Title of Invention	ASSAY FOR DETECTION AND QUANTIFICATION OF HIV-1 IN BODY FLUIDS BY REAL TIME PCR AND A METHOD FOR DEVELOPING THE SAME
Abstract	An assay for detection and quantification of HIV-1 in all body fluids such as serum/plasma, saliva, vaginal secretions, cerebrospinal fluid, urine by Real Time PCR comprising amplified p24 region of gag gene of HIV-1, specific primers, Gag Minor Groove Binding (MGB) probe and recombinant plasmid; wherein the said primers, Gag-F (or 1280F) and Gag-R (or 1403-R), Gag MGB probe having the sequence, Gag-F: 5'- CTAGACTTT(A/G)AATGCATGGGTAAAAGTA -3' (Alternatively, 1280-F: 5' TCA GCCCAGAAGTAATACCCATGT-3'), Gag-R: 5'-GATGTCCCCCCACTGTATTTAACA-3' (Alternatively, 1403-R: 5'-CCATTCTGCAGCCTCTTCATTGA-3'), Gag MGB Probe: 5'- aCATTATCAGAAGGAGCCACCb-3' a- coupled FAM (fluorescent reporter) b- coupled MGB-NFQ (quencher).

Title of Invention

ASSAY FOR DETECTION AND QUANTIFICATION OF HIV-1 IN BODY FLUIDS BY REAL TIME PCR AND A METHOD FOR DEVELOPING THE SAME

Abstract

An assay for detection and quantification of HIV-1 in all body fluids such as serum/plasma, saliva, vaginal secretions, cerebrospinal fluid, urine by Real Time PCR comprising amplified p24 region of gag gene of HIV-1, specific primers, Gag Minor Groove Binding (MGB) probe and recombinant plasmid; wherein the said primers, Gag-F (or 1280F) and Gag-R (or 1403-R), Gag MGB probe having the sequence, Gag-F: 5'- CTAGACTTT(A/G)AATGCATGGGTAAAAGTA -3' (Alternatively, 1280-F: 5' TCA GCCCAGAAGTAATACCCATGT-3'), Gag-R: 5'-GATGTCCCCCCACTGTATTTAACA-3' (Alternatively, 1403-R: 5'-CCATTCTGCAGCCTCTTCATTGA-3'), Gag MGB Probe: 5'- aCATTATCAGAAGGAGCCACCb-3' a- coupled FAM (fluorescent reporter) b- coupled MGB-NFQ (quencher).

Full Text	Patent Application for an RT-PGR assay based on Real Time PCR for detection and Quantitative Determination of HIV-1 in body fluids. Field of Invention: This invention relates to an assay for detection and quantification of HIV-1 in body fluids by real time PCR and a method for developing the same. Background of Invention: AIDS, caused by Human Immunodeficiency virus is a serious disorder of the immune system thereby making the body's normal defense system vulnerable to a host of life-threatening infections. HIV-1 global epidemic has greatly exceeded earlier predictions and above 90% of all HIV infected people are living in developing countries. The major breakthroughs contributing to the care of HIV infected individuals include the development of several antiretroviral drugs and effective techniques to monitor HIV-1 virus load in plasma since it is a more valuable marker than changes in CD4+ T cell counts in predicting disease progression, response to treatment and risk of vertical transmission. In most cases, untreated HIV-1 infection is characterized by high-level viral production and CD4 T ceil depletion. The plasma HIV-1 virus levels appear to reach a set point after infection, these steady levels strongly correlate with the subsequent risk of clinical progression after primary infection. Moreover early changes in virus levels in response to treatment appear to predict a long-term clinical benefit. For this reason, there are marry assays available for quantifying HIV-1 load in plasma samples. But most of these commercially available assays require several amplification reactions per sample, thus they are expensive and allow analysis of only a few samples for each amplification run, the post amplification steps are time consuming and may lead to contamination, the linear range of the assay is usually narrow between four to five log decades. In the present invention a RT-PCR assay based on Real Time PCR is developed which measures PCR product accumulation in the exponential phase through a dual labeled fluoregenic probe, MGB probe. This technique employs the endogenous 5-3' nuclease activity of Taq DNA polymerase. The reporter dye emission is quenched when the probe is intact but when the probe is annealed to the target sequence during PCR, the exonuclease activity of Taq DNA polymerase releases the reporter from the vicinity of the quencher dye resulting in increased reporter fluorescence which is directly proportional to the input target DNA/cDNA. This assay has wide dynamic range of quantification, high technical sensitivity, precision and high throughput. Objects of Invention: An object of this invention is to propose an assay for detection and quantification of HIV-1 in body fluids by real time PCR. Another object of this invention is to propose a method for developing an assay for detection and quantification of HIV-1 in body fluids by real time PCR. Further object of this invention is to propose an assay for detection and quantification of HIV-1 in body fluids by real time PCR using a set of specific primers and probes. Still another object of this invention is to propose an assay for detection and quantification of HIV-1 in body fluids by real time PCR using a recombinant plasmid. Brief Description of the Invention. According to this invention there is provided an assay for detection and quantification of HIV-1 in all body fluids such as serum/plasma, saliva, vaginal secretions, cerebrospinal fluid, urine by Real Time PCR comprising amplified p24 region of gag gene of HIV-1, specific primers, Gag Minor Groove Binding (MGB) probe and recombinant plasmid; wherein the said primers, Gag-F (or 1280F) and Gag-R (or 1403-R), Gag MGB probe having the sequence, Gag-F: 5'-CTAGACTTT(A/G)AATGCATGGGTAAAAGTA -3' (Alternatively, 1280-F: 5' TCA GCCCAGAAGTAATACCCATGT-3'), Gag-R: 5'-GATGTCCCCCCACTGTATTTAACA-3' (Alternatively, 1403-R: 5'-CCATTCTGCAGCCTCTTCATTGA-3'), Gag MGB Probe: 5'-aCATTATCAGAAGGAGCCACCb-3' a- coupled FAM (fluorescent reporter) b- coupled MGB-NFQ (quencher). 2. Control primers and probe designed for Real time RT-PCR assay: Specific primers and probe were designed based on RNA bacteriophage, MS2, sequence to act as an internal control. Forward primer MS2-Control-F and reverse primer MS2-Control-R, designed for the real time RT-PCR assay, amplify a 95bp fragment of MS2 RNA bacteriophage genomic sequence. Control probe is an MGB (minor groove binder) probe coupled with fluorescent dye, VIC at 5' end and a non-fluorescent quencher at 3'end. The MGB probe increases the stability and specificity of probe hybridization. The use of non-fluorescent quencher (NFQ) enhances the spectral performance. Sequence of the primers and probe are: • MS2-Control-F 5'- CGGCTGCTCGCGGATA -3' • MS2-Control-R: 5'- TAGCGACCACTGTCGTGCTTT -3' • Control Probe: 5'-a CCTCGGGTTTCCGTCT b-3' a- coupled VIC (fluorescent reporter). b- coupled MGB-NFQ (quencher). 3. Construction of plasmid pAAgag for preparing RNA transcripts to be used as Standards for Real time PCR assay: 137 base pair fragment was PCR amplified with Gag-F (or 1280-F) and Gag-R (or 1403-R) using Taq polymerase from plasmid p96ZM651.8 containing a full-length molecular clone of subtype C isolate from Zambia. The amplified product with single A overhangs at 3' ends was ligated with single 3' T overhangs of linearized plasmid pCR3.1 using T4 DNA ligase. This resulted in the formation of a plasmid, pAAgag, containing 137 fragment of HIV-1 subtype C. The clone was confirmed by restriction digestion, PCR re-amplification with Gag-F (or 1280-F) and Gag-R (or 1403-R) primers and sequencing using T7 primer. 4. Preparation of HIV Standard RNA templates by In-vitro transcription of pAAgag: pAAgag has a T7 promoter and priming site upstream of the cloned fragment, which enables in-vitro transcription of sense strand. The plasmid was linearized with EcoRV. Linearized plasmid was gel extracted and purified. In-vitro transcription was set up with transcription buffer, rNTPs, linearized templates and T7 RNA polymerase enzyme. Plasmid was digested with RNase free ONasel. RNA (transcripts) were purified and suspended in DEPC treated water. 5. Construction of RNA standard curve: Serial dilutions of transcripts were prepared in nuclease free water containing carrier tRNA Ten fold dilution series of in-vitro transcribed RNA were measured in triplicate in a 25 uJ RT-PCR reaction using one step RT-PCR master-mix consisting of 800nM each of Gag-F (or 1280-F) and Gag-R (or 1403-R) primers and 80nM of Gag probe and 200nM each of MS2-Control-F and MS2-Control-R primers and 40nM of MS2-Control probe. The resultant standard curve was linear in the range of 101 to 108 copies, revealing a quantification range of 8 logarithmic decades with a high coefficient of correlation (r2) of 0.994. The amplification efficiency was determined as 0.9884 from the slope of the curve. 6. Determining the analytical specificity and sensitivity of the assay: Forty no template controls and ten HIV negative individuals tested negative in the assay as expected. The detection limit of the assay was 107 RNA -molecules per ml. Sixty-two seropositive samples were analyzed by quantitative real Time PCR. The HIV viral load values obtained were ranging from as low as 138 copies/ml to as high as 2702900 copies/ml. Five samples showed undetectable values and were classified as carrying less than 100 viral copies/mi. We Claim: 1. An assay for detection and quantification of HIV-1 in all body fluids such as serum/plasma, saliva, vaginal secretions, cerebrospinal fluid, urine by Real Time PCR comprising amplified p24 region of gag gene of HIV-1, specific primers, Gag Minor Groove Binding (MGB) probe and recombinant plasmid; wherein the said primers, Gag-F (or 1280F) and Gag-R (or 1403-R), Gag MGB probe having the sequence: • Gag-F: 5'-CTAGACTTT(A/G)AATGCATGGGTAAAAGTA -3' (Alternatively, 1280-F: 5' TCA GCCCAGAAGTAATACCCATGT-3') • Gag-R: 5'-GATGTCCCCCCACTGTATTTAACA-3' (Alternatively, 1403-R: 5'-CCATTCTGCAGCCTCTTCATTGA-3') • Gag MGB Probe: 5'-aCATTATCAGAAGGAGCCACCb-3' a- coupled FAM (fluorescent reporter). b- coupled MGB-NFQ (quencher). 2. An assay as claimed in claim 1 wherein developing an assay for detection and quantification of HIV-1 in body fluids by Real Time PCR comprising, designing the specific primers and probe, subjecting the p24 region of the gag gene of HIV-1 to the step of amplification using said primers; designing control primers and probe based on RNA bacteriophage to act as an internal control; constructing recombinant plasmid for preparing RNA transcripts, determining the analytic specificity and sensitivity of the assay. 3. An assay as claimed in claim 2, wherein said internal control is based on amplification of 95 bp region of MS2 RNA bacteriophage by a set of primers MS2-Control-F and MS2- Control-R and control MGB probe, MS2-Control probe; wherein the said primers and probe have the following sequence. • MS2-Control-F: 5'- CGGCTGCTCGCGGATA -3' • MS2-ControI-R: 5' - TAGCGACCACTGTCGTGCTTT -3' • Control Probe: 5'-a CCTCGGGTTTCCGTCT b-3' a- coupled VIC (fluorescent reporter). b- coupled MGB-NFQ (quencher). 4. An assay as claimed in claim 2, wherein said RNA transcripts amplified from plasmid pAAgag and are used as "standards" for quantification of HIV-1 in body fluids including plasma samples. 5. An assay as claimed in claim 2, wherein the said plasmid pAAgag contains a 137bp fragment of p24 region of gag gene of HIV-1 subtype C and was constructed by cloning 137bp fragment of p24 region of gag gene of HIV-1 subtype C isolate into plasmid pCR3.1.

Full Text

Patent Application for an RT-PGR assay based on Real Time PCR for detection and Quantitative Determination of HIV-1 in body fluids.
Field of Invention:
This invention relates to an assay for detection and quantification of HIV-1 in body fluids by real time PCR and a method for developing the same.
Background of Invention:
AIDS, caused by Human Immunodeficiency virus is a serious disorder of the immune system thereby making the body's normal defense system vulnerable to a host of life-threatening infections. HIV-1 global epidemic has greatly exceeded earlier predictions and above 90% of all HIV infected people are living in developing countries.
The major breakthroughs contributing to the care of HIV infected individuals include the development of several antiretroviral drugs and effective techniques to monitor HIV-1 virus load in plasma since it is a more valuable marker than changes in CD4+ T cell counts in predicting disease progression, response to treatment and risk of vertical transmission.
In most cases, untreated HIV-1 infection is characterized by high-level viral production and CD4 T ceil depletion. The plasma HIV-1 virus levels appear to reach a set point after infection, these steady levels strongly correlate with the subsequent risk of clinical progression after primary infection. Moreover early
changes in virus levels in response to treatment appear to predict a long-term clinical benefit. For this reason, there are marry assays available for quantifying HIV-1 load in plasma samples. But most of these commercially available assays require several amplification reactions per sample, thus they are expensive and allow analysis of only a few samples for each amplification run, the post amplification steps are time consuming and may lead to contamination, the linear range of the assay is usually narrow between four to five log decades. In the present invention a RT-PCR assay based on Real Time PCR is developed which measures PCR product accumulation in the exponential phase through a dual labeled fluoregenic probe, MGB probe. This technique employs the endogenous 5-3' nuclease activity of Taq DNA polymerase. The reporter dye emission is quenched when the probe is intact but when the probe is annealed to the target sequence during PCR, the exonuclease activity of Taq DNA polymerase releases the reporter from the vicinity of the quencher dye resulting in increased reporter fluorescence which is directly proportional to the input target DNA/cDNA. This assay has wide dynamic range of quantification, high technical sensitivity, precision and high throughput. Objects of Invention:
An object of this invention is to propose an assay for detection and quantification of HIV-1 in body fluids by real time PCR.
Another object of this invention is to propose a method for developing an assay for detection and quantification of HIV-1 in body fluids by real time PCR.
Further object of this invention is to propose an assay for detection and quantification of HIV-1 in body fluids by real time PCR using a set of specific primers and probes.
Still another object of this invention is to propose an assay for detection and quantification of HIV-1 in body fluids by real time PCR using a recombinant plasmid.
Brief Description of the Invention.
According to this invention there is provided an assay for detection and quantification of HIV-1 in all body fluids such as serum/plasma, saliva, vaginal secretions, cerebrospinal fluid, urine by Real Time PCR comprising amplified p24 region of gag gene of HIV-1, specific primers, Gag Minor Groove Binding (MGB) probe and recombinant plasmid; wherein the said primers, Gag-F (or 1280F) and Gag-R (or 1403-R), Gag MGB probe having the sequence, Gag-F: 5'-CTAGACTTT(A/G)AATGCATGGGTAAAAGTA -3' (Alternatively, 1280-F: 5' TCA GCCCAGAAGTAATACCCATGT-3'), Gag-R: 5'-GATGTCCCCCCACTGTATTTAACA-3' (Alternatively, 1403-R: 5'-CCATTCTGCAGCCTCTTCATTGA-3'), Gag MGB Probe: 5'-aCATTATCAGAAGGAGCCACCb-3' a- coupled FAM (fluorescent reporter) b- coupled MGB-NFQ (quencher).
2. Control primers and probe designed for Real time RT-PCR assay:
Specific primers and probe were designed based on RNA bacteriophage,
MS2, sequence to act as an internal control. Forward primer MS2-Control-F
and reverse primer MS2-Control-R, designed for the real time RT-PCR
assay, amplify a 95bp fragment of MS2 RNA bacteriophage genomic
sequence.
Control probe is an MGB (minor groove binder) probe coupled with fluorescent dye, VIC at 5' end and a non-fluorescent quencher at 3'end. The MGB probe increases the stability and specificity of probe hybridization. The use of non-fluorescent quencher (NFQ) enhances the spectral performance. Sequence of the primers and probe are:
• MS2-Control-F 5'- CGGCTGCTCGCGGATA -3'
• MS2-Control-R: 5'- TAGCGACCACTGTCGTGCTTT -3'
• Control Probe: 5'-a CCTCGGGTTTCCGTCT b-3' a- coupled VIC (fluorescent reporter).
b- coupled MGB-NFQ (quencher). 3. Construction of plasmid pAAgag for preparing RNA transcripts to be
used as Standards for Real time PCR assay: 137 base pair fragment was PCR amplified with Gag-F (or 1280-F) and Gag-R (or 1403-R) using Taq polymerase from plasmid p96ZM651.8 containing a full-length molecular clone of subtype C isolate from Zambia. The amplified product with single A overhangs at 3' ends was ligated with single 3' T overhangs of linearized plasmid pCR3.1 using T4 DNA ligase. This resulted in the formation of a plasmid, pAAgag, containing 137 fragment of HIV-1 subtype C. The clone was confirmed by restriction digestion, PCR re-amplification with Gag-F (or 1280-F) and Gag-R (or 1403-R) primers and sequencing using T7 primer.
4. Preparation of HIV Standard RNA templates by In-vitro transcription
of pAAgag:
pAAgag has a T7 promoter and priming site upstream of the cloned fragment, which enables in-vitro transcription of sense strand. The plasmid was linearized with EcoRV. Linearized plasmid was gel extracted and purified. In-vitro transcription was set up with transcription buffer, rNTPs, linearized templates and T7 RNA polymerase enzyme. Plasmid was digested with RNase free ONasel. RNA (transcripts) were purified and suspended in DEPC treated water.
5. Construction of RNA standard curve:
Serial dilutions of transcripts were prepared in nuclease free water containing carrier tRNA Ten fold dilution series of in-vitro transcribed RNA were measured in triplicate in a 25 uJ RT-PCR reaction using one step RT-PCR master-mix consisting of 800nM each of Gag-F (or 1280-F) and Gag-R (or 1403-R) primers and 80nM of Gag probe and 200nM each of MS2-Control-F and MS2-Control-R primers and 40nM of MS2-Control probe. The resultant standard curve was linear in the range of 101 to 108 copies, revealing a quantification range of 8 logarithmic decades with a high coefficient of correlation (r2) of 0.994. The amplification efficiency was determined as 0.9884 from the slope of the curve.
6. Determining the analytical specificity and sensitivity of the assay:
Forty no template controls and ten HIV negative individuals tested negative in
the assay as expected. The detection limit of the assay was 107 RNA
-molecules per ml. Sixty-two seropositive samples were analyzed by quantitative real Time PCR. The HIV viral load values obtained were ranging from as low as 138 copies/ml to as high as 2702900 copies/ml. Five samples showed undetectable values and were classified as carrying less than 100 viral copies/mi.

We Claim:
1. An assay for detection and quantification of HIV-1 in all body fluids such as
serum/plasma, saliva, vaginal secretions, cerebrospinal fluid, urine by Real Time PCR
comprising amplified p24 region of gag gene of HIV-1, specific primers, Gag Minor
Groove Binding (MGB) probe and recombinant plasmid; wherein the said primers, Gag-F
(or 1280F) and Gag-R (or 1403-R), Gag MGB probe having the sequence:
• Gag-F: 5'-CTAGACTTT(A/G)AATGCATGGGTAAAAGTA -3'
(Alternatively, 1280-F: 5' TCA GCCCAGAAGTAATACCCATGT-3')
• Gag-R: 5'-GATGTCCCCCCACTGTATTTAACA-3' (Alternatively, 1403-R: 5'-CCATTCTGCAGCCTCTTCATTGA-3')
• Gag MGB Probe: 5'-aCATTATCAGAAGGAGCCACCb-3' a- coupled FAM (fluorescent reporter).
b- coupled MGB-NFQ (quencher).
2. An assay as claimed in claim 1 wherein developing an assay for detection and
quantification of HIV-1 in body fluids by Real Time PCR comprising, designing the
specific primers and probe, subjecting the p24 region of the gag gene of HIV-1 to the step
of amplification using said primers; designing control primers and probe based on RNA
bacteriophage to act as an internal control; constructing recombinant plasmid for
preparing RNA transcripts, determining the analytic specificity and sensitivity of the
assay.

3. An assay as claimed in claim 2, wherein said internal control is based on amplification of
95 bp region of MS2 RNA bacteriophage by a set of primers MS2-Control-F and MS2-
Control-R and control MGB probe, MS2-Control probe; wherein the said primers and
probe have the following sequence.
• MS2-Control-F: 5'- CGGCTGCTCGCGGATA -3'
• MS2-ControI-R: 5' - TAGCGACCACTGTCGTGCTTT -3'
• Control Probe: 5'-a CCTCGGGTTTCCGTCT b-3' a- coupled VIC (fluorescent reporter).
b- coupled MGB-NFQ (quencher).
4. An assay as claimed in claim 2, wherein said RNA transcripts amplified from plasmid
pAAgag and are used as "standards" for quantification of HIV-1 in body fluids
including plasma samples.
5. An assay as claimed in claim 2, wherein the said plasmid pAAgag contains a 137bp fragment of p24 region of gag gene of HIV-1 subtype C and was constructed by cloning 137bp fragment of p24 region of gag gene of HIV-1 subtype C isolate into plasmid pCR3.1.

Documents:

550-DEL-2005-Abstract-(08-11-2011).pdf

550-del-2005-abstract.pdf

550-DEL-2005-Claims-(08-11-2011).pdf

550-del-2005-claims.pdf

550-DEL-2005-Correspondence Others-(08-11-2011).pdf

550-del-2005-correspondence-others.pdf

550-del-2005-correspondence-po.pdf

550-DEL-2005-Description (Complete)-(08-11-2011).pdf

550-del-2005-description (complete).pdf

550-del-2005-form-1.pdf

550-del-2005-form-18.pdf

550-del-2005-form-2.pdf

550-del-2005-form-3.pdf

550-del-2005-form-9.pdf

550-DEL-2005-GPA-(08-11-2011).pdf

« Previous Patent

Next Patent »

Patent Number

251464

Indian Patent Application Number

550/DEL/2005

PG Journal Number

12/2012

Publication Date

23-Mar-2012

Grant Date

19-Mar-2012

Date of Filing

15-Mar-2005

Name of Patentee

DR. PRADEEP SETH

Applicant Address

C/O DEPARTMENT OF MICROBIOLOGY, ALL INDIA INSTITUTE OF MEDICAL SCIENCES, ANSARI NAGAR, NEW DELHI-110029, INDIA

Inventors:

#	Inventor's Name	Inventor's Address
1	DR. PRADEEP SETH	C/O DEPARTMENT OF MICROBIOLOGY, ALL INDIA INSTITUTE OF MEDICAL SCIENCES, ANSARI NAGAR, NEW DELHI-110029, INDIA
2	DR.ARINDAM MAITRA	C/O DEPARTMENT OF MICROBIOLOGY, ALL INDIA INSTITUTE OF MEDICAL SCIENCES, ANSARI NAGAR, NEW DELHI-110029, INDIA
3	MS.ATIMA AGGARWAL	C/O DEPARTMENT OF MICROBIOLOGY, ALL INDIA INSTITUTE OF MEDICAL SCIENCES, ANSARI NAGAR, NEW DELHI-110029, INDIA

PCT International Classification Number

C12N

PCT International Application Number

N/A

PCT International Filing date

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1			NA