycin containing plates. In the fifth example, the lacZ gene resident in the £ coli chromosome was subcloned in the £ coli strain HB101 using the strategy outlined in Figure 2. Expression of Rcda/p was provided by the plasmid pBADa$y alter this plasmid had been transformed into HB101, followed by arabinose induction before preparation of competent cells. The vector was made by PCR using oligonucleotides of the following sequence: S'-TCAACATTAAATGTGAGCGAGTAACAACCCGTCGGATTCTCCGTGGGAA ACGCKJAAT^CTGAT^AGAAAAACTCATCGAGCATCAAATG•3, (SEQ ID NO:9) and S'-TCAGGGGAAAACCTTATITATC^GCCGGAAAACCTACCGGATTGATGGTAGG GATCCTTAATAAGATGATCT^ClTGAGATGG-3, (SEQ ID NO: 10) to amplify the plSA origin of replication and Tn903 kanamycin resistance gene present in pACYC177. Results of this experiment are summarized in the fifth row of Table 1. In the sixth experiment, a 25kb region of an approximately 150 kb BAC clone carrying the mouse AF4 gene was subcloned in the £ coli strain HS996 using die strategy outlined in Figure 3. Expression of Rcda/p was provided by the plasmid pE/. Japy after this plasmid had been transformed into HS996, followed by arabinose induction before preparation of competent cells. The vector was made by PCR using oligonucleotides of the following sequence: S'-TGTAGCHXJAGCCC^GGGGCAACKOT^ GGCATCACCTGGAATTCTTAATAAGAT^^ (SEQ IDN0:1I) and S'-TCKKJTGTCAACCTCAGGC^ CCTACACACCGAATTCTGATTAGAAAAACTCATCX}AGCATCAAATG-3' (SEQ ID NO:12) to amplify the pl5A origin of replication and Tn903 kanamycin resistance gene present in pACYC177. The PCR product was mixed with 0.5 ng purified BAC DNA for ^transformation. Results of this experiment are summarized in the sixth row of Table 1. Also, shown in Figure 6 is an ethidium bromide stained agarose gel depicting DNA digested with EcoRI isolated from 9 independent colonies (lanes 1*9) obtained from the mAF4 BAC experiment, using EcoRI digest of the starting vector as a control (lane 10). In the seventh experiment, a region of genomic DNA containing an ampicillin resistance gene from the yeast strain MGD 3S3-13D was cloned using the strategy outlined in Figure 7* As depicted in panel A, a DNA fragment containing the plSA origin of replication, flanked by 98 or 102 bp homology aims targeted to the 98 and 102 bps flanking regions of an integrated ampicillin resistance gene in the yeast strain, MGD353-13D. The£ colt strain JC5519 was used, and expression of Reda/p was provided by the plasmid pBADapy-TET, followed by arabinose induction before preparation of competent cells. pBADaPy-TET is a derivative of pBADapy in which the ampicillin resistance gene has been replaced by the tctracyclin resistance gene* The cloning vector was made by PCR using oligonucleotides of the following sequence: 5-TCTTTTACTTTCACCAGC^ CCGCAAAAAAGGGAATAAGGGCGACA^ CTTGTATTAC^GT^TATGTAAGCAGACAG-3, (SEQ IDNO:13) and S'-TCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAAC GAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAATTAA TAAGATGATCTrCTTGAGATCGTTTTGG-3f (SEQ IDNO:14) to amplify the pi 5A origin of replication present in pACYC177. The PCR product was mixed with 4 ng Ncol digested MGD 353-13D yeast genomic DNA for cotransformation in .JC5519 containing Reda/p expressed from pBADapy and plating on ampicillin containing plates after a 90 minute recovery period of culture in L-broth at 37°C. Clones were identified by selection for ampicillin resistance* Eighteen colonies were taken for DNA analysis. An ethidium bromide stained gel of the ten which were correct are shown in Figure 7B. The example described herein illustrates the success of the RecE/T and Redo/p homologous recombination cloning methods using a wide variety of circular targets - from a high copy plasmid, to a low copy large target (a BAQ to the £ coli chromosome. 7* EFFECT OF VECTOR REPEATS AND PHOSPHORYLATION ON CLONING EFFICIENCY The Example presented in this section describes the optimization of conditions for high-efficiency of cloning and subcloning using RecE/T or Reda/p-mediated homologous recombination ("ET cloning"). In particular, as shown in Figure 8t elimination of sequence repeats in the vector improved cloning efficiencies. On the other hand, the presence of S* phosphates at the ends of the linear vector had very little effect on die efficiency of ET cloning. First, the effect of repeats on cloning efficiency was examined in the following experiment As shown in Figure 8, the linear vector used as the cloning vehicle comprised the pi5A replication origin, the chloramphenicol resistance gene (Cnf)t a nucleotide sequence required for PCR amplification of the linear vector (italicized in Figure 8), flanked by the homology arms to the KcolitaeZ gene, and terminal repeated sequences of various lengths (indicated in bold), present on both extremes of the linear vector. The linear vectors were transformed into JC8679 (endogenously ET proficient; Clark, 1974, Genetics, 78,259-271) or JC5519(WiIletts and Clark, 1969, J. Bacterid. 100:231-239) expressing pBADReda/0 (Zhang etaLtl 998, Nat Genet 20:123-128). The number of colonies obtained on LB plates (with 50 jig/ml chloramphenicol) after ET subcloning using the indicated oligonucleotides for PCR amplification of the linear vector, is shown in the table in Figure 8. Of these, 18 were analyzed by restriction digestion. The indicated efficiency was determined by dividing the number of correct recombinants by the total number of colonies obtained. Thus, the presence of terminal repeals > 6 nucleotides significantly reduces the ET subcloning efficiency. All the background colonies contained rc-ligated linear vector. The effect of phosphorylation was also examined, and the results are shown in Figure 8. The ends of the Untax vector were phosphorylated using T4 DNA kinase and Y-ATP. As shown in Figure 8f last column, no effect on ET subcloning or on vector re-ligation was observed. This Example demonstrates that the presence of repeated sequences at the ends of the linear vector, or between the homology arm and the essential elements of the vector, Le. the origin of replication and the selectable marker, results in recombination which dramatically reduces ET cloning and subcloning efficiencies. Thus, in a preferred embodiment, the sequence of the homology cloning vector, does not contain any directly repeated sequence of five (5) or more bases outside the sequences that encode the origin of replication and the selectable marker. 8. ADDITIONAL EXAMPLES OF RECE/T AND REDo/p CLONING AND SUBCLONING The Examples presented in this section describe additional experiments which demonstrate successful cloning and subcloning approaches using RecE/T- or Redo/Red- mediated homologous recombination. The K coli host As described hereinabove, 'an ET competent host' refers to any E.coli cell capable of expressing RecE/RecT and/or Rcdoc/RedB. This may be achieved in a variety of ways, such as either (i) a strain which endogenously expresses RecE/RecT or Redo/Rcdp or (ii) a strain in which RecE/RecT or Redo/Redp are expressed from an exogenously introduced plasmid. This example describes the construction of a plasmid-based expression vector based on the JC9604 and JC8679 and their derivatives (mainly YZ2000 and YZ2001). For other variations and examples of ET competent hosts, see Muiphy ef a/., 2000, Gene 246: 321-330; Yu et al, 2000, Proc. Natl. Acad. Sci. 97: 5978-5983; and Datsenko and Wanner, 2000, Proc. Natl. Acad. Sci. 97:6640-6645. In the first category, two strains have been used, which cany the sbcA mutation and therefore endogenously express RecE/RecT in a RecA" (JC9604; Gillen et aL, 1981, J. Bacteriology 145:521-532 or in a RecA* (JC8679; Gillen et aL9 supra) background. The advantage of using these strains resides in the fact that they can be used directly, without the need to first introduce a plasmid to make the strain ET-cloning competent The disadvantage is that RecE and RecT are constitutively expressed throughout the whole cloning procedure, which enhances the risk of undesired intramolecular recombination, especially in a recA* background. A second disadvantage is that these JC strains have not been modified for use as cloning and propagation hosts. They contain a fully active restriction/modification system which by consequence greatly reduces the efficiency of introduction of large molecules such as BACs into these hosts. The choice of whether to use a host strain with an endogenous or a plasmid-introduccd supply of RecE/T or Redo/p depends on the nature of the circular target No matter which strategy is chosen, the preparation of good competent cells is of crucial importance* If the host strain lacks endogenous ET-cloning potential, the strain needs to be transformed first with pBAD-ccpy or pBAD-ETy. The resulting strain then needs to be grown induced with L~arabino$e to a final concentration of 0.1% and prepared for electroporation. Empirically, the optimal harvesting point of the cells occurs at an ODgg of around 0.35, especially when large DNA substrates are targeted. If the cells have reached an ODoQ of greater than 0.5, they should not be used* The optimal induction time is around 1 hour. Electroporation needs to be used, since no other method of DNA introduction has been found to work. Making good electrocompetent ceils is essential to obtaining ET-recombinants. During the preparation of electrocompetent cells, all steps should be performed oh ice and in precooled buckets and rotors. Electrocompetent cells are concentrated to a high extent: from a 250 ml culture which is harvested at OD^o = 0.35, we routinely prepare no more than 10 aliquots of 50 \d of competent ceils. The resulting transformation efficiency depends greatly on the host strain used, but typically varies around 109 cfu/pg. A detailed protocol of how to prepare electrocompetent cells and how to perform the electroporation can be obtained from http ://www.embl-heidelberg.de/Exteniallnfo/stewart/indexJitml. The plasmid pR6K/BAD-afly(tet), shown in Figure 9A, was constructed to confer upon Ac BAG host strain HS996 (Invitrogen) the ability to cany out ET recombination. This plasmid is based on the pBAD24 backbone (Guzman et al., 1995, J Bacteriol 177:412 Ml 30). Reda (or RecE) is expressed from the L-arabinose-inducible pB AD promoter* and Redp (or RecT) is expressed from the constitutive EM-7 promoter. Ovcrexpression of RecT relative to RecE, or Redp relative to Redo, enhances ET-cloning efficiency (in terms of amount of colonies on selection plates). Finally, this plasmid constitutively expresses the Redy protein, in this case from the constitutive TnS promoter, which is necessary to inhibit the activity of the RecBCD enzyme present in most commonly used host strains (Murphy, 1991, J. Bacteriology 173:5808-5821). If not inactivated, RecBCD completely inhibits ET-cloning, probably because its exonuclease activity degrades the linear DNA before it gets a chance to recombinc. Thus, pBAD-aPy(tct) constitutes a mobile system which can confer regulatable ET-cloning proficiency upon, transformation of the recipient host strain. Given the indudbiHty of the expression of RecE or Redo, and the absolute requirement for both components of the recE/T and redo/p systems to be co-expressed in order for recombination to occur, the recombinogenic window is limited to the arabinose induction time and the half-life of the least stable component. Taken together with the facts that recA hosts will most commonly be used, and that the hosts will also either be recBC', or a phenocopy of recBC (due to the expression of Redy), this means that the risk of unwanted intramolecular reombination is greatly reduced. A further useful characteristic of pBAD-ctpy(tet) & &** these plasmids tend to be lost rapidly when they are not selected for during culturing. This is probably due to the constitutive expression of Redy, and may also vary according to host cell factors, for example the presence of RecBCD. Replication of pR6K/BAD-o0y requires the R6K origin and the Pir-116 protein (Metcalf ere/., 1994, Gene 138,1-7). Tbe pR6K/BAD/aBy, carries the R6K origin, which was obtained from pJP5603 (Penfold and Pemberton, 1992, Genel 18:145-6), the pir-116 replicon gene, which controls R6K ori plasmid replication in bacteria, and the tetracycline resistance gene iet from pBR322. Pir-116 is a copy-up mutant which allows an R6K origin-containing plasmid to exist in an E. colt strain at greater than 200 copies per cell. The pir-116 gene was PCR amplified from the E. coli strain BW3647 and cloned behind die lacZ promoter. To generate pR6K/BAD/afiy, the R6K origin, pir-116 and tef were introduced into pBAD-afiy (Muyrers ef a/., 1999, Nucleic Acids Research, 27:1555-1557) by ET recombination, thereby replacing the ColEl origin and the ampicillin resistance gene originally present on pBAD-oBy. Similarly, pR6K/BAD/ETy and pR6K/BAD/recT were generated. The copy number of any R6K-based plasxnid was found to be approximately two times higher in comparison with the respective CoIEl-based parental plasmid. In a side-by-side comparison of pR6K/BAD/aBy and pBAD-afly in a standard BAC subcloning exercise, the R6K-based plasmid was found to work more efficiently (sec Figure 9B). The R6K replication system present on these pR6K plasmids does not contain any significant sequence homology to other replication origins, including pi 5a and ColEL Moreover, the R6K based plasmids arc compatible with any other replication origin. Thus, replication origins such as Col El zndplSA can be included in the linear vector used for ET subcloning. ET Subcloning Subcloning of a 19kb fragment including exons 2 and 3 of the AF-4 gene present on a BAC is shown in Figure 10. First, pR6K/BAD-aBy was transformed into the BAC carrying strain. Subsequently, the transformed strain was grown on LB medium containing 15 pgfml tetracyclin and 12.5 /tg/ml chloramphenicol The growing cells were induced with L-arabinose for 1 hour, after which electrocompetexxt cells were prepared. These cells were transformed by electroporation with the linear vector, which contained the pi 5A origin of replication and the ampicillin resistance gene, fi-lactamase (bla), flanked by two homology arms of 50 nucleotides which direct homologous recombination to the target DNA on the AF-4 BAC. Recombinants were obtained after growth on LB plates containing 50 /*g/ml ampicillin. As shown in Figure 10B, 5 independent colonies were selected for analysis. DNA was prepared from 5 independent colonies, digested with Hindll, and analyzed on an ethidium bromide stained gel. Hindffl-digested correct colonies and the linear vector alone were used as markers, as well as a 1 kb DNA ladder (Gibco BRL). Correct subclones were confirmed by DNA sequencing. ET Cloning Genomic DNA can also be the direct source of target DNA, as shown in the experiment in Figure 11. In this experiment, the linear vector consisted of the ColEl origin and the kanamycin resistance gene (km), flanked by homology aims which direct recombination to the lacI/lacZlooxs present on Ac £ colt chromosome (see Figure 11A). Genomic DNA was isolated from £ coll prtlinearized by Xhol digestion. Hie linear vector and die prelinearized genomic DNA were mixed and co-elcctroporated into YZ2000, which endogenously expresses RecE/RecT. By selecting on LB plates containing SO //g/ml kanamycin, the desired subclone consisting of the lad and lacZ genes, die ColEl origin and kan was obtained. As shown in Figure 1 IB, restriction analysis of 16 independent colonies contained the correct product (lanes 1*16). Lane 17 shows the linear vector; lane M shows a 1 kb DNA ladder as a marker (Gibco BRL). Another example of successful ET recombination cloning is shown in Figure 12. In this experiment, a fragment was cloned directly from mouse ES cell genomic DNA using a homology arm cloning vector. As shown in Figure 12A, which outlines the cloning strategy, a neomycin resistance gene (neo) from mouse ES cell genomic DNA was employed as the target DNA. The linear vector consisted of the ColEl replication origin plus the chloramphenicol resistance gene Cnf flanked by two arms which were homologous to the Tn5-neo gene. The required mouse EScell line was generated by transfecting a fragment containing TnS-nto under control of the PGK promoter plus * poly A tail. Genomic DNA was prepared from G418 resistance colonies, and sheared with a needle and by phenol/chloroform extraction, creating linear fragments of about 20-40 kb. ET cloning was performed by co-electroporating the linear vector and the sheared genomic DNA into YZ2000, a JC8679 derivative (dark, stpra) in which die restriction system, which degrades foreign methylated DNA, is partially impaired by deletion of the mcrA, mcrBC, hsdRMS and mrr genes. Because ovcrcxpression of RecT greatly enhances the overall ET recombination efficiency, YZ2000 was transformed with the pR6K/B AD/recT plasmid. YZ2000 cells carrying pR6K/BAD/recT, which were induced with L-arabinose for 1 hour prior to harvesting, were co-transformed by electcoporation with 0*5 p% linear vector and 5.0 fig sheared mouse ES cell genomic DNA. An average of 25-35 colonies were obtained on LB plates containing 50 //g/ml chloramphenicol. By re-streaking these colonies on plates containing 50 /*g/ml kanamycin, 6 out of 30 colonies tested were found to grow by assaying 7>L5-neo expression. In Figure 12, panel B, restriction analysis of kanamycin resistant colonies demonstrated that all 6 colonies tested were found to be correct (lanes 2-7). The restriction pattern of a false positive, which grew in the presence of chloramphenicol but failed to grow in the presence of kanamycin, is shown in lane 1. All of these false positives contained the religated vector. An experiment showing a combination of ET subcloning and cloning is shown in Figure 13. The linear vector consisted of the ColEl replication origin plus the kanamycin resistance gene KmT. Each terminus of the linear vector consisted of a BstZ171 site and 2 homology arms. The homology aims present at the extremes of the linear vector (indicated by the smaller boxes in. Figure 13) are homologous to the X phage target DNA. The second set of homology aims (indicated by the larger boxes) is homologous to the lacl4acZ genes present on the E.coli chromosome. In the first subcloning step, the linear vector was co-electroporated with linearized X phage target DNA into the ET proficient £ coli strain JC8679AlacZ. This resulted in the subcloning of a 6.7kb ADNA fragment including the exo, bet, gam, rexA apd eI857 genes, into the linear vector, thereby generating pYZN/A.- PR. For the next ET recombination step, a new linear vector was used, which contained the chloramphenicol resistance gene cat flanked by mutated laxP sites (loxP*f Araki et al, 1997, Nucleic Acids Research, 25:868-372), as well as terminal arms which were homologous to the X DNA present on pYZN/A~ PR. This linear vector was co-electroporated with pYZN/X- PR into the ET proficient strain JC8679AlacZv resulting in Ac formation of pYZN/A- PR/Cm. From this plasmid, the car-containing X DNA fragment flanked by the two terminal arms which were homologous to lacI-lacZ was released by B$tZ171 digestion. This fragment was used to target the chromosome of the E. coli strain JCSS19 (Willetts and Clark, 1969, J Bacterid, 100:231-239) which expressed RccE and RecT from pBADRecE/T (Zhang et aL, 1998, Mature Genetics 20:123-128). After ET recombination and selection for growth in the presence of 20 μg/ml chloramphenicol, YZ2001/Cm strain was generated. Deletion of cat to generate YZ2001 was done by using the 706-Cre plasmid, which is identical to 705-Cre except that it carries the tetracyclin resistance gene (tef) instead of the chloramphenicol resistance gene, as described (Buchholz et aL, 1996, Nucleic Acids Research, 24:3118-3119). YZ2001 thus carried the 6.7 kb X DNA fragment (exo—cI857) plus a mutated loxP site on the chromosome. Since YZ2001/Cm allows heat-inducible expression of the A genes exo9 bet and gam, it is conditionally ET proficient A similar strategy can be used to generate knock-out constructs or to perform BAC modifications, for example. Thus, the examples presented above demonstrate several approaches for successful cloning and subcloning using RecE/T and Reda/p-mediated homologous recombination. The invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed since these embodiments are intended as illustration of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description* Such modifications are also intended to fell within the scope of the appended claims. Throughout this application various references are cited, the contents of each of which is hereby incorporated by reference into the present application in its entirety for all purposes. 1. A method for introducing a double-stranded target DNA into a vector comprising culturing a bacterial cell that expresses a functional recombinase, said bacterial cell containing (a) the target DNA comprising a first double-stranded terminus and a second double-stranded terminus, and (b) a vector DNA comprising, in the following order along the vector DNA strand: (i) a first double-stranded homology arm; (ii) an origin of replication; and (iii) a second double-stranded homology arm, such that the sequence of a vector DNA strand of the first homology arm is designed to be homologous to the sequence of a target DNA strand of the first terminus, and the sequence of a vector DNA strand of the second homology arm is designed to be homologous to the sequence of the target DNA strand of the second terminus, such that the target DNA is inserted into the vector DNA between the homology arms. 2. A method for making a cell containing a recombinant DNA molecule, said method comprising: a) introducing a first and a second strand of a double-stranded vector into a cell, said cell containing a double-stranded target DNA and expressing a bacterial recombinase, said vector comprising an origin of replication and two homology arms, in the following order from 5! to 3' along said first vector DNA strand: a first homology arm, one strand of the origin of replication, and a second homology arm; said target DNA comprising a target DNA sequence and two termini, in the following order, from 3' to 5' along a target DNA strand: a first terminus, the target DNA sequence, and a second terminus, such that the sequence of the first homology arm on said vector DNA strand is homologous to the sequence of the first terminus on said target DNA strand, and the sequence of the second homology arm on said vector DNA strand is homologous to the sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. 3. A method for making a cell containing a recombinant DNA molecule, said method comprising: introducing a first and a second strand of of a double-stranded vector and first and second double-stranded adaptor oligonucleotides into a cell, said cell containing a double-stranded target DNA and expressing a bacterial recombinase, said vector comprising an origin of replication and two double-stranded homology arms, in the following order from 5' to 3' along said first vector DNA strand: a first homology arm, the origin of replication, and a second homology arm; said target DNA comprising a target DNA sequence and two double-stranded termini, in the following order, from 3' to 5' along a target DNA strand: a first terminus, a target DNA sequence, and a second terminus; said first oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3' to 5': a first nucleotide sequence and a second nucleotide sequence, wherein said first nucleotide sequence is homologous to the nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence is designed to be homologous to the nucleotide sequence of the first terminus on said target DNA strand; said second oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5', a third nucleotide sequence and a fourth nucleotide sequence, wherein said third nucleotide sequence is homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth nucleotide sequence is designed to be homologous to the nucleotide sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. 4. A method for making a cell containing a recombinant DNA molecule, said method comprising: a) introducing a first and a second strand of a double-stranded target DNA molecule into a cell, said cell containing a vector and expressing a bacterial recombinase, said target DNA comprising a target DNA sequence and two double-stranded termini, in the following order, from 3! to 5' along said first target DNA strand: a first terminus, a target DNA sequence, and a second terminus; said vector comprising an origin of replication and two homology arms, in the following order from 5* to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the sequence of the first homology arm on.said vector DNA strand is designed to be homologous to the sequence of the first terminus on said first target DNA strand, and the sequence of the second homology arm on said vector DNA strand is designed to be homologous to the sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. 5. A method for making a cell containing a recombinant DNA molecule, said method comprising: a) introducing a first and a second strand of a double-stranded target DNA molecule and a first and second double-stranded oligonucleotide into a cell, said cell containing a vector and expressing a bacterial recombinase, said target DNA comprising a target DNA sequence and two termini, in the following order, from 3' to 5! along said first target DNA strand: a first terminus, a target DNA sequence, and a second terminus; said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3* along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; said first double-stranded oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 31 to 5f: a first nucleotide sequence and a second nucleotide sequence, wherein said first nucleotide sequence is homologous to the nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence designed to be homologous to the nucleotide sequence of the first terminus on said target DNA strand; said second double-stranded oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5', a third nucleotide sequence and a fourth nucleotide sequence, wherein said third nucleotide sequence is homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth nucleotide sequence is designed to be homologous to the nucleotide sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. 6. A method for making a cell containing a recombinant DNA molecule, said method comprising: a) introducing a first and a second strand of a double-stranded vector and a first and a second strand of a double-stranded target DNA into a cell expressing a bacterial recombinase, said double-stranded vector comprising an origin of replication and two homology arms, in the following order from 5' to 3'along said first vector DNA strand: a first homology arm, the origin of replication and a second homology arm, said double-stranded target DNA comprising a target DNA sequence and two termini, in the following order, from 31 to 5' along said first target DNA strand: a first terminus, a target DNA sequence; and a second terminus; such that the nucleotide sequence of the first homology arm on said vector DNA strand is designed to be homologous to the nucleotide sequence of the first terminus on said target DNA strand, and the nucleotide sequence of the second homology arm on said vector DNA strand is designed to be homologous to the sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. 7. A method for making a cell containing a recombinant DNA molecule, said method comprising: a) introducing a first and a second strand of a double-stranded vector, a first and a second strand of a double-stranded target DNA molecule, and a first and second double-stranded adaptor oligonucleotide into a cell expressing a bacterial recombinase, said vector comprising an origin of replication and two double-stranded homology arms, in the following order from 5' to 3! along said first vector DNA strand: a first homology arm, the origin of replication and a second homology arm; said target DNA comprising a target DNA sequence and two double-stranded termini, in the following order, from 3' to 5' along a target DNA strand: a first terminus, the target DNA sequence, and a second terminus; said first oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3' to 51: a first nucleotide sequence and a second nucleotide sequence, wherein said first nucleotide sequence is homologous to the nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence is designed to be homologous to the sequence of the first terminus on said target DNA strand; said second oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 51, a third nucleotide sequence and a fourth nucleotide sequence, wherein said third nucleotide sequence is homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth nucleotide sequence is designed to be homologous to the nucleotide sequence of the second terminus on said target DNA strand; and b) subjecting the cell to conditions that allow intracellular homologous recombination to occur. 8. The method of claim 6 wherein the cell further contains a nucleotide sequence encoding a site-specific recombinase operatively linked to a promoter, and the vector further comprises a first and second recognition site for the site-specific recombinase, a first recognition site located outside the first and second homology arms, and a second site-specific recombinase recognition site located inside the first and second homology arms; and during or after step b), inducing expression of the site-specific recombinase. 9. The method of claim 7 wherein the cell further contains a nucleotide sequence encoding a site-specific recombinase operatively linked to a promoter, and the vector further comprises a first and second recognition site for the site-specific recombinase, a first recognition site located outside the first and second homology arms, and a second site-specific recombinase recognition site located inside the first and second homology arms; and during or after step b), inducing expression of the site-specific recombinase. 10. The method of claim 6 wherein the cell further contains a nucleotide sequence encoding a site-specific endonuclease operatively linked to a promoter, and the vector further comprises a recognition site for the site-specific endonuclease located inside the first and second homology arms; and during or after step b), inducing expression of the site-specific endonuclease. 11. The method of claim 7 wherein the cell further contains a nucleotide sequence encoding a site-specific endonuclease operatively linked to a promoter, and the vector further comprises a recognition site for the site-specific endonuclease located inside the first and second homology arms; and during or after step b), inducing expression of the site-specific endonuclease. 12. The method of any one of Claims 2-11 wherein the vector further comprises a selectable marker located outside the first and second homology arms, such that the vector comprises, in either of the following two orders from 5f to 3' along a vector DNA strand: i) the first homology arm, the selectable marker, the origin of replication and the second homology arm, or ii) the first homology arm, the origin of replication, the selectable marker, and the second homology arm. 13. The method of Claim 12 wherein the selectable marker confers antibiotic resistance to the cell containing the vector. 14. The method of any one of Claims 2-11 wherein the bacterial recombinase is RecE/T or Reda/p recombinase or both RecE/T and Reda/p recombinases. 15. The method of any one of Claims 2-11 wherein the cell is a bacterial cell. 16. The method of any one of Claims 2-11 wherein the cell is an £. coli cell. 17. The method of any one of Claims 2-11 wherein the cell is a eukaryotic cell that recombinantly expresses RecE/T and/or Reda/p recombinase. 18. A method for making a recombinant DNA molecule comprising the method of any one of Claims 2-11 which further comprises isolating a recombinant DNA molecule that comprises the target DNA sequence inserted into the vector. 19. A double-stranded DNA vector useful for directed cloning or subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5f to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the nucleotide sequence of the first homology arm on a first vector DNA strand is homologous to the sequence of the first terminus on a first target DNA strand, and the nucleotide sequence of the second homology arm on the first vector DNA strand is homologous to the nucleotide sequence of the second terminus on the first target DNA strand. 20. The vector of Claim 19 wherein the origin of replication is a bacterial origin of replication. 21. The vector of Claim 19 wherein the origin of replication functions in E. coli. 22. The vector of Claim 19 wherein the origin of replication functions in a mammalian cell 23. A cell comprising a double-stranded DNA vector useful for directed cloning or subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the nucleotide sequence of the first homology arm on a first vector DNA strand is designed to be homologous to the sequence of a first terminus on a first target DNA strand, and the nucleotide sequence of the second homology arm on the first vector DNA strand is designed to be homologous to the nucleotide sequence of a second terminus on the first target DNA strand. 24. The cell of Claim 23 which is a bacterial cell. 25. A kit useful for directed cloning or subcloning of a target DNA molecule comprising in one or more containers: a) a double-stranded DNA vector useful for directed cloning or subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; such that the nucleotide sequence of the first homology arm on a first vector DNA strand is designed to be homologous to the sequence of a first terminus on a first target DNA strand, and the nucleotide sequence of the second homology arm on the first vector DNA strand is designed to be homologous to the nucleotide sequence of a second terminus on the first target DNA strand; and b) a cell containing a bacterial recombinase. 26. The kit of Claim 25 wherein the homology arms have sequence homology to a BAC, PAC, lambda, plasmid or YAC based cloning vector. 27. The kit of Claim 25 wherein the first and second double-stranded oligonucleotide have nucleotide sequence homology to a BAC, PAC, lambda, plasmid or YAC based cloning vector. 28. A kit useful for directed cloning or subcloning of a target DNA molecule comprising in one or more containers: a) a double-stranded DNA vector useful for directed cloning and subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 5' to 3f along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; and b) a first double-stranded adaptor oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3! to 5': a first sequence and a second sequence, wherein said first nucleotide sequence is homologous to the nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence is designed to be homologous to the nucleotide sequence of a first terminus on a target DNA strand; c) a second double-stranded adaptor oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5': a third nucleotide sequence and a fourth nucleotide sequence, wherein said third nucleotide sequence is homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth nucleotide sequence is designed to be homologous to the nucleotide sequence of a second terminus on said target DNA strand; and d) a cell containing a bacterial recombinase. 29. The kit of Claim 25 or 28 wherein the cell is an E. coli cell. 30. The kit of Claim 25 or 28 wherein the cell is a frozen cell competent for uptake of DNA. 31. A kit useful for directed cloning or subcloning of a target DNA molecule comprising in one or more containers: a) a double-stranded DNA vector useful for directed cloning and subcloning of a target DNA molecule of interest, said vector comprising an origin of replication and two homology arms, in the following order from 51 to 3' along a vector DNA strand: a first homology arm, the origin of replication and a second homology arm; b) a first double-stranded adaptor oligonucleotide comprising a first oligonucleotide DNA strand comprising, in the following order, from 3' to 5': a first nucleotide sequence and a second nucleotide sequence, wherein said first nucleotide sequence is homologous to the nucleotide sequence of the first homology arm on said vector DNA strand, and said second nucleotide sequence is designed to be homologous to the nucleotide sequence of a first terminus on a target DNA strand; and c) a second double-stranded adaptor oligonucleotide comprising a second oligonucleotide strand comprising, in the following order, from 3' to 5!: a third nucleotide sequence and a fourth nucleotide sequence, wherein said third nucleotide sequence is homologous to the nucleotide sequence of the second homology arm on said vector DNA strand and said fourth sequence is designed to be homologous to the nucleotide sequence of a second terminus on said target DNA strand. 32. The kit of Claim 25, 28, or 31 wherein the DNA vector is purified. 33. The kit of Claim 28 or 31 wherein the DNA vector, the first double-stranded oligonucleotide, and the second double-stranded oligonucleotide are purified. 34. The kit of Claims 25, 28, or 31 wherein the target DNA molecule comprises bacterial, viral, parasite, or protozoan DNA. 35. The kit of Claims 25, 28, or 31 wherein the target DNA molecule comprises a genetic mutation or polymorphism known or suspected to be associated with a disorder or disease. 36. The kit of any one of Claims 25-29 wherein the bacterial recombinase is RecE/T or Reda/(3 recombinase or both RecE/T and Redαβ / recombinases. 37. The method of any one of Claims 2-11 wherein the target DNA is known or suspected to be associated with a disorder or disease when genetically mutated. 38. The method of any one of Claims 2-11 wherein the target DNA is a bacterial, viral, parasite, or protozoan DNA. 39. The method of Claims 2, 4, 6, 8, or 10 which further comprises detecting a recombinant DNA molecule that comprises the target DNA inserted into the vector. 40. The method of Claims 3, 5, 7, 9, or 11 which further comprises detecting a recombinant DNA molecule that comprises the target DNA inserted into the vector. 41. A method of detecting the presence of an infectious agent comprising carrying out the method of Claim 39, wherein the target DNA is derived from a patient suspected of having the infectious disease, and the sequences of the first and second homology arms are homologous to the sequences present in DNA of the infectious agent. 42. A method of detecting the presence of an infectious agent comprising carrying out the method of Claim 40, wherein the target DNA is derived from a patient suspected of having the infectious disease, and said second and fourth nucleotide sequences are homologous to sequences present in DNA of the infectious agent. 43. The method of Claim 41 or 42 wherein the infectious agent is a virus, bacteria, protozoa, fungus, or parasite. 44. A method of detecting the presence of a genetic condition, disease, disorder, or polymorphic trait comprising carrying out the method of Claim 39, wherein the target DNA is derived from a patient suspected of having a genetic condition, disease, disorder, or polymorphic trait, and the sequence of the first homology arm is homologous to the sequence upstream from a site known or suspected to be associated with the genetic condition, disease, disorder, or polymorphic trait, and the sequence of the second homology arm is homologous to the sequence downstream from a site known or suspected to be associated with the genetic condition, disease, disorder, or polymorphic trait. 45. A method of detecting the presence of a genetic condition, genetic disease, genetic disorder, or polymorphic trait comprising carrying out the method of Claim 40, wherein the target DNA is derived from a patient suspected of having the genetic condition, genetic disease, genetic disorder, or polymorphic trait, and the sequence of the first double-stranded oligonucleotide is homologous to the sequence upstream from a site known or suspected to be associated with the genetic condition, genetic disease, genetic disorder, or polymorphic trait, and the sequence of the second double-stranded oligonucleotide is homologous to the sequence downstream from a site known or suspected to be associated with the genetic condition, genetic disease, genetic disorder, or polymorphic trait. 46. The method of Claims 44 or 45 wherein the genetic condition, genetic disease, genetic disorder, or polymorphic trait is or predisposes the patient to cancer, asthma, arthritis, drug resistance, drug toxicity, or a neural, neuropsychiatry, metabolic, muscular, cardiovascular, or skin condition, disease or disorder. 47. The vector of Claim 19 wherein the vector further comprises a selectable marker located outside the first and second homology arms, such that the vector comprises, in either of the following two orders from 5! to 3' along a vector DNA strand: i) the first homology arm, the selectable marker, the origin of replication and the second homology arm, or ii) the first homology arm, the origin of replication, the selectable marker, and the second homology arm. 48. The vector of Claim 47, wherein the sequence of the vector does not contain one or more direct repeats of a sequence of at least five or more nucleotide base pairs either 5' or 3! to both the origin of replication and the selectable marker. 49. A method for introducing a double-stranded target DNA into a vector, substantially as hereinabove described and illustrated with reference to the accompanying drawings.

Documents:

in-pct-2002-0156-che abstract duplicate.pdf

in-pct-2002-0156-che claims duplicate.pdf

in-pct-2002-0156-che description (complete) duplicate.pdf

in-pct-2002-0156-che drawings duplicate.pdf

in-pct-2002-156-che-claims .pdf

in-pct-2002-156-che-correspondance others.pdf

in-pct-2002-156-che-correspondance po.pdf

in-pct-2002-156-che-description complete.pdf

in-pct-2002-156-che-drawings.pdf

in-pct-2002-156-che-form 1.pdf

in-pct-2002-156-che-form 19.pdf

in-pct-2002-156-che-form 3.pdf

in-pct-2002-156-che-pct.pdf