| Title of Invention | QUINOLINES USEFUL IN TREATING CARDIOVASCULAR DISEASE |
|---|---|
| Abstract | This invention provides compounds of formula (I) that are useful in the treatment or inhibition of LXR mediated diseases. |
| Full Text | WO 2005/058834 PCT/US2004/041399 QUINOLINES USEFUL IN TREATING CARDIOVASCULAR DISEASE BACKGROUND OF THE INVENTION This invention provides quinolines that are useful in the treatment or inhibition of LXR mediated diseases. Atherosclerosis, a complex disease of lipid disorder and inflammation, is the leading cause of death in developed countries. A number of independent risk factors have been identified and the most notable are high levels of serum LDL cholesterol and low HDL cholesterol. Although some of the most effective therapies such as statins have been shown to lower LDL cholesterol significantly (20-60%), still most patients experience adverse coronary events. Also, statins have their own undesirable side effect profile (myotoxicity) which prevent many patients from taking them. Therefore, additional therapeutic strategies to not only decrease LDL cholesterol but also increase HDL cholesterol are critically needed. An important reason to increase HDL cholesterol is to increase cholesterol transport from peripheral tissues to liver for metabolism and excretion. This function of transporting cholesterol from periphery to liver is called reverse cholesterol transport and HDL plays a major role in this pathway. In addition, HDL has been suggested to inhibit the oxidation of LDL cholesterol, reduce the inflammatory response of endothelial cells, inhibit the coagulation pathway and promote the availability of nitric oxide. The key transporter involved in HDL production and reverse cholesterol transport is ABCA1. Therefore, upregulation of ABCA1 results in increased reverse cholesterol transport as well as inhibition of cholesterol absorption in the gut. LXRs (Liver X receptors), originally identified from liver as orphan receptors, are members of the nuclear hormone receptor super family and are involved in the regulation of cholesterol and lipid metabolism. They are ligand-activated transcription factors and bind to DNA as obligate heterodimers with retinoid X receptors. While LXRa is restricted to certain tissues such as liver, kidney, adipose tissue, intestine and macrophages, LXRß displays a ubiquitous tissue distribution pattern. Activation of LXRs by oxysterols (endogenous ligands) in macrophages results in the expression of several genes involved in lipid metabolism and reverse cholesterol transport including ABCA1, ABCG1 and ApoE. Studies have been conducted in LXRa k/o, LXRß k/o and double k/o mice to determine the physiological 1 WO 2005/058834 PCT/US2004/041399 role of LXRs in lipid homeostasis and atherosclerosis. The data, indicate that in double k/o mice on normal chow diet, increased cholesterol accumulation was observed in macrophages (foam cells) of spleen, lung and arterial wail. This was associated with reduced serum HDL cholesterol and increased LDL cholesterol despite normal total cholesterol levels. While LXRa k/o mice did not show significant changes in hepatic gene expression, LXRß k/o mice showed 58% decrease in hepatic ABCA1 expression and 208% increase in SREBP1c expression suggesting that LXRß may be involved in the regulation of fiver SREBP1c expression. Agonists of LXRa or (3 are very effective in upregulating ABCA1 expression (desirable effect) in macrophages. The biological activities of several agonists have been shown in two atherosclerotic mouse models (ApoE k/o and LDLR k/o). Treatment of these mice with, agonists for 12 weeks resulted in significant inhibition of atherosclerotic lesions. While these two compounds had variable effects on serum cholesterol and lipoprotein levels, both compounds caused a significant increase in serum HDL cholesterol and triglyceride levels. These in vivo data agree well with the in vitro data obtained for the compounds in macrophages. In addition to the lipid and triglyceride effects described above, a very recent communication in Nature Medicine (9: 213-219, 2003) presents convincing data that activation of LXRs results in the inhibition of inflammation and proinfiammatory gene expression in three different models of inflammation (LPS-induced sepsis, acute contact dermatitis of the ear and chronic atherosclerotic inflammation of the artery wall). These data suggest that LXR modulators can mediate two-pronged effect (removal of cholesterol from the macrophages and inhibition of vascular inflammation) resulting in the inhibition of atherosclerotic lesion. DESCRIPTION OF THE INVENTION This invention provides compounds of formula I, having the structure 2 PCT/US2004/041399 WO 2005/058834 wherein: R1 is -H or C1 to C3 alkyl; X1 is a bond, C1 to C5 alkyl, -C{O)-, -C(=CR8R9)-, -O-, -S(O)o, -NR8-, -CR8R9-, -CHR23, -CR8(OR9)-, -C(OR8)2-, -CR8(OC(O)R9)-, -C=NOR9-, -C(O)NR8-, - CH2O-, -CH2S-, -CH2NR8-, -OCH2-, -SCH2-, -NR8CH2-, or R2 is H, C1 to C6 alkyl, C2 to C6 alkenyl, C2 to C6 alkynyl, C3 to C6 cycloalkyl, -CH2OH, C7 to C11 arylalkyl, phenyl, naphthyl, C1 to C3 perfluoroalkyl, CN, C(O)NH2, CO2R12 or phenyl substituted independently by one or more of the groups independently selected from C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 alkynyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, -OH, and C1 to C3 alkyl substituted with 1 to 5 fluorines, or R2 is a heterocycle selected from the group consisting of pyridine, thiophene, benzisoxazole, benzothiophene, oxadiazole, pyrrole, pyrazole, imidazole and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, and C1 to C3 alkyl substituted with 1 to 5 fluorines; X2 is a bond or -CH2-; R3 is phenyl, naphthyl, or phenyl or naphthyl substituted by one to four groups independently selected from C1 to C3 alkyl, hydroxy, phenyl, acyl, halogen, ~ NH2, -CN, -NO2, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, NR14R15, -C(O)R10, -C(O)NR10R11, - 3 PCT/US2004/041399 WO 2005/058834 C(O)NR11A, -CSCR8, -CH=CHR8, -WA, -C=CA, -CH=CHA, -WYA, -WYNR11-A, -WYR10, -WY(CH2)jA, -WCHR11(CH2)jA, -W(CH2)A -W(CH2)jR10, -CHR11W(CH2)R10, -CHR11W(CH2)jA, -CHR11NR12YA, -CHR11NR12YR10, pyrrole, -W(CH2)jA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ, - (CH2)JWA(CH2)KD(CH2)PZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, -W(CH2)jCsCA(CH2)kD(CH2)pZ, and -W(CH2);Z, or R3 is a heterocycle selected from pyridine, pyrimidine, thiophene, furan, benzothiophene, indole, benzofuran, benzimidazole, benzothiazole, benzoxazole, and quinoline each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, hydroxy, phenyl, acyl, halogen, -NH2, -CN, -NO2, C1 to C3 perfluoroalkyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, -C(O)R10, - C(O)NR10R11, -C(O)NR11A, -C=CR8, -CH=CHR8, -WA, -C=CA, -CH=CHA, -WYA, -WYR10, -WY(CH2)jA, -W(CH2)jA, -W{CH2)jR10, -CHR11W(CH2)jR10, -CHR11W(CH2)jA, -CHR11NR12YA, -CHRt1NRl2YR10, -WCHR11(CH2)jA, -W(CH2)iA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)PZ, -(CH2)jWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CHz)pZ, -C=CA(CH2)kD(CH2)pZ, -W(CH2)jC=CA(CH2)kD(CH2)pZ, and -W(CH2)jZ; W is a bond, -O-, -S-, -S(O)-, -S(O)2-, -NR11, or -N(COR12)-; Y is -CO-, -S(O)2-,. -CONR13, -CONR13CO-, -CONR13SO2-, -C(NCN)-, -CSNR13, -C(NH)NR13,or-C(O)O-; j is 0 to ,3; k is 0 to 3; t is 0 to 2; D is a bond, -CH=CH-, -C= -C(O)-, -C=C1 phenyl, -O-, -NH-, -S-, -CHR14-, -CR14R15-, -OCHR14-, -OCR14R15-, or -CH(OH)CH(OH)-; p is 0 to 6; Z is -CO2R11, -CONR10R11, -C(=NR10)NR11R12, -CONH2NH2, -CN, -CH2OH, -NR16R17' Phenyl, CONHCH(R20)COR12, phthalimide, pyrrolidine-2,5-dione, thiazolidine-2,4-dione, tetrazolyl, pyrrole, indole, oxazole, 2-thioxo-1,3-thiazolidin-4-one, C1 to C7 amines, C3 to C7 cyclic amines, or C1 to C3 alkyl 4 PCT/US2004/041399 WO 2005/058834 substituted with one to two OH groups; wherein said pyrrole is optionally substituted with one or two substituents independently selected from the group consisting of -CO2CH3, -CO2H, -COCH3, -CONH2 and -CN; wherein said C1 to C7 amines are optionally substituted with one to two substituents independently selected from the group consisting of -OH, halogen, -OCH3, and -C=CH; wherein said phenyl is optionally substituted with CO2R11; wherein said C3 to C7 cyclic amines are optionally substituted with one or two substituents independently selected from the group consisting of -OH -CH2OH, -CH2OCH3, -CO2CH3, and -CONH2, and wherein said oxazoie is optionally substituted with CH2CO2R11; A is phenyl, naphthyl, tetrahydronaphthyl, indan, or biphenyl, each of which may be optionally substituted by one to four groups independently selected from halogen, C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 alkynyl, acyl, hydroxy, halogen, -CN, -NO2, -CO2R11, -CH2CO2R11, phenyl, C1 to C3 perfluoroalkoxy, C1 to C3 perfluoroalkyl, -NR10R11, -CH2NR10R11, -SR11, C1 to C6 alkyl substituted with 1 to 5 fluorines, C1 to C3 alkyl substituted with 1 to 2 -OH groups, C1 to C6 alkoxy optionally substituted with 1 to 5 fluorines, or phenoxy optionally substituted with 1 to 2 CF3 groups; or A is a heterocycle selected from pyrrole, pyridine, pyridine-N-oxide, pyrimidine, pyrazole, thiophene, furan, quinoline, oxazole, thiazole, imidazole, isoxazole, indole, benzo[1,3]-dioxole, benzo[1,2,5]-oxadiazole, isochromen-1-one, benzothiophene, benzofuran, 2,3-dihydrobenzo[1,4]-dioxine, bithienyl, quinazolin-2,4-[1,3H]dione, and 3-H-isobenzofuran-1-one, each of which may be optionally substituted by one to three groups independently selected from halogen, C1 to C3 alkyl, acyl, hydroxy, -CN, -NO2, C1 to C3 perfluoroalkyl, -NR10R11, -CH2NR10R11, -SR11; C1 to C6 alkyl substituted with 1 to 5 fluorines, and C1 to C3 alkoxy optionally substituted with 1 to 5 fluorines; R4, R5, and R6 are each, independently, -H or -F; 5 WO 2005/058834 PCT/US2004/041399 R7 is hydrogen, C1 to C4 aikyl, C1 to C4 perfiuoroalkyl, halogen, -NO2 or -CN, phenyl or phenyl substituted with one or two group independently selected from halogen, C1 to C2 alkyl and OH ; provided that if R7 is hydrogen, then R3 is selected from: (a) phenyl substituted by -W(CH2)JA(CH2)KD(CH2)PZ, -W(CR18R19)A(CH2)kD(CH2)pZ, -(CH2)WA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or -W(CH2)jC=CA(CH2)kD(CH2)pZ, wherein the phenyl moiety is further optionally substituted with one or two groups independently selected from C1 to C2 alkyl, C1 to C2 perfluoroalkyl, halogen, and CN; and (b) a heterocycle selected from pyridine, pyrimidine, thiophene, and furan, each of which is substituted by one of -W(CH2)jA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ, -(CH2)jWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or -W(CH2)jC=CA(CH2)kD(CH2)pZ; further provided that if X1 R2 forms hydrogen, then R3 is selected from: (a) phenyl substituted by -W(CH2)jA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ, -(CH2)jWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -CHCA(CH2)kD(CH2)pZ, or -W(CH2)jCsCA(CH2)kD(CH2)pZ, wherein the phenyl moiety is further optionally substituted with one or two groups independently selected from C1 to C2 alkyl, C1 to C2 perfluoroalkyl, halogen, and CN; and (b) a heterocycle selected from pyridine, pyrimidine, thiophene, and furan, each of which is substituted by one of -W(CH2)jA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ, -(CH2)jWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or -W(CH2)jC=CA(CH2)kD(CH2)pZ; further provided that R3 and R7 cannot both be hydrogen; each R8 is independently -H, or C1 to C3 alkyl; each R9 is independently -H, or C1 to C3 alkyl; each R10 is independently -H, -OH, C1 to C3 alkoxy, d to C7 alkyl, C3 to C7 alkenyl, C3 to C7 alkynyl, C3 to C7 cycloalkyl, -CH2CH2OCH3, 2-methyl-tetrahydro- 6 WO 2005/058834 PCT/US2004/041399 furan, 2-methyl-tetrahydro-pyran, 4-methyl-piperidine, morpholine, pyrrolidine, or phenyl optionally substituted with one or two C1 to C3 alkoxy groups, wherein said C1 to C7 alkyl is optionally substituted with 1, 2 or 3 groups independently selected from C1 to C3 alkoxy, C1 to C3 thioalkoxy and CN; each R11 is independently -H, C1 to C3 alkyl or R22; or R10 and R11, when attached to the same atom, together with said atom form: a 5 to 7 membered saturated ring, optionally substituted by 1 to 2 groups independently selected from C1 to C3 alkyl, OH and C1-C3 alkoxy, or a 5 to 7 membered ring containing 1 or 2 heteroatoms, optionally substituted by 1 to 2 groups independently selected from C1 to C3 alkyl, OH and C1-C3 alkoxy; each R12 is independently -H, or C1 to C3 alkyl; each R13 is independently -H, or C1 to C3 alkyl; each R14 and R15 is, independently, C1 to C7 alkyt, C3 to C8 cycloalkyl, C2 to C7 alkenyl, C2 to C7 alkynyl, -OH, -F, C7 to C14 arylalkyl, where said arylalkyl is optionally substituted with 1 to 3 groups independently selected from NO2, C1 to C6 alkyl, C1 to C3 perhaloalkyl, halogen, CH2CO2R11, phenyl and C1 to C3 alkoxy, or R14 and R15 together with the atom to which they are attached can form a 3 to 7 membered saturated ring; each R16 and R17 is,, independently, hydrogen, C1 to C3 alkyl, C1 to C3 alkenyl, C1 to C3 alkynyl, phenyl, benzyl or C3 to Cs cycloalkyl, wherein said C1 to C3 alkyl is optionally substituted with one OH group, and wherein said benzyl is optionally substituted with 1 to 3 groups independently selected from C1 to C3 alkyl and C1 to C3 alkoxy; or R16 and R17, together with the atom to which they are attached, can form a 3 to 8 membered heterocycle which is optionally substituted with one or two substituents independently selected from the group consisting of C1 to C3 alkyl, -OH, CH2OH, -CH2OCH3, -CO2CH3, and -CONH2; 7 WO 2005/058834 . PCT/US2004/041399 each R18 and R19 is, independently, C1 to C3 alkyl; each R20 is independently H, phenyl, or the side chain of a naturally occurring alpha amino aC1d; each R22 is independently arylaikyl optionally substituted with CH2CO2H; and each R23 is phenyl; or a pharmaceutically acceptable salt thereof, which are useful in the treatment or inhibition of LXR mediated diseases. In particular, the compounds of this invention are useful in the treatment and inhibition of atherosclerosis and atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL cholesterol levels, increasing reverse cholesterol transport, inhibiting cholesterol absorption, treatment or inhibition of Alzheimer's disease, type I diabetes, type II diabetes, multiple sclerosis, rheumatoid arthritis, acute coronary syndrome, restenosis, inflammatory bowel disease (IBD), Crohn's disease, endometriosis, celiac, and thyroiditis. The present compounds are also useful for the treatment of TH-1 mediated diseases, particularly in mammals. Accordingly, in some embodiemtns, the present invention provides methods of treating a Th1-mediated disease in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound as disclosed herein. Non-limiting examples of Th1 -mediated diseases to which the methods of the invention are amenable include multiple sclerosis, rheumatoid arthritis, autoimmune thyroid disease, inflammatory bowel disease, Crohn's disease and atherosclerosis. The present compounds are further useful for suppression of lymphocyte function or activation in a mammal. Thus, in a further aspect, the invention provides methods for suppressing lymphocyte function or activation in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound of a compound as described herein. In some embodiments, the lymphocyte function that is suppressed is lymphokine production. 8 The present compounds find further use in the suppression of macrophage function or activation in a mammal. Thus,'in a further aspect, the invention provides methods for suppressing macrophage function or activation in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound as described herein. In a further aspect, the present compounds find further use in suppressing cytokine production in a mammal. Accordingly, the present invention further provides methods of suppressing cytokine production in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound as described herein. 9 In a further aspect, the present invention provides methods of treating a Th1-mediated disease in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound selected from compounds III, IV, and V: PCT/US2004/041399 WO 2005/058834 In a further aspect, the invention provides methods of suppressing lymphocyte function or activation in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound selected from compounds III, IV, and V as described above. In some such embodiments, the lymphocyte function is lymphokine production. In a further aspect, the invention provides methods of suppressing cytokine production in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound selected from compounds III, IV, and V, as described above. In a further aspect, the invention provides methods of suppressing macrophage function or activation in a mammal in need thereof, which comprises providing to said mammal an effective amount of a compound selected from compounds III, IV, and V, as described above. Pharmaceutically acceptable salts of the compounds of Formula (I) with an aC1dic moiety can be formed from organic and inorganic bases. Suitable salts with bases are, for example, and not by way of limitation, metal salts, such as alkali metal or alkaline earth metal salts, for example sodium, potassium, or magnesium salts; or salts with ammonia or an organic amine, such as morpholine, thiomorpholine, piperidine, pyrrolidine, a mono-, di- or tri-lower alkylamine, for example ethyl-tert-butyl-, diethyl-, diisopropyl-, triethyl-, tributyl- or dimethylpropylamine, or a mono-, di-, or trihydroxy lower alkylamine, for example mono-, di- or triethanolamine. Internal salts may furthermore be formed. Similarly, when a compound of the present invention contains a basic moiety, salts can be formed from organic and inorganic aC1ds. For example salts can be formed from acetic, propionic, lactic, C1tric, tartaric, sucC1nic, fumaric, maleic, malonic, mandelic, malic, phthalic, hydrochloric, hydrobromic, phosphoric, nitric, sulfuric, metnanesulfonic, napthalenesulfonic, benzenesulfonic, toluenesulfonic, camphorsulfonic, and similarly known pharmaceutically acceptable aC1ds. Preferred compounds of this invention include compounds of formula I having the structure: 10 PCT/US2004/041399 WO 2005/058834 wherein the variables R1, R2, R3, R4, R5, R6, R7, R3, R9, R10, R11, R12, R13, X1; X2, W, Y, and A are each defined below, independently or any combination thereof: R1 is -H; X1 is a bond, -C(O)-, -O-, -S(O)1-, -NR8-, or-CR8R9-; R2 is C1 to C6 alkyl, CF3, CN, phenyl, or phenyl substituted independently by one or more of the groups independently selected from C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 alkynyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, .-CN, -OH, and C1 to C3 alkyl substituted with 1 to 5 fluorines, or R2 is a heterocycle selected from the group consisting of pyridine, thiophene, benzisoxazole, benzothiophen, oxadiazole, pyrrole, pryrazole, imidazole and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, and C1 to C3 alkyl substituted with 1 to 5 fluorines; X2 is a bond or -CH2-; R3 is phenyl, naphthyl, or phenyl or naphthyl substituted by one to four groups independently selected from C1 to C3 alkyl, hydroxy, phenyl, acyl, halogen, - NH2, -CN, -NO2, C1 to C3 perfluoroalkyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, -C(O)R10, -C(O)NR10R11, -C(O)HR11A, -C=CR8, -CH=CHR8, -WA, - C=CA, -CH=CHA, -WYA, -WYR10, -WY(CH2)jA, -WCHR11(CH2),A, -W(CH2)jA, -W(CH2)jR10, -CHR11W(CH2)jR10, -CHR11W(CH2)jA, CHR11NR12YA, -CHR11NR12YR10, and pyrrole; or 11 PCT/US2004/041390 WO 2005/058834 R3 is a heterocycle selected from pyridine, pyrimidine, thiophene, furan, benzothiophene, indole, benzofuran, benzimidazole, benzothiazole, benzoxazole, and quinoline, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, hydroxy, phenyl, acyl, halogen, -NH2, -CN, -NO2, C1 to C3 perfluoroalkyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, -C(O)R10, -C(O)NR10R11, -C(O)NR11A, -C=CR8, -CH=CHR8, -WA, -C=CA, -CH=CHA, -WYA, -WYR10, -WY(CH2)jA, -W(CH2)jA, -W(CH2)jR10, -CHR11W(CH2)jR10, -CHR11W(CH2)jA, -CHR11NR12YA, and -CHR11NR12YR10; W is a bond, -O-, -S-, -S(O)-, -S{O)2-, -NR11-, or -N(COR12)-; Y is -CO-, -S(O)2-, -CONR13, -CONR13CO-, -CONR13SO2-, -C(NCN)-, -CSNR13, -C(NH)NR13, or -C(O)O-; j is 0 to 3; t is 0 to 2; A is phenyl, naphthyl, tetrahydronaphthyl, or phenyl substituted by one to four groups independently selected from halogen, C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 alkynyl, acyl, C1 to C3 alkoxy, hydroxy, halogen, -CN, -NO2, -CO2R11, -CH2CO2R11 phenyl, phenoxy, C1 to C3 perfluoroalkoxy, C1 to C3 perfluoroalkyl, -NR10R11, -CH2NR10R11, -SR-,1, C1 to C3 alkyl substituted with 1 • to 5 fluorines, C1 to C6 alkyl substituted with 1 to 2 -OH groups, and C1 to C6 alkoxy optionally substituted with 1 to 5 fluorines, or A is a heterocycle selected from pyrrole, pyridine, pyrimidine, thiophene, furan, quinoline, oxazole, thiazole, imidazole, isoxazole, indole, benzo[1 ,3]-dioxole, benzo[1,2,5]-oxadiazole, isochromen-1-one, and 3-H-isobenzofuran-1-one, each of which may be optionally substituted by one to three groups independently selected from halogen, C1 to C3 alkyl, acyl, C1 to C3 alkoxy, hydroxy, halogen, -CN, -NO2, C1 to C3 perfluoroalkyl, -NR10R11, -CH2NR10R11, -SR11, C1 to C6 alkyl substituted with 1 to 5 fluorines; R4, R5, R6 are each, independently, -H; R7 is C1 to C4 alkyl, C1 to C4 perfluoroalkyl, or halogen; each R8 is independently -H, or C1 to C2 alkyl; 12 PCT/US2004/041399 WO 2005/058834 each R9 is independently -H, or C1 to C2 alkyl; each R10 is independently -H, C1 to C7alkyl, C2 to C7 aikeny], or C3 to C7 cycloalkyi; each R11 is independently-H, or C1 to C3 alkyl; each R12 is independently -H, or C1 to C3 alkyl; and each R13 is independently -H, or C1 to C3 alkyl; or a pharmaceutically acceptable salt thereof. More preferred compounds of this invention include compounds of formula I having the structure wherein: X1 is a bond, -C(O)-, or -CR8R9-; R2 is phenyl substituted independently by one or more of the groups independently selected from C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 alkynyi, C1 to C3 alkoxy, d to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, -OH, and C1 to C3 alkyl substituted with 1 to 5 fluorines, or R2 is a heterocycle selected from the group consisting of pyridine, thiophene, and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, CN, and C1 to C3 alkyl substituted with .1 to 5 fluorines, X2 is a bond R3 is phenyl substituted independently by one to four groups independently selected from hydroxy, halogen, C1 to C3 perfluoroalkyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, -C=CR8, -CH=CHR8, -WA, -C=CA, -WYA, -WY(CH2)jA, -W(CH2)jA -WCHR11(CH2)jA, and -CHR11W(CH2)jA; and wherein the remaining constituent variables are as defined immediately above; or a pharmaceutically acceptable salt thereof. 13 WO 2005/058834 PCT/US2004/041399 Another preferred embodiment includes those compounds of formula I having the structure: wherein: R1 is H; X1 is a bond, -C(O) -, -O-, -S(O)t-, -NR8-, -CR8R9-, or -CR8(OR9) -; R2 is C1 to C6 alkyl, C2 to C6 alkenyl, C2 to C6 alkynyl, C3 to C8 cycloalkyl, -CH2OH, CF3, CN, phenyl, or phenyl substituted by one to four groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C2 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, and C1 to C2 alkyl substituted with 1 to 3 fluorines, or R2 is a heterocycle selected from pyridine, thiophene, and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C2 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, and C1 to C2 alkyl substituted with 1 to 3 fluorines; X2 is a bond or -CH2-;' R3 is phenyl substituted by . -W(CH2)jA(CH2)kD(CH2)pZ, W(CR18R19)A(CH2)kD(CH2)pZ, -(CH2)jWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or W(CH2)jC=CA(CH2)kD(CH2)pZ, and further optionally substituted with one or two groups independently selected from C1 to C2 alkyl, C1 to C2 perfluoroalkyl, halogen, and -CN, or R3 is a heterocycle selected from pyridine, pyrimidine, thiophene, and furan, each of which is optionally substituted by -W(CH2)jA(CH2)kD(CH2)pZ, -W(CR18R19)A(.CH2)kD(CH2)pZ, -(CH2)/WA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or -W(CH2)jC=CA(CH2)kD(CH2)pZ; W is a bond, -O-, -S-, -S(O)-, -S(O)2-, -NR11, or -N(COR12)-; 14 PCT/US2004/041399 WO 2005/058834 j is 0 to 3; k is 0 to 3; t is 0 to 2; D is a bond, -CH=CH-, -CSCI phenyl, -O-, -NH-, -S-, -CHR14-, -CR14R15-, -OCHR14-, -OCR14R15-. or -CH(OH)CH(OH)-; p is 0 to 6, Z is -CO2R11, -CONR10R11, -C(=NR10)NR11R12, -CONH2NH2, -CN, -CH2OH, -NR16R17, CONHCH(R20)COR12, phthalimide, pyrrolidine-2,5-dione, thiazolidine-2,4-dione, tetrazolyl, pyrrole, C1 to C7 amines, C3 to C7 cyclic amines, or C1 to C3 alkyl substituted with one to two OH groups; wherein said pyrrole is optionally substituted with one or two substituents independently selected from the group consisting of -CO2CH3, -CO2H, -COCH3 and -CN; wherein said C1 to C7 amines are optionally substituted with one to two substituents independently selected from the group consisting of -OH, halogen, -OCH3, and -C=CH; and wherein said C3 to C7 cyclic amines are optionally substituted with one or two substituents independently selected from the group consisting of -OH -CH2OH, -CH2OCH3, -CO2CH3, and -CONH2; A is phenyl, or phenyl substituted by one to four groups independently selected from halogen, acyl, C1 to C3 alkyl, C1 to C3 alkoxy, hydroxy, halogen, -CN, -NO2, C1 to C3 perfluoroalkyl, -NR10R11, -CH2NR10R11, -SR11, and C1 to C2 alkyl substituted with 1 to 3 fluorines; or A is a heterocycle selected from pyrrole, pyridine, pyrimidine, thiophene, indole, oxazole, and furan, each of which may be optionally substituted by one to three groups independently selected from halogen, acyl, C1 to C3 alkyl, C1 to C3 alkoxy, hydroxy, -CN, -NO2, C1 to C3 perfluoroalkyl, -NR10R11, -CH2NR10R11, -SR11, and C1 to C2 alkyl substituted with 1 to 3 fluorines; R4, R5, R6 are -H; R7 is -H, C1 to C4 alkyl, C1 to C4 perfluoroalkyl, or halogen; each R8 is independently -H, or C1 to C2 alkyl; each R9 is independently -H, or C1 to C2 alkyl; each R10 is independently -H, or C1 to C3 alkyl; each R11 is independently -H, or C1 to C3 alkyl; 15 WO 2005/058834 PCT/US2004/041399 or R10 and R11, when attached to. the same atom, together with said atom form: a 5 to 7 membered saturated ring, optionally substituted by 1 to 2 groups independently selected from C1 to C3 alkyl, OH and C1-C3 alkoxy; or a 5 to 7 membered ring containing 1 or 2 heteroatoms, optionally substituted by 1 to 2 groups independently selected from C1 to C3 alkyl, OH and C1-C3 alkoxy; each R12 is independently -H, or C1 to C3 alkyl; each R14, and R15 is, independently, C1 to C7 alkyl, C3 to C8 cycloalkyl, C2 to C7 alkenyl, C2 to C7 alkynyl, -OH, -F, C7 to C14 arylalkyl, where said arylalkyl is optionally substituted with 1 to 3 groups independently selected from NO2, C1 to C6 alkyl, C1 to C3 perhaloalkyl, halogen and C1 to C3 alkoxy, or R14 and R15 together with the atom to which they are attached can form a 3 to 7 membered saturated ring; each R16 and R17 is, independently, hydrogen, C1 to C3 alkyl, C1 to C3 alkenyl, -C1 to C3 alkynyl, or C3 to C8 cycloalkyl, wherein said C1 to C3 alkyl is optionally substituted with one OH group; or R16 and R17, together with the atom to which they are attached, can form a 3 to 8 membered heterocycle which is optionally substituted with one or two substituents independently selected from the group consisting of C1 to C3 alkyl, -OH, CH2OH, -CH2OCH3, -CO2CH3, and -CONH2; each R18 and R19 is, independently C1 to C3 alkyl; or a pharmaceutically acceptable salt thereof. Another more preferred embodiment includes those compounds of formula I having the structure: wherein: 16 PCT/US2004/041399 WO 2005/058834 X1 is a band, -C(O) -, or -CR8R9-; R2 is C1 to C6 alkyl, CF3, CN, phenyl, or phenyl substituted by one to four groups independently selected from C1 to C2 perfluoroalkyl, halogen, and C1 to C2 alkyl substituted with 1 to 3 fluorines, or R2 is a heterocycle selected from thiophene, and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C2 perfluoroalkyl, halogen, and C1 to C2 alkyl substituted with 1 to 3 fluorines; X2 is a bond R3 is phenyl substituted by -W(CH2)jA(CH2)jkD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or -(CH2)jWA(CH2)kD(CH2)pZ, and further optionally substituted with one or two groups independently selected from C1 to C2 perfluoroalkyl, halogen, and -CN, or R3 is a heterocycle selected from pyridine, pyrimidine, thiophene, and furan each of which is optionally substituted by ,-W(CH2)jA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ,, or-(CH2)jWA(CH2)kD(CH2)pZ; D is a bond, -O-, -NH-, -S-, -CHR14-, -CR14R15-, -OCHR14-, or -OCR14R15-; Z is -CO2R11, -CONR10R11. -CN, -CH2OH, or -NR16R17; A is phenyl, or phenyl substituted by one to four groups independently selected from halogen, -CN, C1 to C3 perfluoroalkyl, and C1 to C2 alkyl substituted with 1 to 3 fluorines, or A is a heterocycle selected from pyrrole, pyridine, pyrimidine, and thiophene, each of which may be optionally substituted by one to three groups independentiy selected from halogen, -CN, C1 to C3 perfluoroalkyl, and C1 to C2 alkyl substituted with 1 to 3 fluorines; wherein the remaining constituent variables are as defined immediately above; 17 WO 2005/058834 PCT/US2004/041399 or a pharmaceutically acceptable salt thereof. This invention also provides processes for preparing compounds of formula I or a pharmaceutically acceptable salt thereof; whichs processes include one of the following: a) reacting a compound of formula II wherein L is Cl or triflate, R1, R2 and R4-7 are as defined above, and X1 is -CO-, with a boronic aC1d derivative of formula: R3X2B(OH)2 wherein R3 and X2 are as defined above, to give a compound of formula I wherein X1 is -CO-; or b) reacting a compound of formula wherein R1, R3-7 and X2 are as defined above, with a Grignard of formula: R2MgBr wherein R2 is as defiend above, to give a corresponding compound of formula (I) wherein X1 is -CO-; or c) cyclocondensing a compound of formula IV 18 PCT/US2004/041399 WO 2005/058834 wherein R3-7 are as defined above, with a compound of formula R2X1-CH2-CHO wherein R2 and X1 are as defined above, to give a corresponding compound of formula or d) reacting a compound of formula V wherein R1 and R4-7 are as defined above, and X1 is a bond, -S- or -O- , with a boronic aC1 derivative of formula: R3B(OH)2 wherein R3 is as defined above, to give a corresponding compound of formula I wherein X2 is a bond, or . e) reacting a compound of formula 19 WO 2005/058834 PCT/US2004/041399 wherein X2, R1 and R3-7 are as defined above, with a boronic acid derivative of formula R2B(OH)2 wherein R2 is as defined herein, to give a corresponding compound of formula I wherein X, is -CH2-; or f) reacting a compound VI as defined above with pyrrole, pyrazole or imidazole to give a corresponding compound of formula I wherein R2 is pyrrole, pyrazole or imidazole and X1 is -CH2-; or g) reacting a compound of formula VI as defined above with an alcohol or phenol of of formula R2O to give a corresponding compound of formula I wherein X1 is-CH2O-; or h) cyclising a compound of formula wherein X2 and R3-7 are as defined above, with a compound of formula R2SO2-C=C-SO2R2 wherein R2 is as defined above, to give a corresponding compound of formula 1 wherein R1 is H, X1 is SO2; or i) reacting a compound of formula 20 WO 2005/058834 PCT/US2004/041399 wherein R1-7 and X, are as defined above, with HBr to give a corresponding compound of formula I wherein X2 is -CH2-. Also if desired a basic compound of formula I may be converted to a pharmaceutically acid addition acceptable salt thereof or vice versa by the addition of base. Additionally a compound of formula I having a reactive substituent group or site may be converted to a different compound of formula I. As used herein, the term "alkyl" as a group or part of a group includes both branched and straight-chain saturated aliphatic hydrocarbon groups having the speC1fied number of carbon atoms, e.g. methyl (Me), ethyl (Et), propyl (Pr), isopropyl (i-Pr), isobutyl (i-Bu), secbutyl (s-Bu), tertbutyl (t-Bu), isopentyl, isohexyl and the like, unless speC1fied otherwise, akyl groups typically have 1-12 carbon atoms. The term "cycloalkyl" is intended to have its normal meaning of a cyclic alkyl group, e.g., cyC1opropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like. As used herein the term "alkoxy" has its normal meaning of a group of formula -O-alkyl. As used herein, the term alkenyl is intended to denote alkyl groups that contain at least one double bond, including for example but not limited to vinyl, allyl, 2-methyl-allyl, 4-but-3-enyl, 4-hex-5-enyl, 3-methyl-but-2-enyl, cyclohex-2-enyl and the like. As used herein, the term alkynyl is intended to denote alkyl groups that include at least one triple bond, including for example but not limited to but-1-yne, propyne, pent-2-yne, ethynyl-cyclohexyi and the like. As used herein, the term halogen has its normal meaning of period seven elements, including F, Cl, Br and I. As used herein the term aryl is intended to mean an aromatic hydrocarbon system, e.g., of 6-20 carbon atoms, for example phenyl, naphthyl, phenanthrenyl, anthracenyl, pyrenyl, and the like. Also included within the definition of aryl are such 21 WO 2005/058834 PCT/US2004/041J99 aromatic systems containing one or more further fused aromatic rings, for example fluorenyl groups. As used herein, the term arylalkyl is intended to mean a group of formula -alkyl-aryl, alkyl-(aryl)2, and alkyl-(aryl)3, wherein aryl and alkyl have the definitions herein. Non-limiting examples of arylalkyl groups include benzyl, diphenylmethyl and triphenylmethyl. As used herein, the term acyl is intended to mean an alkyl, aryl or arylalkyl group that is connected through a carbonyl group, for example and not limitation, groups of formula -C(=O)-alkyl, -C(=O)-aryl, and (i.e. -C(=O)-arylalkyl. As used herein, the term "heterocycle" indicates a ring system containing at least one hetero (i.e., non-carbon) atom, e.g., 1-4 hetero atoms, which may be the same or different, for example O, N or S. Some preferred heterocycles include, without limitation, pyridine, thiophene, benzisoxazole, benzothiqphen, oxadiazole, pyrrole, pryrazole, and furan. Further non-limiting examples of heterocycle groups include radicals derived from imidazole, tetrazole, imidazolidine, isothiazole, isoxazole, oxathiazole, oxazole, oxazoline, pyrazolidine, pyrazoline, pyrrolidine, pyrroline, thiazoline, bxazine, piperazine, piperidine, pyran, pyrazine, pyridazine, pyrimidine, thiadizine, thiazine, benzodioxine, benzodioxole, benzofuran, chromene, C1nnoline, indazole, indole, indoline, indolizine, isoindole, isoindoline, isoquinoline, i naphthalene, naphthyridine, phthalazine, purine, quinazoline, quinoline, and quinolizine. The term "bithienyl" is intended to mean a group of formula thiophene-thiophene, wherein the two thiophene moieties are connected through any atom thereof. The term C1 to C7 amines is intended to mean aliphatic amines having from 1 to 7 carbon atoms. The term C3 to C7 cyclic amines is intended to mean saturated amines containing at least one ring, and from 3 to 7 carbon atoms. The term "side chain of a naturally occurring alpha amino acid" is intended to denote the side chains of alanine, arginine, asparagines, aspartic acid, cysteine, glutamine, glutamic acid, histidine, isoleuC1ne, leuC1ne, lysine, methionine, phenylalanine, serine; threonine, tryptophan, tyrosine and valine, the side chain thereof being the portion designated "R" in the formula H2N-CH(R)-COOH. 22 WO 2005/058834 PCT/US2004/041399 As used in accordance with this invention, the term "providing," with respect to providing a compound or substance covered by this invention, means either directly administering such a compound or substance, or administering a prodrug, derivative, or analog which will form the effective amount of the compound or substance within the body. This invention also covers providing the compounds of this invention to treat the disease states disclosed herein that the compounds are useful for treating. The compounds of the present invention can contain an asymmetric atom, and some of the compounds can contain one or more asymmetric atoms or centers, which can thus give rise to optical isomers (enantiomers) and diastereomers. The present invention includes such optical isomers (enantiomers) and diastereomers (geometric isomers); as well as the racemic and resolved, enantiomerically pure R and S stereoisomers; as well as other mixtures of the R and S stereoisomers and pharmaceutically acceptable salts thereof. Optical isomers can be obtained in pure form by standard procedures known to those skilled in the art, and include, but are not limited to, diastereomeric salt formation, kinetic resolution, and asymmetric synthesis. It is also understood that this invention encompasses all possible regioisomers, and mixtures thereof, which can be obtained in pure form by standard separation procedures known to those skilled in the art, and include, but are not limited to, column chromatography, thin-layer chromatography, and high-performance liquid chromatography. The compounds of formula (I) can be conveniently prepared by the procedures outlined in schemes below from commercially available starting materials, compounds known in the literature, or readily prepared intermediates, by employing standard synthetic methods and procedures known to those skilled in the art. Standard synthetic methods and procedures for the preparation of organic molecules and functional group transformations and manipulations can be readily obtained from the relevant sC1entific literature or from standard textbooks in the field. Although not limited to any one of several sources, classic texts such as Smith, M. B.; March, J. March's Advanced Organic, Chemistry: Reactions, Mechanisms, and Structure, 5th ed.; John Wiley & Sons: New York, 2001; and Greene, T. W.; Wuts, P. 23 WO 2005/058834 PCT/US2004/041399 G. M. Protective Groups in Organic Synthesis, 3rd ed.; John Wiley & Sons: New York, 1999 are useful and recognized reference textbooks of organic synthesis known to those in the art. According to Scheme 1, aniline (1) can be condensed with diethyl ethoxymethylenemalonate (2) to provide the compound of formula (3). The latter compound is cyclized thermally to provide the quinoline of formula (4). Conversion of the phenol of (4) to the chloride of formula (5) can be accomplished readily with chlorinating agents such as phosphorus oxychloride. Reaction of the ester moiety of (5) with an organolithium reagent (R2Li) provides the compound of formula (6). Reaction of (6) with a boronic acid reagent of formula R3X2B(OH)2 in the presence of a palladium catalyst provides the compound of formula (I), where X1 - CO. The compounds of formula (I) can also be prepared according to Scheme 2. The compound of formula (4) is converted to the triflate of formula (7) using standard literature procedures. Reaction of (7) with a boronic acid reagent of formula R3X2B(OH)2 in the presence of a palladium catalyst provides the compound of formula (8). Hydrolysis of the ester group of (8) with aqueous base provides the acid of formula (9). Conversion of the acid to the N-methyi, N-methoxy amide ("Weinreb amide") of formula (10) occurs readily under standard amidation conditions. Reaction of the amide (10) with a Grignard reagent of formula R2MgBr occurs readily to provide the compound of formula (I), where X1 = CO. The carboxylic acid of 24 WO 2005/058834 PCT/US2004/041399 formula (9) can also under go amidation to the compounds of formula (I) under standard amidation conditions 25 Compounds of formula (I) can also be prepared according to Scheme 3. The ethoxy acrylic acid, ethyl ester of formula (11) is condensed with an aniline of formula (1) to provide the compound of formula (12). The latter compound is thermally cyclized to the quinoline of formula (13). Conversion to the chloride is effected with standard chlorinating agents such as POC13 the compound of formula (6). The compound of formula (6) is converted to the compound of formula (I) as outlined in Scheme 1. WO 2005/058834 PCT/US2004/041399 The compounds of formula (1) can also be prepared according to Scheme 4. The compound of formula (13) is converted to the triflate of formula (14) using standard literature procedures. Reaction of (14) with a boronic acid reagent of formula R3X2B(OH)2 in the presence of a palladium catalyst provides the compound of formula (l), where X1 = CO. According to Scheme 5, the carbonyl group of the compounds of formula (i), where X1 = CO, can be readily converted to other moieties. Treatment of (I), where X1 = CO with hydrazine followed by potassium hydroxide provides the compound of formula (I), where X1 = CH2. Reduction of (I), where X-, = CO with sodium borohydride provides the alcohol of formula (I), where X1 = CH(OH). Reaction of (I), where X1 = CO with a Grignard reagent of formula R8MgBr provides the alcohol of formula (I), where X1 = CR8(OH). Reaction of the compound of formula (I), where X1 = CO with hydroxylamine provides the oxime of formula (I), where X1 = CN(OH). Alkylation of the alcohols of formula (I), where X1 = CH(OH) or CR8(OH) or the oxime of formula (I) using, for instance, sodium hydride followed by an alkylating agent of formula R9X' provides the ethers of formula (I), where X1 = CH(OR9) or X1 = CR8(OR9) or the oxime ether of formula (I), where X1 = CN(OR9). Acylation of the alcohol of formula (I), where X1 = CH(OH) with an acid halide of formula C9COC1 provides the ester of formula (I), where X1 = CH(OCOR9). 26 WO 2005/058834 PCT/US2004/041399 According to Scheme 6, certain compounds of formula (I) prepared by Schemes 1-5, contain a (CH2)jOH moiety on the phenyl ring that is attached to the 4-position of the quinoHne ring system. Alkyiation of this OH with an alkylating agent RX' using potassium, sodium or cesium carbonate as the base provides the alkylated compound of formula (I). Alternatively, if j is 1 or more and ROH is a phenol or substituted phenol, or j is 0 and ROH is an alcohol where the OH is connected to a sp3 hybridized carbon, then the alcohol of formula (I) and the ROH can be reacted with triphenylphosphine (PPh3) and diisopropylazodicarboxylate (DIAD) to form the ether of formula (I). Alternatively, arylation of this OH, when j = 0, with an aryl iodide, bromide or boronic acid using an appropriate copper catalyst, and a tertiary amine base if necessary provides the aryl ether of formula (I). If the R group of the compound of formula (I) contains a carboxylic acid ester moiety, this moiety can be transformed to the carboxylic acid upon treatment with aqueous lithium, sodium or potassium hydroxide in a suitable organic solvent. If the R group of the compound of formula (l) contains a CH2X' where X' is a halogen Br or Cl, then this group can be transformed to CH2CN upon treatment with sodium cyanide in a suitable organic solvent. If the R group of the compound of formula (I) contains a CH2CN, then this 27 WO 2005/058834 PCT/US2004/041399 group can be transformed to the tetrazole using standard conditions such as, sodium, in DMF at 125°C According to Scheme 7, certain compounds of formula (I) prepared by Schemes 1-5, contain a free NH2 moiety on the phenyl ring that is attached to the 4-position of the quinoline ring system. Treatment of the free NH2 compound of formula (I) with a sulfonyl chloride of formula C1SO2-A provides the corresponding sulfonamide of formula (I). Treatment of the free NH2 compound of formula (I) with an acid chloride of formula C1CO-A provides the amide of formula (I). Treatment of the free NH2 compound of formula (I) with an isocyanate of formula A-CNCO provides the urea of formula (I). According to Scheme 8, certain compounds of formula (I) prepared by Scheme 1-5, contain a free NH2 moiety on the phenyl ring that.is attached to the 4-position of the quinoline ring system. Treatment of the free amine with an aldehyde (RCHO) and a reduC1ng agent such as NaBH(OAc)3, results in the secondary amine product of formula (I). The same product of formula (I) could also be obtained upon 28 WO 2005/058834 PCT/US2004/041399 treating the starting primary amine with alkylating agent (RX') in the presence of a base. Treatment of the secondary amine with an aldehyde (R'CHO) and a reduC1ng agent such as NaBH(OAc)3, results in the tertiary amine product of formula (I). The same product of formula (1) could also be obtained upon treating the starting secondary amine with alkylating agent (R'X') in the presence of a base. Treatment of the NHR" of compound of formula (I) with a sulfonyl chloride of formula C1SO2-R' provides the corresponding sulfonamide of formula (I). Treatment of the NHR" compound of formula (I) with an acid chloride of formula CICO-R' provides the amide of formula (I). Treatment of the NHR" compound of formula (I) with an isocyanate of formula R'-CNCO provides the urea of formula (I). If the R group of the compound of formula (I) contains a carboxylic acid ester moiety this moiety can be transformed to the carboxylic acid upon treatment with aqueous lithium, sodium or potassium hydroxide in a suitable organic solvent. If the R group of the compound of formula (I) contains a CH2X' where X' is a halogen Br or Cl, then this group can be transformed to CH2CN upon treatment with sodium cyanide in a suitable organic solvent. If the R group of the compound of formula (I) contains a CH2CN, then this group can be transformed to the tetrazole using standard conditions such as sodium in 29 DMFat125°C WO 2005/058834 PCT/US2004/041399 According to Scheme 9, the compounds of formula (I) where X1 = bond, or C1 to C3 aikyl can also be prepared. The compound of formula (18) is converted to the N-methyl, N-methoxy amide ("Weinreb amide") of formula (19) under standard amidation conditions. Reaction of the amide (19) with a lithio or Grignard reagent of formula R3Li or R3MgBr at low temperature provides the compound of formula (20). Alternatively, the compound of formula (16) is lithiated alpha to fluorine and then treated with an appropriately substituted aldehyde. The resulting alcohol (17) is converted to the ketone (20) under standard oxidation conditions. Conversion of (20) into the aniline is accomplished with ammonium hydroxide at elevated temperature. Substituted anilines of formula (21) undergo clean condensation, cyclization in acetic acid with a catalytic amount of sulfuric acid at elevated temperature to provide compounds of formula (I). According to Scheme 10 the phenol group of the compound (22) can be readily alkylated to give the benzyl chloride (23), which can be further alkylated with either amines or pyrroles. The phenol group of the compound (22) can also be readily acylated with sulfonyl chloride, acyl chloride, and isocyanate. 30 WO 2005/058834 PCT/US2004/041399 31 The compounds of formula (I) can also be prepared according to Scheme 11. Coupling of (27) with aryl iodine in the presence of a palladium catalyst provides the ester (28) which can be converted to the corresponding carboxylic acid (29) under a standard basic hydrolysis condition. WO 2005/058834 PCT/US2004/041399 According to Scheme 12, reaction of aminophenyl (30) with an large excess of the cyclic acetal 2,5-dimethoxytetrahydrofuran gave pyrrole (31). This amine can also be arylated with boronic acid in the presence of a base, preferably 2,6-lutidine, an additive such as myristic acid, and Cu(OAc)2 in an inert solvent such as toluene at room temperature. According to Scheme 13, treatment of the free NH2 compound (30) with an isothiocyanate of formula ArNCS provides the thiourea of formula (33). Reaction of (33) with ammonium hydroxide in the presence of lead acetate provides the guanidine of formula (34). Reaction of the compound (33) with lead cyanamide provides the cyano guanidine (35). .32 WO 2005/058834 PCT/US2004/041399 According to Scheme 14, the ester of formula (36) is converted to the phenyl acetamide (37) or Phenyl-acetic acid hydrazide (38) under standard conditions. Alkylation of this ester with an alkylating agent RX' using cesium carbonate as the base provides the mono or di-alkylated compound of formula (39). Alternatively, compound (39) can be prepared by mono or di-alkyiation of the benzonitrile (40) followed by Ray (Ni) reduction and reductive amination as described in Scheme 8. 33 WO 2005/058834 PCT/US2004/041399 The compounds of formula (I) can also be prepared according to Scheme 15. The compound of formula (41) is converted to the hydroxyl compound (42) using standard reduction procedures. The compound of formula (41) can also be converted to the di-fluoro compound (44) by treatment of DAST. Reductive 34 WO 2005/058834 PCT/US2004/041399 amination of aldehyde (42) or (45) with the amine (30) provides the compound of formula (43) or (46). Compounds (47) can be prepared as shown in Scheme 16. The addition of a Grignard reagent to Weinreb amide (47) in THF produces ketones (I). The carbonyl group of compound (48) can be modified as shown in Scheme 17. The reaction of (48) with trimethylorthoformate in MeOH with para-toluenesulfonic acid produces dirnethoxy compounds (49). The reaction of (48) with a Grignard reagent produces (50) which can be converted to alkene (51) by refluxing in ethanolic HC1. Compound (52) can be produced via catalytic hydrogenation of (51). 35 WO 2005/058834 PCT/US2004/041399 Other modifications to the carbonyl of compound (48) can be made as shown in Scheme 18. Compound (48) can be converted to the hydrazone (53) by reaction with hydrazine in ethyiene glycol. Compound (54) can be converted to the oxime (55) by treating with hydroxylamine in aqueous ethanol at reflux. Oxime (55) can be reacted with acetic anhydride to produce oxime acetate (56). The reaction of compound (56) with NaH in DMF produces benzisoxazole (57). 36 WO 2005/058834 PCT/US2004/041399 Compounds of formula (59) can be synthesized as shown in Scheme 19. The reaction of phenol (58) in CH2Cl2 with Cs2CO3 with an appropriate alkylating agent produces benzylated compounds (59). Compound of formula (I) can also be prepared according to Scheme 20. The compound of formula (60) is converted to the decarboxylated product (61) with Dowtherm A at reflux. Bromination of (61) with, bromine provides bromide of formula (62). Compounds of formula (63) where X = bond are prepared from bromide of formula (62) by coupling with a boronic acid reagent of formula ArB(OH)2 in the presence of a palladium catalyst. Compounds of formula (63) where X = S or O can 37 WO 2005/058834 PCT/US2004/041399 be prepared by aromatic substitution in the presence of the sodium thioaryloxide or potassium aryloxide. Conversion of the quinolin-4-ol (63) to the bromide of formula (64) can be accomplished readily with brominating agents such as phosphorus oxybromide. Compounds of formula (65)jin which Y = H, OH, NH2, or OMe and R1 = Cl, or F are prepared as described in Scheme 6. Compounds of formula (65) where Y = NH2 or OH and R1 = H, Cl or F are alkylated with an alkylating agent RX' using potassium carbonate or the like as the base which provides the alkylated compound of formula (66). Compound of formula (1) can also be prepared according to Scheme 21. The compound (67) is converted to the alcohol (68) by reduction with lithium borohydride or other literature reduC1ng agents. Reaction of (68) with phosphorous tribromide or other brominating agent provides bromides of (69). Compounds (70) are prepared from bromide (69) by coupling with a boronic acid reagent of formula R2B(OH)2 in the 38 WO 2005/058834 PCT/US2004/041399 presence of a palladium catalyst. Compounds (71) exemplified by pyrrole, imidazole, and pyrazole are prepared by reacting bromides (69) with the appropriate heterocycle in the presence of a base such as sodium hydride. Compounds (72) are prepared by treating alcohols and phenols of formula R2OH with a base in the presence of a bromide (69). Compounds (74) can be prepared according to Scheme 22. The ester (67) is condensed with an N-hydroxy-amidine (73) in the presence of strong base such as sodium hydride and a solvent such as THF to provide the compound (74). 39 WO 2005/058834 PCT/US2004/041399 Compounds (77) can be prepared according to Scheme 23. The phenacyl-aniline (75), the preparation of which is described in Scheme 9, is treated with a1,2-disulfonyl-alkene (76) in the presence of a base to provide a compound (77). According to Scheme 24, certain compounds (79) are prepared by reaction of the aryl-halide (78) with a boronic acid reagent of formula R3B(OH)2 in the presence of a palladium catalyst. If the R group of the compound (79) contains a carboxylic acid ester moiety, this moiety can be transformed to the carboxylic acid upon treatment with aqueous lithium, sodium or potassium hydroxide in a suitable organic solvent. If the R group of the compound (79) contains a CH2K' where X' is a halogen Br or Cl, then this group can be transformed to CH2CN upon treatment with sodium cyanide in a suitable organic solvent. If the R group of the compound (79) contains a CH2CN, then this group can be transformed to the tetrazole using standard conditions such as sodium in DMF at 125 °C. 40 WO 2005/058834 PCT/US2004/041399 41 The compounds of formula (I) can also be prepared according to Scheme 25. Coupling an appropriate aryl bromide (80) in the presence of a palladium catalyst with trimethyl-tributylstannanylethynyl-silane followed by desilation provides the aryl-acetylene (81). The acetylene, (81) can be coupled with an appropriate aryl-halide (bromo or iodo) in the presence of a, palladium catalyst to provide the diphenyl substituted acetylene (82). Modification of the acetylene linker is conveniently carried out using hydrogenation with heterogeneous catalysis to (83). WO 2005/058834 PCT/US2004/041399 The compounds of formula (I) can also be prepared according to Scheme 26. Bromide 84 can be reacted with a 2-aryl or 2-heteroarylacetonitril of formula 85 in the presence of a base such as sodium hydride to afford compound 86. Compound 86 can be reacted with hydrobromic acid to remove the nitrile group and afford compound 87. Any substituents on the aryl or heteroaryl moiety of 87 can be further elaborated by any of the preceding procedures. Representative compounds of this invention were evaluated in standard pharmacological test procedures which measured their affinity to bind to LXR and to upregulate the gene ABCA1, which causes cholesterol efflux from atherogenic cells, such as macrophages. LXR activation is critical for maintaining cholesterol homeostasis, but its coinC1dent regulation of fatty acid metabolism may lead to increased serum and hepatic triglyceride levels. Selective LXR modulators that activate cholesterol efflux with minimal impact on SREBP-1c expression and triglyceride synthesis in liver would be expected to reduce atherosclerotic risk with an improved therapeutic index and minimize the potential for deleterious effects on metabolic balance. A method is described herein for identifying selective LXR ligands with differential activity for regulating ABCA1 (ABCG1) vs. SREBP-1c. Accordingly, LXR ligands were identified initially in cell-free LXR beta and LXR alpha competition binding assays. LXR ligands were further characterized by gene expression profiling for tissue selective gene regulation. Selective LXR modulators demonstrate agonist activity for ABCA1 transactivation but exhibit no effect or inhibition of SREBP-1c gene expression in differentiated THP-1 macrophages. Gene expression analysis in an antagonist mode was used to further delineate differential regulation of ABCA1 and SREBP-1c gene expression. In a competition assay with known potent synthetic LXR agonists, selective LXR ligands 42 PCT/US2004/041399 WO 2005/058834 preferentially antagonize SREBP-1c activation (a marker for genes involved in cholesterol and fatty acid homeostasis) but have minimal or additive effects on ABCA1 gene expression or genes known to enhance HDL biogenesis. Ceil type or tissue speC1fiCity may be further evaluated in additional cell lines, intestinal, CaCo2 or liver, HepG2 and Huh-7 cells where ABCA1 activity influences net cholesterol absorption and reverse cholesterol transport. The test procedures performed, and results obtained are briefly described below. LIGAND-BINDING TEST PROCEDURE FOR HUMAN LXRß. Ligand-binding to the human LXRß was demonstrated for representative compounds of this invention by the following procedure. Materials and Methods: Buffer: 100mM KCI, 100mM TRIS (pH 7.4 at +4°C), 8.6% glycerol, 0.1mM PMSF*. 2mM MTG* ,0.2% CHAPS (* not used in wash buffer) Tracer:3H T0901317 Receptor source: E. col) extracted from cells expressing biotinylated hLXRß. Extract was made in a similar buffer as above, but with 50mM TRIS. Dav1 Washed streptavidin and coated flash plates with wash buffer. Diluted receptor extract to give Bmax ~ 4000 cpm and add to the wells. Wrapped the plates in aluminum foil and stored them at +4°C over night. Day 2 Made a dilution series in DMSO of the test ligands. Made a 5nM solution of the radioactive tracer in buffer. Mixed 250µl diluted tracer with 5µl of the test ligand from each concentration of the dilution series. Washed the receptor-coated flash plates. Added 200ul per well of the ligand/radiolabel mixture to the receptor-coated flash plates. Wrapped the plates in aluminum foil and incubate at +4°C over night. Day 3 Aspirated wells, and washed the flashed plates. Sealed the plate. 43 WO 2005/058834 | PCT/US2004/041399 Measured the remaining radioactivity in the plate. Results: Representative compounds of this invention had activity (IC5O values) in the LXRß ligand binding assay in the range between 0.001 to 20 µM. QUANTITATIVE ANALYSIS OF ABCA1 GENE REGULATION IN THP-1 CELLS. The compounds of formula (I) effect on the regulation of the ABCA1 gene was evaluated using the following procedure. Materials and Methods Cell culture: The THP-1 monocytic cell line (ATCC # TIB-202) was obtained from American Type Culture Collection (Manassas, VA) and cultured in RPMI 1640 medium (Gibco, Carlsbad, Ca) containing 10% FBS, 2 mM L-glutamine, and 55 µM beta-Mercaptoethanol (BME). Cells were plated in 96-well format at a density of 7.5 X 104in complete medium containing 50-100 ng/ml phorbal 12,13-dibutyrate (Sigma, St. Louis, Mo) for three days to induce differentiation into adherent macrophages. Differentiated THP-1 cells were treated with test compounds or ligands dissolved in DMSO (Sigma, D-8779) in culture medium lacking phorbal ester. Final concentrations of DMSO did not exceed 0.3% of the media volume. Dose response effects were measured in duplicate, in the range of 0.001 to 30 micromolar concentrations and treated cells were incubated for an additional 18 hrs prior to RNA isolation. Unstimulated cells treated with vehicle were included as negative controls on each plate. An LXR agonist reference, N-(2,2,2-Trifluoro-ethyl)-N-[4-(2,2,2-trifluoro-1-hydroxy-1-trifluoromethyl-ethyl)-phenyl]-ben2enesulfonamide (Schultz, Joshua R., Genes & Development (2000), 14(22), 2831-2838), was dosed at 1.0 µM and served as a positive control. In antagonist mode, the compound under study is analyzed in the presence of 150nM GW3965, trifluoromethyl-benzyl)-(2,2-diphenyl-ethyl)-amino]-propoxy]-phenyl)-acetic acid (Collins, J.L, J. Med. Chem. (2000), 45:1963-1966.). Results of antagonist analysis are expressed as % antagonism and, IC50 (in µM). RNA isolation and quantitation: Total cellular RNA was isolated from treated cells cultured in 96-well plates using PrepStation 6100 (Applied Biosysterns, Foster City, Ca), according to the manufacturer's recommendations. RNA was resuspended in 44 WO 2005/058834 PCT/US2004/041399 ribonuclease-free water and stored at -70°C prior to analysis. RNA concentrations were quantitated with RiboGreen test procedure, #R-11490 (Molecular Probes, Eugene, OR). Gene expression analysis: Gene-speC1fic mRNA quantitation was performed by real- time PCR with the Perkin Elmer Corp. chemistry on an ABI Prism 7700 Sequence detection system (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Samples (50-100 ng) of total RNA were assayed in duplicate or triplicate in 50 µl reactions using one-step RT-PCR and the standard curve method to estimate speC1fic mRNA concentrations. Sequences of gene- speC1fic primer and probe sets were designed with Primer Express Software (Applied Biosystems, Foster City, CA). The human ABCA1 primer and probe sequences are: forward, CAACATGAATGCCATTTTCCAA, reverse, ATAATCCCCTGAACCCAAGGA, and probe, 6FAM- TAAAGCCATGCCCTCTGCAGGAACA-TAMRA. RT and PCR reactions were performed according to PE Applied Biosystem's protocol for Taqman Gold RT-PCR or Qiagen's protocol for Quantitect probe RT-PCR. Relative levels of ABCA1 mRNA are normalized using GAPDH mRNA or 18S rRNA probe/primer sets purchased commercially (Applied Biosystems, Foster City, CA). Statistics: Mean, standard deviation and statistical significance of duplicate evaluations of RNA samples were assessed using ANOVA, one-way analysis of variance using SAS analysis. Reagents: - GAPDH Probe and Primers - Taqman GAPDH Control Reagents 402869 or 4310884E 18S Ribosomal RNA-Taqman 18S Control Reagents 4308329 10 Pack Taqman PCR Core Reagent Kit 402930 Qiagen Quantitect probe RT-PCR 204443. 45 WO 2005/058834 PCT/US2004/041399 Results: Representative compounds of this invention were shown to upregulate the transcription of the ABCA1 gene in THP-1 cells (EC50 value) in a range between 0.001 to 15 µM with efficacy values in the range of 20 to 250% when compared to the efficacy shown by 1.0 µM of the reference standard. QUANTITATIVE ANALYSIS OF SREBP-1C GENE REGULATION IN THP-1 CELLS. The compounds of formula (II) effect on the regulation of the, SREBP-1c gene was evaluated using the same procedure as described for ABCA1 however, a primer and probe set speC1fic for human SREBP-1c was substituted in gene expression analysis. The human SREBP-1c primer and probe sequences are: forward, AGGGCGGGCGCAGAT, reverse, GGTTGTTGATAAGCTGAAGCATGT, and probe, 6FAM-TCGAAAGTGCAATCCATGGCTCCG-TAMRA. Based on the results obtained in the standard pharmacological test procedures, the compounds of this invention are useful in treating or inhibiting LXR mediated diseases. In particular, the compounds of this invention are useful in the treatment and inhibition of atherosclerosis and atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL cholesterol levels, increasing reverse cholesterol transport, inhibiting cholesterol absorption, treatment or inhibition of Alzheimer's disease, type I diabetes, type II diabetes, multiple sclerosis, rheumatoid arthritis, acute coronary syndrome, restenosis, inflammatory bowel disease (IBD), Crohn's disease, endometriosis, celiac, and thyroiditis. Additionally, compounds of formula II having the structure, 46 WO 2005/058834 PCT/US2004/041399 wherein R1, is -H or C1 to C3 atkyl; R2 is phenyl, or phenyl substituted independently by one or more of the groups independentlyl selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, C1 to C3 aikyl substituted with 1 to 5 fluorines, halogen, -NO2, -NR8R9, and -CN; or A is phenyl, or phenyl substituted by one to four groups independently selected from halogen, C1 to C3 alkyl, acyl, C1 to C3 alkoxy, hydroxy, halogen, -CN, -NO2, C1 to C3 perfluoroalkyl, and C1 to C3 alkyl substituted with 1 to 5 fluorines; R8 is -H, or C1 to C3 alkyl; R9 is -H, or C1 to C3 alkyl; R4, R5, and R6 are each independently -H or -F; or a pharmaceutically acceptable salt thereof, are selective LXR modulators, as gene speC1fic modulation in cell based assays showed agonist activity for ABCA1 and antagonist activity for SREBP-1c. In the agonist mode, selective LXR modulators exhibited = 20% efficacy for ABCA1 activation by LXR and little or no agonism for SREBP-1c (= 25% efficacy relative to reference). In the antagonist mode, selective compounds showed no antagonism of ABCA1 gene expression. There may be an additive effect on ABCA1 gene expression relative to reference ligands at their EC50 concentration. In the antagonist mode, selective compounds inhibited agonist-mediated SREBP-1c gene expression in a dose dependent fashion. It is understood that the effective dosage of the active compounds of this invention may vary depending upon the particular compound utilized, the mode of 47 WO 2005/058834 PCT/US2004/041399 administration, the condition, and severity thereof, of the condition being treated, as well as the various physical factors related to the individual being treated. It is projected that compounds of this invention will be administered at an oral daily dosage of from about 0.05 mg to about 30 mg per kilogram of body weight, preferably administered in divided doses two to six times per day, or in a sustained release form, and may be adjusted to provide the optimal therapeutic result. The compounds of this invention can be formulated neat or with a pharmaceutical carrier for administration, the proportion of which is determined by the solubility and chemical nature of the compound, chosen route of administration and standard pharmacological practice. The pharmaceutical carrier may be solid or liquid. A solid carrier can include one or more substances which may also act as flavoring agents, sweetening agents, lubricants, solubilizers, suspending agents, fillers, glidants, compression aids, binders, or tablet-disintegrating agents; it can also be an encapsulating material. In powders, the carrier is a finely divided solid which is in admixture with the finely divided active ingredient. Solid dosage unit forms or compositions such as tablets, troches, pills, capsules, powders, and the like, may contain a solid carrier binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalC1um phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin. When a dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as a fatty oil. Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar or both. Liquid carriers are used in preparing liquid dosage forms such as solutions, suspensions, dispersions, emulsions, syrups, elixirs and pressurized compositions. The active ingredient can be dissolved or suspended in a pharmaceutically acceptable liquid carrier such as water, an organic solvent, a mixture of both, or pharmaceuticaliy acceptable oils or fats. The liquid carrier can contain other suitable pharmaceutical additives such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickening agents, colors, viscosity regulators, stabilizers or osmo-regulators. Suitable examples of liquid carriers for 48 WO 2005/058834 PCT/US2004/041399 oral and parenteral administration include water (partially containing additives as above, e.g. cellulose derivatives, preferably sodium carboxymethyl cellulose solution); alcohols, including monohydric alcohols such as ethanol and polyhydric alcohols such as glycols and their derivatives; lethiC1ns, and oils such as fractionated coconut oil and arachis oil. For parenteral administration, the liquid carrier can also be an oily ester such as ethyl oleate and isopropyl myristate. Sterile liquid carriers are useful in sterile liquid form compositions for parenteral administration. The liquid carrier for pressurized compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant. A liquid pharmaceutical composition such as a syrup or elixir may contain, in addition to one or more liquid carriers and the active ingredients, a sweetening agent such as sucrose, preservatives such as methyl and propyl parabens, a pharmaceutically acceptable dye or coloring agent, or a flavoring agent such as cherry or orange flavoring. Liquid pharmaceutical compositions which are sterile solutions or suspensions can be administered intraocularly or parenterally, for example, by intramuscular, intraperitoneal or subcutaneous injection. Sterile solutions can also be administered intravenously. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy injectability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing a liquid carrier, for example, water, ethanol, polyol (e.g. glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. The liquid carrier may be suitably mixed with a surfactant such as hydroxypropylcellulose. The compounds of the present invention may also be administered rectally or vaginally in the form of a conventional suppository. For administration by intranasal or intrabronchial inhalation or insufflation, the compounds of this invention may be formulated into an aqueous or partially aqueous solution, which can then be utilized in the form of an aerosol. The compounds of this invention may be administered topically, or also trarisdermally through the use of a transdermal patch containing the 49 WO 2005/058834 PCT/US2004/041399 active compound and a carrier that is inert to the active compound, which is non toxic to the skin, and allows delivery of the agent for systemic absorption into the blood stream via the skin. The carrier may take any number of forms such as creams and ointments, pastes, gels, and occlusive devices. The creams and ointments may be viscous liquid or semisolid emulsions of either the oil-in-water or water-in-oil type. Pastes comprised of absorptive powders dispersed in petroleum or hydrophilic petroleum containing the active ingredient may also be suitable. A variety of occlusive devices may be used to release the active ingredient into the blood stream such as a semipermeable membrane covering a reservoir containing the active ingredient with or without a carrier, or a matrix containing the active ingredient. Other occlusive devices are known in the literature. The following describes the preparation of representative compounds of this invention. Compounds described as homogeneous were determined to be of 90% or greater purity (exclusive of enantiomers) by analytical reverse phase chromatographic analysis with 254 nM UV detection. Melting points are reported as uncorrected in degrees centigrade. The infrared data is reported as wave numbers at maximum absorption, vmax, in reC1procal centimeters, cm"1. Mass spectral data is reported as the mass-to-charge ratio, m/zr, and for high resolution mass spectral data, the calculated and experimentally found masses, [M+H]+, for the neutral formulae M are reported. Nuclear magnetic resonance data is reported as 5 in parts per million (ppm) downfield from the standard, tetramethylsilane; along with the solvent, nucleus, and field strength parameters. The spin-spin homonuclear coupling constants are reported, as J values in hertz; and the multipliC1ties are reported as a: s, singlet; d, doublet; t, triplet; q, quartet; quintet; or br, broadened. EXAMPLE 1 PHENYL[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOUN-3-YL]METHANONE. 1) Preparation of Diethyl 2-({[2-(trifluoromethyl)phenyl]amino}rnethylene)malonate. Diethyl ethoxymethylenemalonate (compound III, 50.4 mL, 249.3 mmol) and 2-(Trifluoromethyl)aniline (compound II, 31 mL, 249.3 mmol) was taken into toluene (250 mL) and refluxed overnight twice. Toluene was evaporated and the resulting liquid was taken into hexane and allowed to sit in a freezer for 1 hour. A white solid 50 WO 2005/058834 PCT/US2004/041399 crashed out and was filtered and dried to yield 69.7.3 g (84.4%) of the title compound as white crystals. MS ESI (mfz) 332 ([M+H]+); MS ESI (mlz) 330 ([M-H]"); Anal Calcd.. For C15H16F3NO4: C, 54.38; H, 4.87; N, 4123. Found: C, 54.49; H, 4.68; N, 4.06. 2) Preparation of 4-Hvdroxy-8-(trifluoromethyl)-3-quinolinecarboxylic acid ethyl ester. Diethyl 2-({[2-(trifluoromethyl)phenyl]arnino}methylene)maIonate (compound of formula (IV)), 69.73 g, 210.5 mmol) was taken into Dowtherm A (350 mL) and brought to reflux (-250 °C) with the removal of ethanot that was formed during the reaction for 45 min: The reaction was allowed to cool to approximately 100 °C then carefully poured into hexane (1 L) and allowed to cool overnight. A white solid preC1pitated which was filtered and dried to afford the title compound as a white solid (55.04 g, 91.7%). MS ESI (mlz) 286 ([M+H]+); MS ESI {mlz) 284 ([M-H]"). 3) Preparation of 4-Chloro-8-(trifluoromethyl)-3-quinolinecarboxylic acid ethyl ester. 4-Hydroxy-8-(trifluoromethyl)-3-quinolinecarboxylic acid ethyl ester (compound of formula (V)), 11.27 g, 39.55 mmol) was taken into toluene (125 mL), then POC13 (7.4 mL, 79.08 mmol) was added and the mixture was refluxed for 1.5 hours. The reaction was carefully poured into ice-water with vigorous stirring, then added carefully added saturated NaHCO3 until the solution was neutral. Dilute with ethyl acetate and separate the layers; The organic layer was dried over MgSO4, filtered and concentrated. The resulting material was passed through a short silica gel plug using 10% ethyl acetate in hexane. Concentration and drying under high vacuum yielded 9.93 g of the title compound as a white solid. 4) Preparation of [4-Chloro-8-(trifluoromethyl)quinoi'in-3-yl](phenyl)methanone. 4-Chloro-8-(trifluoromethyl)-3-quinolinecarboxylic acid ethyl ester (compound of formula (VI)), 3.0 g, 9.87 mmol) was taken into THF (40 mL) and. cooled to -78 °C. Phenyllithium (6.6 mL, 11.85 mmol, 1.8 M solution in cyclohexane-ether 70:30) was added dropwise and stirred at -78 °C for 4 hours. The reaction was poured into water/saturated ammonium chloride solution and extracted with ethyl acetate. The combined organics was dried over MgSCU and concentrated. The material was purified via column chromatography using 5% ethyl actetate in hexane as the eluent to yield 1.7 g of material that was comprised of both the starting material and product. Therefore, this material was taken into hexane and heated, then added a minimal amount of ethyl acetate to dissolve the solid. The mixture was allowed 'to cool overnight where a solid preC1pitated. The solvent was decanted to leave 0.599 g of 51 WO 2005/058834 PCT/DS2004/041399 the title compound as,a yellowish white solid. MS ESI (m/z) 336/338 ([M+H]+); Anal. Calcd. For C17H9C1F3NO: C, 60.82; H, 2.70; N, 4.17. Found: C, 60.48; H, 2.60;.N, 4.02. 5) Preparation of Phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone. [4-Chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone (compound of formula (VII)), 0.050 g, 0.15 mmol) was taken into toluene/EtOH (3 mL/0.5 mL). Then phenylboronic acid (0.30 mmol) was added followed by 2 M Na2CO3 (0.25 mL, 0.5 mmol) and finally Pd(PPh3)4 (0.009 g, 0.0075 mmol). The reaction was heated at 90 DC for 4 hours. The solvent was removed and the resulting material was purified via column chromatography using 5% ethyl acetate in hexane to elute out 0.043 g of the title compound: MS (ESI) m/z 378 ([M+H]+); Anal. Calcd for C23H14F3NO: C, 73.21; H, 3.74; N, 3.71. Found: C, 72.16; H, 3.77; N, 3.69. EXAMPLE 2 [4-(4-METHOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLlN-3-YL](PHENYL) METHANONE. This compound was prepared according to the procedure of Example 1 step 5, substituting 4-methoxyphenylboronic acid for phenyl boronic acid. MS (ESI) m/z 408 ([M+H]+). EXAMPLE 3 ([4-(4-HYDROXYPHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL) METHANONE. This compound was prepared according to the procedure of Example 1 step 5, substituting 4-hydroxyphenylboronic acid for phenyl boronic acid. MS (ESI) m/z 394 ([M+H]+); MS (ESI) m/z 392 ([M-H]-); Anal. Calcd for C23H14F3NO2: C, 70.23; H, 3.59; N, 3.56. Found: C, 69.56; H, 3.74; N, 3.41. EXAMPLE 4 [4-(4-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE. This compound was prepared according to the procedure of Example 1 step 5, substituting 4-methylphenylboronic acid for phenyl boronic acid MS (ESI) m/z 392 52 WO 2005/058834 PCT/US2004/041399 ([M+H]+); Anal. Calcd for C24H16F3NO: C.173.65; H, 4.12; N, 3.58. Found: C, 72.83; H, 4.46; N, 3.45. EXAMPLE 5 [4-(3,4-DIMETHOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE. This compound was prepared according to the procedure of Example 1 step 5, substituting 3,4-dimethoxyphenylboronic acid for phenyl boronic acid. . MS (ESI) m/z 438 ([M+H]+); Anal. Calcd for C25H18F3NO3 0.3 H2O: C, 67.81; H, 4.23; N, 3.16. Found: C, 67.85; H, 4.20; N, 2.90. EXAMPLE 6 [4-(2,6-DIMETHOXYPHENYL)-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE. . This compound was prepared according to the procedure of Example 1 step 5, substituting 2,3-dimethoxyphenyfboronic acid for phenyl boronic acid MS (ESI) m/z 438 ([M+H]+); Anal. Calcd for C25H18F3NO3 . 0.25 H2O: C, 67.95; H, 4.22; N, 3.17. Found: C, 67.97; H, 3.98; N, 3.09. EXAMPLE 7 1-{2-[3-BENZOYL-8-(TRiFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}ETHANONE. This compound was -prepared according to the procedure of Example 1 step 5, substituting 2-acetylphenylboronic acid for phenyl boronic acid. MS (ESI) m/z 420 ([M+H]+); Anal. Calcd for C25H16F3NO2 0.2 H2O: C, 70.99; H, 3.91; N, 3.31. Found: C, 70:89; H, 3.68; N, 3.25. EXAMPLE 8 [4-(4-CHLOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL) METHANONE. This compound was prepared according to the procedure of Example 1 step 5, substituting 4-chlorophenylboronic acid for phenyl boronic acid. MS (ESI) m/z 412/414 ([M+H]+). 1H NMR (CDC13) d 9.12 (s, 1H), 8.19 (d, J = 7.36 Hz, 1H), 7.92 (d, J = 8.45 Hz, 1H), 7.64 (m, 2H), 7.52 (d, J = 7.74 Hz, 2H), 7.28 (m, 6H). 53 WO 2005/058834 PCT/US2004/041390 EXAMPLE 9 [4-(1,1'-BIPHENYL-4-YL)-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL) METHANONE. This compound was prepared according to the procedure of Example 1 step 5, substituting 4-(phenyl)phenylboronic acid for phenyl boronic acid. MS (ESI) m/z 454 ([M+H]+); Anal. Calcd for C29H18F3NO • 0.65 H2O: C, 74.88; H, 4.18; N, 3.01. Found: C, 74.82; H, 4.09; N, 2.88. EXAMPLE 10 PHENYL{8-(TRIFLUOROMETHYL)-4-[3- (TRIFLUOROMETHYL)PHENYL]QUINOLlN-3-YL}METHANONE. This compound was prepared according to the procedure of Example 1 step 5, substituting 3-trifiuoromethyiphenylboronic acid for phenyl boronic acid MS (ESI) m/z 446 ([M+H]+); Anal. Calcd for C24H13F6NO • 0.3 H2O: C, 63.95; H, 3.04; N, 3.11. Found: C, 63.96; H, 3.14; N, 2.68. EXAMPLE 11 [4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PYRIDIN-2- YL)METHANONE 1) Preparation of ( 4-Chioro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone. 2-Bromopyridine (0.74 mL, 7.90 mmol) was taken into THF (30 mL) and cooled to -78 °C. Then BuLi (4.8 mL, 7.90 mmol, 1.6 M solution in hexane) was added dropwise and then stirred for 30 minutes. Next, 4-Chloro-8-(trifluoromethyl)-3- quinolinecarboxylic acid ethyl ester (2.0 g, 6.58 mmol) in THF (10 mL) was added rapidly and stirred at -78 °C for 4 hours. The reaction was poured into water/ saturated NH4C1 solution and then extracted with ethyl acetate. The organic layer was dried over MgSO4, filtered and concentrated. The resulting material was purified via column chromatography using 15% ethyl acetate in hexane as the eluent to yield 0.823 g of (4-chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone as a yellow solid. 2) Preparation of [4-phenyl-8-(trifluoromethyl)quinolin-3-yl](pyridin-2-yl)methanone. This compound was prepared using the procedure of Example 1, step 5 using (4- 54 WO 2005/058834 PCT/US2004/041399 chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yf](phenyl)rnethanone. MS (ESI) m/z 379 ([M+H]+); Anal. Calcd for C22H13F3N2O- 0.1 H2O: C, 69.51; H, 3.50; N, 7.37. Found: C, 69.39; H, 3.27; N, 7.27. EXAMPLE 12 [4-(4-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PYRIDIN-2- YL)METHANONE. This compound was prepared using the procedure of Example 1, step 5 using (4-chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 4-methylphenylboronic acid in place of phenyl boronic acid. MS (ESI) m/z 393 ([M+H]+); Anal. Calcd for C23H15F3N2O • 0.2 H2O: C, 69.76; H, 3.92; N, 7.07. Found: C, 69.73; H, 3.79; N, 6.99. EXAMPLE 13 [4-(1,1'-BIPHENYL-4-YL)-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PYRlDIN-2- YL)METHANONE. This compound was prepared using the procedure of Example 1, step 5 using (4-chloro-8-trifluorornethyl-quinolin-3-yl)-pyridin-2-yl-metrianone in place of [4-chloro-8-(trifluoromethyl)quinoiin-3-yl](phenyl)methanone and 4-(phenyl)phenylboronic acid in place of phenyl boronic acid. MS (ESI) m/z 455 ([M+H]+); Anal. Calcd for C28H17F3N2O: C, 74.00; H, 3.77; N, 6.16. Found: C, 73.99; H, 3.81; N, 5.92. EXAMPLE 14 PYRIDIN-2-YL{8-(TRIFLUOROMETHYL)-4-[3-(TRIFLUOROMETHYL)PHENYL]QUINOLIN-3-YL}METHANONE. This compound was prepared using the procedure of Example 1, step 5 using (4-chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 3-trifluoromethylphenylboronic acid in place of phenyl boronic acid. MS (ESI) m/z 447 ([M+H]+); Anal. Calcd for C23H12F6N2O: C, 61.89; H, 2.71; N, 6.28. Found: C, 61.70; H, 2.66; N, 6.14. 55 WO 2005/058834 PCT/US2004/041399 EXAMPLE 15 [4-(3,4-DlMETHOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLlN-3-YL](PYRIDlM- 2-YL)METHANONE. This compound was prepared using the procedure of Example 1, step 5 using (4-chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 3,4-diphenthoxyphenylboronic acid in place of phenyl boronic acid. MS (ESI) m/z 439 ([M+H]+); Anal. Calcd for C24H17F3N2O3 . 0.15 H2O: C, 65.35; H, 3.95; N, 6.35. Found: C, 65.20; H, 3.79; N, 6.33. EXAMPLE 16 [4-(4-CHLOROPHENYL)-8-(TRlFLUOROMETHYL)QUINOLIN-3-YL](PYRIDIN-2- YL)METHANONE. This compound was prepared using the procedure of Example 1, step 5 using (4-chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 4-chlorophenylboronic acid in place of phenyl boronic acid; MS (ESI) m/z 413/415 ([M+H]+); Anal. Calcd for C22H12C1F3N2O: C, 64.01; H, 2.93; N, 6.79. Found: C, 63.66; H, 3.03; N, 6.60. EXAMPLE 17 [4-(3,4-DlCHLOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOL(N-3-YL](PYRIDIN-2- YL)METHANONE. This compound was prepared using the procedure of Example 1, step 5 using (4-chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 3,4-dichlorophenylboronic acid in place of phenyl boronic acid. MS (ESI) m/z 447/449/451 ([M+H]+); 1H NMR (CDC13) d 9.22 (s, 1H), 8.52 (d, J = 4.6 Hz, 1H), 8.18 (d, J = 7.21 Hz, 1H), 7.96 (d, J= 7.83 Hz, 1H), 7.84 (m, 2H), 7.61 (m, 1H), 7.42 (m, 3H), 7.13 (dd, J= 8.25 and 1.97 Hz, 1H). 56 WO 2005/058834 PCT/US2004/041399 EXAMPLE 18 [4.(4-TERT-BUTYLPHENYL)-8-(TRlFLUOROMETHYL)QUlNOLIN-3-YL](PYRIDIN- 2-YL)METHANONE This compound was prepared using the procedure of Example 1, step 5 using (4- chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 4-t-butylphenylboronic acid in place of phenyl boronic acid. MS (ESI) m/z 435 ([M+H]+); Anal. Calcd for C26H21F3N2O: C, 71.88; H, 4.87; N, 6.45; Found: C, 71.51; H, 5.09; N, 6.22. EXAMPLE 19 1-{2-[3-(PYRIDIN-2-YLCARBONYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL.]PHENYL}ETHANONE. This compound was prepared using the procedure of Example 1, step 5 using (4-chloro-8-trifluoromethyl-quinolin-3-yl)-pyridin-2-yl-methanone in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 2-acetylphenylboronic acid in place of phenyl boronic acid. MS (ESI) m/z 421 ([M+H]+); 1H NMR (CDC13) d 9.24 (s, 1H), 8.63 (d, J= 4.16 Hz, 1H), 8.13 (d, J = 7.03 Hz, 1H), 7.93 (m, 2H), 7.81 (m, 1H), 7.51 (m, 5H), 7.18 (m, 1H), 2.41 (s, 3H). EXAMPLE 20 (2-METHOXYPHENYL)[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL]METHANONE. 1) Preparation of Ethyl 8-(trifluoromethyl)-4-{[(trifluoromethyl)sulfonyl]oxy}quinoline-3-carboxvlate. 4-Hydroxy-8-(trifluorornethyl)-3-quinolinecarboxylic acid ethyl ester (49.71 g, 174.3 mmol) was taken into CH2C12 (500 mL) then trifluoromethanesulfonic anhydride (54.1 g, 191.73 mmol) was added. Next, the mixture was cooled to 0 °C where triethylamine was added dropwise via an addition funnel. After triethylamine was added the reaction was allowed to stir for 30 minutes. The reaction was quenched with water and extracted with methylene chloride. The combined organics were washed with 5% HC1 and brine. Then dried over magnesium sulfate and filtered through a short silica gel plug using methylene chloride as the eluent. Concentration afforded ethyl 8-(trifluoromethyl)-4-{[(trifluoromethyl)sulfonyl]oxy}quinoline-3- 57 WO 2005/058834 , PCTAJS2004/041399 carboxylate as a tan solid (70.98 g, 97.6%). MS (ESI) m/z 418 ([M+H]+); Anal. Calcd for C14H9F6NO5S: C, 40.30; H, 2.17; N, 3.36. Found: C, 40.42; H, 1.97; N, 3.29. 2) Preparation of Ethyl 4-phenyl-8-(trifluoromethyl)quinoline-3-carboxylate. Ethyl 8-(trifluoromethyl)-4-{[{trifluoromethyl)sulfonylJoxy}quinoline-3-carboxylate (45.6 g, 109.3 mmol) was taken into dioxane (500 mL). Then phenylboronic acid (26.7 g, 218.6 mmol), K3PO4 (69.6 g, 327.9 mmol) and Pd(PPh3)4 (6.3 g, 5.5 mmol) was added and the reaction was brought to reflux for 1 hour. The reaction was filtered through Celite was still warm and concentrated. The resulting material was passed through a short silica gel plug and concentrated to yield the desired product as a brown viscous liquid (35.96 g). MS (ESI) m/z 346 ([M+H]+). 3) Preparation of 4-Phenyl-8-(trifluoromethyl')quinoline-3-carboxvlic acid. Ethyl 4-phenyl-8-(trifluoromethyl)quinoline-3-carboxylate (35.96 g, 104.14 mmol) was taken into THF/MeOH (300 mL of 1:1 mixture) along with 2 M NaOH (200 mL) and heated at 70 °C for 20 minutes. The organics were removed and the remaining aqueous layer, was cooled to 0 °C and acidified with concentrated HC1. The mixture was concentrated and the resulting material was passed through a silica gel column using CH2Cl2 , then 20% MeOH in CH2C12. The fractions were combined and the volume was reduced and then diluted to twice the volume with hexane and placed in a freezer overnight. A solid preC1pitated which was filtered and dried to yield the carboxylic acid as a brown solid (14.03 g). MS (ESI) m/z 318 ([M+H]+); MS (ESI) m/z 316([M-H]+). 4) Preparation of N-Methoxv-N-methyl-4-phenyl-8-(trifluoromethyl)quinoline-3- carboxamide. 4-Phenyl-8-(trifluoromethyl)quinoline-3-carboxylic acid (6.19 g, 19.51 mmol) was taken into DMF (75 mL) and cooled to 0 °C. Then PyBOP (10.66 g, 20.49 mmol) was added followed by N,O-dimethylhydroxylamine hydrochloride (2.09 g, 21.46 mmol) and diisopropylethylamine (8.50 mL, 48.78 mmol). The reaction was stirred for 3 hours allowing to warm to room temperature during that time. The reaction was poured into water and extracted with ethyl acetate. The combined organics was washed with water, half-saturated brine and then dried over magnesium sulfate. Purification was carried out via column chromatography using 30% ethyl acetate in hexane as the eluent to yield the desired compound as a white solid (6.37 g, 90.6%). 58 WO 2005/058834 PCT/US2004/041399 MS (ESI) m/z 361 ([M+H]+); Anal. Calcd for C19H15F3N2O2' 0.15 H2O: C, 62.86; H, 4.25; N, 7.72. Found: C, 62.89; H, 4.14; N, 7.55. 5) Preparation of (2-Methoxyphenyl)[4-phenyl-8-(trifluoromethyl)quinolin-3- yflmethanone. N-Methoxy-N-methyl-4-phenyl-8-(trifluorornethyl)quinoline-3- carboxamide (0.100 g, 0.278 mmol) was taken into THF (3 mL) and cooled to -78 °C where 2-methoxyphenylmagnesium bromide (0.833 mL, 0.833 mmol, 1.0M solution in THF) was added and stirred for 10 minutes. Then the reaction was stirred for 1 hour at 0 °C, then for 1 hour at room temperature (added an additional 0.5 mL of 2-methoxyphenylmagnesium bromide before room temperature reaction). The reaction was quenched with MeOH and 2 M HC1. The organics were removed and the resulting aqueous mixture was extracted with methylene chloride, dried over magnesium sulfate and concentrated. The resulting material was purified via column chromatography using 15% ethyl acetate in hexane as the eluent to afford 0.0315 g of the desired product. MS (ESI) mlz 408 ([M+H]+); Anal. Calcd. for C24H16F3NO2: C, 70.76; H, 3.96; N, 3.44. Found: C, 70.76; H, 4.15; N, 3.22. EXAMPLE 21 (2-METHYLPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLlN-3- YL]METHANONE. N-Methoxy-N-methyl-4-phenyl-8-(trifluoromethyl)quinoline-3-carboxamide (0.100 g, 0.278 mmol) was .taken into THF (3 mL) and cooled to 0 °C where 2-methylphenylmagnesium bromide was added. The reaction was then allowed to stir at room temperature overnight. The reaction was quenched with MeOH and 2 M HC1 and stirred for 5 minutes. The organics were removed and the resulting aqueous layer was extracted with methylene chloride, dried and concentrated. Column chromatography using 10% ethyl acetate in hexane afforded 0.057 g of the desired product as a white solid. MS (ESI) m/z 392 ([M+H]+); Anal. Calcd. for C24H16F3NO: C, 73.65; H, 4.12; N, 3.58. Found: C, 73.88; H, 3.87; N, 3.29. 59 WO 2005/058834 PCT/US2004/041399 EXAMPLE 22 (4-METHYLPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE. This compound was prepared using the procedure of Example 21 substituting 4-methylphenylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 392 ([M+H]+); Anal. Calcd. for C24H16F3NO: C, 73.65; H, 4.12; N, 3.58. Found: C, 73.52; H, 4.06; N, 3.32. EXAMPLE 23 [4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PYRIDIN-3- YL)METHANONE. This compound was prepared using the procedure of Example 21 substituting 3-pyridylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 379 ([M+H]+); Anal. Calcd for C22H13F3N2O: C, 69.84; H, 3.46; N, 7.40. Found: C, 69.51; H, 3.52; N, 7.27. EXAMPLE 24 (3-ETHYLPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- : YL]METHANONE. This compound was prepared using the procedure of Example 21 substituting 3-ethylphenylmagnesium bromide for 2-methylphenylmagnesium bromide. The HCI salt was further prepared using HC1 in ether. MS (ESI) m/z 406 ([M+H]+); 1H NMR (acetone-d6) d 9.23 (s, 1H), 8.40 (d, J = 7.2 Hz, 1H), 8.12 (d, J = 8.3 Hz, 1H), 7.88 (m, 1H), 7.53 (m, 2H), 7.39 (s, 6H), 7.29 (m, 1H), 2.60 (q, J = 7.5 Hz, 2H), 1.14 (t, J = 7.5 Hz, 3H). EXAMPLE 25 [4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](3- PROPYLPHENYL)METHANONE. This compound was prepared using the procedure of Example 21 substituting 3-propylphenylmagnesium bromide for 2-methylphenylmagnesium bromide. The HCI salt was further prepared using HC1 in ether. MS (ESI) m/z 420 ([M+H]+); Anal. Calcd 60 WO 2005/058834 PCT/US2004/041399 for C26H20F3NO • HC1 • 1.6 H2O: C, 64.43; H, 5.03; N, 2.89. Found: C. 64.34; H, 4.67; N, 2.73. EXAMPLE 26 (2,4-DIMETHYLPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLIN-3- YL]METHANONE. This compound was prepared using the procedure of Example 21 substituting 3,4-dimethylphenylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 406 ([M+H]+); Anal. Calcd. for C25H18F3NO: C, 74.07; H, 4.48; N, 3.45. Found: C, 74.1; H, 4.65; N, 3.33. EXAMPLE 27 (3-METHOXYPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE. This compound was prepared using the procedure of Example 21 substituting 3-methoxyphenylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 408 ([M+H]+); Anal. Calcd for C24H16F3NO2: C, 70.76; H, 3.96; N, 3.44. Found: C, 70.70; H, 3.90; N, 3.27. EXAMPLE 28 [4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](THIEN-2-YL)METHANONE. This compound was prepared using the procedure of Example 21 substituting 2-thienylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 384 ([M+H]+); Anal. Calcd for C21H12F3NOS: C, 65.79; H, 3.15; N, 3.65. Found: C, 65.75; H, 2.94; N, 3.59. EXAMPLE 29 [4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](THIEN-3-YL)METHANONE. This compound was prepared using the procedure of Example 21 substituting 3-thienylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 384 ([M+H]+); Anal. Calcd. for C21H12F3NOS: C, 65.79; H, 3.15; N, 3.65. Found: C, 65.52; H, 3.01; N, 3.47. 61 WO 2005/058834 PCT/US2004/041399 EXAMPLE 30 (3-METHYLPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE. 3-Bromotoiuene (0.078 mL, 0.64 mmol) was taken into THF (3 mL) and cooled to -78 °C. Next, BuLi (0.32 mL of a 2.0 M Solution, 0.64 mmol) was added dropwise and then stirred for 30 minutes. Next, N-methoxy-N-methyl-4-phenyl-8- (trifluoromethyl)quinoline-3-carboxamide (0.231 g, 0.64 mmol) in THF (2 mL) was added quickly via syringe and allowed to stir overnight. MeOH and 2 N HC1 were added and stirred for 5 minutes. Then the mixture was extracted with ethyl acetate and dried over magnesium sulfate and concentrated. The resulting material was purified via column chromatography using 10% ethyl acetate in hexane as the eluent to afford 0.060 g of desired product as an off white solid. MS (ESI) m/z 392 ([M+H]+); Anal. Calcd. for C24H16F3NO: C, 73.65; H, 4.12; N, 3.58. Found: C, 73.34; H, 4.08; N, 3.31. EXAMPLE 31 3-BENZYL-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE. Phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone (Example 1, 0.244 g, 0.65 mmol) was taken into ethylene glycol (5 mL) along with hydrazine hydrate (0.3 mL) and heated at 120°C for 2 hours. Next, a few pellets of KOH were added and reaction was heated at 180 °C for 4 hours. The reaction was allowed to cool to room temperature, where water was added and the mixture was extracted with ether and concentrated. The resulting material was purified via column chromatography using 5% ethyl acetate in hexane as the eluent to produce 0.128 g of desired product. MS (ESI) m/z 364 ([M+H]+); 1H NMR (CDC13) d 9.01 (s, 1H), 8.02 (d, J = 7.2 Hz, 1H), 7.65 (d, J = 7.6 Hz, 1H), 7.51 (m, 3H), 7.44 (m, 1H), 7.20 (m, 5H), 6.97 (m, 2H), 3.98 (s, 2H). EXAMPLE 32 3-BENZYL-4-(4-METHOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLINE. This compound was prepared using the procedure of Example 31 substituting [4-(4-methoxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone of Example 2 for 2 phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone. The HC1 salt was 62 WO 2005/058834 PCT/US2004/041399 further prepared using HC1 in ether. MS (ESI) m/z 394 ([M+H]+); 1H NMR (acetone-d6) d 8.97 (s, 1H), 8.12 (d, J = 7.2 Hz, 1H), 7.76 (d, J = 8.4 Hz, 1H), 7.63 (m, 1H), 7.25 (m, 4H), 7.15 (m, 3H), 7.07 (d, J = 7.5 Hz, 2H), 4.08 (s, 2H), 3.92 (s, 3H). EXAMPLE 33 4-(4-TERT-BUTYLPHENYL)-3-(PYRIDIN-2-YLMETHYL)-8- (TRIFLUOROMETHYL)QUINOLINE. This compound was prepared using the procedure of Example 31 substituting [4-(4-tert-butylphenyl)-8-(trifluoromethyl)qutnolin-3-yl](pyridin-2-yl)methanone. of Example 18 for 2 phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone. MS (ESI) m/z 421 ([M+H]+); Anal. Calcd for C26H23F3N2: C, 74.27; H, 5.51; N, 6.66. Found: C, 73.94; H, 5.30; N, 6.53. EXAMPLE 34 PHENYL[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3-YL]METHANOL. Phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone (Example 1, 0.200 g, 0.53 mmol) was taken into EtOH (5 mL) and cooled to 0 °C where was added NaBH4 (0.020 g, 0.53 mmol). The ice bath was removed and the reaction was allowed to stir at room temperature overnight. The EtOH was removed and water was added to the resulting material, where it was extracted with methylene chloride, dried over sodium sulfate and concentrated. The product was purified via column chromatography using 15% ethyl acetate in hexane as the eluent to afford 0.194 g of desired product as a white solid. MS (ESI) m/z 380 ([M+H]+); Anal. Calcd for C23H16F3NO: C, 72.82; H, 4.25; N, 3.69. Found: C, 72.52; H, 4.20; N, 3.55. EXAMPLE 35 3-[METHOXY(PHENYL)METHYL]-4-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE. Phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanol (Example 34, 0.05 g, 0.132 mmol) was taken into DMF (3 mL). Next, NaH (0.011 g, 0.264 mmol, 60% dispersion) was added and stirred for 1 hour at room temperature. Next, iodomethane (0.04 ml, 0.66 mmol) was added and allowed to stir for 30 minutes. The reaction was quenched with water then extracted with ether. The combined organics were dried 63 WO 2005/058834 PCT/US2004/041399 over magnesium sulfate and concentrated. The resulting material was purified via column chromatography using 5% ethyl acetate in hexane as the eluent to yield 0.039 g (75%) of desired product as a white solid. MS (ESI) m/z 394 ([M+H]+); Anal. Calcd for C24H18F3NO: C, 73.27; H, 4.61; N, 3.56. Found: C, 73.15; H, 4.16; N, 3.41. EXAMPLE 36 PHElMYL[4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLIN-3-YL]METHYL ACETATE. Phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanol (Example 34, 0.050 g, 0.132 mmol) was taken into CH2C12 (3 mL). Next, triethylamine (0.1 mL, 0.70 mmol) was added followed by acetyl chloride (0.05 mL, 0.70 mmol). The reaction was allowed to stir for 2 hours. The solvent was removed and the resulting material was taken up into an Ether/water/5% HC1 solution. The layers were separated and the organic layer was washed once more with 5% HC1, dried over magnesium sulfate and concentrated. The product was purified via column chromatography using 7% ethyl acetate in hexane as the eluent to afford the product as a white solid (0.044 g, 79.4%). MS (ESI) m/z 422 ([M+H]+); Anal. Calcd. for C26H18F3NO2: C, 71.25; H, 4.31; N, 3.32. Found: C, 71.15; H, 4.11; N, 3.21. EXAMPLE 37 (E)-PHENYL[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE OXIME. Phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone (Example 1, 0.128 g, 0.339 mmol) was taken into EtOH/H2O (7 mL, 7:3 mixture) along with hydroxylamine hydrochloride (0.028 g, 0.407 mmol) and sodium acetate trihydrate (0.061 g, 0.447 mmol) and this mixture was refluxed for 1.5 hours. TLC and LC-MS showed no reaction. Therefore, excess quantities of hydroxylamine hydrochloride and sodium acetate trihydrate were added and refluxing was continued overnight. The reaction was concentrated and the resulting material was taken up into CH2C12/H2O. The layers were separated and the aqueous layer was extracted with CH2C12. The combined organics were dried over sodium sulfate and concentrated. The product was purified via column chromatography using 15% ethyl acetate in hexane as the eluent to afford 0.100 g of desired product as a white solid. MS (ESI) m/z 393 ([M+H]+) 64 WO 2005/058834 PCT/US2004/041399 MS (ESI) m/z 391 ([M-H]-); Anal. Calcd. for C23H15F3N2O: C, 70.4; H, 3.85; N, 7.14. Found: C, 70.09; H, 3.65; H, 6.96. EXAMPLE 38 (E)-PHENYL[4-PHENYL-8-(TRIFLUOROMETHYL)QUiNOLIN-3-YL]METHANONE O-METHYLOXIME. (E)-Phenyl[4-phenyl-8-(trifiuoromethy[)quinolin-3-yl]fnethanone oxime (Example 37, 0.070 g, 0.18 mmo|) was taken into DMF (3 mL). Then NaH (0.014 g, 0.36 mmol) was added and stirred for 20 minutes, followed by addition of iodomethane (0.05 mL, 0.72 mmol) and stirring over Ihe weekend. The reaction was quenched with water and extracted with ether. The combined organics were washed with water and dried over magnesium sulfate and concentrated. The resulting material was purified via column chromafography using 5% ethyl acetate in hexane as the eluent to afford 0.063 g (86%) of desired product as;a|white solid. MS (ESI) m/z 407 ([M+H]+); Anal. Calcd for C24H17F3N2O: C, 70.93; H, 4.22; N, 6.89. Found: C, 70.92; H, 4.19; N, 6.68. EXAMPLE 39 1-PHENYL-1-[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3-YL]ETHANOL. Phenyl[4-phenyl-8-(trifluoromefhyl)quinolin-3-yl]methanone (Example 1, 0.260 g, 0.688 mmol) was taken into THF (5 mL) and cooled to 0 °C. Next, methylmagnesium bromide (0.45 mL of 3.0 M solution in Ether, 1.35 mmol) was added and the reaction was allowed to stir overnight allowing to warm to room temperature. TLC indicated the starting material was still present, therefore additional methylmagnesium bromide was added and the reaction was heated at 50 °C overnight. The reaction was allowed to cool and was quenched with saturated NH4Cl and extracted with CH2C12 dried over sodium sulfate and concentrated. The product was purified via column chromatography using 10% ethyl acetate in hexane as the eluent to afford 0.176 g (64.8%) of desired product. MS (ESI) m/z 394 ([M+H]+); Anal. Calcd. for C24H18F3NO • 0.5 H2O: C, 7163; H, 4.76; N, 3.48. Found: C, 71.45; H, 4.66; N, 3.09. 65WO 2005/058834 PCT/US2004/041399 EXAMPLE 40 3-( 1-METHOXY-1-PHENYLETH YL)-4-PH ENYL-8- (TRIFLUOROMETHYL)QUINOLINE. 1-Phenyl-1-[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]ethanol (Example 39, 0.096 g, 0.243 mmol) was taken into DMF (3 mL) then NaH (0.020 g, 0.487 mmol) was added and stirred for 20 minutes. Lastly, iodomethane (0.08 mL, 1.22 mmol) was added and stirring was continued for 30 minutes. The reaction was quenched with water and extracted with ether. The combined organics were dried over magnesium sulfate and concentrated. The resulting material was purified via column chromatography using 5% ethyl acetate in hexane as the eluent. MS (ESI) m/z 408 ([M+H]+); 1H NMR (CDC13) d 9.59 (s, 1H), 8.01 (d, J = 6.8 Hz, 1H), 7.31 (m, 3H), 7.12 (m, 5H), 7.0 (m, 2H), 6.74 (dd, J = 7.5 and 1.2 Hz, 1H), 6.63 (dd, J = 7.7 and 1.3 Hz, 1H), 3.06 (s, 3H), 1.8 (s, 3H). EXAMPLE 41. (4-({4-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)BENZOIC ACID). Preparation of (2-Benzoyl-3-(2-trifluoromethyl-phenylarnino)-acrvlic acid ethyl ester). A mixture of 2-(trifluoromethyl)aniline( 4.6g, 28.8 mmol) and 2-benzoyl-3-ethoxy-acrylic acid ethyl ester 7.2g , 28.8mmol) in toluene (125 ml) was heated to reflux. After 18 hr, the reaction was cooled, concentrated and purified by column chromatography (eluent 10% ElOAc/hexane) to give 2-benzoyl-3-(2-trifluoromethyl-phenylamino)-acrylic acid ethyl ester (8.6g, Yield = 82%); MS (ESI) m/z 364(M+H)+; Anal Calcd for C19H16F3NO3 : C, 62.81; H, 4.44; N, 3.85 . Found: C, 62.87; H, 4.21; N, 3.76. Preparation of (( 4-Hydroxyl-8-trifluoromethyl-quinolin-3-yl)-phenyl-meth3none). A solution of 2-benzoyl-3-(2-trifluoromethyl-phenylamino)-acrylic acid ethyl ester(8.2g, 22.4mmol) in Dowtherm (120ml) was heated to reflux. After 4 hr, the reaction was cooled and poured in hexane. The resulting solid was filtered and washed with hexane to give (4-hydroxy-8-trifluoromethyl-quinolin-3-yl)-phenyl-methanone (4.0g, Yield - 56%); MS (ESI) m/z 318(M+H)+; Anal Calcd for C17H10F3NO2: C, 63.36; H, 3.18; N, 4.41. Found: C, 63.96; H, 3.14; N, 4.25. Preparation of (3-Benzoyl-8-(trifluoromethyl)quinolin-4-yl trifluoromethanesulfonate). 66 WO 2005/058834 PCT/US2004/041399 A solution of (4-hydroxy-8-trifluoromethyl-quinolin-3-yl)-phenyl-methanone(1.2 g, 3.8 mmol), N-p-phenyltrifluoromethanesulfonimide(1.6g, 4.5mmol) and K2CO3 (2.0g, 14.5mmol) in DMF(20ml) was stirred at rt. After 5 hr, the reaction was poured in water and extracted with ether. The ether was dried, concentrated to give a yellow solid which was triturated with MeOH, filtered to give a white solid (1.1g, yield = 65%); MS (ESI) m/z 450 (M+H)+ ; Anal Calcd for C18H9F6NO4S : C, 48.12; H, 2.02; N, 3.12 . Found: C, 48.06; H, 1.76; N, 2.99." Preparation of (r4-(4-methoxvphenyl)-8-(trifluorornethyl)quino)in-3-yi'l(pr)enyl) methanone). , A solution of 3-benzoyl-8-(trifluoromethyl)quinolin-4-yl trifluoromethanesulfonate (1.8g, 4 mmol), 4-methoxyphenylboronic acid(1.0g, 6.5mmol), and KsPO4(3.0g) in dioxane (50ml) was heated to reflux. After, 4 hr, the reaction was cooled, filtered, concentrated to give an oil which was purified by column chromatography (eluent 10%EtOAc/Hex) to give a white solid (1l3g Yield = 81%); MS (ESI) m/z 408 ([M+H]+; 1H NMR (DMSO) d 9.10 (s, 1H), 8.32 (d, 1H, J=6.8Hz), 8.01 (d, 1H, J= 8.4Hz), 7.78-7.74 (m, 1H), 7.66-7.63 (m, 2H), 7.56-7.52 (m, 1H), 7.38-7.35 (m, 2H), 7.26 (d, 2H, J= 7.8H2), 6.94 (d, 2H, J= 7.8Hz), 3.88 (s, 3H); Preparation of ([4-(4-Hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl) methanone). A mixture of [4-(4-methoxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone (1.3g, 3.3mmol) and pyridine HC1(10g) was heated to 200°C. After 1hr, the reaction was cooled and then diluted with 2N HC1. The acidic layer was extracted with EtOAc, dried and concentrated to give an oil which was triturated with 10% EtOAc/hexane to give a solid which was collected by filtration to give ([4-(4-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone (0.80g, Yield = 68%); MS (ESI) m/z 394 ([M+H]+); 1H NMR (DMSO) 5 9.72 (bs, 1H), 9.08 (s, 1H), 8.31 (d, 1H, J= 6.8Hz), 8.06 (d, 1H, J= 8.6Hz), 7.80-7.75 (m, 1H), 7.62-7.60 (m, 2H), 7.58-7.54 (m, 1H), 7.38-7.35 (m, 2H), 7.13 (d, 2H, J= 7.8Hz), 6.75 (d, 2H, J= 7.8Hz); Preparation of (4-((4-[,3-Benzoyl-8-(trifluoromethyl)quinolin-4-yl] phenoxv)methyl)benzoic Acid). A solution of [4-(4-hydroxyphenyl)-8-(trifluoromethyl)quinoIin-3-yl](phenyl)rnethanone (0.5g, 1.3mmol), methyl 4-bromomethylbenzoate(0.30g, 1.3mmol) and K2CO3 (0-42g, 3mmol) in acetone (20ml) was heated to reflux. After 1hr, the reaction was cooled, 67 WO 2005/058834 PCT/US2004/041399 filtered and concentrated. The resulting oil was dissolved in THF/MeOH .(20ml) and treated with 2N NaOH (2ml) and heated to reflux. After 1 hr, the reaction was cooled, poured into 2N HC1 and extracted with EtOAc. The organic layer was dried, concentrated to give a solid which was triturated with 10% EtOAc/ hexane, filtered to give the desired compound (0.32g, Yield = 47%); MS (ESI) m/z 528 ([M+H]+); 1H NMR (DMSO) d 12.98 (bs, 1H), 9.11 (s, 1H), 8.33 (d, 1H, J= 6.8Hz), 7.96-7.91 (m, 3H), 7.82-7.77 ( m, 1H), 7.64- 7.53 (m, 5H), 7.39-7.35 (m, 2H), 7.27 (d, 2H, J= 7.8Hz), 6.99 (d, 2H, J= 7.8Hz), 5.17 (s, 2H). EXAMPLE 42. ([4-(3-HYDROXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE). A solution of 3-benzoyl-8-(trifluoromethyl)quinolin-4-yl trifluoromethanesulfonate (1.6g, 3.6 mmol), 3-hydroxyphenylboronic acid (0.60g, 4.3mmol), and K3PO4(3.0g) in dioxane (50ml) was heated to reflux. After, 4 hr, the reaction was cooled, filtered, concentrated to give a solid which was triturated with 10%EtOAc/hexane to give a white solid (1.2g Yield = 86%); MS (ESI) m/z 394 ([M+H]+; 1H NMR (DMSO) d 9.54 (s, 1H), 9.11 (s, 1H), 8.339 (d, 1h, J=7.0Hz), 8.01 (d, 1H, J=8.0Hz), 7.83-7.79 (m, 1H), 7.64-7.61 (m, 2h), 7.55-7.51 (m, 1H), 7.39 (t, 2H, J= 7.8Hz), 7.13 (t, 1H, = 7.8Hz), 6.72-6.68 (m, 3H); Anal. Calcd for C23H14F3NO2: C, 70.23; H, 3.59; N, 3.56. Found: C, 69.67; H, 3.43; N, 3.51. EXAMPLE 43. ([4-(3-METHOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE). A solution of [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone (0.2Og, 0.58mmol), iodomethane (Example 42, 0.14g, 1.0 mmol) and K2CO3 (0.41g, 3mm ol) in acetone (10ml) was heated to reflux. After 2 hr, the reaction was cooled, filtered, concentrated to give an oil which was purified by column chromatography (eluent 10%EtOAc/hexane) to give a the desired product as a foam (0.1 0g, Yield = 48% ); MS (ESI) m/z 408 ([M+H]+) 68 WO 2005/058834 PCT/US2004/041399 EXAMPLES 44-55 The compounds of Examples 44-55 were prepared from {4-(3-hydroxyphenyl)-8-(trifluoromethyl)quino]in-3-yl](phenyl)methanone (Example 42) using the procedure in Example 43 substituting Cs2CO3 for K2CO3, DMF for acetone, and the appropriate alkylating agent in place of iodomethane. EXAMPLE 44 [4-[3-(BENZYLOXY)PHENYL]-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE. From benzylbromide. MS (ESI) m/z 484 ([M+H]+); HRMS: calcd for C30H20F3NO2, 483.1446; found (ESI_FT), 484.15164.: EXAMPLE 45 [4-{3-[(2-CHLOROBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE. From 2-chlorobenzylbromide. MS (ESI_FT) m/z 518.11207 ([M+H]1+); MS (ESl_FT) m/z 518.11292 (CALCD );HRMS: calcd for C30H19C1F3NO2, 517.1056; found (ESL.FT), 518.11207. EXAMPLE 46 PHENYL[4-[3-(2-PHENYLETHOXY)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL]METHANONE. From 2-phenylbromoethane. HRMS: calcd for C31H22F3NO2, 497.1603; found (ESI_FT), 498.16655. EXAMPLE 47 [4-{3-[(2-CHLORO-6-FLUOROBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE. From 2-chloro-6-fluorobenzylbromide. MS (ESI) m/z 536/538 ([M+H]+);HRMS: calcd for C30H18CIF4NO2, 535.0962; found (ESI_FT), 536.10194; 69 WO 2005/058834 PCT/US2004/041399 EXAMPLE 48 [4-{3-[(4-CHLOROBENZYL)OXY]PHENYL}-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE. From 4-chlorobenzylbromide. MS (ESI) m/z 518/520 ([M+H]+);HRMS: calcd for C30H19C1F3NO2, 517.1056; found (ESI_FT), 518.11102. EXAMPLE 49 [4-{3-[(2-FLUOROBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE. From 2-fluorobenzyIbromide. MS (ESI) m/z 502 ([M+H]+);HRMS: calcd for C30H19F4NO2, 501.1352; found (ESI_FT), 502.14127. EXAMPLE 50 [4-{3.[(4.FLUOROBENZYL)OXY]PHENYLh8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE. From 4-FluorobenzyIbromide. MS (ESI) m/z 502 ([M+H]+);HRMS: calcd for C30H19F4NO2, 501.1352; found (ESI_FT), 502.1415. EXAMPLE 51 [4-{3-[(2-CHLORO-4-FLUOROBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE. From 2-chloro-4-fluorobenzylbromide. MS (ESI) m/z 536/538 ([M+H]+ );HRMS: calcd for C30H18ClF4NO2, 535.0962; found (ESI_FT), 536.1017. EXAMPLE 52 PHENYL[4-{3-[(2,4,6-TRIFLUOROBENZYL)OXY]PHENYL^8- (TRIFLUOROMETHYL)QUlNOLIN-3-YL]METHANONE. From 2, 4, 6-trifluorobenzylbromide. MS (ESI) m/z 538 ([M+H]+);HRMS: calcd for C30H17F6NO2, 537.1163; found (ESI_FT), 538.12281. 70 WO 2005/058834 PCT/US2004/041399 EXAMPLE 53 [4-{3-[(2,4-DIFLUOROBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL](PHENYL)METHANONE. From 2, 4-difluorobenzylbromide. MS (ESI) m/z 520 ([M+H]+);HRMS: calcd for C30H18F5NO2, 519.1258; found (ESl_FT), 520.13135. EXAMPLE 54 [4-{3-[(3,4-DIFLUOROBENZYL)OXY]PHENYL^8-{TRlFLUOROMETHYL)QUINOLIN- 3-YL](PHENYL)METHANONE. From 2, 4-difluorbbenzylbromide. MS (ESI) m/z 520 ([M+H]+); HRMS: calcd for C30H18F5NO2, 519.1258; found (ESl_FT), 520.13178. EXAMPLE 55 ([4-({3-[3-BENZOYL-8~(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETICACID. From 4-bromomethyl-phenylacetic acid. MS (ESI) m/z 542 ([M+H]+); 1H NMR (DMSO) d 12.34 (bs, 1H), 9.149s, 1H), 8.33 (d, 1H, J= 6.7Hz), 7.93 (d, 1H, J= 8.5Hz), 7.65-7.62 (m, 2H), 7.55-7.51 (m, 1H), 7.38-7.35 (m, 2H), 7.25-7.21 (m, 5H), 7.00-6.86 (m, 3H), 5.02-4.96 (m, 2H), 3.58 (s, 2H). EXAMPLE 56 (4-({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUlNOLIN-4- YL]PHENOXY}METHYL)BENZOIC ACID). A solution of 4-(3-hydroxyphenyl)-8-(trifluorometriyl)quinolin-3-yl](phenyl)methanone (Example 42, 1.0g, 2.5mmol), methyl 4-bromomethylbenzoate (0.57g, 2.5mmol) and K2CO3 (1.38g, 10 mmol) in acetone (25ml) was heated to reflux. After 2hr, the reaction was cooled, filtered and concentrated. The resulting oil was taken up into THF/MeOH (20ml) and 2N NaOH (2ml) was added and the reaction was refluxed. After 2hr, the reaction was cooled, poured into 2N HC1 and extracted with EtOAc. The EtOAc was dried concentrated and the product was purified by column chromatography (eluent 40% EtOAc/ hexane) to give the desired product as a foam (1.00g, Yield = 77%); MS (ESI) m/z 528 ([M+H]+); 1H NMR (DMSO) d 12.97 (s, 1H), 9.14 (s, 1H), 8.33 (d, 1H, J= 6.6Hz), 7.94-7.88 (m, 3H), 7.76 (t, 1H, J= 8.0Hz), 7.63 71 WO 2005/058834 PCT/US2004/041399 (d, 2H, J= 7.1 Hz), 7.54-7.47 (m, 1H), 7.46 (d, 2H, J= 8.5Hz), 7.37-7.33 (m, 2H), 7.27 (t, 1H, J= 7.8Hz), 7.05- 6.98 (m , 2H), 6.87 (m, 1H), EXAMPLE 57 (3-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)BENZOIC ACID. Prepared using the procedure in Example 56 except using methy 3-bromomethylbenzoate as the halide. MS (ESi) m/z 528 ([M+H]+); 1H NMR (DMSO) d 13.05 (s, 1H), 9.14 (s, 1H), 8.32 (d, 1H, J= 6.8Hz), 7.96-7.90 (m, 3H), 7.76 (t, 1H, J= 7.8Hz), 7.65-7.49 (m, 5H), 7.37 (t, 2H, J= 7.5Hz), 7.26 (t, 1H, J= 8.0Hz), 7.01-6.97 (m, 2H), 6.87-6.84 (m, 1H), 5.15-5.01 (m, 2H); EXAMPLE 58 ({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}ACETIC ACID. Prepared using the procedure in Example 56 except using ethyl bromoacetate as the halide. MS (ESI) m/z 452 ([M+H]+); 1H NMR (DMSO) d 9.13 (s, 1H), 8.34 ( d, 1H, J= 7.9HZ), 7.98 (d, 1H, J= 8.5Hz), 7.78( t, 1H, J= 8.0Hz), 7.67( d, 2H, J= 7.0Hz), 7.58-7.54 (m, 1H), 7.38-7.35(m, 2H), 7.26 (t, 1H, J= 8.0Hz), 6.93-6.86 ( m, 3H), 4.57 (s, 2H); EXAMPLE 59 ([4-PHENYL-6-FLUORO-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE). Preparation of 2-Benzoyl-3-(2-trifluoromethyl-4-fluoro-phenylamino)-acrylic Acid Ethyl Ester. A mixture of 4-fluoro-2-trifluorornethyl-aniline (5.0g, 27.89 mmol) and 2-benzoyl-3-ethoxy-acrylic acid ethyl ester (6.9 g, 27.89 mmol) in toluene (125 mL) was heated at reflux. After 18 hr, the reaction was cooled, concentrated and purified by column chromatography (eluent 10% to 40% Et2O/hexanes) to give 2-benzoyl-3-(2-trifluoramethyl-4-fluord-phenylamino)-acryiic acid ethyl ester (6.6 g, 62%); MS (ESI) m/z 382 (M+H)+; 1H NMR E:Z (mixture 1:1) (CDCl3): d 0.88 (t, J = 5.38 Hz, 3H), 0.95 (t, J = 5.38 Hz, 3H), 4.02 (q, J = 5.38 Hz, 2H), 4.07 (t, J = 5.38 Hz, 2H), 7.29- 72 WO 2005/058834 PCT/US2004/041399 7.51 (m, 10 H), 7.53-7.56 (dt, J- 9.67, 1.54 Hz, 2H), 7.66-7.68 (dt, J= 8.33, 1.41 Hz, 2H), 8.10- 8.13 (d, J= 12.68 Hz, 2H). 8.36- 8.39 (d, J= 12.43 Hz, 2H), 11.17-11.20 (d, J = 12.68 Hz, 1H), 12.39-12.42 (d, J = 12.43 Hz, 1H). Preparation of 4-Hrdroxy-6-fluoro-8-trifluoromethyl-quinolin-3-yl)-phenyl-methanone. A solution of 2-benzoyl-3-(4-fluoro-2-trifluoromethyl-phenylamino)-acrylic acid ethyl ester(6.1g, 16.0 mmol) in Dowtherm (75mL) was heated to reflux. After 4 hr, the reaction was cooled and poured in hexane (150 mL). The resulting solid was filtered and washed with hexane, recrystalization (1:1 EtOAc/hexane) to give 4-hydroxy-6-fluoro-8-trifluoromethyl-quinolin-3-yl)-phenyl-methanone as a light yellow powder (2.8 g, 53%); MS (ESI) m/z 336 (M+H)+; 1H NMR (CDC13): d 6.99-7.7.02 (d, J - 8.59 Hz, 1H), 7.33-7.36 (t, J = 8.59 Hz, 1H), 7.79-7.81 (t, J = 9.60 Hz, 1H), 7.61-7.67 (m, 2H), 7.96-7.98 (dd, J= 8.32, 5.50 Hz, 1H), 9.14 (s, 1H), 14.16 (s, 1H). Preparation of 3-Benzoyl-(4-fluoro-8-trifluoromethvnquinolin-4-yl Trifluoromethanesulfonate. A solution of (4-hydroxy-6-fluoro-8-trifluoromethyl-quinolin-3-yl)-phenyl-methanone (50 mg, 1.49 mmoi) and triethylamine (310 mg, 3.07 mmol) in CH2C12 (15 mL) was stirred at 0° C under calC1um sulfate tube was added trifluoromethanesulfonic anhydride (505 mg, 1.79 mmol). After 1 hr, the reaction was poured into 2N HC1 (25 mL) and extracted, washed with brine (15 mL), drying over MgSO4 and concentrated in vacuo to give 3-benzoyl-(4-fluoro-8-trifluoromethyl)quinolin-4-yl trifluoromethanesulfonate as an off white powder (510 mg, 71%); MS (ESI) m/z 468 (M+H)+; 1H NMR (CDC13): d 7.00-7.7.03 (d, J = 8.59 Hz, 1H), 7.33-7.36 (t, J = 8.59 Hz, 1H), 7.62-7.67 (m, 3H), 7.87-7.90 (d, J = 8.32 Hz, 1H), 8.00-8.02 (dd, J = 8.32, 5.50 Hz, 1H), 9.15 (s, 1H). Preparation of ([4-Phenyl-6-fluoro-8-(trifluoromethyl)quinolin-3- yl](phenyl)methanone). A solution of 3-benzoyl-6-fluoro-8-trifiuoromethyl)quinolin-4-yl trifluoromethanesulfonate (510g, 1.09 mmol), phenylboronic acid (166mg, 1.36mmol), K3PO4(961 mg, 4.54 mmol), Pd(PPh3)4 (91 mg, 0.08 mmol) in dioxane (35mL) was heated to reflux. After 3 hr, the reaction was cooled, filtered through celite, partitioned between 2N HC1 (40 mL) and EtOAc (50 mL), dried over MgSO4 and concentrated in vacuo. Reverse Phase-HPLC afforded the title compound as a light yellow solid (138 mg, 32%); MS (ESI) m/z 396 (M+H)+; 1H NMR (CDC13): d 73 WO 2005/058834 PCT/US2004/041399 7.31-7.35 (m, 1H), 7.36-7.40 (m, 2H), 7.54-7.58 (dt, J= 7.30, 2.99 Hz, 1H), 7.63-7.65 (d, J= 7.15 Hz, 1H), 8.35-8.38 {dd, J = 8.58 Hz, 1H), 9.14 (s, 1H). EXAMPLE 60 [4-(3-AMINOPHENYL)-8-(TRIFLUOROMETHYL)QUINOLlN-3- YL](PHENYL)METHANONE. To a mixture of tetrakis(triphenylphosphine)palladium (0) (0.12, 0.1 mmol), 2N sodium carbonate (5 mL, 10 mmol), [4-chloro-8-(trifluoromethyl)quinoiin-3-yl](phenyl)methanone (from Example 1, 0.67 g, 2.0 mmol) in 20 mL of toluene and 5 mL of ethanol was added 3-aminobenzeneboronic acid (0.62 g, 4.0 mmol). The reaction mixture was heated to 80 °C for 1 hour, diluted with ethyl acetate, washed with water and dried over MgSO4. Removal of solvent under reduced pressure gave a crude product that was purified by silica gel chromatography eluting with ethyl acetate/ hexanes (5% to 50%) to give the title compound as a pale yellow solid; MS (El) m/z 393.3 (M+H)+; 1H NMR (DMSO-d6): d 5.21 (s, 2 H), 6.39 (d, J = 8.8 Hz, 1 H), 6^47 (s, 1 H), 6.48 (d, J = 9.4 Hz, 1 H), 6.95 (t, J = 9.4 Hz, 1 H), 7.39 (t, J = 7.5 Hz, 2 H), 7.56 (t, J = 8.7 Hz, 1 H), 7.63 (d, J = 8.2 Hz, 2 H), 7.80 (t, J = 7.8 Hz, 1 H), 8.10 (d, J = 8.6 Hz, 1 H), 8.31 (d, J = 6.7 Hz, 1 H), 9.08 (s, 1 H). EXAMPLE 61 4-[({3-[3-BENZOYL~8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}AMINO)SULFONYL]BENZOIC ACID. 4-(Chlorosulfonyl)benzoic acid (0.11g, 0.5 mmol) in 5 mL of THF was added dropwise to a stirred solution of [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone (0.098 g, 0.25 mmol) and triethylamine (0.4 mL, 0.29 mmol) in 5 mL of THF at room temperature. The reaction mixture was stirred overnight, diluted with ethyl acetate, washed with water, and concentrated. The residue was purified by semi-preparative HPLC (Column: Phenomenex C18 Luna 21.6 mm x 60 mm, 5 DM; Solvent A: Water (0.1% TFA buffer); Solvent B: Acetonitrile (0.1 % TFA buffer); Solvent Gradient: Time 0: 0% B; 10 min: 100% B; Hold 100% B 5 min. Flow Rate: 22.5 mL/min). The product was collected based on UV absorption and concentrated to give the title compound as a brown solid (0.075 g, 50%): MS (El) m/z '601.1 (M+H)+; 1H NMR (DMSO-d6): 6 7.03 (d, J = 7.7 Hz, 1 H), 7.33 (t, J = 8.0 Hz, 1 74 WO 2005/058834 PCT/US2004/041399 H), 7.39 (t, J - 7.8 Hz, 2 H), 7.56 (t, J = 7.4 Hz, 1 H), 7.60-8.75 (m, 9 H), 8.06 (d 8.6 Hz, 1 H), 8.36 (d, J= 7.3 Hz, 1 H), 9.16 (s, 1 H), 10.34 (s, 1 H). EXAMPLE 62 N-{3-[3-BENZOYL-8-(TRIFLUOROM£THYL)QUINOUN-4- YL]PHENYL}B ENZENESULFONAMIDE. The title compound was prepared from [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and benzenesulfonyl chloride following the procedure of Example 61 as an off-white solid: MS (El) m/z 533.2 (M+H)+; 1H NMR (DMSO-d6): d 6.95 (d, J = 7.7 Hz, 1 H), 7.03 (d, J= 8.1 Hz, 1 H), 7.05 (s, 1 H), 7.20 (t, J = 7.9 Hz, 1 H), 7.35 (t, J - 7.5 Hz, 2 H), 7.50-7.70 (m, 9 H), 7.76 (t, J = 8.2 Hz, 1 H), 8.33 (d, J = 7.1 Hz, 1 H), 9.11 (s, 1 H), 10.38 (s, 1 H). EXAMPLE 63 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-4- (TRIFLUOROMETHYL)BENZENESULFONAMIDE. The title compound was prepared from [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 4-(trifluoromethyl)benzenesulfonyl chloride following the procedure of Example 61 as an off-white solid: MS (El) m/z 601.1 (M+H)+; 1H NMR (DMSO-d6): d 7.00-7.10 (m, 3 H), 7.24 (d, J = 8.6 Hz, 1 H), 7.33 (t, J= 7.6 Hz, 2 H), 7.50-7.60 (m, 3 H), 7;.70 (d, J = 8.5 Hz, 1 H), 7.75 (t, J = 8.4 Hz, 1 H), 7.87 (d, J = 7.4 Hz, 2 H), 7.96 (d, J = 7.4 Hz, 2 H), S.34 (d, J = 6.2 Hz, 1 H), 9.11 (s, 1 H), 10.65 (s, 1 H). EEXAMPLE 64 N-[3-(3-BENZOYL-8-TRIFLUOROMETHYL-QUINOLIN-4-YL)-PHENYL]-. BENZAMIDE. The title compound was prepared from [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and benzoyl chloride in substantially the same manner as described in Example 61 with one change: pyridine was used as a base instead of triethylamine; off-white solid: MS (El) m/z 497.2 (M+H)+; 1H NMR (DMSO-d6): d 7.03 . (d, J = 7.6 Hz, 1 H), 7.33 (t, J = 7.8 Hz, 1 H), 7.39 (t, J = 8.0 Hz, 2 H), 7.50-7.95 (m, 75 WO 2005/058834 PCT/US2004/041399 10 H), 8.05 (d, J - 7.7 Hz, 1 H), 8.36 (d, J = 7.0 Hz, 1 H), 9.16 (s, 1 H), 10.33 (s, 1 H). EXAMPLE 65 1-[3-(3-BENZOYL-8-TRIFLUOROMETHYL-QUINOUN-4-YL)-PHENYL]-3-PHENYL- UREA. The title compound was prepared from [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and phenyl isocyariate in substantially the same manner as described in Example 61 with one change: no triethylamine was used; off-white solid: MS (El) m/z 512.2 (M+H)+; 1H NMR (DMSO-d6): d 6.90 (d, J = 7.7 Hz, 1 H), 6.96 (t, J = 7.3 Hz, 1 H), 7.20-7.30 (m, 3 H), 7.35-7.47 (m, 6 H), 7.57 (t, J= 7.5 Hz, 1 H), 7.66 (d, J = 8.5 Hz, 2 H), 7.83 (d, J= 7.7 Hz, 1 H), 8.35 (d, J = 6.9 Hz, 1 H), 8.66 (s, 1 H), 8.74 (s, 1 H), 9.14 (s, 1 H). EXAMPLE 66 {4-[({3-[3-BEN20YL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]PHENYL} ACETIC ACID [4-(3-Aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone (0.39 g, 1.0 mmol) and (4-formyl-phenyl)-acetic acid methyl ester (0.17 g, 0.96 mmol) were mixed inTHF (15 mL) and then treated with NaBH(OAc)3 (0.43 g, 2.0 mml) and acetic acid (0.5 mL). After stirring at 40 °C under a N2 atmosphere for 2 h the mixture was quenched with water and then extracted with ethyl acetate. The organic residue was purified by silica gel chromatography using 5-50% EtOAc/hexanes as eluent to provide methyl {4-[({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}acetate as an orange solid (0.30 g, 54%): MS (El) m/z 555.3 (M+H)+; 1H NMR (DMSO-d6): d 3.61 (s, 3 H), 3.66 (s, 2 H), 4.12 (d, J = 6.0 Hz, 2 H), 6.40 (d, J = 6.8 Hz, 2 H), 6.49 (d, J = 6.8 Hz, 2 H), 6.98 (t, J = 7.7 Hz, 1 H), 7.18-7.22 (m, 4 H), 7.36 (t, J = 7.5 Hz, 2 H), 7.55 (t, J = 7.4 Hz, 1 H), 7.59 (d, J - 9.0 Hz, 2 H), 7.72 (t, J= 8.6 Hz, 1 H), 7.99 (d, J = 8.5 Hz, 1 H), 8.30 (d, J = 7.3 Hz, 1 H), 9.08 (s, 1 H). To a stirred solution of methyl {4-[({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}acetate (0.06 g, 0.11 mmol) in THF/methanol/water (2:1:1, 10 mL) was added lithium hydroxide monohydrate (0.06 g, 1.4 mmol). The 76 WO 2005/058834 PCT/US2004/041399 reaction was stirred at 40 ° C for 1 h. The reaction mixture was made acidic (pH 6) with glaC1al acetic acid, and the solid was collected and dried over P2O5 to give the title compound as an orange solid (0.05 g, 93%): MS (El) m/z 541.3 (M+H)+; 1H NMR (DMSO-d6): d 3.53 (s, 2 H), 4.12 (d, J = 5.8 Hz, 2 H), 6.35-6.55 (m, 4 H), 6.97 (t, J = 7.4 Hz, 1 H), 7.15-7.22 (m, 4 H), 7.36 (t, J = 7.8 Hz, 2 H), 7.55 (t, J= 7.4 Hz, 1 H), 7.61 (d, J= 8.2 Hz, 2 H), 7.72 (t, J= 8.0Hz, 1 H), 7.98 (d, J= 8.0 Hz, 1 H), 8.29 (d, J = 7.1 Hz, 1 H), 9.08(s,1 H). EXAMPLE 67 (4-{[{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(METHYL) AMINO]METHYL}PHENYL)ACETIC ACID. The title compound was prepared from methyl {4-[({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}acetate and 37% aqueous formaldehyde followed the procedures of Example 66 as an orange solid MS (El) m/z 555.3 (M+H)+; 1H NMR (DMSO-d6): d 2.86 (s, 3 H), 3.55 (s, 2 H), 4.44 (s, 2 H), 6.50 (d, J = 7.5 Hz, 1 H), 6.60-6.65 (m, 2 H), 6.98 (d, J= 8.1 Hz, 2 H), 7.09 (t, J= 7.9 Hz, 1 H), 7.18 (d, J = 8.0 Hz, 2 H), 7.36 (t, J= 7.4 Hz, 2 H), 7.55 (t, J = 6.2 Hz, 1 H), 7.64 (d, J = 7.0 Hz, 2 H), 7.73 (t, J = 7.8 Hz, 1 H), 8.01 (d, J = 7.7 Hz, 1 H), 8.30 (d, J = 7.0 Hz, 1 H),9.10(s,1H), 12.31 (brs, 1 H). EXAMPLE 68 ([4-(3-HYDROXYMEtHYL-PHENYL)-8-TRIFLUOROMETHYL-QUINOLIN-3-YL]- PHENYL-METHANONE). A solution of (3-benzoyl-8-(trifluoromethyl)quinolin-4-yl trifluoromethanesulfonate). (3.0g, 6.0mmol), 3-hydroxymethylphenylboronic acid (1.5g, 10mmol), K3PO4 (3.0g) and Pd(PPh3)4 (0.30g) in dioxane (30ml) was heated to reflux. After 3hr, the reaction was cooled and poured into water. The aqueous layer was extracted with EtOAc, dried, concentrated to give an oil which was purified by column chromatography (eluent 30 % EtOAc / Hexane) to give the title compound as a foam (2.6g, 96%); MS (ESI) m/z 407([M+H]+); 1H NMR (DMSO) d 9,149 (s, 1H), 8.33 (d, 1H, J=7.1Hz), 7.96 (d, 1H), 7.8Hz), 7.80 (t, 1H, J= 7.4Hz), 7.62 (d, 2H, H= 7.1 Hz), 7.55 (t 1H, J= 7.5Hz), 7.40-7.28 (m, 5H), 7.18-7.14 (m, 1H), 5.23 (t, 1H, J= 5.6Hz), 4.41 (d, 1H, J= 5.6Hz). 77 WO 2005/058834 PCT/US2004/041399 .EXAMPLE 69 ([4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}OXY)PHENYL]ACETICACID). To a solution of [4-(3-hydroxymethyl-phenyl)-8-trifluoromethyI-quinolin-3-yl]-phenyl' methanone (0.20g, 0.5mmol), PPh3 (0.2g, 0.75mmol) and methyl 4-hydroxyphenylacetate (0.13g, 0.75mmol) in THF (10ml) was added DIAD (0.15g, 0.75mmol) drop wise. After 1hr, the reaction was concentrated and purified by column chromatography (eluent 20 %EtOAc / Hexane) to give a foam (0.14g). The foam was dissolved in THF / MeOH (10ml) and 1N NaOH (1ml) and heated to reflux. After 1 hr, the reaction was cooled, poured into 1N HC1 and extracted with EtOAc. The organic layer was dried and concentrated to the title compound as a foam (0.11 g, 41%); MS (ESI) m/z 542 ([M+H]+); 1H NMR( DMSO) d 12.24 (s, 1H), 9.15 (s, 1H), 8.34 (d, 1H, J= 6.7HzX 7.91 (d, 1H, J= 7.2Hz), 7.78 (t, 1H, J= 7.6Hz), 7.61 (d, 2H, J= 8.2Hz), 7.56-7.52 (m, 1H), 7.40-7.35 (m, 5H), 7.27-7.22 (m, 1H), 7.16 (d, 2H, J= 8.2z), 6.85 (d, 2H, J= 8.2Hz), 5.04 (s, 2H), 3.47 (s, 2H). EXAMPLE 70 ([4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETONITRlLE). A solution of [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone (1.5g, 3.8mmol), dichloro-p-xylene and K2CO3 in acetone ( 50ml) was heated to reflux. After 18 hr, the reaction was cooled, filtered, concentrated and purified by column chromatography (eluent 20 %EtOAc / Hexane) to give {4-[3-(4-chloromethyl-benzyloxy)-phenyl]-8-trifluoromethyl-quinolin-3-yl}-phenyl-methanone as a foam (1.1g, 55%). This foam was dissolved in DMF and NaCN (0,16g, 2.5mmol) and Nal (.075g, 0.5mmol) were added. The reaction was heated to 60°C for 1hr and then cooled. The solution was poured into water and extracted with EtOAc, which was dried and concentrated. The product was purified by column chromatography (eluent 20 % EtOAc / Hexane) to give the title compound as a foam (0.80g, 72%); MS (ESl) m/z 523 ([M+H]+); 1H NMR(DMSO) d 9.14 (s, 1H), 8.33 (d, 1H, J= 6.7Hz), 7.93 (dd, 1H, J= 8.5HZ, 1.0Hz), 7.78 (1, 1H, J= 7.4Hz), 7.64 (d, 2H, J= 8.4Hz), 7.57 (t, 1H, J= 7.5Hz), 7.40-7.35 (m, 6H), 7.26 (t, 1H, J=7.9Hz), 6.99-6.94 (m, 2H), 6.84 (d, 1H, J= 8.2Hz), 5.10-4.97 (m, 2H), 4.05 (s, 2H). 78 WO 2005/058834 PCT/US2004/041399 EXAMPLE 71 (PHENYL[4-(3-{[4-(1H-TETRAZOL-5-YLMETHYL)BENZYL]OXY}PHENYL)-8- (TRlFLUOROMETHYL)QUlNOLIN-3-YL]METHANONE). A solution of ([4-({3-[3-benzoyI-8-(trifluoromethyl)quino]in-4-yl]phenoxy}methyl phenyl]acetonitrile) (0.52g, LOmmol), sodium azide (0.33g, 5.0mmol) and NH4CI (0.27g, 5mmol) in DMF (30ml) was heated to 125°C. After 48 hr, the reaction was cooled and poured into water. The aqueous layer was extracted with EtOAc, dried and concentrated. The product was purified by column chromatography (eluent 50% EtOAc / Hexane) to give the title compound as a foam (0.12g, 22%); MS (ESI) m/z [M+H]+ (566); 1H NMR (DMSO) d 16.2 (s, 1H), 9.13 (s, 1H), 8.32 (d, 1H, J= 6.7Hz), 7.92 (d, 1H, J=8.4Hzj, 7.75 (t, 1H, J= 7.8Hz), 7.63 (d, 2H, J= 8.4Hz), 7.57-7.53 (m, 1H), 7.39-7.25 (m, 7H), 6.98-6.93 (m, 2H), 6.84 (d, 1H, J= 8.2Hz), 5.02-4.43 (m, 2H), 4.32 (s, 2H). EXAMPLE 72 N, 4-DIPHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3-CARBOXAMIDE. To a solution of 4-phenyl-8-trifluorornethyl-quinoline-3-carboxylic acid (0.24 g, 0.757 mmole) in 15 mL DMF was added aniline (0.137mL, 1.51 mmole), EDC1-HC1 (0.218 g, 1.13 mmole), and DMAP (0.184 g, 1.51 mmole). After stirring at room temperature overnight, the solution was partitioned between ethyl acetate and water and the aqueous layer was extracted with ethyl acetate. The combined organic phases were washed with water, brine, and dried with magnesium sulfate. The organic phases were concentrated and the residue was loaded onto silica gel and chromatographed with hexanes:ethyl acetate (9:1) to afford 0.211 g (71%) of the title compound as a white solid: mp 207-208 °C; Calculated mass for C23H15N2F3O is 392.38, found by ESI MS, 393 (M + H)+, found by HRMS (ESI), 393.12056 (M + H)+; 1H NMR (DMSO-d6) d 10.40 (bs, 1H), 9.25 (bs, 1H), 8.31 (d, 1H, J = 6.9 Hz), 7.90 (d, 1H, J = 8.3 Hz), 7.77 (t, 1H, J = 7.5 Hz), 7.47 (m, 7H), 7.28 (t, 2H, J = 7.5 Hz), 7.06 (t, 1H, J = 7.06 Hz). Anal. Calcd for C23H15N2F3O: C, 70.40; H, 3.85; N, 7.14. Found: C, 70.00; H, 3.61; N, 6.96. 79 WO 2005/058834 PCT/US2004/041399 EXAMPLE 73 4-({4-FLUORO-3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETIC ACID The title compound is prepared essentially as described in Example 400, supra, except using Ethyl [4-({4-fluoro-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl] acetate instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yOphenyl acetic acid ester to afford 0.100 g (96%) of the title compound as a white solid: mp 257 °C; Calculated mass for C31 H21NF4O3 is 531.51, found MS (ES) m/z 532. EXAMPLE 74 N-{4-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'- PHENYLUREA The title compound was prepared from [4-(4-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and phenyl isocyanate in substantially the same manner as described in Example 61 with one change: no triethylamine was used; off-white solid: MS (ES)-m/z 510.2. EXAMPLE 75 N-PHENYL-N'-{3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}UREA The title compound was prepared from {3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and phenyl isocyanate in substantially the same manner as described in Example 61 with one change: no triethylamine was used; off-white solid: mp 202-205 °C; MS (ES) m/z 481.8. EXAMPLE 76 N-(2-CHLOROPHENYL)-N'-{3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}UREA The title compound was prepared from {3-[3-phenyl-8-(trifluorornethyl)quinolin-4-yl]phenyl}amine and 2-chlorophenyl isocyanate in substantially the same manner as described in Example 61 with one change: no triethylamine was used; off-white solid: mp 192-195 °C; MS (ES) m/z 515.8. 80 WO 2005/058834 PCT/US2004/041399 EXAMPLE 77 N-(2-FLUOROPHENYL)-N'-{3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}UREA The title compound was prepared from {3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-fluorophenyl isocyanate in substantially the same manner as described in Example 61 with one change: no triethylamine was used; off-white solid: MS (ES) m/z 499.8. EXAMPLE 78 [4-[3-({4-[(DIETHYLAMINO)METHYL]BENZYL}OXY)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE Step 1: [4-(3-Hydroxyphenyl)-8-(trifluoromethyl)quinolin-3- yl](phenyl)methanone(2.5g, 6.4mmol), p-Dichloroxylene(5.6g, 32mmol), and K2CO3( 2.6g, 19mmol) in Acetone ( 50ml) was heated to reflux. After 3hr, the reaction was cooled, filtered, and concentrated. The resulting oil was purified by column chromatography (eluent 15 % EtOAc/Hex) to give {4-[3-(4-chloromethyl-benzyloxy)-phenyl]-8-trifluoromethyl-quinolin-3-yl}phenyl-methanone as a foam ( 2.7g) MS m/z 532. Step 2: A solution of {4-[3-(4-chloromethyl-benzyloxy)-phenyl]-8-trifluoromethyl-quinolin-3-yl}phenyl-methanone (011g, 0.2 mmol) and diethylamine( 0.3g, 5.7mmol) in CH2C12(5ml) was stirred at r.t. After 24 hr, the reaction was concentrated and purified by column chromatography (eluent 25% EtOAc/Hex) to give the title compound as a foam (0.10g); MS m/z 569. EXAMPLE 79 [4-[3-({4-[(DIMETHYLAMINO)METHYL]BENZYL}OXY)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using dimethylamine as the amine. MS (ES) m/z 541.3. 81 WO 2005/058834 PCT/US2004/041399 EXAMPLE 80. [4-{3-[(4-{[(2- HYDROXYETHYL)(METHYL)AMINO]METHYL}BENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANON E Prepared using the procedure in Example 78 except using N-Methylaminpethanol as the amine. MS (ES) m/z 571.3. EXAMPLE 81 PHENYL[4-(3-{[4-(PYRROLIDIN-1-YLMETHYL)BENZYL]OXY}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE Prepared using the procedure in Example 78 except using pyrollidine as the amine. MS (ES) m/z 567.4. EXAMPLE 82 PHENYLt4-(3-{[4-(PlPER(DIN-1-YLMETHYL)BENZYL]OXY}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE Prepared using the procedure in Example 78 except using piperidine as the amine. MS (ES) m/z 581.4. EXAMPLE 83 [4-{3-[(44[ETHYL(METHYL)AMINO]METHYL}BENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using N-ethylmethylamine as the amine. MS (ES) m/z 555.4. EXAMPLE 84 [4-[3-({4-[(METHYLAMiNO)METHYL]BENZYL}OXY)PHENYL]-8-(TRlFLUOROMETHYL)QUINOLiN-3-YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using methylamine as the amine. MS (ES) m/z 527.3. 82, WO 2005/058834 PCT/US2004/041399 EXAMPLE 85 [4-[3-({4-[(3-HYDROXYPIPERIDIN-1-YL)METHYL]BENZYL}OXY)PHENYL]-8- (TRIFLUOROMETHYL) QUINOUN-3-YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using 3-hydroxypiperidine as the amine. MS m/z 597. EXAMPLE 86 [4-{3-t(4-{[METHYL(PROP-2-YNYL)AMINO]METHYL}BENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using N-methy[propargylaniine as the amine. MS (ES) m/z 565.2. EXAMPLE 87 [4-[3-({4-[(4-METHYLP)PERAZIN-1-YL)METHYL]BENZYL}OXY)PHENYL]-8- (TRIFLUOROMETHYL)QUlNOLIN-3-YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using N-methylpiperaztne as the amine. MS m/z 596. EXAMPLE 88 [4-[3-({4-[(3-HYDROXYPYRROLIDIN-1-YL)METHYL]BENZYL}OXY)PHENYL]-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using 3-hydroxypyrollidine as the amine. MS (ESI) m/z 582. EXAMPLE 89 [4-{3-[(4-{[2-(METHOXYMETHYL)PYRROLIDIN-1-YL]METHYL}BENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using 2-(methoxymethyl) pyrrolidine as the amine. MS (ESI) m/z 611. 83 WO 2005/058834 PCT/US2004/041399 EXAMPLE 90 [4-{3-[(4-{[2-(HYDROXYMETHYL)PYRROLIDIN-1-YL]METHYL}BENZYL)OXY]PHENYL}-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE Prepared using the procedure in Example 78 except using 2-(hydroxymethyl) pyrrolidine as the amine. MS (ESI) m/z 597. EXAMPLE 91 METHYL 1 -[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENOXY}METHYL)BENZYL]PROLINATE Prepared using the procedure in Example 78 except using proline methyl ester as the amine. MS (ES) m/z 625.4. EXAMPLE 92 1-[4-({3-f3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)BENZYLl]PROLINAMIDE Prepared using the procedure in Example 78 except using pyrrolidine-2-carboxylic acid amide as the amine. MS (ES) m/z 610.3. EXAMPLE 93 1-{1-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL)BENZYL]-1H-PYRROL-2-YL}ETHANONE 1) [4-(3-Hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone: (2.5g, 6.4mmoi), p-dichloroxylene(5.6g, 32mmol), and K2CO3( 2.6g, 19mmol) in acetone( 50ml) was heated to reflux. After 3hr, the reaction was cooled, filtered, and concentrated. The resulting oil was purified by column chromatography (eluent 15 % EtOAc/Hex) to give {4-[3-(4-chloromethyl-benzyloxy)-phenyl]-8-trifluoromethyl- quinolin-3-yl}phenyl-methanone as a foam ( 2.7g). MS m/z 532. 2) 1-{1-[4-({3-[3-BenzoyI-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]-1H- pyrrol-2-yl}ethanone: To a solution of 2-acetylpyrrole (0.065g, 0.60mmol) in DMF(4ml) was added NaH ( 0.015g, 0.60mmol). After stirring the reaction for 10min, 1-{1-[4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]-1H- pyrrol-2-yl}ethanone was added. The reaction was stirred at r.t. for 2hrand then 84 WO 2005/058834 PCT/US2004/041399 poured into water and extracted with EtOAc. The EtOAc was dried, concentrated and the product purified by column chromatography to give the title compound as a foam ( 0.095g); MS (ES) m/z 605.3. EXAMPLE 94 1 -[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL)BENZYL]-1H-PYRROLE-2-CARBONITRILE Prepared using the procedure in Example 93 except using 2-cyanopyrrole as the pyrrole. MS (ESI) m/z 588. EXAMPLE 95 METHYL 1-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL) BENZYL]-1H-PYRROLE-2-CARBOXYLATE Prepared using the procedure in Example 93 except using 1 H-pyrrole-2-carboxylic acid methyl ester as the pyrrole. MS (ESI) m/z 621. EXAMPLE 96 1-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL)BENZYL]-1 H-PYRROLE-2-CARBOXYLIC ACID Prepared by NaOH hydrolysis of methyl 1-[4-({3-[3-Benzoyl-8-(trifiuoromethyl)quinolin-4-yl]phenoxy}methyl) benzyl]-1 H-pyrrole-2-carboxyIate; MS (ESI) m/z 607; MS (ESI) m/z 605. EXAMPLE 97 1-[4-({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUlNOLIN-4-YL]PHENOXY}METHYL)BENZYL]PYRROLIDINE-2,5-DIONE Prepared using the procedure in Example 93 except using sucC1nimide instead of pyrrole. MS (ESI) m/z 595. 85 WO 2005/058834 PCT/US2004/041399 EXAMPLE 98 PHENYL[4-[3-(PROP-2-YNYLOXY)PHENYL]-8-(TRlFLUOROMETHYL)QUINOLIN- 3-YL]METHANONE. The title compound was prepared from propargyl bromide followed the procedure of Example 43. MS (ESI) m/z 432. EXAMPLE 99 [4-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL3PHENOXY}METHYL)PHENYL]ACETlCAClD Prepared using the procedure in Example 56 except using 3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenol instead of 4-(3-hydroxyphenyl)-8-(trifluoromethyl) quinolin-3-yl](phenyl)methanone and 4-bromomethyl-phenyl)-acetic acid ethyl ester as the halide. MS (ESI) m/z 528. EXAMPLE 100 [3-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETICACID Prepared using the procedure in Example 56 except using 3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenol instead of 4-(3-hydroxyphenyl)-8-(trifluoromethyl) quinolin-3-yl](phenyl)methanone and 3-bromomethyl-phenyl)-acetic acid ethyl ester as the halide. MS (ES) m/z 526 EXAMPLE 101 3-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]BENZYL}OXY)PHENYL]PROPANOICACID This compound was made using the same procedure as example 69 but using 3-(4-Hydroxy-phenyl)-propionic acid methyl ester as the phenol; MS m/z 556. EXAMPLE 102 3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL PHENYLCARBAMATE A solution of [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl) 86 WO 2005/058834 PCT/US2004/041399 methanone( Example 42) (0.20g , 0.5mmol), phenyl isocyanate{ 0.2g, 1.7mmol) and TEA( 1ml) in acetonitrile( 5ml) was stirred at r.t. After 20 hr the reaction was concentrated and the oil was purified by column chromatography (eluent 20 % EtOAc/Hex) to give the title compound as a white foam (0.12g); MS (ES) m/z 512.9. EXAMPLE 103 4-(3-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}PROP-1- YNYL)BENZOIC ACID A solution of phenyl[4-[3-(prop-2-ynyloxy)phenyl]-8-(trifluoromethyl)quinolin-3-yl]methanone (Example 21)( 0.3g, 0.7mmol), methy 4-lodobenzoate(0.22g, 0.84mrriol), and PdCl2(PPh3)2( 0.05g), and Cul(0.03g) in TEA/CH3CN( 10ml) was stirred at r.t. After 2hr, the reaction was poured into 2N HC1 and extracted with EtOAc. The EtOAc was dried .concentrated and purified by column chromatography to give an oil( 0.28g). This oil was dissolved in THF/MeOH(5ml) and hydrolized with 1N NaOH( 1ml) to give the title compound as a foam (0.22g); MS (ES) m/z 549.8 EXAMPLE 104 3-(3-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}PROP-1- YNYL)BENZOIC ACID • Prepared as in Example 103 using methy 3-lodobenzoate instead of methy 4-lodobenzoate. MS (ES) m/z 549.8. EXAMPLE 105 [4-({3-[3-[HYDROXY(PHENYL)METHYL]-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENOXY} METHYL)PHENYL]ACETIC ACID Prepared as in Example 34 using 4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]acetic acid (Example 55) instead of phenyl[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone; MS (ES) m/z 542.1. 87 WO 2005/058834 PCT/US2004/041399 EXAMPLE 106 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}METHANOL . This compound was prepared using the procedure of Example 1, step 5 using (3-benzyl-4-bromo-8-(trifluoromethy))quinoline in place of [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 3-(hydroxymethyl)phenylboronic acid in place of phenyl boronic acid; MS (ES) m/z 392.5. EXAMPLE 107 {4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QU(NOLIN-4- YL]PHENYL}AMINO)SULFONYL] PHENYL}ACETIC ACID This title compound was prepared from (4-chlorosulfonyl-phenyl)-acetic acid according to the procedure of Example 61. MS (ESI) m/z 591 ;MS (ESI) m/z 589 EXAMPLE 108 PHENYL[4-[3-(1H-PYRROL-1-YL)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE A mixture of [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone (0.04 g, 0.1 mmol) and 2,5-dimethoxytetrahydrofuran (0.08 g, 0.6 mmol) in 5 mL of acetic acid was heated at 80 for 1 h. Removal of solvent under reduced pressure gave a crude product that was purified by silica gel chromatography eluting with ethyl acetate/ hexanes (5% to 30%) to give 30 mg (67%) of the title compound as an off-white solid. MS (ESI) m/z 443; HRMS: calcd for C27H17F3N2O, 442.1293; found (ESI, ' [M+H]+), 443.1373. EXAMPLE 109 (4-{[{3-[3-BEMZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(FORMYL)AMINO] METHYL}PHENYL)ACETIC ACID A mixture of methyl {4-[({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}acetate (0.05 g, 0.09 mmol) in 5 mL of 96% of formic acid and 1 mL of acetic anhydride was heated under reflux for 1 h. Removal of solvent under reduced pressure gave a crude product that was used for the LiOH hydrolysis as described in Example 66. 35 Mg (68%) of the title compound was 88 WO 2005/058834 PCT/US2004/041399 obtained as a pale yellow solid. MS (ESI) m/z 569; HRMS: calcd for C33H23F3N2O4, 568.1610; found (ESI, [M-H]-), 567.1543. EXAMPLE 110 [4-(3-ANILINOPHENYL)-8-(TRlFLUOROMETHYL)QUINOLIN-3-YL] (PHENYL)METHANONE Phenylboronic acid (0.12 g, 1.0 mmol), Cu(OAc)2 (0.036 g, 0.2 mmol), and myristic acid (0.046 g, 0.2 mmol) were combined in a 100-mL round-bottom flask with a large stir bar. A rubber septum was attached, and dry toluene (2 ml_), 2,6-lutidine (0.116 mL, 1.0 mmol), and {4-[({3-[3-benzoyl-8~(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl] phenyl}acetate (0.045 g, 0.09 mmol) were successively added. The resulting mixture was stirred at a high rate for 24 h, diluted with ethyl acetate (10 mL), filtered through a plug of silica gel, and then purified by semi-preparative HPLC (Column: Phenomenex C18 Luna 21.6 mm x 60 mm, 5 µM; Solvent A: Water (0.1% TFA buffer); Solvent B: Acetonitrile (0.1 % TFA buffer); Solvent Gradient Time 0: 0% B; 10 min: 100% B; Hold 100% B 5 min. Flow Rate: 22.5 mL/min). The product was collected based on UV absorption and concentrated to give the title compound as a yellow solid (0.05 g, 94%). MS (ESI) m/z 469; MS (ESI) m/z 467; HRMS: calcd for C29H19F3N2O, 468.1449; found (ESI, [M-H]-), 467.1362; Anal. Calcd for C29H19F3N2O: C, 74.35; H, 4.09; N, 5.98. Found: C, 74.27; H, 3.72; N, 5.82. EXAMPLE 111 [4-[3-(BENZYLAMINO)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 483. EXAMPLE 112 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINE The title compound was prepared from of [4-(3-aminophenyl)-8-(trifiuoromethyl) quinolin-3-yl](phenyl)methanone according to the procedure of Example 31. MS (ESI) m/z 379. 89 WO 2005/058834 PCT/US2004/041399 EXAMPLE 113 2-{4-[({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO) METHYL]PHENYL}ACETAMIDE A mixture of methyl {4-[({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}acetate (0.06 g, 0.11 mmol) in 25 mL of 28% of ammonium hydroxide and 5 mL of methanol was stirred at room temperature for 2 days. Removal of solvent under reduced pressure gave a crude product that was purified by semi-preparative HPLC. 15 Mg of the title compound was isolated (25%) as a pale yellow solid. MS (ESI) m/z 540. EXAMPLE 114 {4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]PHENYL} ACETIC ACID The title compound was prepared from {4-[({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}acetate according to the procedure of Example 31. MS(ESl)m/z 527. EXAMPLE 115 [4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}AMINO)PHENYL]ACETICACID The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4~ yl]benzaldehyde and (4-amino-phenyl)-acetic acid ethyl ester according to the procedure of Example 66. MS m/z 541. EXAMPLE 116 3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]BENZALDEHYDE The title compound was prepared from 3-formyl phenylboronic acid according to the procedure of Example 60. HRMS: calcd for C24H14F3NO2, 405.0977; found (ESI, [M+H]+), 406.1042; Anal. Calcd for C24H14F3NO2: C, 71.11; H, 3.48; N, 3.46. Found: C, 71.23; H, 3.17; N, 3.28. 90 WO 2005/058834 PCT/US2004/041399 EXAMPLE 117 4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}AMINO)BENZOIC ACID The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]benzaldehyde and 4-amino-benzoic acid ethyl ester according to the procedure of Example 66. MS m/z 527; MS m/z 525. EXAMPLE 118 4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]BENZYL}AMINO)METHYL]BENZOlCACID The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]benzaldehyde and 4-aminomethyl-benzoic acid ethyl ester according to the procedure of Example 66. MS m/z 541; MS m/z 539. EXAMPLE 119 [3-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}AMlNO)PHENYL]ACETICACID The title compound was prepared from 3-[3-benzoyl-8-{trifluoromethyl)quinoIin-4-yl]benzaldehyde and (4-amino-phenyl)-acetic acid according to the procedure of Example 66. HRMS: calcd for C32H23F3N2O3, 540.1661; found (ESI, [M-H]-), 539.1594. EXAMPLE 120 METHYL (4-{[{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}(METHYL)AMlNO]METHYL}PHENYL)ACETATE The title compound was prepared from methyl {4-[({3-[3-benzoyl-8-(trifluoromethyl) quinolin-4-yl]phenyl}amino)methyl]phenyl}acetate and formaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 569; HRMS: calcd for C34H27F3N2O3, 568.1974; found (ESI, [M+H]+), 569.2039; Anal. Calcd for C34H27F3N2O3: C, 71.82; H, 4.79; N, 4.93. Found: C, 71.57; H, 4.64; N, 4.87. 91 WO 2005/058834 PCT/US2004/041399 EXAMPLE 121 4-[({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YLjPHENYL}AMINO)METHYL]BENZOICACID The title compound was prepared from [4-(3-aminophenyl)-8-(trifluoromethyl)quinolu> 3-yl](phenyl)methanone and 4-formyl-benzoic acid methyl ester according to the procedure of Example 66. MS (ESI) m/z 527 EXAMPLE 122 3-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]-1H-INDOLE-6-CARBOXYLICAClD The title compound was prepared from [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin- 3-yl](phenyl)methanone and 3-formyl-1H-indole-6-carboxylic acid methyl ester according to the procedure of Example 66. MS (ESI) m/z 564. EXAMPLE 123 [4-({[3-(3-BENZOYL-8-METHYLQUINOLIN-4-YL)PHENYL]AMINO}METHYL)PHENYL]ACETICACID The title compound was prepared from [4-(3-amino-phenyl)-8-methyl-quinolin-3-yl]-phenyl-methanone and (4-formyl-phenyl)-acetic acid methyl ester according to the procedure of Example 66. MS (ESI) m/z 487; MS (ESI) m/z 485. EXAMPLE 124 [4-(4-AMINOPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from 4-aminophenylboronic acid according to the procedure, of Example 60. HRMS: calcd for C23H15F3N2O, 392.1136; found (ESI, [M+H]+), 393.1206. . EXAMPLE 125 2-{4-[({3-[3-BENZYL-8-(TRI FLUOROMETH YL)QU INOLIN-4- YL]PHENYL}AMINO)METHYL]PHENYL}ACETOHYDRAZIDE The title compound was prepared from {4-[({3-[3-benzoyl-8-(trifluoromethyl)quinolin- 4-yl]phenyl}amino)methyl]phenyl} acetic acid according to the procedure of Example 92 WO 2005/058834 PCT/US2004/041399 31. MS (ESI) m/z 541; HRMS: calcd for C32H27F3N4O, 540.2137; found (ES), [M+H]+), 541.2236. EXAMPLE 126 {4-[({4-[3rBENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]PHENYL} ACETIC ACID The title compound was prepared from [4-(4-amino-phenyl)-8-methyl-quinolin-3-yl]-phenyl-methanone and (4-formyl-phenyl)-acetic acid methyl ester according to the procedure of Example 66. MS (ESI) m/z 541; MS (ESI) m/z 539. EXAMPLE 127 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2,4- DIFLUOROPHENYL) UREA The title compound was prepared from 2,4-difluorophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 546.2. EXAMPLE 128 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- FLUOROPHENYL)UREA The title compound was prepared from 2-fluorophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 528.2. EXAMPLE 129 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(4- FLUOROPHENYL)UREA The title compound was prepared from 4-fluorophenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C30H19F4N3O2, 529.1413; found (ESI, [M+H]+), 530.1506. 93 WO 2005/058834 PCT/US2004/041399 EXAMPLE 130 N-{3-t3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}-N-(4- CYANOPHENYL)UREA The title compound was prepared from 4-cyanofluorophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 535.2. EXAMPLE 131 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-[4- (METHYLTHIO)PHENYL] UREA The title compound was prepared from 4-methylthiophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 556.2. EXAMPLE 132 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QU}NOLlN-4-YL]PHENYL}-AT-(2- METHYLPHENYL)UREA The title compound was prepared from 2-methy(phenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C31H22F3N3O2, 525.1664; found (ESI, [M+H]+), 526.1735. , EXAMPLE 133 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}-AT-(2,6- DICHLOROPHENYL) UREA The title compound was prepared from 2,6-dichlorophenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C30H18Cl2F3N3O2, 579.0728; found (ESI, [M+H]+), 580.0793. EXAMPLE 134 -N-{3-t3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2,6- DIMETHYLPHENYL) UREA The title compound was prepared from 2,6-dimethylphenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C32H24F3N3O2, 539.1821; found (ESl, [M+H]+), 540.1895. 94 WO 2005/058834 PCT/US2004/041399 EXAMPLE 135 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}-N-(3- METHOXYPHENYL)UREA The title compound was prepared from 3-methoxyphenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C31H22F3N3O3, 541.1613; found (ESI, [M+H]+), 542.1719. EXAMPLE 136 N-(3-ACETYLPHENYL)-N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}UREA The title compound was prepared from 3-acetylphenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C32H22F3N3O3; 553.1613; found (ESI, [M+H]+), 554.1678. EXAMPLE 137 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-[4- (DIMETHYLAMINO) PHENYL]UREA The title compound was prepared from 4-dimethylaminophenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C32H25F3N4O2 554.5617; found (ESI, [M+H]+), 555.2007. EXAMPLE 138 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(4- NITROPHENYL)UREA The title compound was prepared from 4-nitrophenylphenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C30H19F3N4O4, 556.1358; found (ESI, [M+H]+), 557.1452. 95 WO 2005/058834 PCT/US2004/041399 EXAMPLE 139 N-{3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(4- PHENOXYPHENYL)UREA The title compound was prepared from 4-phenoxyphenyl isocyanate according to the procedure of Example; 65. HRMS: calcd for C36H24F3N3O3, 603.1770; found (ESI, [M+H]+), 604.1873. . EXAMPLE 140 N-{3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N- CYCLOHEXYLUREA The title compound was prepared from cyclohexyl isocyanate according to the -procedure of Example 65. MS (ES) m/z 516.2; EXAMPLE 141 N-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4- YL]PHENYL}AMINO)CARBONYL]BENZAMIDE The title compound was prepared from benzoyl isocyanate according to the procedure of Example 65. MS (ES) m/z 538.2. EXAMPLE 142 N-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-, YL]PHENYL}AMINO)CARBONYL] BENZENESULFONAMIDE The title compound was prepared from benzenesulfonyl isocyanate according to the procedure of Example 65. MS (ES) m/z 576. EXAMPLE 143 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(3- FLUOROPHENYL)UREA The title compound was prepared from 3-fluorophenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C30H19F4N3O2, 529.1413; found (ESI, [M+H]+), 530.1515. 96 PCT/US2004/041399 WO 2005/058834 EXAMPLE 144 N{3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-AT- BUTYLUREA The title compound was prepared from n-butyl isocyanate according to the procedure of Example 65. MS (ES) m/z 490.3. EXAMPLE 145 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}-N- BENZYLUREA The title compound was prepared from benzyl isocyanate according to the procedure of Example 65. MS (ES) m/z 524.2. EXAMPLE 146 N-ALLYL-N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}UREA The title compound was prepared from allyl isocyanate according to the procedure of Example 65. MS (ES) m/z 474.2. EXAMPLE 147 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(4- FLUOROPHENYL) THIOUREA The title compound was prepared from phenyl isothiocyanate according to the procedure of Example 65. MS (ES) m/z 544.2. EXAMPLE 148 (4-{[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}AMINO)CARBONYL]AMlNO} PHENYL)ACETlC ACID The title compound was prepared from (4-isocyanato-phenyl)-acetic acid ethyl ester according to the procedure of Example 65 followed by LiOH hydrolysis. HRMS: calcd for C32H22F3N3O4, 569.1562; found (ESI, [M+H]+), 570.1636. 97 WO 2005/058834 PCT/US2004/041399 EXAMPLE 149 (4-{[[3-(3-BENZOYL-8-METHYLQUINOLIN-4-YL)PHENYL1(METHYL)AMINO]METHYL}PHENYL) ACETIC ACID The title compound was prepared from (4-{[3-(3-benzoyl-8-methyl-quinolin-4-yl)-phenylamino]-methyl}-phenyl)-acetic acid methyl ester according to the procedure of Example 66. MS (ES) m/z 501.3. EXAMPLE 150 {4-[3-(DIMETHYLAMINO)PHENYL]-8-METHYLQUINOLIN-3- YL}(PHENYL)METHANONE The title compound was prepared from [4-(3-amino-phenyl)-8-methyl-quinolin-3-yl]-phenyl-methanone and formaldehyde according to the procedure of Example 66. MS (ES) m/z 367.3; HRMS: calcd for C25H22N2O, 366.1732; found (ESI, [M+H]+), 367.1797; Anal. Calcd for C25H22N2O: C, 81.94; H, 6.05; N, 7.64. Found: C, 81.71; H, 5.89; N, 7.56. EXAMPLE 151 [4-({[3-(3-BENZYL-8-METHYLQUINOLIN-4-YL)PHENYL]AMINO}METHYL)PHENYL]ACETICACID The title compound was prepared from [4-(3-amino-phenyl)-8-methyl-quinolin-3-yl]-phenyl-methanone and (4-formyl-phenyl)-acetic acid methyl ester according to the procedure of Example 66. MS (ES) m/z 473.3. EXAMPLE 152 PHENYL[4-(3-{[(2-PHENYLETHYL)AMINO]METHYL}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]benzaldehyde and phenethylamine according to the procedure of Example 66. MS (ES)m/z 511.3. 98 WO 2005/058834 PCT/US2004/041399 EXAMPLE 153 PHENYL[4-(3-{[(PYRIDIN-4-YLMETHYL)AMINO]METHYL}PHENYL)-8- (TRIFLUOROMETHYL) QUINOLIN-3-YL]METHANONE The title compound was prepared from 3-[3-benzoyI-8-(trifluoromethyl)quinoiin-4-yl]benzaldehyde and 4-aminopyridine according to the procedure of Example 66. MS (ES) m/z 498.2. EXAMPLE 154 [4-(3-{[(2-METHYLPHENYL)AMINO]METHYL}PHENYL)-8-(TRIFLUOROMETHYL)QUINOLlN-3-YL](PHENYL)METHANONE The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]benzaldehyde and 2-methylaniline according to the procedure of Example 66. MS (ES) m/z 497.3. EXAMPLE 155 PHENYL[4-(3-{[(TETRAHYDROFURAN-2-YLMETHYL)AMINO]METHYL}PHENYL)- 8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE The title compound was prepared from 3~[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]benzaldehyde and (tetrahydro-furan-2-yl}-methylamine according to the procedure of Example 66. MS (ES) m/z 491.2. EXAMPLE 156 [4-(3-{[(2-METHOXYBENZYL)AMINO]METHYL}PHENYL)-8-(TRIFLUOROMETHYL)QUINOLlN-3-YL](PHENYL)METHANONE The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yljbenzaldehyde and 2-methoxy-benzylamine according to the procedure of Example 66. MS (ES) m/z 527.2. 99 WO 2005/058834 PCT/US2004/04J399 EXAMPLE 157 [4-(3-{[(4-METHOXYBENZYL)AMINO]METHYL}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLIN~3-YL](PHENYL)METHANONE The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4- yljbenzaldehyde and 4-methoxy-benzylamine according to the procedure of Example 66. MS (ES) m/z 527.2. EXAMPLE 158 [4-[3-({[2-(METHYLTHIO)BENZYL]AMINO}METHYL)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 3-[3-benzoyl-8-{trifluoromethyl)quinolin-4-yl]benzaldehyde and 2-methyithio benzylamine according to the procedure of Example 66.MS (ES) m/z 543.2. EXAMPLE 159 (4-{[{3-[3-BENZYL-8-(TR(FLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(METHYL)AMINO]METHYL} PHENYL)ACETIC ACID The title compound was prepared from (4-{[3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamino]-methyl}-phenyl)-acetic acid methyl ester and formaldehyde according to the procedure of Example 66. MS (ES) m/z 541.3. EXAMPLE 160 PHENYL[4-(3-[(2-PYRlDIN-2-YLETHYL)AMINO]METHYL}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLlN-3-YL]METHANONE The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]benzaldehyde and 2-pyridin-2-yl-ethylamine according to the procedure of Example 66.MS m/z 512. 100 WO 2005/058834 PCT/US2004/041399 EXAMPLE 161 [4-(3-{[(2-METHOXYETHYL)AMINO]METHYL}PHENYL)-8-(TRlFLUOROMETHYL)QUINOUN-3-YL](PHENYL)METHANONE The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethy()quinolin-4-yl]benzaldehyde and 2-methoxy-ethylamine according to the procedure of Example 66. MS m/z 465. EXAMPLE 162 5-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}AMINO)METHYL]-2-HYDROXYBENZOIC ACID The title compound was prepared from [4-(3-Aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanoneand 4-formyl-2-hydroxy-benzoic acid according to the procedure of Example 66. MS (ESI) m/z 543. EXAMPLE 163 {3-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOUN-4- YL]PHENYL}AMINO)METHYL] PHENOXY}ACETIC ACID The title compound was prepared from [4~(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](pheny])methanone and (3-formyl-phenoxy)-acetic acid according to the procedure of Example 66. MS (ESI) m/z 557. EXAMPLE 164 {4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLlN-4- YL]PHENYL}AMINO)METHYL] PHENOXY}ACETIC ACID The title compound was prepared from [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and (4-formyi-phenoxy)-acetic acid according to the procedure of Example 66. MS (ESI) m/z 557. 101 PCTAJS2004/0-U399 WO 2005/058834 EXAMPLE 165 (2E)-3-{4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL] PHENYL}ACRYLIC ACID The title compound was prepared from [4-(3-aminophenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 3-(4-formyl-phenyl)-acrylic acid according to the procedure of Example 66. MS (ESI) m/z 553. EXAMPLE 166 PHENYL[4-(3-{[(PIPERIDIN-4-YLMETHYL)AMlNO]METHYL}PHENYL)-8- (TRIFLUOROMETHYL) QUINOLIN-3-YL]METHANONE The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]benzaldehyde and C-piperidin-4-yl-methylamine according to the procedure of Example 66. MS (ESI) m/z 504. EXAMPLE 167 {4-t({3-[3-[HYDROXY(PHENYL)METHYL]-8-(TRIFLUOROMETHYL)QUINOLlN-4- YL]PHENYL}AMINO) METHYL]PHENYL}ACETIC ACID The title compound was prepared from (4-{[3-(3-benzoyl-8-trifluoromethyl-quinolin-4-yl)-phenylamino]-methyl}-phenyl)-acetic acid according to the procedure of Example 34. MS (ES) m/z 541.2. EXAMPLE 168 ETHYL{4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}AMINO)METHYL]PHENYL}(HYDROXY)ACETATE Step 1: A mixture of (4-cyano-phenyl)-oxo-acetic acid ethyl ester 0.41 g, 2.0 mmol) in 25 mL of 90% formic acid and a large excess of Raney nickel (50% slurry in water) was refluxed for 1 hr. The solid was filtered off and the liquid was concentrated. The crude material was purified by silica gel chromatography (5 ~ 100% ethyl acetate/hexane) to give 0.35 g of (4-formyl-phenyl)-hydrbxy-acetic acid ethyl ester as an oil. Step 2: The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and (4-formyl-phenyl)-hydroxy-acetic acid ethyl 102 WO 2005/058834 PCT/US2004/041399 ester according to the procedure of step 1, Example 66. MS (ES) m/z 585.3. EXAMPLE 169 {4-[({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUiNOLIN-4-YL]PHENYL}AM1NO)METHYL]PHENYL} (HYDROXY)ACETIC ACID The title compound was prepared from ethyl {4-[({3-[3-benzoyl-8-(trifluoromethyl) quinolin-4-yl]phenyl}amino)methyl]phenyl}(hydroxy)acetate according to the procedure of step 2, Example 66. MS (ES) m/z 555.2. EXAMPLE 170 ETHYL {4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]PHENYL}(DIFLUORO)ACETATE Step 1: A mixture of (4-cyano-phenyl)-oxo-acetic acid ethyl ester 1.0 g, 4.9 mmol) in 20 mL of dichloromethane and (diethylamino)sulfur trifluoride (DAST) (1.0 g, 6.2 mmol) was stirred at r.t. for 3 hrs. The mixture was poured into iced water and extracted with ethyl acetate. The organics were dried over MgSO4 and concentrated to give crude (4-cyano-phenyl)-difluoro-acetic acid ethyl ester which was used for the reaction. Step 2: Difluoro-(4-formyl-phenyl)-acetic acid ethyl ester was prepared from (4-cyano-phenyl)-difluoro-acetic acid ethyl ester by Raney nickel reduction. Step 3: The title compound was prepared from [4-(3-amino-phenyl)-8-trifluorornethyl-quinolin-3-yl]-phenyl-methanone and difluoro-(4-formyl-phenyl)-acetic acid ethyl ester according to the procedure of step 1, Example 66. MS (ES) m/z 605.3. EXAMPLE 171 {4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}AMINO)METHYL]PHENYL} (DIFLUORO)ACETIC ACID The title compound was prepared from ethyl {4-[({3-[3-benzoyl-8-(trifluoromethyl) quinolin-4-yl]phenyl}amino)methyl] phenyl}(difluoro)acetate according to the procedure of step 2, Example 66. MS (ES) m/z 575.2. 103 WO 2005/058834 PCT/US2004/041399 EXAMPLE 172 . [4-({[3-(3-BEMZOYL-8-CHLOROQUINOLIN-4-YL)PHENYL]AMINO}METHYL)PHENYL]ACETICACID The title compound was prepared from [4-(3-amino-phenyl)-8-chloro-quinolin-3-yl]-phenyl-methanone and (4-formyl-phenyl)-acetic acid methyl ester according to the . procedure of Example 66. MS (ESI) m/z 507. EXAMPLE 173 [3-({[3-(3~BENZOYL-8-CHLOROQUINOLIN-4-YL)PHENYL]AMINO}METHYL)PHENYL]ACETIC ACID The title compound was prepared from [4-(3-amino-phenyl)-8-chloro-quinolin-3-yl]-phenyl-methanone and (3-formyl-phenyl)-acetic acid methyl ester according to the procedure of Example 66. MS (ESI) m/z 507. EXAMPLE 174 {3-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMlNO)METHYL]PHENYL} ACETIC ACID The title compound was prepared from ethyl (3-{[3-(3-benzoyl-8-trifluoromethyl-quinolin-4-yl)-phenylamino]-rnethyl}-phenyl)-acetate according to the procedure of Example 31. MS (ESI) m/z 527; MS (ESI) m/z 525. EXAMPLE 175 (3-{[(3-{8-CHLORO-3-[HYDROXY(PHENYL)METHYL]QUINOLIN-4- YL}PHENYL)AMINO]METHYL} PHENYL)ACETIC ACID The title compound was prepared from [4-({[3-(3-benzoyl-8-chloroquinolin-4-yl)phenyl]amino}methyl)phenyl]acetic acid according to the procedure of Example 34. MS m/z 509. 104 WO 2005/058834 PCT/US2004/041399 EXAMPLE 176 (4-{[(3-{3-[HYDROXY(PHENYL)METHYL]-8-METHYLQUINOLIN-4- YL}PHENYL)AMINO]METHYL} PHENYL)ACETIC ACID The title compound was prepared from (4-{[3-(3-benzoyl-8-methyl-quinolin-4-yl)-phenylamino]-methyl}-phenyl)-acetic acid according to the procedure of Example 34. MS m/z 489. EXAMPLE 177 [4-({[3-(3-BENZYL-8-CHLOROQUINOLIN-4- YL)PHENYL]AMINO}METHYL)PHENYL]ACET[CACfD The title compound was prepared from ethy) (3-{[3-(3-benzoyl-8-chloroquinolin-4-yl)-phenylamino]-methyl}-phenyl)-acetate according to the procedure of Example 31. MS (ESI) m/z 493. EXAMPLE 178 2-{4-[({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMlNO)METHYL]PHENYL}-2-METHYLPROPANOICACID The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin- 3-yl]-phenyl-methanone and 2-(4-formyl-phenyl)-2-methyl-propionic acid methyl ester according to the procedure of Example 66. MS m/z 569; MS m/z 567. EXAMPLE 179 2-{4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]PHENYL}-2-METHYLPROPANOlC ACID . The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yrj-prrenyl-methandne and 2-(4-formyl-phenyl)-propionic acid methyl ester according to the procedure of Example 66. HRMS: calcd for C34H29F3N2O2, 554.2181; found (ESI, [M+H]+), 555.2247. 105 WO 2005/058834 PCT/US2004/041399 EXAMPLE 180 2-{4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMlNO)METHYL]PHENYL} PROPANOIC ACID The title compound was prepared from [4-(3-amino~phenyl)-8-trifluorornethyl-quinolin-3-yl]-phenyl-methanone and 2-(4-formyl-phenyl)-propionic acid methyl ester according to the procedure of Example 66. MS (ESI) m/z 555. EXAMPLE 181 2-{4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}AMINO)METHYL]PHENYL} PROPANOIC ACID The title compound was prepared from 2-{4-[({3-[3-benzoyl-8- (trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}propanoic acid methyl eater according to the procedure of Example 31. MS (ESI) m/z 541. EXAMPLE 182 -N-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)CARBONYL]-4-METHYLBENZENESULFONAMIDE The title compound was prepared from 4-methyl-benzenesulfonyl isocyanate according to the procedure of Example 65. MS (ESI) m/z 590; MS (ESI) m/z 588. EXAMPLE 183 -N-[({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)CARBONYL]-2-CHLOROBENZENESULFONAMIDE The title compound was prepared from 2-chloro-benzenesulfonyl isocyanate according to the procedure of Example 65. MS (ESI) m/z 608. EXAMPLE 184 N-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)CARBONYL]-4-FLUOROBENZENESULFONAMIDE The title compound was prepared from 4-fluoro-benzenesulfonyl isocyanate according to the procedure of Example 65. MS (ESI) m/z 594. 106 WO 2005/058834 PCT/US2004/041399 EXAMPLE 185 -N-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)CARBONYL]-4-CHLOROBENZENESULFONAMIDE The title compound was prepared from 4-chloro-benzenesulfonyl isocyanate according to the procedure of Example 65. MS (ESI) m/z 610. EXAMPLE 186 4-[4-({3~[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}AMINO)PHENYL]BUTANOIC ACID The title compound was prepared from 3-[3-benzoyl-8-(trifluorornethyl)quinolin-4-yl]benzaldehyde and 4-(4-amino-phenyl)-butyric acid according to the procedureof Example 66. MS (ES) m/z 567.0. EXAMPLE 187 3-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}AMINO)PHENYL]PROPANOIC ACID The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinoIin-4-yl]benzaldehyde and 3-(4-amino-phenyl)-propionic acid. MS (ES) m/z 552.9. EXAMPLE 188 AT-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}--N-METHYL- -N-PHENYLUREA The title compound was prepared from N-methyl-N-phenylcarbamoyl chloride according to the procedure of Example 65. MS (ES) m/z 523.9. EXAMPLE 189 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-METHYL- N-PHENYLUREA Step 1: A solution of [4-(3-amino-phenyl)-8-triffuoromethyl-quinolin-3-yl]-phenyl-rnethanone (100 mg) and dimethyl sulfate (150 mg) in ethanol was stirred at r.t. for 4 hrs. The solution was concentrated and purified by semi-HPLC to give [4-(3-methylamino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone as a gum. 107 WO 2005/058834 PCT/US2004/041399 Step 2: The title compound was prepared from [4-(3-methylamino.-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-metrianone and phenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 524.0. EXAMPLE 190 4'-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]-1,1'-BIPHENYL-2-CARBOXYL|C ACID The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and (4'-formyI-biphenyl-2-yl)-acetic acid according to the procedure of Example 66. MS (ES) m/z 600.9. EXAMPLE 191 {4'-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]-1,1'-BIPHENYL-4-YL}ACETIC ACID The title compound was prepared from [4-(3-arnino-phenyl)-8-trifluorornethyl-quinolin-3-yl]-phenyl-methanone and (4'-formyl-biphenyl-4-yl)~acetic acid according to the procedure of Example 66. MS (ES) m/z 617.2. EXAMPLE 192 4'-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]-1,1'-BIPHENYL-4-CARBOXYLIC ACID -The title compound was prepared from [4-(3-arnino-phenyl)-8-trifluoromethyl-quinoIin-3-yl]-phenyl-methanone and 4'-formyl-biphenyl-4-carboxylic acid according to the procedure of Example 66. MS (ES) m/z 600.9. EXAMPLE 193 4'-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AM(NO)METHYL]-1,1'-BlPHENYL-3-CARBOXYLIC ACID . The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and (4'-formyl-biphenyl-3-yl)-acetic acid according to the procedure of Example 66. MS (ES) m/z 600.9. 108 WO 2005/058834 PCT/US2004/041399 . EXAMPLE 194 [4-{3-[(1,1-BlPHENYL-4-YLMETHYL)AMINO]PHENYL}-8~ (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yrj-phenyl-methanone and biphenyl-4-carbaldehyde according to the-procedure of Example 66. MS (ES) m/z 559.2. EXAMPLE 195 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-,-N- DIETHYLUREA The title compound was prepared from diethyl carbamoy] chloride according to the procedure of Example 65. MS (ES) m/z 489.9. EXAMPLE 196 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL|PHENYL}MORPHOLlNE-4-CARBOXAMIDE The title compound was prepared from 4-morphoIinecarbamoyl chloride according to the procedure of Example 65. MS (ES) m/z 503.9; HRMS: calcd for C28H22F3N3O3, 505.1613; found (ESI, [M+H]+), 506.1691; Anal. Calcd for C28H22F3N3O3: C, 66.53; H, 4.39; N, 8.31. Found: C, 66.29; H, 4.09; N, 7.99. EXAMPLE 197 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLlN-4- YL]PHENYL}PYRROLIDINE-1-CARBOXAMIDE The title compound was prepared from 1-pyrrolidinecarbamoyl chloride according to the procedure of Example 65. MS (ES) m/z 487.9. EXAMPLE 198 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-N- DIMETHYL-N-PHENYLUREA The title compound was prepared from N-methyl-N-phenylcarbamoyl chloride according to the procedure of Example 65. MS (ES) m/z 540.1. 109 WO 2005/058834 PCTAJS2004/041399 EXAMPLE 199 4-{4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}AMINO)METHYL]-3-METHOXYPHENOXY}BUTANOIC ACID The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 4-(4-formyl-3-methoxy-phenoxy)-butyric acid according to the procedure of Example 66. MS (ESI) m/z 613. EXAMPLE 200 N-[4-({3-t3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}AMINO)BEN2OYL]-BETA-ALANINE The title compound was prepared from 3-[3-benzoyl-8-(trifluorornethyl)quinolin-4-yl]benzaldehyde and 3-(4-amino-benzoylamino)-propionic acid according to the procedure of Example 66. MS (E:S) m/z 595.9. EXAMPLE 201 3-[3-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}AMlNO)PHENYL]PROPANOICACID The title compound was prepared from 3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]benzaldehyde and 3-(3-3mino-phenyl)-propionic acid according to the procedure of Example 66. HRMS: calcd for C33H25F3N2O3, 554.1817; found (ESI, [M+H]+), 555.1881. EXAMPLE 202 PHENYL[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLlN-4- YL]PHENYL}AMlNO)CARBONYL]CARBAMATE The title compound was prepared from phenyl isocyanatoformate according to the procedure of Example 65. MS (ESI) m/z 556. 110 WO 2005/058834 PCT/US2004/041399 EXAMPLE 203 3-[3-({3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}OXY)PHENYL]PROPANOICACID The title compound was prepared from [3-(3-benzyl-8-trifluoromethyl~quinolin-4-yl)-phenyl]-methanol and 3-(3-hydroxy-phenyl)-propionic acid methyl ester according to the procedure of Example 69. MS (ESI) m/z 542. EXAMPLE 204 N-{3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- CHLOROPHENYL)UREA The title compound was prepared from 2-chlorophenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C30H19C1F3N3O2, 545.1118; found (ESI, [M+H]+), 546.1206. EXAMPLE 205 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}-N-(2- ETHYLPHENYL)UREA The title compound was prepared from 2-ethylhenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C32H24F3N3O2, 539.1821; found (ESI, [M+H]+), 540.1913. EXAMPLE 206 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2,3- DICHLOROPHENYL)UREA The title compound was prepared from 2,3-dichlorophenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C30H18C12F3N3O2, 579.0728; found (ESI, [M+H]+), 580.0815. EXAMPLE 207 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}-N-[2- (TRIFLUOROMETHYL) PHENYL]UREA The title compound was prepared from 2-trifluoromethylphenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C31H19F6N3O2, 579.1381; found 111 WO 2005/058834 PCT/US2004/041399 (ESI, [M+H]+), 580.1436. EXAMPLE 208 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}-N-[2- (TRlFLUOROMETHOXY)PHENYL]UREA The title compound was prepared from 2-trifluoromethoxyphenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C31H19F6N3O3, 595.1331; found (ESI, [M+H]+), 596.1426. EXAMPLE 209 N-{3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-yV-(2- ISOPROPYLPHENYL)UREA The title compound was prepared from 2-isopropylphenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C33H26F3N3O2, 553.1977; found (ESI, [M+H]+), 554.2071. EXAMPLE 210 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-5,6,7,8- TETRAHYDRONAPHTHALEN-1-YLUREA The title compound was prepared from 1-isocyanato-5,6,7,8-tetrahydronaphthalene according to the procedure of Example 65. MS (ESI) m/z 566. EXAMPLE 211 (2S,3S)-3-{4-[({3-r3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]PHENYL}-3-HYDROXY-2-METHYLPROPANOIC ACID The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 3-(4-formyl-phenyl)-3-hydroxy-2-methyl-proplonic acid according to the procedure of Example 66. MS (ES) m/z 583.0. 112 WO 2005/058834 PCT/US2004/041399 EXAMPLE212 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- METHOXYPHENYL)UREA The title compound was prepared from 2-methoxypheny] isocyanate according to the procedure of Example 65. MS (ES) m/z 539.8. EXAMPLE 213 N-{3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QU)NOLIN-4-YL]PHENYL}-N-[2- FLUORO-3-(TRIFLUOROMETHYL)PHENYL]UREA The title compound Was prepared from 2-fluoro-3-trifluoromethyl-phenyl isocyanate according to the procedure of Example 65. MS (ESI) m/z 598. EXAMPLE 214 3-[4-({3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOUN-4- YL]BENZYL}OXY)PHENYL]PROP-2-YNOIC ACID The title compound was prepared from [3-(3-benzyl-8-trifluoromethyI-quinoIin-4-yl)-pheny)]-methanol and (4-hydroxymethyl-phenyl)-propynoic acid methyl ester according to the procedure of Example 69. MS (ESI) m/z 538. EXAMPLE 215 (5Z)-5-{4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMlNO)METHYL]BENZYLlDENE}-1-THIAZOLlDlNE-2,4-DIONE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 4-(2,4-dioxo-thiazolidin-5-ylidenemethyl)-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 607.8. EXAMPLE 216 2-[4-({[3-(3-BENZOYL-8-METHYLQUlNOLIN-4- YL)PHENYL]AMlNO}METHYL)PHENYL]-3-PHENYLPROPANOICACID A, mixture of (4-{[3-(3-benzoyl-8-methyl-quinolin-4-yl)-phenylamino]-methyl}-phenyl)-acetic acid (0.04 g, 0.08 mmol), benzyl bromide (0.12 g, 0.8 mmol), and cesium carbonate (0.33 g, 1 mmol) in 5 mL of DMF was stirred at room temperature for 2 h. The reaction was quenched with water and extracted with ethyl acetate. The 113 WO 2005/058834 PCT/US2004/041399 combined organics were washed with water, dried over magnesium sulfate and concentrated. The crude ester was treated with LiOH followed by semi-preparative HPLC purification to give the title compound. MS (ESI) m/z 577. EXAMPLE 217 N-{3-[3-BENZYL-8-(TRIFLUOROIVlETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- FLUOROPHENYL)UREA The title compound was prepared from 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-fluorophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 513.9. EXAMPLE 218 N-{3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- CHLOROPHENYL)UREA The title compound was prepared from 3-(3-benzyi-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-chlorophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 529.8. EXAMPLE 219 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- BROMOPHENYL)UREA The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 2-bromophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 587.8. EXAMPLE 220 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}-N-(2- IODOPHENYL)UREA The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 2-iodophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 635.7. 114 WO 2005/058834 PCT/US2004/041399 EXAMPLE 221 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-2- PH EN YLACETAMIDE The title compound was prepared from [4-(3-amino-phenyl)-8-trif)uoromethyl-quinolin- 3-yl]-phenyl-methanone and phenyl-acetyl chloride according to the procedure of Example 61. MS (ES) m/z 508.9. : EXAMPLE 222 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-2-(2- FLUOROPHENYL) ACETAMIDE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 2-fluorophenyl-acetyl chloride according to the procedure of Example 61. MS (ES) m/z 526.8. EXAMPLE 223 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-2-(2- CHLOROPHENYL) ACETAMIDE The title compound was prepared from [4-(3-aminb-phenyl)-8-trifluoromethyl-quinoiin-3-yl]-phenyl-methanone and 2-chlorophenyl-acetyl chloride according to the procedure of Example'61. MS (ES) m/z 542.8. EXAMPLE 224 ETHYL 4-{[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)CARBONYL]AMlNO}BENZOATE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 4-lsocyanato-benzoic acid ethyl ester according to the procedure of Example 65. HRMS: calcd for C33H24F3N3O4, 583.1719; found (ESI, [M+H]*), 584.1801. 115 WO 2005/058834 PCT/US2004/041399 EXAMPLE 225 4-{[({3-[3-BENZOYL-8-(TRI FLUOROIVIETH YL)QU I NOLI N-4-YL]PHENYL}AMINO)CARBONYL]AM1NO} BENZOIC ACID The title compound was prepared from ethyl 4-{[({3-[3-benzoyl-8-(trifiuoromethyl) quinolin-4-yl]phenyl}amino)carbonyl] amino}benzoate by hydrolysis with LIOH. HRMS: calcd for C31H26F3N3O4, 555.1406; found (ESI, [M+H]+), 556.1495. EXAMPLE 226 N-{3-[3-BENZOYL-8-(TR{FLUOROMETHYL)QUINOLIN-4-YL]PHENYL}UREA The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quiholin-3-yl]-phenyl-methanone and trimethylsilyl isocyanate according to the procedure of Example 65. HRMS: calcd for C24H16F3N3O2, 435.1195; found (ESI, [M+H]+), 436.1258. EXAMPLE 227 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2,6- DlFLUOROPHENYL)UREA The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 2,6-difluorophenyl isocyanate according to the procedure of Example 65. HRMS: calcd for C30H18F5N3O2, 547.1319; found (ESI, [M+H]+). 548.1425. EXAMPLE 228 5-{4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}AMINO)METHYL] BENZYLlDENEZ}-2-THIOXO-1.3-THIAZOLIDIN-4- ONE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 4-(4-oxo-2-thioxo-thiazolidin-5-ylidenemethyl)-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 623.8. 116 WO 2005/058834 PCT/US2004/041399 EXAMPLE 229 5-{4-[({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOHN-4-YL]PHENYL}AMINO)METHYL] BENZYLIDENE}-3-METHYL-2-THIOXO-1,3- THlAZOLIDIN-4-ONE The title compound was prepared from [4-(3-amino-phenyO-S-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 4-(3-methyl-4-oxo-2-thioxo-thiazolidin-5-ylidenemethyl)-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 637.9. EXAMPLE 230 3-ALLYL-5-{4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL}QUlNOLlN-4-YL]PHENYL}AMINO)METHYL]BENZYLIDENE}-2-THIOXO-1,3-THlAZOLIDIN-4- ONE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 4-(3-allyl-4-oxo-2-thioxo-thiazolidin-5-ylidenemethyl)-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 663.8. EXAMPLE 231 PHENYL-N-S-tS-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YLlPHENYL}-N- CYANQIMIDOCARBAMATE A mixture of diphenyl cyanocarbonimidate (0.6 g, 2.52 mmol) and [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone (0.1 g, 0.26 mmol) in 30 mL of acetonitrile was refluxed for 3 days. Removal of solvent under reduced pressure gave a crude product that was purified by silica gel chromatography eluting with ethyl acetate/ hexanes (5% to 30%) to give 65 mg (47%) of the title compound as an off-white solid. MS (ES) m/z 534.9. EXAMPLE 232 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- NITROPHENYL)UREA The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 2-nitrophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 554.8. 117 WO 2005/058834 PCT/US2004/041399 EXAMPLE 233 N-(2-AMlNOPHENYL)-N-{3-[3-[HYDROXY(PHENYL)METHYL]-8- (TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}UREA The title compound was prepared from N-{3-[3-benzoyl-8-(trifluoromethyl)quino)in-4-yl]phenyl}-N-(2-nitrophenyl)urea by hydrogenation (Pd/C, 5 psi of H2). MS (ES) m/z 526.9. EXAMPLE 234 N-(2-AMINOPHENYL)-AT-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}UREA The title compound was prepared from -N-{3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}-N-(2-nitrophenyl)urea by Zinin reduction (Na2S/NH4C1). MS (ES) m/z 524.9. EXAMPLE 235 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- CHLOROPHENYL) THIOUREA The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 2-chlorophenyl isothiocyanate according to the procedure of Example 65. MS (ES) m/z 559.8. EXAMPLE 236 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- CHLOROPHENYL) GUANIDIME A mixture of N-{3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}-N-(2-chlorophenyl)thiourea (0.07g, 0.12 mmol), lead(IV) acetate (0.30g, 0.68 mmol) in 10 mL of ethanol/28% ammonium hydroxide (1/1) was heated to reflux for 30 minutes. Removal of solvents under reduced pressure gave a crude product that was purified by preparative thin layer chromatography with ethyl acetate as the developing solvent to give 52 mg (71%) of the title compound as an off-white solid. MS (ES) m/z 542.8. 118 PCT/US2004/041399 WO 2005/058834 EXAMPLE 237 PHENYL[4-THlEN-2-YL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL3METHANONE The title compound was prepared from 2-thiopnene boronic acid according to the procedure of Example 60. MS (ESI) m/z 384; HRMS: calcd for C21H12F3NOS, 383.0592; found (ESI, [M+H]+), 384.0645. EXAMPLE 238 PHENYL[4-TH(EN-3-YL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE The title compound was prepared from 3-thiopnene boronic acid according to the procedure of Example 20. MS (ESI) m/z 384; HRMS: calcd for C21H12F3NOS, 383.0592; found (ESI, [M+H]+), 384.0634. EXAMPLE 239 [4-(4-ETHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from 4-ethylphenyl boronic acid according to the procedure of Example 20 step 2. MS (ESI) m/z 406; HRMS: calcd for C25H18F3NO, 405.1340; found (ESI, [M+H]+), 406.1382. EXAMPLE 240 [4-(3-FLUOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YLJ(PHENYL)METHANONE The title compound was prepared from 3-fluorophenyl boronic acid according to the procedure of Example 60. MS (ESI) m/z 396; HRMS: calcd for C23H13F4NO, 395.0933; found (ESI, [M+H]+), 396.098. EXAMPLE 241 [4-(3-CHLORO-4-FLUOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from 3-chloro-4-fluorophenyl boronic acid according to the procedure of Example 60. HRMS: calcd for C23H12C1F4NO, 429.0544; found (ESI, [M+H]+), 430.0606. 119 PCT/US2004/041399 WO 2005/058834 EXAMPLE 242 1-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}ETHANONE The title compound was prepared from 3-ethanonephenyl boronic acid according to the procedure of Example 60. MS (ESI) m/z 420. EXAMPLE 243 [4-[4-(DIMETHYLAMINO)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from 4-dimethylaminophenyl boronic acid according to the procedure of Example 60. MS (ESI) m/z 421; HRMS: calcd for C25H19F3N2O, 420.1449; found (ESI, [M+H]+), 421.1538. EXAMPLE 244 [4-(3-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from 3-methylphenyl boronic acid according to the procedure of Example 60. HRMS: calcd for C24H16F3NO, 391.1184; found (ESI, [M+H]+), 392.127. EXAMPLE 245 [4-[3-(DIMETHYLAMINO)PHENYL]-8-(TRIFLUOROMETHYL)QUlNOLlN-3- YL](PHENYL)METHANONE The title compound was prepared from 3-dimethylarninophenyl boronic acid according to the procedure of Example 60. HRMS: calcd for C25H19F3N2O, 420.1449; found (ESI, [M+H]+), 421.1524. EXAMPLE 246 [4-(3,4-DIFLUOROPHENlYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from 3,4-difluorophenyl boronic acid according to the procedure of Example 60. MS (ESI) m/z 414; HRMS: calcd for C23H12F5NO, 413.0839; found (ESI, [M+H]+), 414.0907. 120 WO 2005/058834 PCT/US2004/041399 EXAMPLE 247 [4-(3-NITROPHENYL)-8-(TRiFLUOROMETHYL)QUINOLIN-3- YL]( PHENYL)METH ANONE The title compound Was prepared from 3-nitrophenyl boronic acid according to the procedure of Example 60. MS (ESI)jm/z 423; HRMS: calcd for C23H13F3N2O3, 422.0878; found (ESI, [M+H]+), 423.0955. EXAMPLE 248 [4-(3,5-DIFLUOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE To (4-chloro-8-trifluoromethyl-quinoline-3-yl)-phenyl-methanone (150 mg, 0.448 mmol), 3,5-difluorophenyl boronic acid (141 mg, 0.895 mmol), tetrakis(triphenylphosphine) palladium (52 rng, 0.045 mmol), sodium carbonate (50 mg, 1.41 mmol) in water (750 ml), glyme (2 rnl), and ethanol (350 ml), was subjected to micro wave conditions (140°C, 300 watts, 300 sec). The resulting dark red-brown mixture was filtered concentration in vacuo. Reverse phase gradient HPLC (CH3CN, H2O) afforded the title compound as a yellow powder (88 mg, 48%). MS (ESI) m/z 414; HRMS: calcd for C23H12F5NO, 413.0839; found (ESI, [M+H]+), 414.0911. EXAMPLE 249 3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]BENZONITRILE The title compound was prepared from 3-cyanophenyl boronic acid according to the procedure of Example 248. MS (ESI) m/z 403; HRMS: calcd for C24H13F3N2O, 402.0980; found (ESI, [M+H]+), 403.1048. EXAMPLE 250 4-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]BENZONITRILE The title compound was prepared from 4-cyanophenyl boronic acid according to the procedure of 248. MS (ESI) m/z 403; HRMS: calcd for C24H13F3N2O, 402.0980; found (ESI, fM+H]+), 403.1046. 121 WO 2005/058834 PCT/US2004/041399 EXAMPLE 251 [4-(1-NAPHTHYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YLJ(PHENYL)METHANONE The title compound was prepared from 1-naphthyl boronic acid according to the procedure of Example 248. MS (ESI) m/z 428; HRMS: calcd for C27H16F3NO, 427.1184; found (ESI, [M+H]+), 428.1255. EXAMPLE 252 [4-(2-FURYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 3-furyl boronic acid according to the procedure of Example 248. MS (ESI) m/z 368; HRMS: calcd for C21H12F3NO2, 367.0820; found (ESI, [M+H]+), 368.0876. EXAMPLE 253 [4-[3-(ETHYLSULFONYL)PHENYL]-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from 3-ethylsulfonylphenyl boronic acid according to the procedure of Example 248. MS (ESI) m/z 470; HRMS: calcd for C25H18F3NO3S, 469.0959; found (ESI, [M+H]+), 470.1054. EXAMPLE 254 PHENYL[4-PYRIDIN-3-YL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE The title compound was prepared from 4-pyridin-3-yl boronic acid according to the procedure of Example 248. MS (ESI) m/z 379; HRMS: calcd for C22H13F3N2O, 378.0980; found (ESI, [M+H]+), 379.1046. EXAMPLE 255 PHENYL[4-PYRIDIN-4-YL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE The title compound was prepared from 4-pyridin-4-yl boronic acid according to the procedure of Example 248. MS (ESI) m/z 379; HRMS: calcd for C22H13F3N2O, 378.0980; found (ESI, [M+H]+), 379.1044. 122 WO 2005/058834 PCT/US2004/041399 EXAMPLE 256 PHENYL[4-PYRIMlDIN--5-YL-8-(TRlFLUOROMETHYL)QUINOUN-3- YL]METHANONE The title compound was prepared from 4-pyridin-5-yI boronic acid according to the procedure of Example 248. MS (ESI) m/z 380; HRMS: calcd for C21H12F3N3O, 379.0932; found (ESI, [M+H]+). 380.0999. EXAMPLE 257 PHENYL[4-{3-[(THIEN-3-YLMETHYL)AMINO]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLlN-3-YLlMETHANONE The title compound was prepared from tbiophene-3-carbaldehyde according to the procedure of Example 66. MS (ESI) m/z 489; HRMS: calcd for C28H19F3N2OS, 488.1170; found (ESI, [M+H]+), 489.1226. EXAMPLE 258 PHENYL[4-{3-[(PYRIDIN-3-YLIVIETHYL)AMINO]PHENYL}-8- (TRIFLUOROMETHYL)QUlNOLIN-3-YL]METHANONE The title compound was prepared from pyridine-3-carbaIdehyde according to the procedure of Example 66. MS (ESI) m/z 484; HRMS: calcd for C29H20F3N3O, 483.1558; found (ESI,[M+H]+), 484.1611. EXAMPLE 259 [4-(3-AM INOPH ENYL)-8-METH YLQ UIN OLIN-3-YL](PH EN YL)METHANONE The title compound was prepared from 3-aminophenyl boronic acid according to the procedure of Example 60. MS (ESI) m/z 339; HRMS: calcd for C23H18N2O, 338.1419; found (ESI, [M+H]+), 339.1487. EXAMPLE 260 PHENYL[4-{3~[(PYRIDlN-2-YLMETHYL)AMINO]PHENYL}-8- (TRIFLUOROMETHYL)QUlNOL1N-3-YL] METHANONE The title compound was prepared from pyridine-2-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 484.2; HRMS: calcd for C29H20F3N3O, 483.1558; found (ESI, [M+H]+), 484.1643. 123 WO 2005/058834 PCT/US2004/041399 EXAMPLE 261 PHENYL[4-{3-[(PYRIDIN-4-YLMETHYL)AMINO]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE The title compound was prepared from pyridine-4-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 482.2; HRMS: calcd for C29H20F3N3O, 483.1558; found (ESI, [M+H]+), 484.1641. EXAMPLE 262 [4-{3-[(2,5-DIFLUOROBENZYL)AMINO]PHENYL}-8- (TRIFLLJOROMETHYL)QUINOLIN-3-YL](PHENYL) METHANONE .. The title compound was prepared from 2,5-difluorophenyl carbaldehyde according to the procedure of Example 66. MS (ES) m/z 517.2; HRMS: calcd for C30H19F5NzO, 518.1418; found (ESI, [M+H]+), 519.1492. EXAMPLE 263 [4-{3-[(2-FLUOROBENZYL)AMlNO]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL](PHENYL) METHANONE The title compound was prepared from 2-fluorophenyl carbaldehyde according to the procedure of Example 66. MS (ES) m/z 499.2; HRMS: calcd for C30H20F4N2O, 500.1512; found (ESI, [M+H]+), 501.1593. EXAMPLE 264 [4-{3-[(2-FURYLMETHYL)AMINO]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL) METHANONE The title compound was prepared from 2-furyl carbaldehyde according to the procedure of Example 66. MS (ES) m/z 473.2; HRMS: calcd for C28H19F3N2O2, 472.1399; found (ESI, [M+H]+), 473.1483. 124WO 2005/058834 PCT/US2004/041399 EXAMPLE 265 [4-{3-[(2-FURYLMETHYL)(3-FURYLMETHYL)AMINO]PHENYL}-8- (TRIFLU0R0METHYL)QU)N0LIN-3-YL](PHENYL)METHAN0NE The title compound was prepared from 2-furyl carbaldehyde according to the procedure of Example 66. MS (ES) m/z 553.2; HRMS: caicd for C33H23F3N2O3, 552.1661; found (ESI, [M+H]+), 553.1754. EXAMPLE 266 [4-{3-[(3-FLUOROBENZYL)AMINO]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL](PHENYL) METHANONE The title compound was prepared from 3-f(uorophenyl carbaldehyde according to the procedure of Example 66. MS (ES) m/z 501.2; HRMS: calcd for C30H20F4N2O, 500.1512; found (ESI, [M+H]+), 501.1591. EXAMPLE 267 [4-{3-[(2-CHLOROBENZYL)AMINO]PHENYLh8-(TRlFLUOROMETHYL)QUINOLIN- 3-YL](PHENYL) METHANONE The title compound was prepared from 2-chlorophenyl carbaldehyde according to the procedure of Example 66. MS (ES) m/z 515.3; HRMS: calcd for C30H20C1F3N2O, 516.1216; found (ESI, [M+H]+), 517.131. EXAMPLE 268 PHENYL[4-{3-[(1,3-THIAZOL-2-YLMETHYL)AMlNO]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL] METHANONE The title compound was prepared from thiazole-2-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 488.2; HRMS: calcd for C27H18F3N3OS, 489.1123; found (ESI, [M+H]+), 490.1197. 125 WO 2005/058834 PCT/US2004/041399 EXAMPLE 269 [4-(3-AMlNO-4-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOL(N-3- YL](PHENYL)METHANONE The title compound was prepared from 3-amino-4-methylphenyl boronic acid according to the procedure of Example 60. MS (ES) m/z 407.2; HRMS: calcd for C24HUF3N2O, 406.1293; found (ESI, [M+H]+), 407.1346. EXAMPLE 270 ETHYL {3-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMJNO)METHYL]PHENYL}ACETATE The title compound was prepared from (3-formylphenyl)acetic acid ethyl ester according to the procedure of Example 66. MS (ES) m/z 567.3; HRMS: calcd for C34H27F3N2O3, 568.1974; found (ESI, [M+H]+), 569.2058. EXAMPLE 271 {3-[({3-t3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL] PHENYL} ACETIC ACID The title compound was prepared from (3-forrjnylphenyl)acetic acid ethyl ester according to the procedure of Example 66. MS (ESI) m/z 541; MS (ESI) m/z 539; HRMS: calcd for C32H23F3N2O3, 540.1661; found (ESI, [M+H]+), 541.1732. EXAMPLE 272 [4-{3-[(3-NITROBENZYL)AMINO]PHENYL}-8-(TRIFLUOROMETHYL)QUtNOLIN-3- YL](PHENYL) METHANONE The title compound was prepared from 3-nitrophenylcarbaldehyde according to the procedure of Example 66. MS (ESI) m/z 528; HRMS: calcd for C30H20F3N3O3, 527.1457; found (ESI, [M+H]+), 528.1519. 126 WO 2005/058834 PCT/US2004/041399 EXAMPLE 273 [4-{3-[(3-METHYLBENZYL)AM(NO]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YLKPHENYL) METHANONE The title compound was prepared from 3-methylphenylcarbaldehyde according to the procedure of Example 66. MS (ESI) m/z 497; MS (ESI) m/z 495; HRMS: calcd for C31H23F3N2O, 496.1762; found (ESI, [M+H]+), 497.1817. EXAMPLE 274 [4-(3-AMINOPHENYL)-8-CHLOROQUINOLIN-3-YLKPHENYL)METHANONE The title compound was prepared from 3-aminophenyl boronic acid according to the procedure of Example 60. MS (ES) m/z 359.2; HRMS: calcd for C22H15C1N2O, 358.0873; found (ESI, [M+H]+), 359.0965. EXAMPLE 275 [4-{3-[(4-ISOPROPYLBENZYL)AMINO]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL) METHANONE The title compound was prepared from 4-isopropylphenylcarbaldehyde according to the procedure of Example 66. MS m/z 525; HRMS: calcd for C33H27F3N2O, 524.2075; found (ESI, [M+H]+), 525.2142. EXAMPLE 276 [4-(3-{[(5-CHLOROTHIEN-2-YL)METHYL]AMINO}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 5-chloro-2-thiophenecarbaldehyde according to the procedure of Example 66. MS (ES) m/z 521.1; HRMS: calcd for C28H18C1F3N2OS, 522.0780; found (ESI, [M+H]+), 523.0862. EXAMPLE 277 [4-{3-[(2,4-DICHLOROBENZYL)AMINO]PHENYL}-8- (TRIFLUOROMETHYL)QUlNOLlN-3-YL](PHENYL) METHANONE The title compound was prepared from 2,4-dichlorophenylcarbaldehyde according to the procedure of Example 66. MS (ES) m/z 549.1; HRMS: calcd for CsoHigC1zFs^O, 550.0827; found (ESI, jM-Hr), 549.0757. 127 WO 2005/058834 PCT/US2004/041399 EXAMPLE 278 PHENYL[4-{3-[(THiEN-2-YLMETHYL)AMINO]PHENYL}-8- (TRlFLUOROMETHYL)QUlNOLlN-3-YL3 METHANONE The title compound was prepared from 2-thiophenecarbaldehyde according to the procedure of Example 66. MS (ES) m/z 489.2; HRMS: calcd for C28H19F3N2OS, 488.1170; found (ESI, [M+H]+), 489.1266l EXAMPLE 279 [4-(3-{[(4,5-DlMETHYL-2-FURYL)METHYL]AMINO}PHENYL)-8- (TRIFLUOROMETHYL)QUlNOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 4,5-dimethylfurylcarbaldehyde according to the procedure of Example 66. MS (ES) m/z 501.2; HRMS: calcd for C30H23F3N2O2, 500.1712; found (ESI, [M+H]+), 501.1803. EXAMPLE 280 [4-[3-(ETHYLAM)NO)PHENYL]-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from acetaldehyde according to the procedure of Example 66. MS (ESI) m/z 420; HRMS: calcd for C25H19F3N2O, 420.1449; found (ESI, [M+H]+), 421.1521. EXAMPLE 281 PHENYL[4-{3-[(3-PHENYLPROPYL)AMINO]PHENYL}-8-(TRIFLUOROMETHYL)QUINOUN-3-YL] METHANONE The title compound was prepared from 3-phenylpropylcarbaldehyde according to the procedure of Example 66. MS (ESI) m/z 511; HRMS: calcd for C32H25F3N2O, 510.1919; found (ESI, [M+H]+), 511.1988. 128 WO 2005/058834 PCT/US2004/041399 EXAMPLE 282 PHENYL[4-{3-[(2-PHENYLETHYL)AMINO]PHENYL}-8-(TRIFLUOR0METHYL)QUINOLIN-3-YL]METHAN0NE The title compound was prepared from phenethylcarbaldehyde according to the procedure of Example 66. MS (ESI)| m/z 497; HRMS: calcd for C31H23F3N2O, 496.1762; found (ESI, [M+H]+), 497.1835. j EXAMPLE 283 [4-{3-[(1H-IMIDAZOL-2-YLMETHYL)AM(NO]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 1 H-imidazole-2-carbaldehyde according to the procedure of Example 66. MS (ESI) m/z 473; MS (ESI) m/z 471; HRMS: calcd for C27H19F3N4O, 472.1511; found (ESI, [M+H]+), 473.1581. EXAMPLE 284 [4-(3-{[(4-METHYL-1H-IMIDAZOL-5-YL)METHYL]AMlNO}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 5-methyl-3H-imidazole-5-carbaldehyde according to the procedure of Example 66. MS (ESI) m/z 486; HRMS: calcd for C28H21F3N4O, 487.496; found (ESI, [M+H]+), 488.499. EXAMPLE 285 PHENYL(8-(TRIFLUOROMETHYL)-4-{3-[(3- VINYLBENZYL)AMINO]PHENYL}QUINOLIN-3-YL)METHANONE The title compound was prepared from 3-ethyienephenyl-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 509.2; HRMS: calcd for C32H23F3N2O, 508.1762; found (ESI, [M+H]+), 509.183. 129 WO 2005/058834 PCTAJS2004/041399 EXAMPLE 286 PHENYL[8-(TRIFLUOROMETHYL)-4-(3-{[3- (TRIFLUOROMETHYL)BENZYL]AMINO}PHENYL)QUINOLlN-3-YL]METHANONE The title compound was prepared from 3-trifluoromethylphenyl-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 549.2; HRMS: calcd for C31H20F6N2O, 550.1480; found (ESI, [M+H]+), 551.1533. EXAMPLE 287 [4-{3-[(3-METHOXYBENZYL)AMlNO]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 3-methoxyphenyl-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 513.2; HRMS: calcd for C31H23F3N2O2, 512.1712; found (ESI, [M+H]+), 513.1804. EXAMPLE 288 [4-{3-[(3-CHLOROBENZYL)AMINO]PHENYL}-8-(TRIFLUOROMETHYL)QU(NOLIN- 3-YL](PHENYL) METJHANONE The title compound was prepared from 3-chlorophenyl-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 517.1; HRMS: calcd for C30H20C1F3N2O, 516.1216; found (ESI, [M+H]+), 517.1285. EXAMPLE 289 [4-(3-{[4-(2-HYDROXYETHYL)BENZYL]AMINO}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 4-(2-hydroxyethyl)-phenyl-carbaldehyde according to the procedure of Example 66. MS (ESI) m/z 527; HRMS: calcd for C32H25F3N2O2, 526.1868; found (ESI, [M+H]+), 527.1954. EXAMPLE 290 [4-(3-AMINOPHENYL)-8-FLUOROQUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 3-aminophenyl boronic acid according to the procedure of Example 60. HRMS: calcd for C22H15FN2O, 342.1168; found (ESI, [M+H]*). 343.1241. 130 WO 2005/058834 PCT/US2004/041399 EXAMPLE 291 [4-({[3-(3-BENZOYL-8-FLUOROQUlNOLIN-4-YL)PHENYL]AMINO}METHYL)PHENYL]ACETICAClD The title compound was prepared from 4-formylbenzoic acid according to the procedure of Example 66. HRMS: calcd for C31H23FN2O3, 490.1693; found (ESI, [M+H]+), 491.1758. EXAMPLE 292 3-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]BENZONlTRILE The title compound was prepared from 3-formylbenzonitrile according to the procedure of Example 66. MS (ESI) m/z 508; HRMS: calcd for C31H20F3N3O, 507.1558; found (ESI, [M+H]+), 508.163. EXAMPLE 293 3-{4-[({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QU)NOLIN-4-YL]PHENYL}AMINO)METHYL]PHENYL} PROPANOIC ACID The title compound was prepared from 3-(4-formyl-phenyl)-propionic acid according to the procedure of Example 66. MS (ES) m/z 553.1; HRMS: calcd for C33H25F3N2O3, 554.1817; found (ESI, [M+H]+), 555.1888. EXAMPLE 294 [4-({[3-(3-BENZOYLQUINOLIN-4-YL)PHENYL]AMINO}METHYL)PHENYL]ACETIC ACID The title compound was prepared from 3-(4-formyl-phenyl)-acetic acid according to the procedure of Example 66. MS (ES) m/z 471.1; HRMS: calcd for C31H24N2O3, 472.1787; found (ESI, [M+H]+), 473.1867. 131 WO 2005/058834 PCT/US2004/041399 EXAMPLE 295 [4-{3-[(4-HYDROXYBENZYL)AMINO]PHENYL}-8--(TRIFLUOROMETHYL)QUINOLlN-3-YL](PHENYL)METHANONE The title compound was prepared from 4-hydroxybenzaldehyde according to the procedure of Example 66. MS (ES) m/z 497.1; HRMS: calcd for C30H21F3N2O2, 498.1555; found (ESI, [M+H]+), 499.1651. EXAMPLE 296 [4-(3-{[4-(HYDROXYMETHYL)BENZYL]AMINO}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from 4-hydroxymethylbenzaldehyde according to the procedure of Example 66. MS (ES) m/z 513.2; HRMS: calcd for C31H23F3N2O2, 512.1712; found (ESI, [M+H]+), 513.1772. EXAMPLE 297 N-[3-(3-BENZOYL-8-CHLOROQUINOLIN-4-YL)PHENYL]-N'-(2,6- DlCHLOROPHENYL)UREA The title compound was prepared from 2,6-dichiorophenylisocyanate according to the procedure of Example 65. MS m/z 546; HRMS: calcd for C29H18Cl3N3O2, 545.0465; found (ESI, [M+H]+), 546.0533. EXAMPLE 298 N-[3-(3-BENZOYL-8-CHLOROQUINOL)N-4-YL)PHENYL]'N'-PHENYLUREA The title compound was prepared from phenylisocyanate according to the procedure of Example 65. MS m/z 478; HRMS: calcd for C29H20C1N3O2, 477.1244; found (ESI, [M+H]+), 478.1312. EXAMPLE 299 N-{3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'- PHENYLUREA The title compound was prepared from phenylisocyanate according to the procedure of Example 65. MS (ES) m/z 498.2; HRMS: calcd for C30H22F3N3O, 497.1715; found {ESI, [M+H]+), 498.1775. 132 WO 2005/058834 PCT/US2004/041399 EXAMPLE 300 N-{3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'-(2,6- DIMETHYLPHENYL)UREA The title compound was prepared from 2,6-dimethylphenylisocyanate according to the procedure of Example 65. MS (ES) m/z 524.9; HRMS: calcd for C32H26F3N3O, 525.2028; found (ESI, [M+H]+), 526.2091. EXAMPLE 301 N-{3-f3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N1-(2,6- DICHLOROPHENYL)UREA The title compound was prepared from 2,6-dichlorophenylisocyanate according to the procedure of Example 65. MS (ES) m/z 563.8; HRMS: calcd for C30H20C12F3N3O, 565.0935; found (ESI, [M+H]+), 566.0988. EXAMPLE 302 2-METHOXYPHENYL{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}CARBAMATE The title compound was prepared from 2-methoxyphenylchloroformate according to the procedure of Example 65. MS (ES) m/z 543.1; HRMS: calcd for C31H21F3N2O4, 542.1453; found (ESI, [M+H]+), 543.1505. EXAMPLE 303 4-METHOXYPHENYL{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}CARBAMATE The title compound was prepared from 4-methoxyphenylchloroformate according to the procedure of Example 65. MS (ES) m/z 540.9; HRMS: calcd for C31H21F3N2O4, 542.1453; found (ESI, [M+H]+), 543.1536. 133 WO 2005/058834 PCT/US2004/041399 EXAMPLE 304 4-METHYLPHENYL{3-[3-BENZOYL-8 The title compound was prepared from 4-methylphenylchloroformate according to the procedure of Example 65. MS (ES) m/z 527.2; HRMS: calcd for C31H21F3N2O3, 526.1504; found (ESI, [M+H]+), 527.1578: EXAMPLE 305 3-(TRIFLUOROMETHYL)PHENYL{3-[3-BENZOYL-8- (TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL} CARBAMATE The title compound was prepared from 3-trifluoromethylphenylchloroformate according to the procedure of Example 65. MS m/z 581; HRMS: calcd for C31H18F6N2O3, 580.1222; found (ESI, [M+H]+), 581.1281. EXAMPLE 306 N-[3-(3-BENZOYL-8-CHLOROQUINOLIN-4-YL)PHENYL]-N'-(2,6- DIMETHYLPHENYL)UREA The title compound was prepared from 2,6-dimethylphenylisocyanate according to the . procedure of Example 65. MS (ES) m/z 506.1; HRMS: calcd for C31H24C1N3O2, 505.1557; found (ESI, [M+H]+), 506.1624. EXAMPLE 307 [8-CHLORO-4-(3-HYDROXYPHENYL)QUINOLlN-3-YL](PHENYL)METHANONE The title compound was prepared from 3-hydroxyphenyl boronic acid according to the procedure of Example 60. MS (ESI) m/z 360; MS (ESI) m/z 358; HRMS: calcd for CaHuC1NOa. 359.0713; found (ESI, [M+H]+), 360.0776. EXAMPLE 308 (8-CHLORO-4-{3-[(4-FLUOROBENZYL)OXY]PHENYL}QUIN0LIN-3- YL)( PH ENYL)METH ANONE The title compound was prepared from 4-fluorobenzylbromide according to the procedure of Example 43. MS (ESI) m/z 468; HRMS: calcd for C29H19C1FNO2, 467.1088; found (ESI, [M+H]+), 468.1151. 134 WO 2005/058834 PCT/US2004/041399 EXAMPLE 309 (8-CHLORO-4-{3-[(2-FLUOROBENZYL)OXY]PHENYL}QUINOLIN-3- YL)(PHENYL)METHANONE The title compound was prepared from 2-fluorobenzylbromide according to the procedure of Example 43. MS (ESI) m/z 468; HRMS: calcd for C29H19C1FNO2, 467.1088; found (ESI, [M+H]+), 468.1159; Anal. Calcd for C29H19C1FNO2: C, 74.44; H, 4.09; N, 2.99. Found: C, 74.25; H, 4.05; N, 2.69. EXAMPLE 310 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'-(3- CHLORO-4-FLUOROPHENYL)UREA The title compound was prepared from 3-chloro-4-fluorophenylisocyanate according to the procedure of Example 65. MS (ES) m/z 561.9; HRMS: calcd for C30H18C1F4N3O2, 563.1024; found (ESl, [M+H]+), 564.1091. EXAMPLE 311 N-{3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'-(3,4- DIFLUOROPHENYL) UREA The title compound was prepared from 3,4-difluorophenylisocyanate according to the procedure of Example 65. MS (ES) m/z 545.9; HRMS: calcd for C30H18F5N3O2, 547.1319; found (ESI, [M+H]+), 548.1396. EXAMPLE 312 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'-(3,4,5- TRIMETHOXY PHENYL)UREA The title compound was prepared from 3,4,5-trimethoxyphenylisocyanate according to the procedure of Example 65. MS (ES) m/z 600.0; HRMS: calcd for C33H26F3N3Os, 601.1825; found (ESI, [M+H]+), 602.1904. 135 WO 2005/058834 PCT/US2004/041399 EXAMPLE 313 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'-(2- PHENYLETHYL)UREA The title compound was prepared from phenethylisocyanate according to the procedure of Example 65. MS (ES) m/z 538.0; HRMS: calcd for C32H24F3N3O2, 539.1821; found (ESI, [M+H]+), 540.1898. EXAMPLE 314 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUiNOLIN-4-YL]PHENYL}-N'-(2- THIEN-2-YLETHYL)UREA The title compound was prepared from 2-(2-isocyantoethyl)-thiophene according to the procedure of Example 65. MS (ES) m/z 543.9; HRMS: calcd for C30H22F3N3O2S, 545.1385; found (ESI, [M+H]+), 546.1476. EXAMPLE 315 N-{3-[3-BENZOYL-8-(TR)FLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'-(5- PHENYLTHlEN-2-YL)UREA The title compound was prepared from 2-isocyanto-5-phenyl-thiophene according to the procedure of Example 65. MS (ES) m/z 591.9; HRMS: calcd for C34H22F3N3O2S, 593.1385; found (ESI, [M+H]+), 594.1453. EXAMPLE 316 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}-N'-THIEN-3- YLUREA The title compound was prepared from 3-isocyantothiophene according to the procedure of Example 65. MS (ES) m/z 515.9; HRMS: calcd for C28H18F3N3O2S, 517.1072; found (ESI, [M+H]+), 518.1152. WO 2005/058834 PCT/US2004/041399 EXAMPLE 317 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'-THIEN-2- YLUREA The title compound was prepared from 2-isocyantothiophene according to the procedure of Example 65. MS (ES) m/z 515.9; HRMS: calcd for C28H18F3N3O2S, 517.1072; found (ESI, [M+H]+), 518.1161. EXAMPLE 318 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}-N'-(3,5- DIMETHYLISOXAZOL-4-YL)UREA The title compound was prepared from 4-lSocyanto-3,5-dimethylisoxazole according to the procedure of Example 65. MS (ES) m/z 529.0; HRMS: calcd for C29H21F3N4O3, 530.1566; found (ESI, [M+H]+), 531.1649. EXAMPLE 319 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N'-(5- METHYL-3-PHENYL ISOXAZOL-4-YL)UREA The title compound was prepared from 4-isocyanto-5-methyl-3-phenylisoxazole according to the procedure of Example 65. MS (ES) m/z 591.0; HRMS: calcd for C34H23F3N4O3, 592.1722; found (ESI, [M+H]+), 593.1812. EXAMPLE 320 N-2,1,3-BENZOTHIADIAZOL-4-YL-N'-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}UREA The title compound was prepared from 4-isocyantobenzo[1,2,5]thiadiazole according to the procedure of Example 65. MS (ES) m/z 567.9; HRMS: calcd for C30H18F3N5O2S, 569.1133; found (ESI, [M+H]+), 570.1184. 137 WO 2005/058834 PCT/US2004/041399 EXAMPLE 321 [4-[(3-HYDROXYBENZYL)AMINO]-8~(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE PHENYLlSOXAZ0L-4-YL)UREA The title compound was prepared from (3-hydroxyphenyl)methyl boronic acid according to the procedure of Example 60. MS (ESI) m/z 423; HRMS: calcd for C24H17F3N2O2, 422.1242; found (ESI, [M+H]+), 423.132. EXAMPLE 322 4-{[3-(3-BENZOYL-8-CHLOROQUINOLlN-4-YL)PHENOXY]METHYL}BENZOIC ACID The title compound was prepared from 4-bromomethyIbenzoic acid ethyl ester according to the procedure of Example 43. MS (ES) m/z 494.1; HRMS: calcd for C30H20C1NO4, 493.1081; found (ESI, [M+H]+), 494.1151. EXAMPLE 323 PHENYL{3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUlNOLlN-4- YL]PHENYL}CARBAMATE The title compound was prepared from phenylchloroformate according to the procedure of Example 65. MS (ES) m/z 513.0; HRMS: calcd for C30H19F3N2O3, 512.1348; found (ESI, [M+H]+), 513.1406. EXAMPLE 324 3-{3-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4 YL]PHENYL}AMINO)METHYL]PHENYL PROPANOIC ACID The title compound was prepared from 3-(3-formylphenyl)-propionic acid ethyl ester according to the procedure of Example 66. MS (ES) m/z 552.9; HRMS: calcd for C33H25F3N2O3, 554.1817; found (ESI, [M+H]+), 555.1868. 138 „„„. PCT/US2004/041399 WO 2005/058834 EXAMPLE 325 3-{4-[({3-[3-BENZYL-8-(TRIFLUdROMETHYL)QUINOLlN-4-YL]PHENYL}AMINO)METHYL]PHENYL} PROPANOIC ACID The title compound was prepared from 3-(4-formylphenyl)-propionic acid according to the procedure of Example 66. MS (ES) m/z 538.9; HRMS: calcd for C33H27F3N2O2, 540.2025; found (ESI, [M+H]+), 541.2115. EXAMPLE 326 {4-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}AMINO)METHYL]PHENYL} ACETIC ACID The title compound was prepared from 4-formylphenyl acetic acid according to the procedure of Example 66. MS (ES) m/z 552.9; HRMS: calcd for C33H25F3N2O3, 554.1817; found (ESI, [M+H]+), 555.1894. EXAMPLE 327 , 2-FURYL[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3-YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 2-furylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 368. EXAMPLE 328 (4-BROMO-2-FURYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 4-brorno-2-furylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 446. EXAMPLE 329 3-FURYL[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 3-furylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 368; HRMS: calcd for C21H12F3NO2 + H, 368.08984; found (ESI, [M+H]+), 368.0887. 139 WO 2005/058834 PCT/US2004/041399 EXAMPLE 330 (3-BROMO-2-FURYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 3-bromo-2-furytmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 446; HRMS: calcd for C21H11BrF3NO2, + H, 446.00035; found (ESI, [M+H]+), 445.9997. EXAMPLE 331 (3-METHYLTHIEN-2-YL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 3-methyl-2-thienylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESi) m/z 398; HRMS: calcd for C22H14F3NOS, + H, 398.08264; found (ESI, [M+H]+), 398.0811. EXAMPLE 332 (4-ETHYLPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 4-ethylphenylmagnesium bromide for 2-methyiphenylmagnesium bromide. MS (ESI) m/z 406; HRMS: calcd for C25H18F3NO + H, 406.14187; found (ESI, [M+H1+), 406.1407. EXAMPLE 333 (4-FLUOROPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 4-fluorophenylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 396; HRMS: calcd for C23H13F4NO + H, 396.10115; found-(ESI, [M+H]+), 396.1012. 140 WO 2005/058834 PCT/US2004/041399 EXAMPLE 334 (4-CHLOROPHENYL)[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLlN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 4-chlorophenylmagnesium bromide for 2-methylphenylmagnesium bromide. MS m/z 412; HRMS: calcd for C23H13C1F3NO + H, 412.07160; found (ESI, [M+H]+), 412.0696. EXAMPLE 335 BlS(4-CHLOROPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLIN-3- YL]METHANOL This compound is prepared according to the procedure of Example 21, substituting excess 4-chlorophenylmagnesium bromide for 2-methylphenylmagnesium bromide. MS m/z 524; MS m/z 522; HRMS: calcd for C29H18C12F3NO - H, 522.06393; found (ESI, [M-H]-), 522.0651. EXAMPLE 336 (4-AMINOPHENYL)[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL]METHANONE (4-Fluorophenyf)[4-phenyl-8-(trif(uoromethyl)quinolin-3-yl]methanone (0.631 g, 1.60 mmol) and ammonium hydroxide (9 mL) are heated in a steel pressure vessel at 150°C overnight. The cooled reaction is poured into water, extracted with methylene chloride, and concentrated in vacuo. The resulting solid into DMSO (2 mL) and ammonium hydroxide (8 mL) is heated in the steel bomb at 150°C overnight and worked up as above. The product is purified by chromatography eluting with 30:70 ethyl acetate:hexane to yield the title compound as a solid (0.344 g). MS (ESI) m/z 393; HRMS: calcd for C23H15F3N2O - H, 391.10582; found (ESI, [M-H]-), 391.1054. EXAMPLE 337 (4-NITROPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE (4-Aminophenyl)[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone (0.050 g, 0.127 mmol) in AcOH (2 mL) is added slowly to a stirred solution of NaBO3 4H2O (0.098 g, 0.637 mmol) in AcOH (3 mL) at 55°C over 40 min. After 1 h, the reaction is cooled, 141 WO 2005/058834 PCT/US2004/041399 poured into water and extracted with methylene chloride. The extracts are washed with saturated aq sodium bicarbonate, dried I over MgSO4 and concentrated. The residue is purified by chromatography eluting with 10:90 ethyl acetaterhexane to afford the title compound (0.0157 g). MS (ESI) m/z 423; HRMS: calcd for C23H13F3N2O3 + H, 423.09565; found (ESI, [M+H]+), 423.0943. EXAMPLE 338 [4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3-YL][4- (TRIFLUOROMETHYL)PHENYL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 4-trifluorornethylphenylmagnesiurn bromide for 2-methy)phenylmagnesium bromide. MS (ESI) m/z 446; HRMS: calcd for C24H13F6NO + H, 446.09796; found (ESI, [M+H]+), 446.0962. EXAMPLE 339 (4-METHOXYPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 4-methoxyphenylmagnesium bromide for 2-methylphenylmagnesium bromide. MS (ESI) m/z 408.1193; HRMS: calcd for C24H16F3NO2 + H, 408.12114; found (ESI, [M+H]+), 408.1193. EXAMPLE 340 (4-BROMOPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE (4-Aminophenyl)[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone (0.121 g, 0.31 mmol) in acetonitrile (5 mL) is added dropwise to a stirred solution of tert-butyl nitrite (0.055 mL, 0.46 mmol) and CuBr2 (0.083 g, 0.372 mmol) in acetonitrile (5 mL) at 65°C. After 2 h, the reaction is poured into 2N aq HCI, extracted with methylene chloride, and the extracts washed once with,2N aq HCI. The extracts are dried over MgSO4l concentrated in vacuo, and chromatographed eluting with 2.5:97.5 ethyl acetate:hexane to afford the title compound as a white solid (0.092 g). MS (ESI) m/z 142 WO 2005/058834 PCT/US2004/041399 456.0199; HRMS: calcd for C23H13BrF3NO + H, 456.02108; found (ESI, [M+H]+), 456.0199. EXAMPLE 341 (4-HYDROXYPHENYL)[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3- YLJMETHANONE (4-Methoxyphenyl)[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone (0.174 g) and pyridine hydrochloride are heated at 200°C for 2 h and then cooled. The resulting solid is taken into methylene chloride and 2N aq HC1. The layers are separated, the aqueous layer is extracted again, and the combined organics are washed with saturated sodium bicarbonate and dried over MgSO4. The residue is chromatographed eluting with 25:75 ethyl acetate: hexane to afford the title compound as a white solid (0.132 g). MS (ES) m/z 392.1; HRMS: calcd for C23H14F3NO2 - H, 392.08984; found (ESI, [M-H]-), 392.0883. EXAMPLE 342 [4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3-YL](4- VINYLPHENYL)METHANONE This compound is prepared according to the procedure of Example 21, substituting 4-vinylphenylmagnesium bromide for 2-methylphenylmagnesium bromide MS (ES) m/z 404.2; HRMS: calcd for C25H16F3NO + H, 404.12622; found (ESI, [M+H]+), 404.1245. EXAMPLE 343 (2-HYDROXYPHENYL)[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL]METHANONE (2-Methoxyphenyl)[4-phenyl-8-(trifluoromethyl)quinolin-3-yl3methanone (0.853 g, 2.09 mmol) and pyridine hydrochloride are heated at 200°C for 4 h. The reaction is worked up and purified as in Example above except eluting with 10:90 ethyl acetate:hexane to afford the title product as white solid (0.669 g, 81%). MS (ESI) m/z 392.0901; HRMS: calcd for C23H14F3NO2 - H, 392.08984; found (ESI, [M-H]-), 392.0901. 143 WO 2005/058834 PCT/US2004/041399 EXAMPLE 344 1-[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]PENTAN-1-ONE This compound is prepared according to the procedure of Example 21, substituting butylmagnestum bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C21H18F3NO + H, 358.14187; found (ESI, [M+H]+), 358.141. EXAMPLE 345 1-[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]HEXAN-1-ONE This compound is prepared according to the procedure of Example 21, substituting pentylmagnesium bromide for 2-methyiphenylmagnesium bromide. HRMS: calcd for C22H20F3NO + H, 372.15752; found (ESI, [M+H]+), 372.1574. EXAMPLE 346 CYCLOPROPYL[4-PHENYL-8-(TRlFLUOROMETHYL)QUlNOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting cyclopropylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C20H14F3NO + H, 342.11057; found (ESI, [M+H]+), 342.1118. EXAMPLE 347 CYCLOPENTYL[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting cyclopentylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C22H18F3NO + H, 370.14187; found (ESI, [M+H]+), 370.141. EXAMPLE 348 (3-FLUOROPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 3-fluorophenylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C23H13F4NO + H, 396.10115; found (ESI, [M+H]+), 396.0993. 144 PCT/US2004/041399 WO 2005/058834 EXAMPLE 349 (3-CHLOROPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YLJMETHANONE This compound is prepared;according to the procedure of Example 21, substituting 3-chlorophenylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C23H13ClF3NO + H, 412.07160; found (ESI, [M+H]+), 412.0713. EXAMPLE 350 (4-CHLORO-3-FLUOROPHENYL)[4-PHENYL.-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YLjMETHANONE This compound is prepared according to the procedure of Example 21, substituting 4-chloro-3-fluorophenylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C23H12C1F4NO + H, 430.06218; found (ESI, [M+H]+), 430.0606. EXAMPLE 351 (3,4-DICHLOROPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE . This compound is prepared according to the procedure of Example 21, substituting 3,4-dichlorophenylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C23H12C12F3NO + H, 446.03263; found (ESI, [M+H]+), 446.0332. EXAMPLE 352 (4-CHLORO-2-METHYLPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 4-chloro-2-rnethylphenylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C24H15C1F3NO + H, 426.08725; found (ESI, [M+H]+), 426.0859. 145 WO 2005/058834 PCT/US2004/041399 EXAMPLE 363 (3-FLUORO-2-METHYLPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 3-fluoro-2-methylphenylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C24H15F4NO + H, 410.116801 found (ESI, [M+H]+), 410.1158. EXAMPLE 354 (3-FLUORO-4-METHYLPHENYL)[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN- 3-YL]METHANONE This compound is prepared according to the procedure of Example 21, substituting 3-fluoro-4-methylphenylmagnesium bromide for 2-methylphenylmagnesium bromide. HRMS: calcd for C24H15F4NO + H, 410.11680; found (ESI, [M+H]+), 410.117. EXAMPLE 355 3-[DIMETHOXY(PHENYL)METHYL]-4-PHENYL-8~ (TRIFLUOROMETHYL)QUINOLINE Phenyl[4-phenyl-8-(trifluoromethyl)quinoIin-3-yl]methanone (0.210 g, 0.56 mmol) in MeOH (5 mL) is refluxed with trimethyiorthoformate (0.12 mL, 1.12 mmol) and para- toluenesulfonic acid (0.005 g). After 5 h, additional orthoformate (0.20 mL) is added. After 3 h more, more orthoformate (0.20 mL) is added. After refluxing overnight, the reaction is cooled and treated with NaOMe in methanol (0.5 mL). After 10 min of stirring, the reaction is concentrated and the residue chromatographed eluting with 5:95 ethyl acetate: hexanes to afford the title compound as a white solid (0.100 g). MS (ESI) m/z 424; HRMS: calcd for C25H20F3NO2 + H, 424.15244; found (ESI, [M+H]+), 424.1519. EXAMPLE 356 4-PHENYL-3-(1-PHENYLVINYL)-8-(TRIFLUOROMETHYL)QUINOLINE 1-Phenyl-1-[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]ethanol (0.675 g, 1.72 mmol) in EtOH (13 mL) is refluxed with cone HC1 (2.6 mL) for 2 h. The cooled reaction is poured into water and extracted with methylene chloride. The extract is washed with saturated aq sodium bicarbonate, dried (MgSO4) and concentrated. The residue is chromatographed eluting with 5:95 ethyl acetate:hexane to afford the title compound 146 WO 2005/058834 PCT/US2004/041399 as a yellow solid (0.546 g, 85%). MS (ESI) m/z 376; HRMS: calcd for C24H16F3N + H, 376.13131; found (ESI, [M+H]+), 376.1306. ; ' EXAMPLE 357 4-PHENYL-3-(1-PHENYLETHYL)-8-(TRlFLUOROMETHYL)QUINOLINE 4-Phenyl-3-(1-phenylvinyl)-8-(trifluoromethyl)quinoline (0.050 g, 0.133 mmol) and 5% Pd/C (0.010 g) in EtOH (7 mL) is hydrogenated on a Parr shaker (40 psi hydrogen) overnight. The reaction is filtered through Celite and concentrated. The product is chromatographed eluting with 2:98 ethyl acetate:hexanes to afford the title compound (0.051 g). MS (ESI) m/z 378; HRMS: calcd for C24H18F3N + H, 378.14696; found (ESI, [M+H]+), 378.1459 EXAMPLE 358 (Z)-(2-HYDROXYPHENYL)[4-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL]METHANONE HYDRAZONE (2-Hydroxyphenyl)[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone (0.05 g, 0.127 mmol) and 5% Pd/C (0.010 g) in ethylene glycol (3 mL) is heated at 120°C for 0.5 h. The cooled reaction is treated with water and the product is extracted with methylene chloride. The "dried extract (Na2SO4) and concentrated to afford the title compound (0.0318 g). MS (ESI) m/z 408.1312; HRMS: calcd for C23H16F3N3O + H, 408.13237; found (ESI, [M+H]+), 408.1312. EXAMPLE 359 3-(1,2-BENZlSOXAZOL-3-YL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE (2-Hydroxyphenyl)[4-phenyl-8-(trifluoromethyl)quinolin-3-yl]methanone (0.079 g, 0.20 mmol), hydroxylamine hydrochloride (0.053 g, 0.762 mmol) and sodium acetate trihydrate (0.138 g, 1.02 mmol) is refluxed in EtOH/H2O (5 mL of 7:3 mixture) for several hours. No reaction took place. The EtOH is removed and replaced with ethylene glycol along with more hydroxylamine hydrochloride and sodium acetate trihydrate and heated at 130°C overnight. The reaction is poured into water and extracted with methylene chloride, dried (MgSO4)'and concentrated. The residue is chromatographed eluting with 15:85 ethyl acetate:hexanes to afford the oxime intermediate as a white solid (0.075 g, 91%) The intermediate (0.066 g, 0.161 mmol) 147 WO 2005/058834 PCT/US2004/041399 and acetic anhydride (5 mL) are placed in an oil bath preheated to 130°C for 1 min. The reaction is poured into water and extracted with ethyl acetate. The extracts are washed several times with saturated aq sodium bicarbonate, dried (MgSCU) and concentrated to afford the oxime acetate intermediate (0.058 g) as a white foamy solid. The oxime acetate (0.058 g, 0.129 mmbl) is dissolved in DMF (3 mL) and treated with NaH (0.015 g, 0.378 mmoi, 60% dispersion in oil). The reaction is allowed to stir at room temperature for 1.5 h. The reaction is poured into water and extracted with ether. The extracts are washed with half-saturated brine, dried (MgSO4), and concentrated in vacuo. The residue is chromatographed eluting with 10:90 ethyl acetate:hexane to afford the title compound (0.0128 g). HRMS: calcd for C23H13F3N2O + H, 391.10582; found (ESI, [M+H]+), 391.1073. EXAMPLE 360 3-(1-METHYL-1-PHENYLETHYL)-4--PHENYL-8-(TRIFLUOROMETHYL)QUlNOLlNE 3,3-Dimethyl-3-'pheny)propionaldehyde (0.272 g, 1.67 mmoi) and [2-amino-3-(trifluoromethyl)phenyl](phenyl)methanone (0.138 g, 0.52 mmoi) are dissolved in AcOH (3 mL) and treated with 1:20 H2SO4/AcOH solution (0.10 mL). The mixture is heated in a microwave at 175°C for 15 min and a further 5 min at 200°C. The reaction is carefully poured into saturated aq sodium bicarbonate and extracted with ethyl acetate. The extracts are washed with saturated aq sodium bicarbonate and dried (MgSCU). The product is chromatographed eluting with 5:95 ethyl acetate:hexane. The partially purified is further purified using Prep HPLC with a gradient of 10-100% acetonitrile/water to afford the title compound (0.069 g). HRMS: calcd for C25H20F3N + H, 392.16261; found (ESI, [M+H]+), 392.1637. EXAMPLE 361 4-PHENYL-3-(1-PHENYLCYCLOPROPYL)-8-(TRIFLUOROMETHYL)QUINOLINE Pyridinium chlorochromate (0.417 g, 1.94 mmoi) in CH2C12 (3 mL) is treated with a mixture of 2-(1-phenylcyclopropyl)ethano) (0.157 g, 0.967 mmoi) in CH2Cl2 (2 mL) for 2 h. The reaction is filtered through Celite, treated with AcOH (3 mL) and [2-amino-3-(trifluoromethyl)phenyfj(phenyl)methanone (0.128 g, 0.484 mmoi), and the methylene chloride is removed in vacuo. Then 1:20 H2SO4:AcOH (0.1 mL) is added and the reaction is heated at 120°C for 3.5 h. The cooled reaction is poured into saturated aq 148 WO 2005/058834 PCT/US2004/041399 sodium bicarbonate and extracted with ethyl acetate. The extract is washed with saturated aq sodium bicarbonate and dried (MgSO4). The residue is chromatographed eluting with 5:95 ethyl acetate:hexane and then prep HPLC with a gradient of 10-100% acetonitrile/water to afford the title compound (0.032 g). HRMS: calcd for C25H18F3N + H, 390.14696; found (ESI, [M+M]+]+), 390.1468. EXAMPLE 362 (2-FLUOROPHENYL)[4-PHENYL-8~(TRIFLUOROMETHYL)QUINOLlN~3- YL]METHANONE 3-(2-Fluorophenyl)-3-oxopropionaldehyde (0.451 g, 2.70 mmol) and [2-amino-3-(trif(uoromethyl)phenyl](phenyl)methanone (0.119 g, 0.448 mmol) in AcOH (5 mL) is treated with 0.1 mL of 1:20 H2SO4/AcOH solution and heated at reflux for 20 min. The cooled reaction is quenched with water and extracted with ethyl acetate twice. The combined organic layers are washed with saturated aq sodium bicarbonate and dried over MgSO4. The product is purified by chromatography (5:95 ethyl acetate:hexane) to afford the title compound as a yellow solid (0.162 g, 91.5%). MS (ESI) m/z 396.1009; HRMS: calcd for C23H13F4NO + H, 396.10115; found (ESI, [M+H]+). 396.1009. EXAMPLE 363 (2-BROMOPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL]METHANONE This compound is prepared according to the procedure above substituting 3-(2-bromophenyl)-3-oxopropionaldehyde for 3-(2-fluorophenyl)-3-oxopropionaldehyde. HRMS: calcd for C23H13BrF3NO + H, 456.02108; found (ESI, [M+H]+), 456.0229. EXAMPLE 364 (2-CHLOROPHENYL)[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- YIJMETHANONE This compound is prepared according to the procedure above substituting 3-(2-chlorophenyl)-3-oxopropionaldehydefor3-(2~fIuorophenyl)-3-oxopropionaldehyde. HRMS: calcd for C23H13C1F3NO + H, 412.07160; found (ESI, [M+H]+), 412.0703. 149 WO 2005/058834 PCT/US2004/041399 EXAMPLE 365 2-[4-({3-[3-METHYL-8-(TRIFLUOROMETHYL)QUlNOUN-4- YL]PHENOXY}METHYL)PHENYL]ETHANOL To a stirred solution of 3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (0.086 g, 0.28 mmol) and 2-(4-bromomethlyphenyl)ethanol (0.061 g, 0.28 mmol) in CH2C12 (5 mL) is added Cs2CO3 (0.365 g, 1.12 mmol). After 1.5 h, additional alkylating agent (0.015 g) is added and the reaction is stirred overnight. The reaction is neutralized with 2N aq HC1, extracted with ethyl acetate and dried (MgSO4). Chromatography eluting with 5:95 ethyl acetate:hexane afforded the title compound (0.092 g, 75%). HRMS: calcd for C26H22F3NO2 + H, 438.16809; found (ESI, [M+H]+), 438.167. EXAMPLE 366 [4-({3-[3-METHYL-8-(TRIFLUOROMETHYL)QUINOUN-4- YL]PHENOXY}METHYL)PHENYL]ACETICACID 3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (1.13 g, 3.73 mmol) and 4-bromomethylphenylacetic acid (1.02 g, 4.47 mmol) in CH2C12 (60 mL) is treated with CS2CO3 (4.86 g, 14.9 mmol) and the reaction is stirred overnight. The solvent is removed and the residue dissolved in THF and 2N aq NaOH. After heating at 70°C for 1 h, the reaction is cooled and the layers separated. The aqueous layer is further extracted with ethyl acetate. The combined organics are dried (Na2SO4) and concentrated. The residue is chromatographed eluting with 20:80 ethyl acetate:hexane and then 5:95 methanol:methylene chloride to afford the title product. HRMS: calcd for C26H20F3NO3 + H, 452.14735; found (ESI, [M+H]+), 452.1452. EXAMPLE 367 [4-({3-[3-(HYDROXYMETHYL)~8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETICACID 4-Bromomethylphenylacetic actd (1.86 g, 8.13 mmol) is taken into CH2C12 (80 mL) and to this is added Cs2CO3 (9.63 g, 29.56 mmol) and the mixture is stirred for 1 hour. Next, 3-[3-(hydroxymethyl)-8-(trifluoromethyl)quinolin-4-yl]phenol (2.36 g, 7.39 mmol) is added and the reaction is stirred overnight. The reaction is not complete, therefore an additional 3 g of 4-bromomethylphenylacetic acid and 2 g of Cs2CO3 is added and stirring is continued for another overnight period. The reaction is neutralized with HC1 150 WO 2005/058834 PCT/US2004/041399 and then the solvent is removed. The resulting material is taken up into THF/MeOH/2N NaOH and heated at 70°C for 45 minutes. The reaction is neutralized with HC1 then the organics are removed and the aqueous layer is extracted with ethyl acetate. The combined organics is washed with water and brine and finally dried over Na2SO4. The resulting material is purified via column chromatography using 50% ethyl acetate in hexanes as the eluent to yield a white solid, which still contained an impurity. This material is dissolved into ethyl acetate and washed with saturated sodium bicarbonate. The ;ethyl acetate layer is concentrated to yield the desired product. HRMS: calcd for C26H20F3NO4 + H, 468.14227; found (ESI, [M+H]+), 468.1428. EXAMPLE 368 N-(4-METHYLPHENYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXAMIDE 4-Phenyl-8~trifluorpmethyl-quinoline-3-carboxylic acid (0.110 g, 0.347 mmol), whose preparation is described in Scheme 2, p-toluidine (0.074 mL, 0.693 mmol), EDC1-HC1 (0.110 g, 0.520 mmol), and DMAP (0.084 g, 0.520 mmol). are dissolved in 1,2-dichloroethane (3 mL) in a 5 mL microwave tube. After stirring in the microwave reactor for 6 min at 70°C the cooled solution is poured into 2 N aq HC1 and extracted with methylene chloride, washed with water, brine, and dried with magnesium sulfate. The combined extracts are concentrated and the residue is chromatographed in 1:9 ethyl acetate:hexanes to afford the title amide as a white solid (0.078 g, 56%). mp 203-205°C; MS (ES) m/z 405.2; HRMS: calcd for C24H17N2F3O+ H, 407.13712; found (ESI, [M+H]+), 407.1376. . EXAMPLE 369 ETHYL[4-({4-FLUORO-3-[3-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETATE The title compound is prepared essentially as described in Example 396, supra, except using 4-(2-Fluoro-5-hydroxyphenyl)-3-phenyl-8-(trifluoromethyl)quinoline instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenol to afford 0.151 g (51%) of the title compound as a tan tacky solid: Calculated mass for C33H25NF4O3 is 559.56, found MS (ES) m/z 560; (M + H)+. 151 WO 2005/058834 PCT/US2004/041399 EXAMPLE 370 N-(3-METHYLPHENYL)-4-PHENYL-8-(TRlFLUOROMETHYL)QUINOUNE-3- CARBOXAMIDE The titie compound is prepared essentially as described in Example 368, except using m-toluidine instead of p-toluidine to afford the title amide as a white solid (0.111 g, 62%). mp 182-184°C; MS (ES) mlz 405.1; HRMS: calcd for C24H17N2F3O + H, 407.13712; found (ESI, [M+H]+), 407.1385. EXAMPLE 371 4-PHENYL-8-(TRiFLUOROMETHYL)-N-[3-(TRIFLUOROMETHYL)PHENYL]QUlNOLINE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 368, except using 3-(trifluoromethyl)aniline instead of p-toluidine to afford the title amide as a tan solid (0.074 g, 60%). mp 155-157°C; MS (ES) m/z 459.1; HRMS: caicd for C24H14N2F6O + H, 461.10886; found (ESI, [M+H]+), 461.1096. EXAMPLE 372 N-(4-CHLOROPHENYL)-4-PHENYLL-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXAMIDE The title compound is prepared essentially as described in Example 368, except using 4-chloroaniiine instead of p-toluidine to afford the title amide as a tan solid (0.085 g, 62%). mp 153-155°C; MS (ES) m/z 425.1; HRMS: calcd for C23H14N2F3OC1 + H, 427.08250; found (ESI, [M+H]+), 427.0819. EXAMPLE 373 N-(3-CHLOROPHENYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUiNOLINE-3- CARBOXAMIDE The title compound is prepared essentially as described in Example 368, except using 3-chloroaniiine instead of p-toluidine to afford the title amide as a white solid (0.086 g, 70%). mp 159-161°C; MS (ES) m/z 425.1; HRMS: calcd for C23H14N2F3OC1 + H, 427.08250; found (ESI, [M+H]+), 427.0826. 152 WO 2005/058834 PCT/US2004/041399 EXAMPLE 374 N-(2-CHLOROPHENYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXAMIDE The title compound is prepared essentiallyl as described in Example 368, except using 2-chloroaniline instead of p-toluidine to afford the title amide as a white solid (0.011 g, 12%). mp 173-175°C; MS (ES) m/z 425.2; HRMS: calcd for C23H14N2F3OC1 + H, 427.08250; found (ESI, [M+H]+), 427.0829. EXAMPLE 375 N-(3-METHOXYPHENYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXAMIDE The title compound is prepared essentially as described in Example 368, except using m-anisidine instead of p-toluidine to afford the title amide as a tan solid (0.115 g, 80%). mp 141-434°C; HRMS: calcd for C23H17N2F3O2 + H, 423.13204; found (ESI, [M+H]+), 423.1315. EXAMPLE 376 N-(4-FLUOROPHENYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXAMIDE The title compound is prepared essentially as described in Example 368, except using 4-fiuoroaniline instead of p-toluidine to afford the title amide as a tan solid (0.120 g, 83%). mp 157-159°C; MS (ES) m/z 409.2; HRMS: calcd for C23H14N2F4O + H, 411.11205; found (ESI, [M+H]+), 411.1103. EXAMPLE 377 N-(3-FLUOROPHENYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXAMIDE The title compound is prepared essentially as described in Example 368, except using 3-fluoroaniline instead of p-toluidine to afford the title amide as a tan solid (0.120 g, 86%). mp 171-173°C; MS (ES) m/z 409.2; HRMS: calcd for C23H14N2F4O + H, 411.11205; found (ESI, [M+H]+), 411.1108. 153 WO 2005/058834 PCT/US2004/041399 EXAMPLE 378 N-METHYL-N,4-DlPHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXAMIDE To a solution of N,4-diphenyl-8-(trifluoromethyl)quinoline-3-carboxamide, (0.150 g, 0.382 mmol), whose preparation is described in Example 368, in DMF (20 mL) is added sodium hydride (0.010 g, 0.421 mmol). After stirring in an ice bath for 1 h, methyl iodide (0.027 mL, 0.421 mmol) is added drop wise and the reaction mixture is removed from the ice bath and stirred 2 h. The reaction mixture is partitioned between ethyl acetate and water and the aqueous layer is extracted with ethyl acetate. The combined extracts are washed with water, brine, and dried with magnesium sulfate. The extracts are concentrated and the residue is chromatographed with 1:4 ethyl acetate:hexanes to afford the title compound as a white solid (0.147 g, 96%). mp 188-190°C; MS (ESI) m/z 407; HRMS: calcd for C24H17N2F3O + H, 407.13712; found (ESI, [M+H]+), 407.1361. EXAMPLE 379 N-METHYL-N-(3-METHYLPHENYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(3-methylphenyl)-4-phenyl-8-(trifluoromethyl)quinoline-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinoline-3-carboxamide to afford the title amide as a tan solid (0.046 g, 83%). mp 174-176°C; MS (ES) m/z 421.3; HRMS: calcd for C25H19N2F3O + H, 421.15277; found (ESI, [M+H]+), 421.151. EXAMPLE 380 N-METHYL-N-(4-METHYLPHENYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLINE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(4-methylphenyl)-4-phenyl-8-(trifluoromethyl)quinoline-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinoline-3-carboxamide to afford the title amide as a white solid (0.046 g, 86%). mp 143-145°C; MS (ES) m/z 421.3; HRMS: calcd for C25H19N2F3O + H,' 421.15277; found (ESI, [M+H]+), 421.1522. 154 WO 2005/058834 PCT/US2004/041399 EXAMPLE 381 N-METHYL-N-(2-METHYLPHENYL)-4-PHENYL-8-(TRlFLU0R0METHYL)QUIN0LlNE-3-CARB0XAMIDE The title compound is prepared essentially as described in Example 378, except using N-(2-methyl0henyl)-4-phenyl-8-{trifluoromethyl)quinoIine-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinoline-3-carboxamide to afford the title amide as a tan solid (0.018 g, 23%). mp 144°C; MS.(ES) m/z 421.2; HRMS: calcd forC25H19N2F3O + H, 421.15277; found (ESI; [M+H]+), 421.1508. EXAMPLE 382 N-METHYL-4-PHENYL-8-(TRIFLUOROMETHYL)-N-[3- (TRIFLUOROMETHYL)PHENYL]QUINOLINE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(3-trifluoromethylphenyl)-4-phenyl-8-(trifluoromethyl)quinoline-3- carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinolbe-3-carboxamide to afford the amide as a white solid (0.028 g, 53%). mp 163-165°C; MS (ES) m/z 475.2; HRMS: calcd for C25H16N2F6O + H, 475.12451; found (ESI, [M+H]+), 475.1259. EXAMPLE 383 N-(4-CHLOROPHENYL)-N-METHYL-4-PHENYL-8- (TRIFLUOROMETHYL)QUlNOLINE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(4-chlorophenyl)-^-phenyl-8-(trifluoromethyl)quinoline-3-carboxamide instead I of N,4-diphenyl-8-(trifluor6methyl)quinoiine-3-carboxamide to afford the amide as a white solid (0.059 g, 73%). mp 177-179°C; MS (ES) m/z 441.2; HRMS: calcd for C24H16N2F3OC1 + H, 441.09815; found (ESI, [M+H]+), 441.0965. EXAMPLE 384 N-(3-CHLOROPHENYL)-N-METHYL-4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLINE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(3-chlorophenyl)-4-phenyJ-8-(trifluoromethyl)quinoline-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)qurnoIine-3-carboxamide to afford the amide as a 155 PCT/US2004/041399 WO 2005/058834 white solid (0.057 g, 83%). mp: 211-213oC; MS (ES) m/z 441.2; HRMS: caJcd.for C24H16N2F3OC1 + H, 441.09815; found (ESI, [M+H]+), 441.0973. EXAMPLE 385 N-(4-ETHYLPHENYL)-N-METHYL-4-PHENYL-8-(TRlFLUOROMETHYL)QUJNOL[NE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(4-ethylphenyl)-4-phenyl-8-(trifluoromethyl)quinoline-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinoline-3-carboxamide to afford the amide as a tan solid (0.042 g, 63%). mp 136-138°C; MS (ES) m/z 435.3; HRMS: calcd for C26H21N2F3O + H, 435.16842; found (ESI, [M+H]+), 435.1691. EXAMPLE 386 N-(3-ETHYLPHENYL)-N-METHYL-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLlNE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(3-ethylphenyl)-4-phenyl-8-(trifluoromethyl)quinoline-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinoline-3-carboxamide to afford the amide as a white solid (0.062 g, 63%). mp 144-146°C; MS (ES) m/z 435.3; HRMS: calcd for C26H21N2F3O + H, 435.16842; found (ESI, [M+H]+), 435.1681. EXAMPLE 387 N-(2-METHOXYPHENYL)N-METHYL-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE-3-CARBOXAMJDE The title compound is prepared essentially as described in Example 378, except using N-(2-methoxyphenyl)-4-phenyl-8-(trifluoromethyl)quinoline-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinoiine-3-carboxamide to afford the amide as a tan solid (0.014 g, 33%). mp 138°C; MS (ES) m/z 437.2; HRMS: calcd for C25H19N2F3O2 + H, 437.14769; found (ESI, IM+H]+), 437.1498. 156 WO 2005/058834 PCT/US2004/041399 EXAMPLE 388 N-(4-FLUOROPHENYL)-N-METHYL-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLlNE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(4-fluorophenyl)-4~phenyl-8~(trifluoromethyl)quinoiine-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinoline-3-carboxamide to afford the amide as a tan solid (0.061 g, 73%). mp 138-140°C; S (ES) m/z 425.2; HRMS: calcd for C24H16N2F4O + H, 425.12770; found (ESI, [M+H]+), 425.1296. EXAMPLE 389 N-(3-FLUOROPHENYL)-N-METHYL-4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLINE-3-CARBOXAMIDE The title compound is prepared essentially as described in Example 378, except using N-(3-fluorophenyl)-4-phenyl-8-(trifluoromethyl)quinoline-3-carboxamide instead of N,4-diphenyl-8-(trifluoromethyl)quinoline-3-carboxamide to afford the amide as a tan solid (0.066 g, 75%). mp 200-202°C; MS (ES) m/z 425,2; HRMS: calcd for C24H16N2F4O + H, 425.12770; found (ESI, [M+H]+), 425.1267. l EXAMPLE 390 3,4-DIPHENYL-8-(TRlFLUOROMETHYL)QUlNOLINE 1) Preparation of 8-Trifluoromethyl-quinolin-4-ol 1 (CL-78142-2): 4-Hydroxy-8- trifluoromethyl-quinoline-3-carboxylic acid (17.07 g, 66.3 mmol) is heated at reflux in Dowtherm A (106 mL) for 3 h. Upon cooling, diethyl ether is added and the dark solution is stirred 1 h, suction filtered, and isolated solid air dried to afford the title compound as a white solid (10.01 g, 72%). mp 181-183°C; MS (ESI) m/z 214; MS (ESI) m/z 212; HRMS: calcd for C10H6NF3O + H, 214.04797 ; found (ESI_FT, [M+H]1+), 214.04703. 2) Preparation of 3-Bromo-8-(trifluoromethyl)quinolin-4-ol: 8-Trifluoromethyl-quinolin- 4-ol (9.12 g, 42.8 mmol) is dissolved in acetic acid (300 mL). Bromine (2.20 mL 42.8 mmol) is dissolved in acetic acid (30 mL) and then added drop wise to the reaction over 20 min. After 0.5 h, the solution is poured into 500 mL of 2N NaOH and stirred. The white preC1pitate is filtered and dried in vacuo yielding the title compound as a white solid (10.3 g, 83%). mp 297-299°C; MS (ESI) m/z 292; MS (ESI) m/z 290; 157 WO 2005/058834 PCT/US2004/041399 HRMS: calcd for C10H5BrNF3O + H, 291.95848; found (ESI_FT, [M+H]1+), 291.95847. 3) 3-Phenyl-8-(trifluoromethyl)quinolin-4-ol: A solution of 3-bromo-8- (trifluoromethyl)quinolin-4-ol (3.2 g, 10.95 mmol) and pheny] boronic acid (2.67 g, 21.91 mmol) in 2:1 toluenermethanol (120 mL) and sat aq NaHCO3 (40 mL) is treated with Pd(PPh3)4 (760 mg) and heated at reflux overnight. The reaction is poured into water and extracted with ethyl acetate. The combined extracts are washed with 2N aq NaOH, water, brine, and dried with magnesium sulfate. The extracts are concentrated and the residue is chromatographed with 1:4 ethyl acetaterhexanes to afford the title compound as a yellow solid (6.4 g, 59%). mp 272- 275°C; MS (ESI) m/z 290;, MS (ESI) m/z 288; HRMS: calcd for C16H10NF3O + H, 290.07927; found (ESLFT, [M+H]1+), 290.07816. 4) 4-Bromo-3-phenyl-8-(trifIuoromethyl)quinoline: A stirred solution of 3-phenyl-8- (trifluoromethyl)quinolin-4-ol (0.162 g, 0.56 mmol) in DMF (5 mL) is treated with P(O)Br3 (0.452rng, 1.67 mmot) and heated at 90°C. After stirring 0.5 h, the solution is poured into 2N aq HC1 and extracted with ethyl acetate. The combined extracts are washed with water, sat aq NaHCO3, brine, dried over magnesium sulfate, and concentrated in vacuo to afford the title compound as a light orange solid (0.170 g, 86%). mp 75-77°C; MS (ESI) m/z 352; HRMS: calcd for C16H9NF3Br + H, 351.99487; found (ESI, [M+H]+), 351.9948. 5) 3,4-Diphenyl-8-(trifluoromethyl)quinoline: The title compound is prepared essentially as described in step 3, except using 4-bromo-3-phenyl~8- (trifluoromethyl)quinoline instead of 3-bromo-8-(trifluoromethyl)quinolin-4~ol to afford the title compound as a white solid (0.171 g, 82%). mp 138-140°C; MS (ESI) m/z 350; HRMS: calcd for C22H14NF3 + H, 350.11566; found (ESI, [M+H]+), 350.1143. EXAMPLE 391 3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YLlPHENOL The title compound is prepared essentially as described in 390, except in Step 5 using 3-hydroxyphenyl boronic acid instead of phenyl boronic acid to afford the title compound as a tan solid (0.075 g, 60%); mp 123°C; MS (ES) m/z 364.1; HRMS: calcd for C22H14NF3O - H, 364.09492; found (ESI, [M-H]-), 364.0936. 158 WO 2005/058834 PCT/US2004/041399 EXAMPLE 392 2-CHLORO-5-[3-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENOL The title compound is prepared essentially as described in 390, except in Step 5 using 2-chioro-3-hydroxy-phenyl boronic acid instead of phenyl boronic acid to afford the title compound as a white solid (0.031 g, 61%). mp 252°C; MS (ES) m/z 397.8; HRMS: calcd for C22H13NF3OC1 + H, 400.07160; found (ESI, [M+H]+), 400.0727. EXAMPLE 393 4-(4-CHLORO-3-METHOXYPHENYL)-3-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 390, except in Step 5 using 2-chIoro-3-methoxy phenyl boronic acid instead of phenyl boronic acid to afford the title compound as a white solid (0.031 g, 61%). mp 172-174°C; MS (ES) m/z 414,1; HRMS: calcd forC23H15NF3OCl + H, 414.08725; found (ESI, [M+H]+), 414.0863. EXAMPLE 394 4-(2-FLUORO-5-METHOXYPHENYL)-3-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 390, except in Step 5 using 4-fluoro-3-methoxy phenyl boronic acid instead of phenyl boronic acid to afford the title compound as a tacky solid (0.240 g, 65%). Calcd. mass for C22H15NF4O 397.37, found by MS (ES) m/z 397.9. EXAMPLE 395 {3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINE The title compound is prepared essentially as described in Example 390, except in Step 5 using 3-amino phenyl boronic acid instead phenyl boronic acid to afford the title compound as a white solid (0.171 g, 69%). mp 163-165°C; MS (ES) m/z 365.1; HRMS: calcd for C22H15N2F3 + H, 365.12656; found (ESI, [M+H]+), 365.1276. 159 WO 2005/058834 PCT/US2004/041399 EXAMPLE 396 ETHYL[4-({3-[3-PHENYL-8-(TRlFLUOROMETHYL)QUINOLIN- YL]PHENOXY}METHYL)PHENYL]ACETATE To a solution of 3-[3-phenyl-8-(1:rifluoromethyl)quinolin-4-yl]phenoI (0.178 g, 0.487 mmol), and potassium carbonate (0.134 g, 0.974 mmol), in DMF at 120°C is added 4-bromomethy)phenylacetic acid ethyl ester (6.334 g, 1.46 mmol), drop wise over 2 h. After an additional 2 h, the cooled reaction is poured into 2N aq HC1 and extracted with ethyl acetate. The combined extracts are washed with sat aq NaHCO3, water, brine, and dried with magnesium sulfate. The extracts are concentrated and the residue is chromatographed with 1:9 ethyl acetaterhexanes to afford the title compound as a syrup (0.051 g, 37%). MS m/z 542; HRMS: calcd for C33H26NF3O3 + H, 542.19430; found (ESI, [M+H]+), 542.194. EXAMPLE 397 METHYL[4-({3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETATE The title compound is prepared essentially as described in Example 396, except using 4-bromomethylphenylacetic acid methyl ester instead of 4-bromomethylphenylacetic acid ethyl ester to afford the title compound as a creamy tacky solid (0.066 g, 60%). Calcd mass for C32H24NF3O3 is 527.24, found MS (ES) m/z 528.2; (M + H)+. EXAMPLE 398 [4-({3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETIC ACID A solution of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenyl acetic acid ethyl ester (0.051 g, 0.10 mmol), and 2N aq NaOH (0.100 mL, 0.20 mmol), in 1:1 ethanol:THF is refluxed at 120°C for 1 h cooled and poured into 2N aq HC1. The solution is extracted with ethyl acetate. The combined extracts are washed with sat aq NaHCO3, water, brine, and dried with magnesium sulfate. The extracts are concentrated and the residue is chromatographed with 1:9 ethyl acetate:hexanes to afford the title compound as a colorless solid (0.045 g, 97%). mp 122°C; MS (ES) 160 WO 2005/058834 PCT/US2004/041399 m/z 514.2; HRMS: calcd C31H22NF3O3+ H, 514.16300; found (ESl, [M+H]+), 514.1629. EXAMPLE 399 METHYL (2E)-3-[4-({3-[3-PHENYL-8-(TRlFLUOROMETHYL)QUINOLlN-4- YL]PHENOXY}METHYL)PHENYL]ACRYLATE The title compound is prepared essentially as described in Example 396, except using 3-(4-bromomethyl-phenyl)-acrylic acid methyl ester instead of 4-bromomethylphenylacetic acid ethyl ester to afford the title compound as white solid (0.69O g, 96%). mp 91°C; Calcd mass for C32H24NF3O3 is 539.55, found MS (ES) m/z 540.2. EXAMPLE 400 2E)-3-[4-({3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL)PHENYL] ACRYLIC ACID The title compound is prepared essentially as described in Example 398, except using methyl(2E)-3-[4-({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl3phenoxy}methyl) phenylj acrylate instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenyl acetic acid ethyl ester to afford the title compound as a white solid (0.167 g, 81%). mp 229°C; Calcd mass for C32H22NF3O3 is 525.23, found MS (ES) m/z 523.8. ([M+H]-). EXAMPLE 401 ETHYL(2E)-3-t4-({2-CHLORO-5-[3-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENOXY}METHYL)PHENYL3ACETATE The title compound is prepared essentially as described in Example 396, except 2-chloro-5-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenol instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenol to afford 0.086 g (42%) of the title compound as a white solid; Calculated mass for C33H25NF3O3C1 is 576.99, found MS (ES) m/z 576; (M + H)+. 161 WO 2005/058834 PCT/US2004/041399 EXAMPLE 402 4-({2-CHLORO-5-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL)PHENYL] ACETIC ACID The title compound is prepared essentially as described in Example 398, except using ethyl 4-({2-chloro-5-[3-phenyl-8-(trifluorornethyl)quinolin-4- yl]phenoxy}methyl)phenyl]acetate instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenyl acetic acid ethyl ester to afford the title compound as a white solid (0.031 g, 61%). mp 86°C; Calcd mass for C31H21NF3O3C1 is 547.96, found MS (ES) m/z 547.9. EXAMPLE 403 METHYL (2E)-3-[4-({2-CHLORO-5-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN- 4-YL]PHENOXY}METHYL)PHENYL]ACRYLATE The title compound is prepared essentially as described in 401, except 2-chloro-5-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenol instead of 3-[3-phenyl-8-(trifiuoromethyl)quinolin-4-yl]phenoI to afford 0.127 g (52%) of the title compound as a white solid: mp 149-151 °C; Calculated mass for C33H23NF3O2C1 is 573.99, found MS (ES) m/z 573.9; (M + H)+., EXAMPLE 404 (2E)-3-[4-({2-CHLORO-5-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL) PHENYL]ACRYLIC ACID The title compound is prepared essentially as described in Example 398, except using methyl (2E)-3-[4-({2-chloro-5-[3-phenyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}methyl)phenyl]adrylate instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenyl acetic acid ethyl ester to afford title compound as a white solid (0.097 g, 61%). mp 257°C; Calcd mass for C32H21NF3O3C1 is 559.97, found MS (ES) m/z 557.8. 162 WO 2005/058834 PCTAUS2004/041399 EXAMPLE 405 ETHYL{4-[({3-[3-PHENYL-8-(TRlFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}AMINO)METHYL] PHENYL}ACETATE The title compound is prepared essentially as described in Example 396, except i using {3-[3-Phenyl-8-(trifluoromethyl)quinolin-4-yl3phenyl}amine instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenoi to afford. 0.127 g (52%) of the title compound as a yellow syrup: Calculated mass for C33H27N2F3O2 is 540.57, found MS (ES)m/z 541.2; (M + H)+. EXAMPLE 406 {4-[({3-[3-PHENYL-8-(TRIFLUGROMETHYL)QUINOLIN-4-YL]PHENYL}AM)NO)METHYL] PHENYL} ACETIC ACID The title compound is prepared essentially as described in Example 398, except using ethyl j {4-[({3-[3-phenyl-8-(trifluorornethyl)quinolin-4- yl]phenyl}amino)methyl]phenyl}acetate instead 3-[3-phenyl-8- (trifluoromethyl)quinolin-4-yl]phenyl acetic acid ethyl ester to afford the title compound as a tan tacky solid (0.021 g, 31%). Calcd mass for C31H23N2F3O2 is 512.53, found MS (ES) m/z513. EXAMPLE 407 3-PHENOXY-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE 1) 3-Phenoxy-8-(trifluoromethyl)quinolin-4-ol: A solution of 3-bromo-8-(trif)uoromethyl)quinolin-4-ol (1.28 g, 4.38 mmol), potassium phenoxide (4.24 g, 45.1 mmol), and copper powder (0.100 g, 1.61 mmol) in DMF (30 mL) is treated with CuBr (0.943 g, 6.57 mmol) and heated at reflux for 6 days. The cooled reaction is poured into 2N aq HC1 and extracted with ethyl acetate. The combined extracts are washed with sat aq NaHCO3, water, brine, and dried with magnesium sulfate. The extracts are concentrated and the residue is chromatographed with 1:9 ethyl acetate:hexanes to afford the title compound as a orange solid (0.471, 35%). mp 153-155°C; Calcd mass for C16H10NF3O2 is 305.25, found by ESI MS, 306 (M + H)+. 163 WO 2005/058834 PCT/US2004/041399 2) 4-Bromo-3-phenoxy-8-(trtfluoromethyl)quinoline: The title compound is prepared essentially as described in Example 392, step 4, except using 3-phenoxy-8- (trifluoromethyl)quinolin-4-ol instead of 3-phenyl-8-(trifluoromethyl)quinoIin-4-ol to afford the title compound as a yellow solid (0.230 g, 80%). mp 122°C; MS (ESI) m/z 368; HRMS: calcd for C16H9NF3OBr + H, 367.98978; found (ESI, [M+H]+), 367.9879. 3) 3-Phenoxy-4-phenyl-8-(trifluoromethyl)quinoline: The title compound is prepared essentially as described in Example 390 step 5, except using 4-bromo-3-phenoxy-8- (trifluoromethyl)quinoline instead of 4-bromo-3-phenyl-8-(trifluorornethy))quinoline to afford the title compound as a tacky cream colored solid (0.075 g, 71%). MS (ESI) m/z 366; HRMS: calcd for C22H14NF3O + H, 366.11057; found (ESI, [M+H]+), 366.1085. EXAMPLE 408 3-[3-PHENOXY-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound is prepared essentially as described in 407, except in step 3 using 3-hydroxy phenyl boronic acid instead of phenyl boronic acid to afford the title compound as a yellow syrup (0.066 g, 60%). Calcd mass for C16H10NF3O2 is 381.35, found MS (ES) m/z 380.0; (M + H). EXAMPLE 409 ETHYL [4-({3-[3-PHENOXY-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENOXY} METHYL)PHENYL]ACETATE The title compound is prepared essentially as described in Example 396, except using 3-[3-phenoxy~8-(trifluoromethyl)quinolin-4-yl]pheno} instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenol to afford the title compound as a tan syrup (0.066 g, 60%). Calcd mass for C33H26NF3O4 is 557.57, found MS (ES) m/z 557.9. EXAMPLE 410 [4-({3-[3-PHENOXY-8-(TRIFLUOROMETHYL)QUJNOLIN-4-YL]PHENOXY}METHYL)PHENYL] ACETIC ACID The title compound is prepared essentially as described in Example 398, except using ethyl [4-({3-[3-phenoxy-8-(trif)uoromethyl)quinolin-4- 164 WO 2005/058834 PCT/US2004/041399 yl]phenoxy}methyl)phenyl]acetate instead of 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yljphenyl acetic acid ethyl ester to afford the title compound as clear tacky solid (0.131 g, 61%). Calcd mass'for C31H22NF3O4 is 529.52, found MS (ES) m/z 529.9. i EXAMPLE 411 4-PHENYL-3-(PHENYLTHIO)-8-(TRlFLUOROMETHYL)QUINOLINE 1) 3-(Phenylthio)-8-(trifluoromethyl)quinolin-4-ol: A solution of 3-bromo-8- (trifluoromethyl)quinolin-4-ol (0.240 g, 0.830 mmol), sodium thiophenol (0.293 g, 45.1 mmol), is dissolved in DMF and heated in a microwave reactor for 10 min at 120°C. After which, the reaction is; poured into water and extracted with ethyl acetate. The combined extracts are washed with sat aq NaHCO3, water, brine, and dried with magnesium sulfate. The extracts are concentrated and the residue is chromatographed with 1:9 ethyl acetate:hexanes to afford the title compound as a white solid (0.151 g, 57%). mp 153-155°C; MS (ESI) m/z 322; MS (ESI) m/z 320; HRMS: calcd for C16H10NF3OS + H, 322.05134; found (ESI, [M+H]+), 322.0486. 2) 4-Bromo-3-(phenylthio)-8-(trifluoromethyl)quinoline: The title compound is prepared essentially as described in Example 390, step 4, except using 3- (phenylthio)-8-(trifluoromethy4)quinolin-4-ol instead of 3-phenyl-8- (trifluorornethyl)quinolin-4-6l to afford the title compound as a white solid (0.230 g, 80%). mp 139-141 °C; MS (ESI) m/z 384; HRMS: calcd for C16H9NF3BrS + H, 383.96694; found (ESI, [M+H]+), 383.9657. 3) 4-Phenyl-3-(phenylthio)-8-(trifluorornethyl)quinoline: The title compound is prepared essentially as described in Example 390, step 5, except using 4-bromo-3- (phenylthio)-8-(trifluoromethyl)quinoline instead of . 3-bromo-8- (trifluoromethyl)quinolin-4-ol to afford the title compound as a tacky solid (0.065 g, 44%). MS (ES) m/z 382.2; HRMS: calcd for C22H14NF3S + H, 382.08773; found (ESI, [M+H]+), 382.0864. EXAMPLE 412 4-FLUORO-3-[3-PHENyL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENOL 4-(2-FIuoro-5-methoxyphetjiyl)-3-phenyl-8-(trifluoromethyl)quinoline (0.230 g, 0.578 mmol) was combined with pyridine-HC1 (50 g) and raised to 200 °C in and oil bath for 2 hours. Upon cooling to a solid waxy solid, 2N HC1 was added and the solid 165 WO 2005/058834 PCT/US2004/041399 dissolved, poured into a separator/ funnel, and extracted with ethyl acetate. The combined organic phases were washed with1 sat. NaHCO3, water, brine, and dried with magnesium sulfate to afford 0.142 g (65%) of the title compound as a tan solid: mp85°C; Calcd. mass for C22H13NF4O 383 found by MS (ES) m/z 393.9. EXAMPLE 413 ETHYL [4-({4-FLUORO-3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETATE Arg 319 Et ester of Example 414 EXAMPLE 414 [4-({4_FLUORO-3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL] ACETIC ACID Acid of Example 413 EXAMPLE 415 3-{4-METHYLBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOL)NE ' 1) [4-Phenyl-8-(trifluoromethyl)quinolin-3-yl]methanol: Ethyl 4-phenyl-8-(trifluoromethyl)quinoline-3-carboxylate (3.45 g, 10.0 mmol), was dissolved in THF (75 mL) and treated with 2.0 M LiBH4 in THF (12.5 mL, 25.0 mmol) over 5 min at ambient temperature underj nitrogen. After stirring 24 h, the reaction is quenched with methano) and stirred overnight. The reaction is concentrated in vacuo, treated with water, extracted with methylene chloride, dried over MgSO4, and concentrated in vacuo. The residue is chromatographed with 40:60 ethyl acetate:hexane to afford the title compound as a solid (1.77g). MS (ES) m/z 304.1; HRMS: calcd for C17H12F3NO, 303.0871; found (ESI, [M+H]+), 304.0934 2) 3-(Bromomethyl)-4-phenyl-8-(trifluoromethyl)quino)ine: A stirred solution of [4-phenyl-8-(trifluoromethy])quinolin-3-yl]methanol (1.76 g, 11.9 mmol) in dichloromethane (120 mL) is treated with 1.0 M PBr3 in dichloromethane (13.1 mL, 13.1 mmol). After 3 h at ambient temperature, the reaction is treated with aq saturated NaHCO3 (125 mL), the layers separated, and the aqueous extracted with dichloromethane. The organic extracts are dried with MgSO4, concentrated, and the residue chromatographed with 20:80 ethyl acetaterhexane as eluent to afford the title 166 WO 2005/058834 PCT/US2004/041399 compound,as a foaming oil which is used quickly to minimize decomposition (2.11 g). MS (ES) m/z 366.0; HRMS: calcd for C17H11BrF3N, 365.0027; found (ESI, IM+H]+), 366.0091 : 3) 3-(4-Methylbenzyl)-4-phenyl-8-(trifluoromethyl)quinoIine: A solution of 3-(bromomethyt)-4-phenyl-8-(trifluoromethyl)quinoline (128 rng, 0.35 mrnol) and 4-MePhB(OH)2 (72 mg, 0.525 mmol) in DME (3.0 mL) and 2.0 M Na2CO3 (0.6 mL) is treated with Pd(PPh3)4 (20 mg) and heated at 85°C for 22 h. After an additional 24 h at ambient temperature, the reaction is treated with water (4 mL) and extracted with 1:4 ethyl acetate:hexanes (25 mL). The extract is dried with MgSO4 and concentrated in vacuo. The residue is chromatographed with 15:85 ethyl acetate:hexane to afford the title compound as an oil. MS (ES) m/z 378.2; HRMS: calcd for C24H18F3N, 377.1391; found (ESI, [M+H]+), 378.1474; EXAMPLE 416 3-(4-METHOXYBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 417, step 3, except using 4-methoxyphenylboronic acid instead of 4-methylphenylboronic acid. MS m/z 410; HRMS: calcd for C24H18F3NO, 393.1340; found (ESI, [M+H]+), 394.1403; EXAMPLE 417 3-(4-CHLOROBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 4-chlorophenylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 398.2; HRMS: calcd for C23H15C1F3N, 397.0845; found (ESI, [M+H]+), 398.0916; EXAMPLE 418 3-(3-CHLOROBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 3-chlorophenylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 398.2; HRMS: calcd for C23H15C1F3N, 397.0845; found (ESI, [M+H]+), 398.0916; 167 WO 2005/058834 PCT/US2004/041399 EXAMPLE 419 3-(4-FLUOROBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 4-fluorophenylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 382.2; HRMS: calcd for C23H15F4N, 381.1141; found (ESI, [M+H]+), 382.1211; EXAMPLE 420 3-(3-FLUOROBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 3-fluorophenylbpronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 382.2; HRMS: calcd for C23H15F4N, 381.1141; found (ESI, [M+H]+), 382.1205; EXAMPLE 421 3-(2-FLUOROBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUJNOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 2-fluoropheny)boronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 382.2; HRMS: calcd,'for C23H15F4N, 381.1141; found (ESI, [M+H]+), 382.1233; EXAMPLE 422 3-(3,5-DIFLUOROBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 3,5-difluorophenylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 400.2; HRMS: calcd for C23H14F5N, 399.1046; found (ESI, IM+H]+), 400.1112; EXAMPLE 423 3.{[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]METHYL}PHENOL The title compound is prepared essentially as described in Example 415, step 3, except using 3-hydroxyphenylboronic acid instead of 4-methylphenylboronic acid. 168 WO 2005/058834 PCT/US2004/041399 MS (ES) m/z 378.2; HRMS: calcd for C23H16F3NO, 379.1184; found (ESI, [M+H]+), 380.1248; EXAMPLE 424 3-(2-NAPHTHYLMETHYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLlNE The title compound is prepared essentially as described in Example 415, step 3, except using 2-naphthylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 414.2; HRMS: calcd for C27H18F3N, 413.1391; found (ESI, [M+H]+), 414.1464; EXAMPLE 425 4-{[4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLIN-3-YL]METHYL}BENZONITRILE The title compound is prepared essentially as described in Example 415, step 3, except using 4-cyanophenylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 387.1; HRMS: calcd for C24H15F3N2, 388.1187; found (ESI, [M+H]+), 389.1261; EXAMPLE 426 3-( 1 -BENZOTHIEN-2-YLMETHYL)-4-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 2-benzothienylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 420.2; HRMS: calcd for C25H16F3NS, 419.0956; found (ESI, [M+H]+), 420.1031; EXAMPLE 427 4-PHENYL-3-(THIEN-3-YLMETHYL)-8-(TRIFLUOROMETHYL)QUINOUNE The title compound is prepared essentially as described in Example 415, step 3, except using 3-thienylborbnic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 370.1; HRMS: calcd for C21H14F3NS, 369.0799; found (ESI, [M+H]+), 370.0876; 169 WO 2005/058834 PCT/US2004/041399 EXAMPLE 428 3-(2-METHYLBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 2-methylphenylboronic acid instead of 4-methylpheny)boronic acid. HRMS: calcd for C24H18F3N, 377.1391; found (ESI, [M+H]+), 378.1469; EXAMPLE 429 4-PHEISYL-8-(TRlFLUOROMETHYL)-3-[4-(TRIFLUOROMETHYL)BENZYL]QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 4-trifluoromethylphenylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 430.1; HRMS: calcd for C24H15F6N, 431.1109; found (ESI, [M+H]+), 432.1175; EXAMPLE 430 3-(2-METHOXYBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 2-methoxyphenylboronic acid instead of 4-rnethylphenylboronic acid. MS (ES) m/z 394.1; HRMS: calcd for C24H18F3NO, 393.1340; found (ESI, [M+H]+), 394.1414; EXAMPLE 431 3-(2-CHLOROBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 2-chlorophenylboronic acid instead of 4-methylphenylboronic acid. MS (ES) m/z 398.1; HRMS: calcd for C23H15C1F3N, 397.0845; found (ESI, [M+H]+), 398.0941; - EXAMPLE 432 3-(2,4-DIFLUOROBENZYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE The title compound is prepared essentially as described in Example 415, step 3, except using 2,4-difluorophenylboronic acid instead of 4-methylphenylboronic acid. 170 IOUUUUII to ubaicu VVILII VIQIC1 ai/u CAiiaoicu will I cu itM. lilt; tSMIHUl IS UllfcJU WIID MgSO4 and concentrated to an oil. Chromatography with 10:90 ethyl acetaterhexane affords the title compound as a white soiid (114 mg, 62%). MS (ES) m/z 380.2; HRMS: calcd for C23H16F3NO, 379.1184; found (ESI, [M+H]+), 380.1246; EXAMPLE 434 3-{[4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-3- ]YL]METHOXY}BENZONITRILE Prepared as in Example 435 except using 3-cyanophenol as the reactant. MS (ES) m/z 405.1; HRMS: calcd for C24H15F3N2O, 404.1136; found (ESI, [M+H]+), 405.1228; EXAMPLE 435 3~[(4-CHLOROPHENOXY)METHYL]-4-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 435 except using 4-chlorophenol as the reactant. MS (ES) m/z 414.1; HRMS: calcd for C23H15C1F3NO, 413.0794; found (ESI, [M+H]+), 414.0858; EXAMPLE 436 3-[(4~METHYLPHENOXY)METHYLj-4-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 435 except using 4-methylphenol as the reactant. MS (ES) m/z 394.1; HRMS: calcd for C24H18F3NO, 393.1340; found (ESI, [M+H]+), 394.142; 171 WO 2005/058834 PCT/US2004/041399 EXAMPLE 437 3-[(1-NAPHTHYLOXY)METHYLj-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOUNE Prepared as in Example 435 except using 1-naphthol as the reactant. MS (ES) m/z 430.2; HRMS: calcd for C27H18F3NO, 429.1340; found (ESI, [M+H]+), 430.1432; EXAMPLE 438 3-[(2,4-DIMETHYLPHENOXY)METHYL]-4-PHENYL'8- (TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using 2,4-dimethylphenol as the reactant. MS (ES) m/z 408.2; HRMS: calcd for C25H20F3NO, 407.1497; found (ESI, [M+H]+), 408.1589; ; EXAMPLE 439 3-[(4-METHOXYPHENOXY)METHYL]-4-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using 4-methoxyphenol as the reactant. MS (ES) m/z 410.2; HRMS: caicd for C24H18F3NO2, 409.1290; found (ESI, [M+H]+), 410.1358. EXAMPLE 440 3-[(CYCLOBUTYLOXY)METHYL]-4-PHENYL-8-(TRIFLUOROMETHYL)QU 1NOLINE Prepared as in Example 433 except using cyclobutanol as the reactant. MS (ES) m/z 358.2; HRMS: calcd for C21H18F3NO, 357.1340; found (ESI, [M+H]+), 358.1401. i EXAMPLE 441 3-[(CYCLOPENTYLOXY)METHYL]-4-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using cyclopentanol as the reactant. MS (ES) m/z 372.2; HRMS: calcd for C22H20F3NO, 371.1497; found (ESI, [M+H]+), 372.1566; EXAMPLE 442 4-PHENYL-3-[(2-PHENYLETHOXY)METHYL]-8-(TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using 2-phenyl-ethanol as the reactant. MS (ES) m/z 408.2; HRMS: calcd for C25H20F3NO, 407.1497; found (ESI, [M+H]+), 4O8.1555; 172 WO 2005/058834 PCT/US2004/041399 EXAMPLE 443 3-[(ALLYLOXY)METHYL]-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using allyl alcohol as the reactant MS (ES) m/z 344.1; HRMS: calcd for C20H16F3NO, 343.1184; found (ESI, [M+H]+), 344.1268; EXAMPLE 444 3-[(CYCLOHEXYLOXY)METHYL]-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using cyclohexanol as the reactant. MS m/z 386; HRMS: calcd for C23H22F3NO, 385.1653; found (ES), [M+H]+), 386.1717; EXAMPLE 445 3-(SEC-BUTOXYMETHYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using sec-butyl alcohol as the reactant. MS (ES) m/z 360.2; HRMS: calcd for C21H20F3NO, 359.1497; found (ESI, [M+H]+), 360.1563; EXAMPLE 446 3-{[(2-CHLOROBENZYL)OXY]METHYL}-4-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using 2-chIorobenzyl alcohol as the reactant. MS (ES) m/z 428.1; HRMS: calcd for C24H17C1F3NO, 427.0951; found (ESI, [M+H]+), 428.1013; , EXAMPLE 447 3-(ISOBUTOXYMETHYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using isobutyl alcohol as the reactant. MS m/z 360; HRMS: calcd for C21H20F3NO, 359.1497; found (ESI, [M+H]+), 360.1566. EXAMPLE 448 3-(ISOPROPOXYMETHYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUlNOLINE Prepared as in Example 433 except using 2-propanol as the reactant. MS (ES) m/z 346.1; HRMS; calcd for C20H18F3NO, 345.1340; found (ESI, [M+H]+), 346.1404. 173 WO 2005/058834 PCT/US2004/041399 EXAMPLE 449 3-(METHOXYMETHYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 433 except using methanol as the reactant. MS (ES) m/z 318.2; HRMS: calcd for C18H14F3NO, 317.1027; found (ESI, [M+H]+), 318.1094. EXAMPLE 450 3-(ETHOXYMETHYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QU)NOLlNE Prepared as in Example 433 except using ethanol as the reactant. MS (ES) m/z 332.1; HRMS: calcd for C19H16F3NO, 331.1184; found (ESI, [M+H]+), 332.1247. EXAMPLE 451 4-PHENYL-3-(1H-PYRAZOL-1-YLMETHYL)-8-(TRlFLUOROMETHYL)QUINOLINE A mixture of pyrazole (45 mg, 0.67 mmol) in DMF (2.0 mL) is treated with NaH (60% in oil, 27 mg, 0.67 mmol) is stirred 0.5 h, then treated with bromide (120 mg, 0.33 mmol) in DMF (1.0 mL). After stirring 6 d, the reaction is treated with water, extracted with ether, and the extracts dried with MgSO4. The concentrated extract is chromatographed with 50:50 ethyl acetate:hexane to afford the title compound as a solid (79 mg). MS (ES) m/z 354.1; HRMS: calcd for C20H14F3N3, 353.1140; found (ESI, [M+H]+), 354.1233 EXAMPLE 452 4-PHENYL-3-(1H-PYRROL-1-YLMETHYL)-8-(TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 451 except using pyrrole in place of pyrazole. MS (ES) m/z 353.1; HRMS: calcd for C21H15F3N2, 352.1187; found (ESI, [M+H]+), 353.1262. EXAMPLE 453 3-(1H-IMIDAZOL-1-YLMETHYL)-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOLlNE Prepared as in Example 451 except using imidazole in place of pyrazole. MS (ES) m/z 354.1; HRMS: calcd for C20H14F3N3, 353.1140; found (ESI, [M+H]+), 354.1231 174 WO 2005/058834 PCT/US2004/041399 EXAMPLE 454 3-(3-METHYL-1,2,4-OXADIAZOL-5>-YL)-4-PHENYL-8- (TRIFLUOROMETHYL)QUINOLINE A mixture of acetamidoxime (148 mg, 2.0 mmol) and powdered 4A molecular sieves (0.5 g) in THF (5 mL) is treated with 60% NaH in oil (80 mg, 2.0 mmol) for 15 min at ambient temperature. The reaction is treated with ethyl 4-phenyl-8-(trifluoromethyl)quinoline-3-carboxylate (173 mg, 0.50 mmol) and heated at reflux for 22 h. The reaction is cooled, concentrated, treated with water, and extracted with dichloromethane. The extracts are dried with MgSO4. concentrated, and the residue chromatographed with 20:80 ethyl acetate:hexane to afford the title compound as an off-white solid (151 mg). MS (ES) m/z 356.1; HRMS: calcd for C19H12F3N3O, 355.0932; found (ESI, [M+H]+), 356.1008 EXAMPLE 455 4-PHENYL-3-(3-PHENYL-1,2>4-OXADIAZOL-5-YL)-8- (TRIFLUOROMETHYL)QUINOLINE Prepared as in Example 454 except using PhC(NH2)NOH. MS (ESI) m/z 418; HRMS: calcd for C24H14F3N3O, 417.1089; found (ESI, [M+H]+), 418.1173. EXAMPLE 456 4-PHENYL-3-(PHENYLSULFONYL)-8-(TRIFLUOROMETHYL)QUINOLINE A stirred solution of aniline (265 mg, 1.00 mmol) prepared as in Example 75, Scheme 9, in DMF (4.0 mL) is treated with NaH (60% in oil, 44 mg, 1.10 mmol) at ambient temperature. After 3 min, PhSO2CH=CHSO2Ph (308 mg, 1.00 mmol) is added to the red solution. After stirring overnight, the reaction is treated with water and brine and extracted with CH2C12. The extract is concentrated in vacuo and the residue chromatographed eluting with 20:80, then 40:60, then 100:0 ethyl acetate:hexane mixtures. The title compound is isolated (Rf ~ 0.25 in the initial system) as a pale yellow solid (100 mg). mp 149-151 °C; MS (ESI) m/z 414; HRMS: calcd for C22H14F3NO2S, 413.0697; found (ESI, [M+H]+), 414.0755; Anal. Calcd for C22H14F3NO2S: C, 63.92; H, 3.41; N, 3.39. Found: C, 64.24; H, 3.30; N, 3.20. 175 WO 2005/058834 PCT/US2004/041399 EXAMPLE 457 3-(3-BENZYL-8-TRIFLUOROMETHYL-QUINOLIN-4-YL)-PHENOL 1) 2-FIuoro-N-methoxy-N-methyl-3-trifluoromethyl-benzamide: To a solution of 2~ Fluoro-3-trifluoromethyl-ben2oic acid, (15 g, 72 mmol) in 150 mL benzene at rt is added a solution of 10 mL (137 mmol) of SOC12 in 30 mL of CH2C12 drop wise over 30 min. The resulting solution is brought to reflux (pot: 85 °C) for ~6 hr. The vessel is cooled to rt and concentrated in vacuo, followed by 3x50 mL toluene azeotrope. The residue is taken up in CHC13 (250 mL) and 10 g (103 mmol) Weinreb reagent is added. The mixture is cooled to 0 °C and 16 mL pyridine is added via syringe in a slow stream. The vessel is allowed to warm to rt and stir at rt for ~12hr. The CHC13 is then stripped off and the residue taken up in CH2C12-Et2O (1:1) 400 mL and washed with water, brine and then dried over Na2SO4, filtered and concentrated in vacuo to provide 17 g ( 95 %) of the desired crude benzamide. This material is of suffiC1ent purity for the next step. 2) (2-Fluoro-3-trifluoromethyl-phenylH3-methoxy-phenyl)-methanone: 2-Fluoro-N- methoxy-N-methyl-3-trifluoromethyl-benzamide from step 1, is taken up in 150 mL THF and cooled to -78 °C. A solution of 3-methoxy phenyl magnesium bromide in THF (1 M) (97 mL, 97 mmol) is added slowly (~ 1.5 hr) at -78 °C. The vessel is then stirred for 1 hr at -78 °C and then brought to 0 °C and stirred for an additional 2 h. The reaction is quenched by pouring it into a ice cold 1 N HC1 solution and extracting with EtOAc. The EtOAc layer is washed with water, brine and dried over Na2SO4, filtered and concentrated in vacuo to provide the desired crude ketone which is chromatographed with methylene chloride:hexane (90:10) to afford the title compound, 17.8 g (88 %). MS (ES) m/z 299.1. 3) [2-amino-3-(trifIuoromethyl)phenyl](3-methoxyphenyl)methanone: (2-Fluoro-3- trifluoromethyl-phenyl)-(3-methoxy-phenyl)-methanone, from step 2, (7g, 23.5 mmol) is taken up in DME, (~ 50 mL) and 150 mL NH4OH solution is added. The mixture is placed in a steel bomb and heated to 140 °C for ~6 hr. The vessel is then cooled in ice and carefully opened. The resulting mixture is concentrated and then extracted with EtOAc. The EtOAc layer is washed with water, brine and dried over Na2SO4, filtered and concentrated in vacuo to provide the desired aniline, which is purified by chromatography with methylene chloride:methaol (98:2) to afford the title compound, 176 WO 2005/058834 PCT/US2004/041399 4.8 g (70 %). MS (ESI) m/z 296; HRMS: calcd for C15H12F3NO2 + H+, 296.08929; found (ESI, [M+H]+), 296.0887 4) [2-amino-3-(trifluoromethyl)phenyl](3-hydroxyphenyl)methanone: [2-amino-3- (trifluoromethyl)phenyl](3-methoxyphenyl)methanone, from step 3, (3g, 10 mmol) and 40 g Py-HCt is placed into a RBF with a stir bar and lowered into a heating bath at 190-200 °C for 2-3 hr. The vessel is then cooled to RT and 1 N HC1 is added to dissolve all solids. The mixture is extracted with EtOAc. The EtOAc layer is washed with water, brine and dried over Na2SO4, filtered and concentrated in vacuo to provide a semi-solid material. This material is repeatedly triturated with CH2C12- The methylene chloride is then concentrated providing the desired crude aniline. This material can be used crude however is purified by silica gel chromatography using methylene chloride and 1 % methanol to give the title compound, 2.6 g, (91 %): mp 106-107 °C; MS m/z 282; HRMS: calcd for C14H10F3NO2+, H+, 282.07364; found(ESI,[M+H]+),282.0729. 5) 3-(3-Benzyl-8-trifluoromethyl-quinolin-4-yl)-phenol: To a solution of [2-amino-3- (trifluoromethyl)phenyl](3-hydroxyphenyl)methanone from step 4, (3.0 g, 10.6 mmol) in AcOH (glaC1al, 20 mL) at rt is added 3-phenyl-propionaldehyde (2.1 g, 15.9 mmol) followed by 1.5 ml of a solution of H2SO4 in AcOH (solution: 0.5 ml H2SO4 in 9.5 ml AcOH). The reaction mixture is then heated to 120 °C for approximately 3 hr. The vessel is cooled, the AcOH removed in vacuo and the residue taken up in EtOAc and washed with sat. NaHCO3 solution. The EtOAc layer is dried over NaSO4, filtered and concentrated giving an oily residue, which is purified by silica gel chromatography, CH2C12, MeOH (98:2) to afford the desired quinoline as a light yellow foam (2.8 g, 70 %); MS (ES) m/z 378.2; HRMS: calcd for C23H16F3NO + H+, 380.12567; found (ESI, [M+H]+), 380.1257 EXAMPLE 458 3-[3-(2-FLUOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3- i hydroxy-phenyl)methanone and (2-Fluoro-phenyl)-acetaldehyde following the procedure of Example 457: mp 186-187 °C; MS m/z 384, HRMS: calcd for C22H13F4NO + H+, 384.10060; found (ESI, [M+H]+), 384.1. 177 WO 2005/058834 PCT/US2004/041399 EXAMPLE 459 3-[3-(3-FLUOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluorometriyl)phenyl]-(3-hydroxy-phenyl)methanone and (3-Fluoro-phenyl)-acetaldehyde following the procedure of Example 457: MS (ESI) m/z 384; HRMS: calcd for C22H13F4NO + H+, 384.10060; found (ESI, [M+H]+), 384.0992; EXAMPLE 460 3-[3-(4-FLUOROPHENYL)-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENOL The title compound was prepared from : [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone; and (4-Fluoro-phenyl)-acetaldehyde following the procedure of Example 457: MS m/z 384;HRMS: calcd for C22H13F4NO + H+, 384.10060; found (ESI, [M+H]+), 384.0997. l EXAMPLE 461 3-[3-(2-METHOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (2-Methoxy-phenyl)-acetaldehyde following the procedure of Example 457: MS (ESI) m/z 396; HRMS: calcd for C23H16F3NO2 + H+, 396.12059; found (ESI, [M+H]+), 396.1223. EXAMPLE 462 3-[3-(3-METHOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The titte compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (3-Methoxy-phenyl)-acetaidehyde following the procedure of Example 457: MS (ES) m/z-394.0; HRMS: calcd for C23H16F3NO2 + H+, 396.12059; found (ESI, [M+H]+), 396.1196. EXAMPLE 463 3-[3-(4-METHOXYPHENYL)-8-(TRlFLUOROMETHYL)QUINOLlN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (4-Methoxy-phenyl)-acetaldehyde following the 178 WO 2005/058834 PCT/US2004/041399 procedure of Example 457: MS (ESI) m/z 396; HRMS: calcd for C23H16F3NO2 + H+, 396.12059; found (ESI, [M+H]+), 396.1195. i EXAMPLE 464 3-[3-(3-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOUN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and m-Tolyl-acetaldehyde following the procedure of Example 457: MS (ES) m/z 378.0; HRMS: calcd for C23H16F3NO + H+ 380.12567; found (ESI, [M+H]+), 380.1263. EXAMPLE 465 3-[3-MESITYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (2,4,6-Trimethy)-phenyl)-acetaldehyde following the procedure of Example 457: MS (ES) m/z 405.9; HRMS: calcd for C25H20F3NO + H+, 408.15697; found (ESI, [M+H]+), 408.1573. : EXAMPLE 466 3-[3-(2-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-arnino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and o-Tolyl-acetaldehyde following the procedure of Example 457: MS (ESI) m/z 380.126; HRMS: calcd for C23H16F3NO + H+, 380.12567; found (ESI, [M+H]+), 380.126. EXAMPLE 467. 3-{8-(TRlFLUOROMETHYL)-3-[2-(TRIFLUOROMETHYL)PHENYL]QUINOLIN-4- YL}PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (2-TrifIuoromethyl-phenyl)-acetaldehyde following the procedure of Example 457: MS (ES) m/z 431.9; HRMS: calcd for C23H13F6NO + H+, 434.09741; found (ESI, [M+H]+), 434.0961. 179 WO 2005/058834 PCT/US2004/041399 EXAMPLE 468 3-[3-(4-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from ' [2-amino-3-(trifluoromethyl)phenyl]-(3- hydroxy-phenyl)methanone and p-To)yl-acetaldehyde following the procedure of Example 457: MS (ESI) m/z 380; HRMS: calcd for C23H16F3NO + H+, 380.12567; found (ESI, [M+H]+), 380.1259. EXAMPLE 469 3-[3-(2,5-DIMETHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (2,5-Dimethyl-phenyl)-acetaldehyde following the procedure of Example 457: MS (ESI) m/z 394; HRMS: calcd for C24H18F3NO + H+, 394.14132; found (ESI, [M+H]+), 394.1402. EXAMPLE 470 3-{8-(TRIFLUOROMETHYL)-3-[3-(TRIFLUOROMETHYL)PHENYL]QUINOLIN-4- YL}PHENOL The title compound was, prepared from [2-amino-3-(trifluorornethyl)phenyl]-(3-hydroxy-phenyl)methanone and (3-Trifluoromethyl-phenyl)-acetaldehyde following the procedure of Example 457: HRMS: calcd for C23H13F6NO + H+, 434.09741; found (ESI, [M+H]+), 434.0993. ' EXAMPLE 471 3-[3-(2-BROMOPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (2-Bromo-phenyl)-acetaldehyde following the procedure of Example 457: MS (ES) m/z 441.8; HRMS: calcd for C22H13BrF3NO + H+, 444.02053; found (ESI, (M+H]+), 444.0191. EXAMPLE 472 3-[3-(3-BROMOPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from f2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (3-Bromo-phenyl)-acetaldehyde following the 180 WO 2005/058834 PCT/US2004/041399 procedure of Example 457: MS (ES) m/z 441.8; HRMS: calcd for C22H13BrF3NO + H+, 444.02053; found (ESI, [M+H]+), 444.0206. EXAMPLE 473 3-[3-(2-CHLOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (2-chloro-phenyl)-acetaldehyde following the procedure of Example 457: MS (ES) m/z 397.9; HRMS: calcd for C22H13ClF3NO + H+, 400.07105; found (ESI;, [M+H]+), 400.0706. EXAMPLE 474 3-[3-(3-CHLOROPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluorornethyl)phenyl]-(3-hydroxy-phenyl)methanone and (3-chbro-phenyl)-acetaldehyde following the procedure of Example 457: MS (ES) m/z 397.9; HRMS: calcd for C22H13C1F3NO + H+, 400.07105; found (ES), [M+H]+), 400.0697. EXAMPLE 475 3-[3-(2,6-DlCHLOROPHENYL)-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy-phenyl)methanone and (2,6-dichloro-phenyl)-acetaldehyde following the procedure of Example 457: MS (ES) m/z 4318; HRMS: calcd for C22H12C12F3NO + H+, 434.03208; found (ESI, [M+H]+), 434.033. EXAMPLE 476 3-[3-METHYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENOL The title compound was prepared from [2-amino-3-(trifluoromethyl)phenyl]-(3-hydroxy~phenyl)methanone and Propionaldehyde following the procedure of Example 457: MS (ES) m/z 304.28 181 WO 2005/058834 PCTAJS2004/041399 EXAMPLE 477 [2~METHYL-4-PHENYL-8-(TRIFLUOROMETHYL)QUINOL(N-3-YL](PHENYL)METHANONE t 1) (2-Fluoro-3-trifluoromethyl-phenyl)-plnenyl-methanone: The title compound was prepared from 2-Fluoro-N-rnethoxy-N-me{hyl-3-trifluoromethyl-benzamide and phenyl magnesium bromide following the procedure of Example 457, Step. 2: MS (ES) m/z 268.2. 2) [2-amino-3-(trifluoromethyl)phenyl](phenyl)methanone: The title compound was prepared from (2-Fluoro-34rifluoromethyl-phenyl)-phenyl-rnethanone following the procedure of Example 457, Step 3: MS (ESI) m/z 266; HRMS: calcd for C14H10F3NO + H+, 266.07872; found (ESI, [M+H]+), 266.0771 3) [2-methyl-4-phenyl-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone: The title compound was prepared from (2-Amino-3-trif)uoromethyl-phenyl)-phenyl-methanone and 1-Phenyl-butane-1,3-dione following the procedure of Example 459, step 5: mp 175-177 °C; HRMS: calcd for C24H16F3NO + H+, 392.12567; found (ESI, [M+H]+), 392.1251. EXAMPLE 478 [4-{3-I(2-NlTROBENZYL)OXY]PHENYL}-8-(TRiFLUOROMETHYL)QUINOL[N-3- YL](PHENYL)-METHANONE A solution of [4-(3-hydroxyphenyl)-8-(trifIuoromethyl)quinolin-3-yl](phenyl)methanone (0.15g, 0.38 mmol), 1 -Bromomethyl-2-nitro-benzene (0.1 Og, 0.46 mmol) and CsCO3 (0.25g, 0.76 mmol) in DMF (3ml) was heated to 60 °C. After 14 hr, the reaction was cooled, filtered and concentrated. The crude residue was purified by reverse phase HPLC to provide the desired compound (0.066g, Yield = 33%); MS (ESI) m/z 529; '. EXAMPLE 479 [4-{3-[(3-NITROBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLiN-3- YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 1 -Bromomethyi-3-nitro-benzene following the procedure of Example 478: MS (ESI) m/z529. 182 WO 2005/058834 PCT/US2004/041399 ' EXAMPLE 480 i [4-{3-[(4-NITROBENZYL)OXY]PHENYL}-S-(TRIFLUOROMETHYL)QUlNOLIN-3- YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifIuoromethyl)quinolin-3-yl](phenyl)methanone and 1-Bromomethyl-3-nitro-benzene following the procedure of Example 478: MS (ESI) m/z 529; EXAMPLE 481 [4-{3-K2-METHYLBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL}(PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)~8-(trifluoromethyl)quinolin~3-yl](phenyl)methanone and 1 -Bromomethyl-2-methyl-benzene following the procedure of Example 478: MS (ESI) m/z 498. EXAMPLE 482 [4-{3-[(3-METHYLBENZYL)OXY]PHENYL}~8-(TRIFLUOROMETHYL)QUINOLIN-3- ;YLj(PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifiuoromethyl)quinolin-3-yl](phenyl)methanone and 1-Bromomethyl-3-methyI-benzene following the procedure of Example 478: MS (ESI) m/z 498. EXAMPLE 483 [4-{3-[(4-METHYLBENZYL)OXY]PHENYL}-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 1 -Bromomethyl-4-methyl-benzene following the procedure of Example 478: MS (ESI) m/z 498. 183 WO 2005/058834 PCT/US2004/041399 . EXAMPLE 484 [4-{3-[(2-METHOXYBENZYL)OXY]PHEMYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YLj(PHENYL)~METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)~8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 1-Bromomethyl-2-methoxy-benzene following the procedure of Example 478: MS (ESI) m/z 514. EXAMPLE 485 [4-{3-t(3-METHOXYBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL}(PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifIuoromethyl)quinolin-3-ylJ(phenyl)methanone and 1 -Bromomethyl-3-methoxy-benzene following the procedure of Example 478: MS (ESI) m/z 514. EXAMPLE 486 [4-{3-[(4-METHOXYBENZYL)OXY]PHEMYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 1 -Bromomethyl-4-methoxy-benzene following the procedure of Example 478: MS (ESI) m/z 514. EXAMPLE 487 PHENYL[8-(TRIFLUOROMETHYL)-4-(3-{[2- (TRlFLUOROMETHYL)BENZYL]OXY}PHENYL)QUlNOLIN-3-YL]METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinolin-3-yl](phenyl)methanone and 1-Bromomethyl-2- trifluoromethyl-benzene following the procedure of Example 478: MS (ESI) m/z 552. 184 WO 2005/058834 PCT/US2004/041399 EXAMPLE 488 PHENYL[8-(TRIFLUOROMETHYL)-4-{3-{[3- (TRIFLUOROMETHYL)BENZYL]OXY}PHENYL)QUINOLIN-3-YL]-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinolin-3-yl](phenyl)methanone and 1 -Bromomethyl-3- trifluoromethyl-benzene following the procedure of Example 478: MS (ESi) m/z 552. EXAMPLE 489 [4-{3-[(4-7Ef?T-BUTYLBENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLlN-3-YL](PHENYLhMETHANONE The title compound was prepared from [4*(3-hydroxyphenyl)-8- (trifluoromethyl)quinolin-3-yl](phenyl)methanone and 1 -Bromomethyl-4-tert-butyl- benzene following the procedure of Example 478: MS (ESI) m/z 540. EXAMPLE 490 [4-{3-[(4-ISOPROPYLBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)rnethanone and 1-Bromomethyl-4-isopropyl-benzene following the procedure of Example 478: MS (ESI) m/z 526; EXAMPLE 491 [4-{3-[(4_CHLORO-2-FLUOROBENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinolin-3-yl](pheny))methanone and 1-Bromomethyl-4-chloro-2- fluoro-benzene following the procedure of Example 478: MS (ESI) m/z 536. 185 WO 2005/058834 PCT/US2004/041399 EXAMPLE 492 [4-[3-(2-NAPHTHYLMETHOXY)PHENYL]-8-(TRlFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinotin-3-yl](phenyl)methanone and 2-BromomethyI-naphthalene following the procedure of Example 478: MS (ESI) m/z 534. EXAMPLE 493 PHENYL[4-[3^PYRIDIN-2-YLMETHOXY)PHENYLJ-8-(TRlFLUOROMETHYL)QUINOLIN-3-YL]-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 2-Bromomethyl-pyridine following the procedure of Example 478: MS (ESI) m/z 485. EXAMPLE 494 PHENYL[4-[3- The title compound was prepared from [4-(3-hydroxypheriy))-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 4-Bromomethyl-pyridine following the procedure of Example 478: MS (ESI) m/z 485. EXAMPLE 495 [4-(3-ISOPROPOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from [4~(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 2-Bromo-propane following the procedure of Example 478: MS (ESI) m/z 436. 186 WO 2005/058834 PCT/US2004/041399 EXAMPLE 496 [4-{3-[(4-METHYLPENT-3-ENYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifiuoromethyl)quinolin-3-yl](phenyl)nnethanone and 5-Bromo-2-methy)-pent-2-ene following the procedure of Example 478: MS (ESI) m/z 476. ; EXAMPLE 497 PHENYL[4-[3-(TETRAHYDRO-2H-PYRAN-2-YLMETHOXY)PHENYL]-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trtfluoromethyl)quinolin-3-yl](phenyl)methanone and 2-Bromomethyl-tetrahydro-pyran following the procedure of Example 478: MS (ESI) m/z 492. EXAMPLE 498 [4-{3-[(2,6-DICHLOROBENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUiNOLlN-3-YL](PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinolin-3-yl](phenyl)methanone and 2-Bromomethyl-1,3-dichloro- benzene following the procedure of Example 478: MS (ESI) m/z 552. EXAMPLE 499 t4-{3-[(4-METHYLPENTYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 1-Bromo-4-methyl-pentane following the procedure of Example 478: MS (ES) m/z 478.3. 187 PCT/US2004/041399 WO 2005/058834 EXAMPLE .500 [4-[3-(CYCLOHEXYLMETHOXY)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and Bromomethyl-cyclohexane following the procedure of Example 478: MS (ES) m/z 490.3. EXAMPLE 501 [4-{3-[(6-CHLOROPYRIDIN-3-YL)METHOXYlPHENYL}-8- (TRIFLUOROMETHYL)QUINOLlN-3-YL](PHENYL)METHANONE The title compound was prepared from [4~(3-hydroxyphenyl)-8- (trifluoromethyl)quinolin-3-yl](phenyl)methanone and 5-Bromomethyl-2-chloro- pyridine following the procedure of Example 478: MS (ES) m/z 519.1. EXAMPLE 502 PHENYL[4-[3-(QUINOLIN-2-YLMETHOXY)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3-YL]METHANONE The title compound was prepared from [4-(3-hydroxypheny))-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 2-Bromomethyl-quinoline following the procedure of Example 478: MS (ES) m/z 535.3. EXAMPLE 503 [4-{3-[(5-NlTRO-2-FURYL)METHOXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinolin-3-yl](phenyl)methanone and 2-Bromomethyl-5-nitro-furan following the procedure of Example 478: MS (ES) m/z 517.2. EXAMPLE 504 [4-{3-[(2,6-DlFLUOROBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YLl(PHENYL)METHANONE 188 WO 2005/058834 PCT/US2004/041399 The title . compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)rnethanone and 2-BromomethyM ,3-difluoro-benzene following the procedure of Example 478: MS (ESI) m/z 520. EXAMPLE 505 [4-{3-[(4-BROMO-2-METHOXYBENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUlNOLIN-3-YLJ{PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifluoromethyl)quino[in-3-yl](phenyl)methanone and 4-Bromo-1-bromomethyl-2- methoxy-benzene following the procedure of Example 478: MS (ES) m/z 592.1. EXAMPLE 506 [4-{3-[(2,6-DIMETHYLBENZYL)OXY]PHENYLh8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL](PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifIuoromethyl)quinolin-3-yl](phenyl)rnethanone and 2-Bromomethyl-1,3-dimethyl-benzene following the procedure of Example 478: MS (ES) m/z 511.5. EXAMPLE 507 METHYL-4-({3-[3-BENZOYL-8~(TRIFLUOROMETHYL)QUlNOLlN-4- YL]PHENOXY}METHYL)-3-METHOXYBENZOATE The . title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone and 4~Bromomethyl-3-methoxy-benzoic acid methyl ester following the procedure of Example 478: mp 60-63 °C; MS (ES) m/z 571.9; HRMS: calcd for C33H24F3NO5 + H+, 572.16793; found (ESI, [M+H]+), 572.1708. EXAMPLE 508 [4-[3-( 1,3-BENZODIOXOL-5-YLMETHOXY)PHENYL]-8- (TRIFLUOROMETHYL)QUINOLlN-3-YL](PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinolin-3-yl](phenyl)methanone and 5-Bromomethyl- 189 WO 2005/058834 PCT/US2004/041399 benzo[1,3]dioxole following the procedure of Example 478: MS (ESI) m/z 528; HRMS: calcd for C31H20F3NO4 + H+, 528.14172; found (ESI, [M+H]+), 528.1435. EXAMPLE 509 [4-[3-(2,1,3-BENZOXADIAZOL-5-YLMETHOXY)PHENYL]-8- (TRIFLUOROMETHYL)QUINOLlN-3-YL](PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxyphenyl)-8- (trifiuoromethyl)quinolin-3-yl](phenyl)methanone and 5-Bromomethyl- benzo[1 ,2,5]oxadiazole following the procedure of Example 478; MS (ESI) m/z 526; MS (ESI) m/z 524; HRMS: calcd for C30H18F3N3O3 + H+, 526.13730; found (ESI, [M+H]+), 526.1356. EXAMPLE 510 4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YLlPHENOXY}METHYL)- 1 H-ISOCHROMEN-1-ONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluorornethyl)quinolin-3-yl](phenyl)methanone and 4-Brornomethyl-isochromen-1 -one following the procedure of Example 478: MS (ESI) m/z 552; HRMS: calcd for C33H20F3NO4 + H+, 552.14172; found (ESI, [M+H]+), 552.1434. EXAMPLE 511 3-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YLlPHENOXY}-2- BENZOFURAN-1(3H)-ONE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluorpmethyl)quinolin-3-yl](phenyl)methanone and 3-Bromo-3H-isobenzofuran-1-one following the procedure of Example 478: MS (ESI) m/z 526; HRMS: calcd for C31H18F3NO4 + H+, 526.12607; found (ESI, [M+H]+), 526.1287. EXAMPLE 512 4-({3-[3-PHENYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)BENZOIC ACID The title compound was prepared from [3-(3-Phenyl-8-trifluoromethyl-quinolin-4-yl)-phenol and 4-Bromomethyl-benzoic acid following the procedure of Example 1: mp 190 WO 2005/058834 PCT/US2004/04I399 108-112 °C; MS m/z 500; HRMS: caicd for C30H20F3NO3 + H+, 500.14680; found (ESI, [M+H1+), 500.1461.-' EXAMPLE 513 3-BENZYL-4-{3-[(2,6-DIMETHYLBENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from 3-(3-Benzyl-8-trifluoromethyl-quinolin-4-yl)-phenol and 2-Bromomethyl-1,3-dtmethyl-benzene following the procedure of Example 478: MS m/z 498; HRMS: calcd for C32H26F3NO + H+, 498.20392; found (ESI, [M+H]+), 498.2038. EXAMPLE 514 4-({3-(3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENOXY}METHYL)-3- FLUOROBENZOIC ACID The title compound was prepared from 3-(3-Benzyl-8-trifluoromethyI-quinolin-4-yl)-phenol and 4-Bromomethyl~3-fluoro-benzoic acid following the procedure of Example 478: MS m/z 532; MS m/z 530; HRMS: calcd for C31H21F4NO3 + H+, 532.15303; found (ESI, [M+H]+), 532.153; EXAMPLE 515 4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOUN-4-YL]PHENOXY}METHYL> 3METHOXY-BENZOIC ACID The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifluoromethyl)-quinolin-3-yl](phenyl)methanone and 4-Bromomethyl-3-methoxy-benzoic acid methyl ester following the procedure of Example 478 then hydrolysis using sodium hydroxide in THF.MeOH (1:2) at RT for 12 hr, the reaction mixture was acidified and concentrated. The crude residue was purified by reverse phase HPLC to provide the desired compound: mp 100-110 °C; MS (ES) m/z 555.8; HRMS: calcd for C32H22F3NO5 + H+, 558.15228; found (ESI, [M+H]+), 558.154. 191 WO 2005/058834 PCT/US2004/041399 EXAMPLE 516 3-BENZYL-4-[3-(4-METHOXYPHENOXY)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLINE 1) (2-Fluoro-34rifluoromethyl-phenyl)-[3-(4-methoxy-phenoxy)-phenyl]-methanol: To a solution of 1-Ruoro-2-trifluoromethyl-benzene (.39 ml, .003 mole) in 10 ml THF, cooled to -78 °C, under nitrogen, was added 2.5M n-BuLi (1.5 ml, .0037 mole) dropwise over 3 minutes and then stirred 5 hr at -78 °C. Then 3-(4-Methoxy- phenoxy)-benzaldehyde (.78 ml, .0037 mole) in 1 ml THF was added over 3 minutes and the reaction allowed to warm to rt. A 1N HC1 solution (15 ml) was added to the reaction and extracted with ethyl acetate. The organic layer was washed with brine, dried over magnesium sulfate and evaporated to dryness, giving 1.65 g of the title compound: MS (ES) m/z 375.1; 2) [2-fluoro-3-(trifluoromethyl)phenyl][3-(4-methoxyphenoxy)phenyl]methanone: To a suspension of pyridinium chlorochromate (19.7g, .092 mole) in 400 ml dichloromethane is added a solution of (2-fluoro-3-trifluoromethylphenyl)-[3-(4- methoxyphenoxy)-phenyl]methanol (26.2g, .061 mole) in 150 ml dichloromethane, dropwise over 20 minutes. This mixture was stirred at rt for 3.5 hr. The reaction was filtered, the filtrate was washed with 1N HC1 (2x), brine and then dried over magnesium sulfate and evaporated to dryness to give 26.4g of [2-fluoro-3- (trifluoromethyl)phenyl]- [3-(4-methoxyphenoxy)phenyl]methanone. This material was used in the subsequent step without further purification. The compound can be purified by reverse-phase HPLC: MS (ES) m/z 391.0; HRMS: calcd for C21H14F4O3 + H+, 391.09518; found (ESI, [M+H]+), 391.0938 3) [2-amino-3-(trifluoromethyl)phenyl][3-(4-methoxyphenoxy)phenyl]methanone: The title compound was prepared from (2-fluoro-3-trifluoromethylphenyl)-[3-(4-methoxy- phenoxy)-phenyl]methanone (.64g, .0015 mole) following the procedure of Example 457, Step 3: MS (ESI) m/z 388; 4) 3-benzyl-4-[3-(4-methoxyphenoxy)phenyl]-8-(trifluoromethyl)quinoline: The title compound was prepared from (2-amino-3-trifluoromethyI-phenyl)-[3-(4-methoxy- phenoxy)-phenyl]-methanone (.41 g, .0011 mole) and hydroC1nnamaldehyde (.21g, .0016 mole) following the procedure of, Example 457, Step 5. The crude product was purified by flash chromatography to give .33g of 3-benzyl-4-[3-(4- methoxyphenoxy)phenyl]-8-(irifluoromethyl)quinoline: MS (ES) m/z 485.9 192 WO 2005/058834 PCT/US2004/041399 EXAMPLE 517 4-{3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUlNOLIN-4-YL]PHENOXY}PHENOL The title compound was prepared from 3-benzyl-4-[3-(4-methoxyphenoxy)phenyl]-8-(trifluoromethyl)quinoline (.22g, .00045 mole) following the procedure of Example 457, Step 4. The crude product was purified by flash chromatography to give the title compound: mp 55-60 °C; MS (ES) m/z 469.9; HRMS: calcd for C29H20F3NO2 + H+, 472.15189; found (ESl, [M+H]+), 472.153 EXAMPLE 518 3-BENZYL-4-[3-(4-METHYLPHENOXY)PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from 1-Fluoro-2-trifluoromethyl-benzene and 3-p-Tolyloxy-benzaldehyde foilowing the procedure of Example 516. The crude product was purified by flash chromatography to give the title compound: MS m/z 470 EXAMPLE 519 3-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}BENZOIC ACID To [4-(3-hydroxy-pheny})-8-trifluoromethylquinolin~3-yl]-pheny] methanone (.1g, .00025 mole) and 3-carboxyphenyl boronic acid (.12g, .00072 mole) in 2 ml dichloromethane was added copper acetate (.091 g, .0005 mole) and triethylamine (.1ml, .00072 mole). This mixture was stirred at room temperature overnight. The reaction was then filtered and the filtrate evaporated to dryness. The crude product was purified by flash chromatography to give .027g of 3-[3-(3-benzoyl-8-trifIuoromethyl-quinolin-4-yl)-phenoxy]-benzoicacid: MS: MS (ESI) m/z 514; MS (ESI) m/z 512. 193 WO 2005/058834 PCT/US2004/041399 EXAMPLE 520 [4-(3-PHENOXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxy-phenyl)-8-trifIuoromethylquinolin-3-yl]-phenyl methanone and Phenyl boronic acid, following the procedure of Example 519: MS (ESI) m/z 470. EXAMPLE 521 4-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}BENZOIC ACID The title compound was prepared from [4-(3-hydroxy-phenyl)-8-trifluoromethylquinolin-3-yl]-phenyl methanone and 4-carboxyphenyl boronic acid, following the procedure of Example 519: MS (ESI) m/z 514; MS (ESI) m/z 512. EXAMPLE 522 [4-{3-[(6-METHOXYPYRIDIN-3-YL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLIN-3-YL](PHENYL)-METHANONE The title compound was prepared from [4-(3-hydroxy-phenyl)-8- trifluoromethylquinolin-3-yl]-phenyl methanone and 2-Methoxy-5-pyridineboronic acid, following the procedure of Example 519: MS m/z 501. EXAMPLE 523 [4-[3-(1H-lNDOL-5-YLOXY)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE The title compound was prepared from [4-(3-hydroxy-phenyl)-8-trifluoromethylquinolin-3-yl]-phenyl methanone and 5-lndolylboronic acid, following the procedure of Example 519: MS m/z 509; MS m/z 507 EXAMPLE 524 [4-[3-(1,3-BENZODiOXOL-5-YLOXY)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN- 3-YL](PHENYL)METHANONE 194 WO 2005/058834 PCT/US2004/041399 The title compound was prepared from [4-(3-hydroxy-phenyl)-8-trifluoromethylquinoiin-3-yl]-phenyl methanone and 3,4-(methylenedioxy) phenyl boronic acid, following the procedure of Example 519: MS m7z 514. EXAMPLE 525 METHYL-4-[(4-{3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENOXY}PHENOXY) METHYLJBENZOATE The title compound was prepared from 4-{3-[3-benzyl-8-(trifluoromethyl)quinoIin-4-yl]-phen-oxy}phenol (.1g, .0002 mole) and 4-Bromomethyl-benzoic acid methyl ester {.057g, .00024 mole) following the procedure of Example 478: MS (ESI) [M+H]+), 620.0. EXAMPLE 526 4-[(4-{3~[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}PHENOXY)METHYL] BENZOIC ACID The title compound was prepared from 4-{3-[3-benzyl-8~(trifluoromethyl)quinolin-4-yl]-phen-oxy}phenol (.1g, .0002 mole) and 4-Bromomethyl-benzoic acid methyl ester (.O57g, .00024 mole) with subsequent hydrolysis following the procedure of Example 515: MS (ES) m/z 603.9; HRMS: calcd for C37H26F3NO4 + H+, 606.18867; found (ESI, [M+H]+), 606.1894. EXAMPLE 527 METHYL-4-[(4-{3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4- YL]PHENOXY}PHENOXY)-ACETATE The title compound was prepared from 4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-phen-oxy}phenol and Bromo-acetic acid methyl ester following the procedure of Example 478: MS (ES) m/z 543.9. 195 WO 2005/058834 PCT/US2004/041399 EXAMPLE 528 (4-{3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}PHENOXY)ACETIC ACID The title compound was prepared from 4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-phen-oxy}phenol and Bromo-acetic acid methyl ester with subsequent hydrolysis following the procedure of Example 515: MS (ES) m/z 527.9. EXAMPLE 529 3-BENZYL-4-(3-BROMOPHENYL)-8-(TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from 1-Ruoro-2-trifluoromethyl-benzene and 3~ bromo-benzaldehyde following the procedure of Example 516, Steps 1-4. The crude product was purified by flash chromatography to give the title compound: MS (ESI) m/z 442; HRMS: calcd for C23H1sBrF3N + H+, 442.04127; found (ESI, [M+H]+), 442.0418. EXAMPLE 530 3-{343-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]-1,1I-BIPHENYL-4- YL)PROPANOIC ACID To a solution of 3-benzyl-4-(3-bromopheny[)-8-(trifluoromethyl)quinoIine (0.30g, 0.7 mmol), 4-(2-carboxyethyl) benzene boronic acid (0.15g, 0.75 mmol) in 15 ml DME under a nitrogen atmosphere is added terakistriphenyl phosphine palladium (0.08g, 0.07 mmol) followed by sodium carbonate (0.22g, 2.04 mmol) dissolved in 5 ml water. The reaction mixture was heated to reflux for 12 hr. The reaction was cooled, poured into 1N HC1 and extracted with EtOAc. The organic layer was dried and concentrated to provide the title compound as a tan solid (0.24 g, 70%): MS (ES) m/z 509.9; HRMS: calcd for C32H24F3NO2 + H+, 512.18319; found (ESI, [M+H]+), 512.1842; 196 WO 2005/058834 PCT/US2004/041399 EXAMPLE 531 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,6- DIFLUOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethy))quino)in-4-yl]phenyl}amine and 2,6-difIuorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 505. EXAMPLE 532 {3-[3-BENZYL-8-(TRJFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(3,3- DIFLUOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluorornethyl)quinolin-4-yl]phenyl}amine and 3,5-difluorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 505. EXAMPLE 533 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(3,4- DICHLOROBENZYL)AMlNE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinoIin-4-yl]phenyl}amine and 3,4-dichlorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 537. EXAMPLE 534 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYLK2,3- DICHLOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2,3-dichlorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 537. EXAMPLE 535 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL>(2,6- DICHLOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4- 197 WO 2005/058834 PCT7US2004/041399 yl]phenyl}amine and 2,6-dichlorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 537. EXAMPLE 536 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL}PHENYL}(5-CHLORO-2- NITROBENZYL)AM)NE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinoIin-4- yl]phenyl}amine and 5-chloro-2-nitro-benzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 548. EXAMPLE 537 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(4-BROMO-2- THIENYL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 4-bromo-2-formylthiophene according to the procedure of step 1, Example 66. MS (ESI) m/z553. EXAMPLE 538 {3-[3-BENZYL-8-(TRIFLUpROMETHYL)QUINOLIN-4-YL]PHENYL}(2,4- DlCHLOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2,4-Dichlorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 537. EXAMPLE 539 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2- FLUOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-fluorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 487. 198 WO 2005/058834 PCT/US2004/041399 EXAMPLE 540 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,3- DIFLUOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinblin-4-yl]phenyl}amine and 2,3-DtfIuorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 505. EXAMPLE 541 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}(2,3,6-. TRICHLOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2,3,6-trichlorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 571. EXAMPLE 542 2-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]-4-FLUOROPHENOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 5-fluoro-2-hydroxybenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 503; MS (ESI) m/z 501. EXAMPLE 543 4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4- YL]PHENYL}AMINO)METHYL]-2-ETHOXYPHENOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 5-ethoxy-4-hydroxybenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 529; MS (ESI) m/z 527. 199 WO 2005/058834 PCT/US2004/041399 EXAMPLE 544 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOL(N-4-YL]PHENYL}(2,3-DIHYDRO- 1,4-BENZODIOXlN-6-YLMETHYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinoIin-4-yl]phenyl}amine and 1,4-benzodioxan-6-carboxaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 527. EXAMPLE 545 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2-FLUORO-6- METHOXYBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-fluoro-6-methoxybenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 517. EXAMPLE 546 3-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]BENZENE-1,2-DIOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2,3-dihydroxybenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 501; MS (ESI) m/z 499. EXAMPLE 547 2-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QU)NOLIN-4- YL]PHENYL}AMINO)METHYL]-6-FLUOROPHENOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 3-fluoro-2-hydroxybenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 503; MS (ESI) m/z 501. EXAMPLE 548 2-[({3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]-6-ETHOXYPHENOL 200 WO 2005/058834 PCT/US2004/041399 The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinoiin-4-yl]phenyl}amine and 3-ethoxy-2-hydroxybenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 529; MS (ESI) m/z 527. EXAMPLE 549 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(1-METHYL-1H- INDOL-2-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 1-methylindole-2-carboxaldehyde according to the procedure of step 1, Example 66. MS (ESI) rn/z 522. EXAMPLE 550 -N-[4-(BENZYLOXY)-3-METHOXYBENZYL]-3-[3-BENZYL-8- (TRIFLUOROMETHYL)QUINOLIN-4-YL]ANILINE The title compound was prepared from {3-[3-benzyI-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 4-benzyloxy-3-methoxybenzaidehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 605. EXAMPLE 551 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(6- BROMOPYRIDIN-3-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 6-bromopyridine-3-carbaIdehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 548. EXAMPLE 552 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(2- CHLOROQUINOLIN-3-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-chloroquinoline-3-carboxaldehyde to the procedure of step 1, Example 66. MS (ESI) m/z 554. 201 WO 2005/058834 PCT/US2004/041399 EXAMPLE 553 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(6- METHOXYPYRIDIN-3-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 6-methoxypyridine-3-carbaldehyde to the procedure of step 1, Example 66. MS (ESI) m/z 500. EXAMPLE 554 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(6- CHLOROPYRIDlN-3-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 6-chloropyridine-3-carbaldehyde to the procedure of step 1, Example 66. MS (ESI) m/z 504. EXAMPLE 555 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,3,4- TRIMETHOXYBENZYL)AMlNE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2,3,4-trimethoxybenzaldehyde to the procedure of step 1, Example 66. MS (ESI) m/z 559. EXAMPLE 556 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(1H-INDOL-5- YLMETHYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 5-formylindole to the procedure of step 1, Example 66. MS (ESI) m/z 508. 202 WO 2005/058834 PCT/US2004/041399 EXAMPLE 557 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(1H-lNDOL-6- YLMETHYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenyl}amine and 6-formylindole to the procedure of step 1, Example 66. MS (ESI) m/z 508. EXAMPLE 558 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(1-ETHYL-1H- INDOL-6-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 6-formy-1-ethyllindole to the procedure of step 1, Example 66. MS(ESI)m/z536. EXAMPLE 559 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}t(1-METHYL-1H- INDOL-5-YL)METHYL]AMINE The title compound was. prepared from {3-[3-benzyI-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 5-formy-1-methyllindole to the procedure of step 1, Example 66. MS (ES) m/z 522.3. EXAMPLE 560 {3-[3-BENZYL-8-(TRlFLU.OROMETHYL)QU I NOLIN-4-YL]PHENYL}[(1 -METHYL-1H- INDOL-7-YL)METHYL]AMINE The title compound was prepared from -(3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 7-formy-1-methyllindo]e to the procedure of step 1, Example 66. MS (ES) m/z 522.3. 203 WO 2005/058834 PC1/US2004/041399 EXAMPLE 561 {3-[3-BENZYL-8- The title compound was preparod from {3-{3-benzy1-8-(trifluoromethyl)qijinolin-4-yl]phcnyl}amine and 7-formytindole to the procedure of step 1, Example 66. MS (ES) m/z 506.2. EXAMPLE 562 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YLlPHENYL}(1H-INDOL-4- YLME"1HYL)AMINE The title compound was preparod from {3-[3-benzyl-8-(trifluorornethy1)quinolin-4-y1jphenyl}amine and 4-formyiindole to tho procedure of step 1. Example 66. MS (ES) m/z 506.2. EXAMPLE 563 2-(4-({3-[3-BENZYL-8- Prepared using the procedure in Example 56 except using 3-(3-bon7y1-8- (trifluoromothyl)quinolin-4-yl)phonol and 2-{4-Bromomethyl-phcfiyl)-2-nu)thyl propionic acid methyl estor as the halide MS (ESI) ml/ {>i>6. EXAMPLE 564 2-(4-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYl.)PHENYL] PROPANOIC ACID Prepared using the procedure in Example 56 except using 3-[3-ben7yl-fi-(trrfluoromethy(lquinolin-4-yl]phenol and 2-(4-Bromomothyl-phenyl)-propionic nC1d ethyl ester as tho halide. MS (ESI) m/z 542 204 WO 2005/058833 PCT/US2004/041399 EXAMPLE 565 2-({3 (3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL)PHENOXY}METHYL)TEREPHTHALONITRILE The title compound was prepnred from 3-[3-benzyl-8-(trtfluoromelhy1)quinolin-4-yl]phenol and 2.5 dicyanobenzylbromide as in the procedure of Example 43. MS (ESI) m/z 520. EXAMPLE 566 3-BENZYL-4-(3-{(5-CHLORO-2-(TRIFLUOROMETHYL)BENZYLlOXY}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from 3-[3-benzyl-8-(trifluoromothy1)quinolin-4-yl]phenol and 5-chloro-2-trifluoromethylbenzyl bromide as in the procedure of hxample 43. MS (ESI) m/z 572. EXAMPLE 567 3-BENZYL-4-{3-{[5-FLUORO-2-(TRIFLUOROMETHYL)BFNZYL]OXY} PHENYL)-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from 3-{3-benzyl-8-{trifluoromethy1)quinolin-4-yl]phonol and 5-fluoro-2trifluoromethy1benzy1 bromide as in the procedure of Example 43 MS (ESI) m/z 556. EXAMPLE 568 (4-((1S) 1-{3-[3 BCNZYL-8(TRIFLUOROMETHYL)QUINOLIN-4- YL)PHFNOXY}ET HYL)PHENYL)ACETIC ACID The title compound was prepared using the procedure of example 69 using 3-[3-benzyl-8-(tnfluoromethyl)quiMolin-4-yl]phenol as the phenol and (4-(1-Hydroxy-ethyl)-phenyl}-acetic acid ethyl ester as the alcohol and isolated using chiral column chromatography MS (ESI) m/z 540 EXAMPLE 569 (4-(( 1R)- 1- {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4 YL]PHENOXY}ETHYI )PHENYL)ACETIC ACID 205 WO 2005/058834 PCT/US2004/041399 The title compound was prepared using the procedure of example 69 using 3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenol as the phenol and [4-(1-Hydroxy-ethyl)- phenyl]-acetic acid ethyl ester as the alcohol and isolated using chiral column chromatography. MS (ESI) m/z 540. 206 WO 2005/058834 PCT/US2004/041399 EXAMPLE 570 5-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]BENZYL}OXY)-1H- INDOLE-2- CARBOXYLIC ACID The title compound was prepared using trie procedure of example 69 using 5-Hydroxy-1H-indole-2-carboxylic acid methyl ester as the phenol and [3-(3-Benzyl-8-" trifluoromethyl-quinolin-4-yl)-phenyl]-methanol as the alcohol. MS (ESI) m/z 553. EXAMPLE 571 N-{3-[3-(2-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}- N'-PHENYLUREA The title compound was prepared from {3-[3-(2-methylphenyl)-8 (trifluoromethyl)quinolin-4-yl]phenyl}amine and phenyl isocyanate in substantially the same manner as described in Example 65; off-white solid: mp 192-195 °C; MS (El) m/z 498 (M+H)+. EXAMPLE 572 N-(2-CHLOROPHENYL)-N'-{3-[3-(2-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}UREA The title compound was prepared from {3-[3-(2-methyIphenyl)-8-(trifluoromethyl)quinolin-4-y}]phenyl}arnine and 2-chlorophenyl isocyanate in substantially the same manner as described in Example 65; off-white solid: mp 224-226 oC; MS (El) m/z 532 (M+H}+ EXAMPLE 573 N-(2-FLUOROPHENYL)-N'-{3-[3-(2-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}UREA The title compound was prepared from {3-[3-(2-methylphenyl)-8 (trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-fluorophenyl isocyanate in substantially the same manner as described in Example 65; off-white solid: mp 218- 220 °C; MS (El) m/z 516 (M+H)+. 207 WO 2005/058834 PCT/US2004/041399 EXAMPLE 574 N-(2-CHLOROPHENYL)-N'-{3-[3-(2-TRIFLUOROMETHYLPHENYL)-8- (TRIFLU0R0METHYL)QUIN0LIN-4- YL]PHENYL}UREA The title compound was prepared from {3-[3-(2-trifluorornethylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-chIorophenyl isocyanate in substantially the same manner as described in Example 65; off-white solid: rnp 230-232 oC; MS (El) m/z 587(M+H)+. EXAMPLE 575 [4-[3-(BENZYLTHlO)PHENYL]-8-(TRIFLUOROMETHYL)QUINOLIN-3- YL](PHENYL)METHANONE This compound was prepared according to the procedure of Example 1 step 5, substituting [3-(benzylthio)phenyl]boronic acid for phenyl boronic acid. MS (ESI) m/z 500([M+H]+). EXAMPLE 576 3-[4-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)PHENYL]PROPANOICACID The title compound was prepared from {3-[3-benzyI-8-(trifluoromethyl)qutnolin-4-yl]phenyl}amine and [4(2-ethoxycarbonylethyl)phenyl]boronic acid using the procedure of example 110 followed by hydrolysis with NaOH; MS (ESI) m/z 527([M+H]+). EXAMPLE 577 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-N-(2- FLUOROPHENYL)THIOUREA The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and 2-fluorophenyl isothiocyanate according to the procedure of Example 65. MS (ESI) m/z 546. 208 WO 2005/058834 PCT/US2004/041399 EXAMPLE 578 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-AT'-CYANO- A^-(2-FLUOROPHENYL)GUANIDINE A mixture of N-{3-[3-benzoyl-8-(trifluoromethyl)quinoIin-4-yl]pheny)}-N-(2-fluorophenyl)thiourea (0.10 g, 0.18 mmol), PbNCN (0.50 g, 2. 0 mmol) in 10 mL of acetonitrile/DME (1 ; 1) was heated to refluxforone hour. The solid was removed and the liquid was concentrated on vacuum. The crude material was purified by semi-preparative HPLC to give 11 mg of the title compound as an off-white solid. MS (ESI) m/z 554. EXAMPLE579 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL^N-(2- CHLOROPHENYL)-AT-CYANOGUANIDINE The title compound was prepared from N-{3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}-AT(2-chlorophenyl)thiourea according to the procedure of Example 578. MS (ES) m/z 567.9. EXAMPLE 580 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}-A^-(2- FLUOROPHENYL)GUANIDINE A mixture of -N-{3-[3-benzoyl-8-(trifluoromethyl)quinolin-4~yl]phenyl}-/Sf-(2 fluorophenyl)thiourea (0.10 g, 0.18 mmol), lead acetate (0.50 g, 1.13 mmol) in 10 mL of ethanol/~30% ammonium hydroxide (1 ; 1) was heated to reflux for one hour. The solid was removed and the liquid was concentrated on .vacuum. The crude material was purified by semi-preparative HPLC to give 45 mg of the title compound as an off-white solid. MS (ESI) m/z 527. EXAMPLE 581 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}-N- PHENYLTHIOUREA The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin 3-yl]-phenyl-methanone and phenyl isothiocyanate according to the procedure of Example 65. MS (ESI) m/z 526. 209 WO 2005/058834 PCT/US2004/041399 EXAMPLE 582 2-CHLOROPHENYL {3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}CARBAMATE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluorornethyl-quinolin-3-yl]-pheny)-methanone and 2-chlorophenyl chloroformate according to the procedure of Example 65. MS (ES) m/z 546.9. EXAMPLE 583 -N-{3-[3-BENZOYL-8-(TRIFLUOR0METHYL)QU)NOL)N-4-YL]PHENYL}-N-"-CYANO- . N-PHENYLGUANIDINE The title compound was prepared from -N-{3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-ylJphenyl}-N-phenylthiourea according to the procedure of Example 578. MS (ESI) m/z 534, 536. r EXAMPLE 584 {2-[4-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]BENZYL}OXY)PHENYL]-1,3-OXAZOL-4-YL}ACETIC ACID The title compound was prepared from [4-(4-hydroxy-phenyl)-oxazol-2-yl]-acetic acid ethyl ester and [4-[3-(hydroxymethyl)phenyl]-8-(trifluoromethy))quinolin-3 yl](phenyl)methanone according to the procedure of Example 69. MS (ESI) m/z 593, 595. EXAMPLE 585 -N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]BENZYL}-N-(2- FLUOROPHENYL)UREA Step 1: 4-[3-(2-Fluoro-phenyl)-ureidomethyl]-phenylboronic acid was prepared from 2-fluorophenyl isocyanate and 4-aminomethylphenylboronic acid HCL salt according to the procedure of Example 65. Step 2: The title compound was prepared from 4-[3-(2-Fluoro-phenyl)-ureidomethyl] phenylboronic acid and [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone according to the procedure of Example 1. MS (ES) m/z 541.9. 210 WO 2005/058834 PCT/US2004/041399 EXAMPLE 586 4-(3-{[3-CYANO-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]AMINO}PHENYL)-8- (TRIFLUOROMETHYL)QUlNOLlNE-3-CARBONITRILE Step 1: 4-Chloro-8-(trifluoromethyl)quinoline-3-carbonitrile was prepared from. 2-cyano-3-ethoxy-acrylic acid ethyl ester according to the procedure of Example 1. Step 2: The title compound was prepared from 4-chloro-8-(trifluoromethyl)quinoline-3-carbonitrile and 3-aminophenylboronic acid according to the procedure of Example 1 as a side product. MS (ES) m/z 531.8. EXAMPLE 587 4-(3-AMINOPHENYL)-8-(TRIFLUOROMETHYL)QUlNOLINE-3-CARBONITRlLE The title compound was prepared from 4-chloro-8-(trifluoromethyl)quinoline-3-carbonitrile and 3-aminophenylboronic acid according to the procedure of Example 1. MS (ES)/77/z 314.0. EXAMPLE 588 {4-[({3-[3-CYANO-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]PHENYL} ACETIC ACID The title compound was prepared from 4-(3-aminophenyl)-8-(trifluoromethyl)quinoline-3-carbonitrile according to the procedure of Example 66. MS (ES) m/z 459.9. EXAMPLE 589 -N-(2-CHLOROPHENYL)-N-{3-[3-CYANO-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}UREA The title compound was prepared from 4-(3-aminophenyl)-8 (trifluoromethyl)quinoline-3-carbonitrile and 2-chlorophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 464.8. 211 WO 2005/058834 PCT/US2004/041399 EXAMPLE 590 4-(3-HYDROXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLINE-3-CARBONITRILE The title compound was prepared from 4-chloro-8-(trifluoromethyl)quinoline-3-carbonitrile and 3-hydroxyphenylboronic acid according to the procedure of Example 1. HRMS: cafcd for C17H9F3N2O + H+, 315.07397; found (ESI, [M+H]+), 315.0752. EXAMPLE 591 [4-({3-[3-CYANO-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETIC ACID The title compound was prepared from 4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinoline-3-carbonitrile and 4-hydroxyphenyl acetic acid according to the procedure of Example 41. HRMS: calcd for C26H17F3N2O3 + H+, 463.12640; found (ESI, [M+H]+), 463.1242. EXAMPLE 592 {4-[({[4-{{3-[3-CYANO-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL] ACETYL}OXY)METHYL]PHENYL}ACET)C ACID The title compound was prepared from 4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinoline-3-carbonitrile and 4-hydroxyphenyl acetic acid according to the procedure of Example 41 as a di-alkylation product. HRMS: calcd for C35H25F3N2O5 + H+, 611.17883; found (ESI, [M+H]+), 611.1773. EXAMPLE 593 METHYL 2-{[({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}AMINO) CARBONYL]AMINO}BENZOATE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and methyl 2-isocyanatobenzoate according to the procedure of Example 65. MS (ES) m/z 567.9. 212 PCT/US2004/041399 WO 2005/058834 EXAMPLE 1594 ETHYL 3-{[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO) CARBONYL]AMINO}BENZOATE The title compound was prepared from [4-(3-amino-phenyl)-8-trifluoromethyi-quinor)n- 3-yl]-phenyl-methanone and ethyl 3-isocyanatobenzoate according to the procedure of Example 65. MS (ES) m/z 581.9. EXAMPLE 595 3-{3-[3-BEN2OYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}QUINAZOLINE-2,4(1H,3H)-D1ONE The title compound was prepared from methyl 2-{[({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino) carbonyl]arhino}benzoate and LiOH according to the procedure of Example 1. MS (ES) m/z 535.8. EXAMPLE 596 3-{[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}AMINO)CARBONYL] AMINO}BENZOIC ACID The title compound was prepared from methyl 3-{[({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino) carbonyl]amino}benzoate and LiOH according to the procedure of Example 1. MS (ES) m/z 553.9. EXAMPLE 597 4-(3-AMlNOPHENYL)-8-(TRIFLUOROMETHYL)QUlNOLINE-3-CARBOXAMlDE A mixture of 4-(3-aminophenyl)-8-(trifluoromethyl)quinolrne-3-carbonitrile (0.30, g, 0.96 mmol), 30% hydrogen peroxide (5 mL), NaOH (0.5 g, 12 mmol) and ethanol (15 mL) was heated to ~ 40 °C for 3 hours. The pH of the solution was adjusted to ~6 by diluted HC1. The reaction mixture was partitioned between ethyl acetate and water and the aqueous layer was extracted with ethyl acetate. The combined organic phases were washed with water, brine, and dried with magnesium sulfate. The organic phases were concentrated and the residue was loaded onto silica gel and chromatographed with hexanes:ethyl acetate (50% to 100%) to afford 0.13 g of the title compound as an off-white solid. MS (ESI) m/z 332; 213 WO 2005/058834 PCT/US2004/041399 EXAMPLE 598 {4-[({3-[3-(AMiNOCARBONYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMlNO)METHYL] PHENYL}ACETIC ACID The title compound was prepared from 4-(3-aminopheny))-8-(trifluoromethyl)quinoline-3-carboxamide according to the procedure of Example 66, MS (ESI) m/z 478, 480. EXAMPLE 599 [4-({3-[3-(AMINOCARBONYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETIC ACID The title compound was prepared from 4-(3-hydroxyphenyl)-8-(trifluoromethyl)quinoline-3-carboxamide according to the procedure of Example 41. MS (ESI) m/z 481. EXAMPLE 600 {4-[({[4-({3-[3-(AMINOCARBONYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETYL}OXY)METHYL]PHENYL}ACETiCAC)D The title compound was prepared from 4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinoline-3-carboxamide according to the procedure of Example 41 - as a dialkylated product. MS (ESI) m/z Q27, 629. EXAMPLE 601 ETHYL 4-(3-HYDROXYPHENYL)-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXYLATE The title compound was prepared from 4-chloro-8-trifluoromethyl-quinoline-3-carboxylic acid ethyl ester: and 3-hydroxyphenylboronic acid according to the procedure of Example 1. MS (ES) m/z 359.9. 214 WO 2005/058834 PCT/US2004/041399 EXAMPLE 602 ETHYL 4-(3-AMINOPHENYL)-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXYLATE The title compound was prepared from' 4-chloro-8-trifluoromethyl-quinoIine-3-carboxylic acid ethyl ester and 3-aminophenylboronic acid according to the procedure of Example 1. MS (ES) m/z 361.0; EXAMPLE 603 ETHYL 4-[3-({[(2-CHLOROPHENYL)AMJNO]CARBONYL}AMINO)PHENYL]-8- (TRlFLUORdMETHYL)QUINOUNE-3-CARBOXYLATE The title compound was prepared from ethyl 4-(3-aminophenyl)-8-(trifluoromethyl)qtiinoline-3-carboxylate and 2-chlorophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 511.9. EXAMPLE 604 4-{3-[(2-FLUOROBENZYL)OXY]PHENYL}-8-(TRIFLUOROMETHYL)QUINOLINE-3- CARBOXYLIC ACID The title compound was prepared from ethyl 4-(3-hydroxyphenyl)-8- (trifluoromethyl)quinoline-3-carboxylate and 2-fluorobenzyl bromide according to the procedure of Example 41. MS (ES) m/z 439.9. EXAMPLE 605 4-[3-({[(2-CHLOROPHENYL)AMINO]CARBONYL}AMINO)PHENYL]-8- (TRIFLUOROMETHYL) QUINOLlNE-3-CARBOXYLIC ACID The title compound was prepared from ethyl 4-(3-aminophenyl)-8-(trifluoromethyl)quinoline-3-carboxylate and 2-chlorophenyl isocyanate according to the procedure of Example 65. MS (ES) m/z 483.9. 215 WO 2005/058834 PCT/US2004/041399 EXAMPLE 606 METHYL 2-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL)PHENYL]-3-[4-(2-METHOXY-2- OXOETHYL)PHENYL]PROPANOATE The title compound was prepared from [4-(3-hydroxyphenyl)-8-(trifIuoromethy))quinolin-3-yl](phenyl)methanone and (4-bromomethyl-phenyl)-acetic acid methyl ester according to the procedure of Example 41. MS (ESI) m/z 718; HRMS: calcd for C43H34F3NO6 + H+, 718.24110; found (ESI, [M+H]+), 718.2444. EXAMPLE 607 2-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL)PHENYL]-3~[4-(CARBOXYMETHYL)PHENYL]PROPANOIC ACID The title compound was prepared from methyl 2-[4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]-3-[4-(2-methoxy-2-oxoethyl)phenyl]propanoate by LiOH hydrolysis. MS (ES) m/z 688.0. EXAMPLE 608 2-[4~({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL3PHENOXY}METHYL)PHENYL]-2-PROP-2-YN-1 -YLPENT-4-YNOIC ACID The title compound was prepared from{4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}methyl)phenyl]acetic acid methyl ester and propargyl bromide according to the procedure of Example 41. MS (ESI) m/z 618. EXAMPLE 609 2-[4-({3-[3-BENZOYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]-3-(4-rE/?T-BUTYLPHENYL)PROPANOICACID The title compound was prepared from[4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}methyl)phenyl]acetic acid methyl ester and 4-tert-butylbenzyl bromide according to the procedure of Example 41. MS (ES) m/z 688.1. 216 WO 2005/058834 PCT/US2004/041399 EXAMPLE 610 2-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]-3-(4-NITROPHENYL)PROPANOlC ACID The title compound was prepared from[4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}methyl)phenyl]acetic acid methyl ester and 4-nitrobenzyI bromide according to the procedure of Example 41. MS m/z 677; EXAMPLE 611 2-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]-3-BIPHENYL-4-YLPROPANOICACID The title compound was prepared from[4-({3-[3-benzoyl-8-(trifluoromethyl)qu(nolin-4- yl]phenoxy}methyl)phenyl]acetic acid methyl ester and 4-bromomethylbiphenyl according to the procedure of Example 41. MS m/z 708. EXAMPLE 612 2-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]-3-PHENYLPROPANOIC ACID The title compound was prepared from[4-({3-[3-benzoyl-8-(trifluorornethyl)quinolin-4- yl]phenoxy}methyl)phenyl]acetic acid methyl ester and benzyl bromide according to the procedure of Example 41. MS (ES) m/z 632. EXAMPLE 613 2-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]-3,3-DIPHENYLPROPANOICACID The title compound was prepared from[4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4- yl]phenoxy}methyl)phenyl]acetic acid methyl ester and bromodiphenylmetbane according to the procedure of Example 41. MS (ESI) m/z 708. 217 WO 2005/058834 PCT/US2004/041399 EXAMPLE 614 {4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}THIO)METHYL]PHENYL}ACETICACID Step 1: 3-(4-Carboxymethyl-benzylsulfanyl)phenylboronic acid was prepared from 4-(bromomethyl)phenyl acetic acid and 3-mecaptophenylboronic acid according to the procedure of Example 41. Step 2: The title compound was prepared from 3-(4-carboxymethyl-benzylsulfanyl)phenylboronic acid and [4-chloro-8-(trifluoromethyl)quinolin-3-yl](phenyl)methanone according to the procedure of Example 1. MS (ES) m/z 541.9. EXAMPLE 615 {4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}SULFONYL)METHYL]PHENYL} ACETIC ACID 30% Hydrogen peroxide was added slowly to a stirred solution of {4-[({3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}thio)methyl]phenyl}acetic acid (70 mg) in 10 mL of acetic acid at 60 °C. After being stirred at 60 °C for one hour the solution was poured into ice-water and the solid was collected to give the title compound as a white solid. HRMS: calcd for C32H24F3NO4S + H+, 576.14509; found (ESI, [M+H]+), 576.1445. EXAMPLE 616 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,3- DlMETHOXYBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluqromethyl)quinolin-4-yl]phenyl}amine and 2,3-dimetnoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 529; EXAMPLE 617 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,5- DICHLOROBENZYL)AMlNE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2,4-dichloro-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 537. 218 PCT/US2004/041399 WO 2005/058834 EXAMPLE 618 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(3- PHENOXYBENZYL)AMlNE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 3-phenoxy-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 561.1. EXAMPLE 619 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOL)N-4-YL]PHENYL}(2,5- DIMETHOXYBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]pheny(}amine and 2,5-dimethoxy-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 529.1. EXAMPLE 620 2-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMlNO)METHYL]-4-CHLOROPHENOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-chloro-5-hydroxy-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 517.0; EXAMPLE 621 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(3,4- DIMETHOXYBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluorornethyl)quinolin-4-yl]phenyl}amine and 3,4-dimethoxy-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 529.1. 219 WO 2005/058834 PCT/US2004/041399 EXAMPLE 622 3-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AM)NO)METHYL]-4-NITROPHENOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4~ yl]phenyf}amine and 5-hydroxy~2-nitro-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 528.0. EXAMPLE 623 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YLlPHENYL}(4,5- DIMETHOXY-2-NITROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinoliri-4-y)]pheny)}amine and 4,5-dimethoxy-2-nitro-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 57'4.1. EXAMPLE 624 2-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}AMINO)METHYL]-4-BROMOPHENOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethy()quinolin-4-yl]phenyl}amine and 5-bromo-2-|hydroxy-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 560.9. EXAMPLE 625 2-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]-5-METHOXYPHENOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yljphenyl}amine and 2-hydroxy-4-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 513. 220 PCT/US2004/041399 WO 2005/058834 EXAMPLE 626 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}{[4- (DIMETHYLAMINO)-1-NAPHTHYL]METHYL}AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 4-dimethylamino-naphthalene-1-carbaIdehyde according to the procedure of Example 66. MS (ESI) m/z 562.; EXAMPLE 627 2-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]-4-METHOXYPHENOL The title compound was prepared from {3-[3-benzyi-8-(trifluoromethyl)quinoKn-4~ yl]phenyl}amine and 2-hydroxy-5-methoxy-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 513.0. EXAMPLE 628 4-[({3-t3-BENZYL-8-(TRIFLUOROMETHYL)QUfNOLIN-4- YL]PHENYL}AMINO)METHYL]BENZENE-1,2-DIOL The title compound was prepared from {3-[3-benzyI-8~(trifluoromethyl)quinolin-4-yl]phenyl}amine and 3,4-dihydroxy-benzaldehyde according to the procedure of Example 66. MS (ES) m/z499.0. EXAMPLE 629 2-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]PENT-4-ENOIC ACID The title compound was prepared from[4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]acetic acid methyl ester and propargyl bromide according to the procedure of Example 41. MS (ESl) m/z 582. EXAMPLE 630 2-[4-({3-[3-BENZOYL-8-(TR(FLUOROMETHYL)QUINOLlN-4- YL]PHENOXY}METHYL)PHENYLJHEX-4-YNOlCACID The title compound was prepared from[4-({3-[3-benzoyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyJ)phenyl]acetic acid methyl ester and 1-bromo-but-2-yne according 221 PCTAJS2004/041399 WO 2005/058834 to the procedure of Example 41. MS (ESI) m/z 594; HRMS: calcd for C36H26F3NO4 + H+, 594.18867; found (ESI, [M+H]+), 594.1869; EXAMPLE 631 2-[4-({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]HEPT-4-YNOICACID The title compound was prepared from[4-({3-[3-benzoyl~8-(trif)uoromethyl)quinolin-4-yl]phenoxy}methyl)pheny)]aceticacid methyl ester and 1-bromo-pent-2-yne according to the procedure of Example 41. MS (ESI) m/z 608. HRMS: calcd for C37H28F3NO4 + H+, 608.20432; found (ESI, [M+H]+), 608.2075; EXAMPLE 632 2-[4-({3~[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENOXY}METHYL)PHENYL]-2-PENT-2-YN-1 -YLHEPT-4-YNOlC ACID The title compound was prepared from[4-({3-[3-benzoyl-8-(trifluoromethyl)quino(in-4-yl]phenoxy}methyl)phenyljaceticacid methyl ester and 1-bromo-pent-2-yne according to the procedure of Example 41. HRMS: caicd for C42H34F3NO4 + H+, 674.25127; found (ESI, fM+H]+), 674.2532. EXAMPLE 633 {3-t3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2-FLUORO-3- METHOXYBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-fluoro-3-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 517. EXAMPLE 634 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[3- (TRIFLUOROMETHYL)BENZYL] AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quino)in~4-yl]phenyl}amine and 3-trifluoromethyl-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 537. 222 PCT/US2004/041399 WO 2005/058834 EXAMPLE 635 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(5-FLUORO-2- METHOXYBENZYQAMINE The title compound was prepared from {3-[3-benzyi-8-(trifluoromethyl)quinorrn-4-yl]phenyl}amine and 5-fluoro-2-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 517. EXAMPLE 636 2-t({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]-4-IODOPHENOL The title compound was prepared from {3-[3-benzyI-8-(trifluoromethyl)quino1in-4-yl]phenyl}amine and 5-iodo-2-hydroxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 611. EXAMPLE 637 {3-(3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}(3,4- DlETHOXYBENZYL)AM)NE The title compound was prepared from {3-[3-benzyl-8-(trifluorarnethyl)quinolin-4-yl]phenyl}amine and 3,4-diethoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 557. EXAMPLE 638 N-[2-(BENZYLOXY)-3-METHOXYBENZYL]-3-[3-BENZYL-8- (TRlFLUOROMETHYL)QUINOLIN-4-YL3ANILINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-benzyloxy-3-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 605. EXAMPLE 639 W,N-DIBENZYL-3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]ANILINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 559. 223 WO 2005/058834 PCT/US2004/041399 EXAMPLE 640 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHE(SIYL}BIS(3- METHYLBENZYL)AM1NE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenyl}amine and 3-methylbenzaldehyde according to the procedure of Example 66. MS (ESI) m/z 587. ; EXAMPLE 641 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLiN-4-YL]PHENYL}BIS(2-ETHOXY- 3-METHOXYBENZYL)AMINE The title compound was prepared from {3~[3-benzyl~8-(trifluoromethyl)quinolin-4~ yl]phenyl}amine and 2-ethoxy-3-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 707. EXAMPLE 642 -N-BENZYL-3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLlN-4-YL]ANILINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 469. EXAMPLE 643 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(3- METHOXYBENZYL)AMlNE The title compound was prepared from {3-[3-benzyI-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 3-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 498. EXAMPLE 644 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(4- METHOXYBENZYL)AMlNE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 4-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 499. 224 WO 2005/058834 PCT/US2004/041399 EXAMPLE 645 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2-ETHOXY-3- METHOXYBENZYL) AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluorornethyl)quinolin-4-yl]phenyl}amine and 2-ethoxy-3-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 543. EXAMPLE 646 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}(3-CHLORO-4- FLUOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 3-chloro-2-fluoro-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 521. EXAMPLE 647 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(3-CHLORO-4- , METHOXYBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 3-chloro-4-methoxy-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 533. llEXAMPLE 648 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(3-CHLORO-2- FLUOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 3-chloro-2-fluoro-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 521. 225 WO 2005/058834 PCT/US2004/041399 EXAMPLE 649 2-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMlNO)METHYL]-4-(TRIFLUOROMETHOXY)PHENOL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinoIin-4- yl]phenyl}amine and 2-hydroxy-3-trifluoromethyl-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 569; EXAMPLE 650 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[5-CHLORO-2- (TRIFLUOROMETHYL)BENZYL]AM1NE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 5-chloro-2-trifluoromethyl~benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 571. EXAMPLE 651 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[5-FLUORO-2- (TRIFLUOROMETHYL)BENZYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 5-fluoro-2-trifluoromethyl-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 555. EXAMPLE 652 3-BENZYL-4-{3-[(2,5-DIMETHYLPHENOXY)METHYL]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}methanol and 2,5-dimethylphenol according to the procedure of Example 69. MS (ESI) m/z 498. 226 WO 2005/058834 PCT/US2004/041399 EXAMPLE 653 3-BENZYL-4-(3-{[2-FLUORO-3-(TR)FLUOROMETHYL)PHENOXY]METHYL}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from {3-[3-benzyl-8-(frifluoromethyl)quinolin-4-yl]phenyl}methanol and 2-fluoro-3~trifluoromethylphenol according to the procedure of Example 69. MS (ESI) m/z 556. EXAMPLE 654 3-BENZYL-443-[(2,3-DlMETHYLPHENOXY)METHYL]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}methanol and 2,3-dimethylpheno] according to the procedure of Example 69. MS (ESI) m/z 498. EXAMPLE 655 3-BENZYL-4-(3-{[2-CHLORO-3-(TRIFLUOROMETHYL)PHENOXY]METHYL}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quino)in-4-yl]phenyl}methanol and 2-chloro-3-trifluoromethylphenol according to the procedure of Example 69. MS (ESI) m/z 572. EXAMPLE 656 3-BENZYL-4-{3-[(1 -METHYL-1 H-PYRROL-2-YL)METHOXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE The title compound was prepared from 3-[3-benzyi-8-(trifluorornethyl)quinolin-4-yl]phenol and (1-methyl-1H-pyrrol-2-yl)-methanol according to the procedure of Example 69. MS (ESI) m/z 473. WO 2005/058834 PCT/US2004/041399 EXAMPLE 657 METHYL [5-({4-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4- YL)PHEN0XY}METHYL)-1 -METHYL-1H-PYRROL-2-YL]ACETATE The title compound was prepared from 3-[3-benzyl-8-(trifluoromethyl)quinolin~4- yl]phenol and (5-hydroxymethyl-1-methyl-1H-pyrrol-2-yl)-acetic acid methyl ester according to the procedure of Example 69. MS (ESI) m/z 545. EXAMPLE 658 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2- THlENYLMETHYL)AMlNE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and thiophene-2-carbaldehyde according to the procedure of' Example 66. MS (ES) m/z 475.2. EXAMPLE 659 {2-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]-3-THlENYL}ACETIC ACID The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and (2-formyl-thiophen-3-yl)-acetic acid methyl ester according to the procedure of Example 66. MS (ES) m/z 531.1. EXAMPLE 660 {5-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]-2-THIENYL}ACETICACID The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and (5-formyl-thiophen-3-yl)-acetic acid methyl ester according to the procedure of Example 66. MS (ES) m/z 533.1. 228 WO 2005/058834 PCTYUS2004/041399 EXAMPLE 661 (5Z)-5-{4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}AMINO)METHYL]BENZYLIDENEM,3-THIAZOLlDINE-2,4-DlONE The title compound was prepared from {3-[3-benzyl-8-(trifiuoromethyl)quinolin-4- yl]phenyl}amine and 4-(2,4~dioxo-thiazolidin-5-ylidenemethyl)-ben2aldehyde according to the procedure of Example 66. MS (ES) m/z 594.1. EXAMPLE 662 (5Z)-5-{4-[({3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]BENZYLIDENE}-2-THIOXO-1,3-THIAZOLIDIN-4- ONE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 4-(4-oxo-2-thioxo-thiazolidin-5-yIidenemethyl)-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 610.0. EXAMPLE 663 5-{4-[({3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLlN-4- YL]PHENYL}AMINO)METHYL]BENZYL}-1,3-THlAZOLIDINE-2,4-DIONE Treatment of (5Z)-5-{4-[({3~[3-benzyl-8-(trifluoromethyl)quinolin-4- yl]phenyl}amino)methyl] benzylidene}-1,3-thiazolidine-2,4-dione with LiBH4 in pyridine gave the title compound. MS (ES) m/z 596.1 (M-1). EXAMPLE 664 5-{4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLlN-4-YL]PHENYL}AMINO)METHYL]BENZYL}-2~THIOXO-1.3-THIAZOLID1N-4-ONE Treatment of (5Z)-5-{4-[({3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino) methyl] benzylidene}-2-thioxo-1,3-thiazolidin-4-one with LiBH4 in pyridine gave the title compound. HRMS: calcd for C34H26F3N3OS2 + H+, 614;15421; found (ESI, [M+KD, 614.1539. 229 WO 2005/058834 PCT/US2004/041399 EXAMPLE 665 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}[(4- FLUOROBfPHENYL-3-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 4-fluoro-biphenyl-3-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 563.0. EXAMPLE 666 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLlN-4-YL]PHENYL}(2,2 YLMETHYL)AMINE The title compound was prepared from {3-[3-benzyl-8~(trifluoromethyl)quinolin-4-yl]phenyl}amine and [2,2']bithiophenyl-5-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 557.0. EXAMPLE 667 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(3-FLUORO-4'- METHOXYBIPHENYL-4-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifiuoromethyl)quinolin-4-yl]phenyl}amine and 3-fluoro-4'-methoxy-biphenyl-4-carbaldehyde according to the procedure of Example 66. MS (ESI) m/z 593. EXAMPLE 668 3'-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AMINO)METHYL]-4'-FLUOROBIPHENYL-4-OL The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 4-fluoro-4'-hydroxy~biphenyl-3-carbaldehyde according to the procedure of Example 66. MS (ESI) m/z 579. 230 WO 2005/058834 PCT/US2004/041399 EXAMPLE 669 {3-[3-BENZYL-8-(TRIFLUOROMETHYli)QUINOLlN-4-YL]PHENYL}(3- METHYLBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 3-methyl-benzaldehyde according to the procedure of Example 66. MS (ES) m/z 483.1. EXAMPLE 670 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,4- DIMETHYLBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2,4-dimethyl-benzaldehyde according to the procedure of Example 66. MS (ESI) m/z 497. EXAMPLE 671 N-[(1 -ACETYL-1 H-INDOL-3-YL)METHYL]-3-[3-BENZYL-8- (TRIFLUOROMETHYL)QUINOLlN-4-YL]ANILINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 1-acetyl-1H-indole-3-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 550.0. EXAMPLE 672 N,N-BIS[(1 -ACETYL-1 H-INDOL-3-YL)METHYL]-3-[3-BENZYL-8- (TRIFLUOROMETHYL)QUlNOLIN-4-YL]ANlLlNE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 1-acetyl-1H-indole-3-carbaldehyde according to the procedure of Example 66. MS (ES) m/z 721.1. 231 WO 2005/058834 PCT/US2004/041399 EXAMPLE 673 3-BENZYL-4-{3-[(1 -METH YL-1 H-lNDOL-3-YL)METHOXY]PHENYL}-8- (TRIFLUOROMETHYL) QUINOLINE The title compound was prepared from 3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yljphenoi and (1-methyl-1H-indol-3-yl)-methanol according to the procedure, of Example 69. MS (ES) m/z 523.1. EXAMPLE 674 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[2-FLUORO-5- (1 H-PYRROL-2-YL)BENZYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2-(4-fluoro-3-formyl-phenyl)-pyrrole-1-carboxylic acid tert-butylamide according to the procedure of Example 66. MS (ES) m/z 552.0; EXAMPLE 675 3-BENZYL-4-{3-[(1~METHYL-1 H-INDOL-7-YL)METHOXY]PHENYL}-8- (TRIFLUOROMETHYL) QUINOLINE The title compound was prepared from 3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yljphenol and (1-methyl-1H-indol-7-yl)-methanol according to the procedure, of Example 69. MS (ES) m/z 523.6. EXAMPLE 676 3-BENZYL-4-(3-ETHYNYL-PHENYL)-8-TRIFLUOROMETHYL-QUINOLINE 1) A solution of 3-benzyl-4-(3-bromo-phenyl)-8-trifluoromethyI-quinoline (1.0 g, 23 mmol) and trimethyl-tributylstannanytethynyl-silane (1.3 g, 34 mmol) in toluene (25 mL) is treated with Pd(PPh3)4 (270 mg) and heated at 120 °C for 3 h. The reaction is then cooled and concentrated in vacuo. The residue is chromatographed with 10:90 ethyl acetate:hexane to afford 3-benzyl-8-trifluoromethyl-4-(3-trimethylsilanylethynyl- phenyl)-quinoline as an oil. MS (ESI) m/z 460.0. 2) A solution of the above oil, 3-benzyl-8-trifluoromethyl-4-(3-trimethylsilanylethynyl- phenyl)-quinoline (730 mg, 1.6 mmol) and potassium carbonate (220 mg, 1.6 mmol) in methanol (30 mL) is stirred at ambient temperature for 3 h. The reaction mixture is stripped to dryness and the residue taken up in ethyl acetate and washed with 30 mL 232 WO 2005/058834 PCT/US2004/041399 (1N HC1). The.organic layer is dried and concentrated in vacuo to provide after chromatography 870 mg (80%) of the title compound: MS (ESI) m/z 388 EXAMPLE 677 3-BENZYL-4-(3-PHENYLETHYNYL-PHENYL)-8-TRIFLUOROMETHYL-QU)NOLINE A solution of 3-benzyl-4-(3-ethynyl-phenyl)-8-trifluoromethyl-quinoIine (80 mg, 0.2 mmol), iodobenzene 84 mg, 0.4 mmol), piperidine (80 mg, 0.9 mmol) in toluene (2.0 mL) is treated with Pd(C1)2(PPh3)2 (8.0 mg) and heated at 90 °C for 3 h. The reaction' is then cooled and concentrated in vacuo. The residue is taken up in ethyl acetate and washed with 10 mL (1N HC1). The organic layer is dried and concentrated in vacuo to provide after chromatography 72 mg (75%) of the title compound. MS (ES) m/z 464.1 EXAMPLE 678 [4-(2-{3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLlN-4- YL]PHENYL}ETHYL)PHENYL]ACETICACID A solution of [4-({3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}ethynyl)-phenyl]acetic acid (50 mg, 0.09 mmol), in ethyl acetate:acetic acid (8:1, 4.0 mL) is treated with Pd/C(10%) (3 mg) and placed on a PARR hydrogenator under 40 psi H2 The reaction filtered through celite and concentrated in vacuo. After chromatography (ethyl acetate:hexane, 33:70) the title saturated compound is obtained, 40 mg (80%). MS (ES) m/z 524.1 Examples 679 to 694 were prepared using similar procedure to Example 676. Example Name MS Example679 [4-({3-[3-benzyl-8-(trifluoromethyl)quinolin-4-Yl]phenyl}ethynyl)phenyllacetic acid MS (ES) m/z 522 A; Example 680 ethyl 3-({3-[3-benzyl-8-(trifluoromethyl)quinol(n-4-yf|phenyl}ethynyl)benzoate MS (ES) m/z 536.2; 233 WO 2005/058834 PCT/US2004/041399 Example 681 3-({3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}ethynyl)benzoic acid MS (ESI) m/z 506.1 (M+H)+ Example 682 methyl 4-({3^[3-benzyl-8-(trifluoromethyl)quinoIin-4-yllphenyl}ethynyl)benzoate MS (ES) m/z 522.1; Example 683 4-({3-[3-benzyl~8-(trifluoromethyl)quinolin-4-yl]phenyl}ethynyl)benzoic acid MS Example 685 methyl 3-[4-({3-[3-benzy)~8-(trifluoromethyl)quinolin-4-yl]phenyl}ethynyl)phenyl]propanoate MS (ES) m/z 550.2; Example 686 [3-({3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}ethynyl)phenyl]aceticacid MS (ES) m/z 522.1; Example 687 3-[3-({3-[3-benzyl-8-(trifluoromethy))quinolin-4-yl]phenyl}ethynyl)phenyl]propanoic acid MS (ES) m/z 534.1; Example 688 methyl 3-[3-({3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yllphenyl}ethynyl)phenyl]propanoate MS (ES) m/z 550.2; Example 689 3-benzyl-4-{3-[(2-fluorophenyl)ethynyl]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 482; Example 690 . 3-benzyl-4-{3-[(2-chlorophenyl)ethynyl]phenyl)-8-(trifluorom ethyl )qui noline MS (ESl) m/z 498; Example 691 3-benzyl-4-{3-[(4-bromophenyl)ethynyl]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 542; 234 W0 2005,058834 PCT/US2004/041399 Example 692 3-benzyl-4-{3-[(2,5-dichlorophenyl)ethynyl]phenyl}-8-(trifluoromethyf)quinoline MS (ESI) m/z 532; Example 693 3-benzyi-4-{3-[(2,4-dichlorophenyl)ethynyl]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 523; Example 694 3-benzyl-4-{3-[(3,4-dichlorophenyl)ethynyl]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 532; EXAMPLE 695 3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]METHYL}PHENOL 1) A stirred mixture of 3-benzyl-4-bromo-8-(trifluoromethyl)quinoline (10.0 g, 27.31 mmol) and (3-methoxyphenyl)acetonitrile (5.57 ml_, 40.96 mmol) in THF (100 mL) is treated with NaH (1.64 g, 41.0 mmol, 60% dispersion in oil). After 0.5 h at ambient temperature, the reaction is heated at 50 °C for 2 h. The cooled reaction is diluted with water, extracted with ethyl acetate, and the combined extracts are dried (MgSO4) and concentrated. The residue is purified via column chromatography using 10:90 ethyl acetate.hexane as the eluent. The purified product is dissolved in a mixture of methylene chloride and hexane and concentrated until preC1pitation commences. After preC1pitation is complete, [3-benzyl-8-(trifluoromethyl)quinolin-4- yl](3-methoxyphenyl)acetonitrile is isolated as an off- white crystalline solid (5.18 g, 44%). HRMS: calcd for C26H19F3N2O + H+, 433.15222; found (ESI, [M+H]+), 433.1528. 2) [3-BenzyI-8-(trifluoromethyl)quinolin-4-yl](3-methoxyphenyl)acetonitrile (5.14 g, 11.88 mmol) in 48% HBr (75 mL) is heated at 90 °C for 65 h. Cooled reaction is poured into concentrated ammonium hydroxide (50 mL) diluted with water and ice. The mixture is extracted with ethyl acetate and the combined extracts are dried (MgSO4) and concentrated. The residue is purified via column chromatography using 15:85 ethyl acetate:hexane as the eluent to afford the title compound as a yellow powder (3.91 g, 84%). HRMS: calcd for C24H18F3NO + H+, 394.14132; found (ESI, [M+H]+), 394.1404. 235 WO 2005/058834 PCT/US2004/041399 EXAMPLE, 696 METHYL 3-[(3-{[3~BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4 YL]METHYL}PHENOXY)METHYL]BENZOATE 3-{[3~Benzyl-8-(trifluoromethyl)quino)in-4-yl]methyl}phenoI (0.100 g, 0.254 mmol), methyl 3-bromomethylbenzoate (0.058 g, 0.254 mmol) and Cs2CO3 (0.331 g, 1.02 mmol) in acetonitrile (4 mL) are stirred 18 h. The reaction is filtered and then purified using Prep HPLC (10 to 100% acetonitrile/water gradient) to afford 0.070 g of the title compound as a colorless oil. 1H NMR (CDC13) d 8.96 (s, 1H), 8.12 (d, J= 8.6 Hz, 1H), 8.02 (m, 2H), 7.97 (d, J= 7.7 Hz, 1H), 7.5 (m, 2H), 7.42 (m, 1H), 7.18 (m, 6H), 6.80 (dd, J - 8.2 and 2.0 Hz, 1H), 6.63 (d, J = 7.7 Hz, 1H), 6.51 (s, 1H), 4.96 (s, 2H), 4.45 (s, 2H), 4.19 (s, 2H), 3.92 (s, 3H). EXAMPLE 697 METHYL 4-[(3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4 YL]METHYL}PHENOXY)METHYL]BENZOATE This compound is prepared according to the procedure of Example 696 using methyl 4-bromomethylbenzoate as the alkylating agent. 1H NMR (CDC13) d 8.96 (s, 1H), 8.09 (d, J= 7.9 Hz, 1H), 8.00 (m, 3H), 7.49 (m, 1H), 7.36 (d, J- 8.4 Hz, 2H), 7.18 (m, 6H), 6.78 (dd, J = 2.0, 8.2 Hz, 1H), 6.64 (dd, J = 0.7, 7.7 Hz, 1H), 6.47 (s, 1H), 4.96 (s, 2H), 4.45 (s, 2H), 4.17 (s, 2H), 3.92 (s, 3H). EXAMPLE 698 ETHYL {3-[(3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4 YL]METHYL}PHENOXY)METHYL]PHENYL}ACETATE . This compound is prepared according to the procedure of Example 696 using ethyl 3-bromomethylphenyJ acetate as the alkylating agent. 1H NMR (CDC13) d 8.96 (s, 1H), 8.13 (d, J= 8.6 Hz, 1H), 8.02 (d, J = 7.2 Hz, 1H), 7.51 (m, 1H), 7.23 (m, 8H), 7.10 (d, J = 7.5 Hz, 2H), 6.80 (d, J = 8.2 Hz, 1H), 6.61 (d, J = 7.5 Hz, 1H), 6.53 (s, 1H), 4.91 (s, 2H), 4.45 (s, 2H), 4.19 (s, 2H), 4.14 (m, 2H), 3.6 (s, 2H), 1.24 (m, 3H). 236 WO 2005/058834 PCT/US2004/041399 EXAMPLE 699 METHYL {3-{3-[(3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOUN-4 YL]METHYL}PHENOXY)METHYL]PHENYL}PROPANOATE This compound is prepared according to the procedure of Example 695 using methyl (3-bromomethylphenyl)propanoate as the alkylating agent 1H NMR (CDCI3): d 8.96 (s, 1H), 8.13 (d, J = 8.6 Hz, 1H), 8.02 (d, J = 7.3 Hz, 1H), 7.50 (m, 1H), 7.18 (m, 10H), 6.80 (dd, J = 2.3, 8.2 Hz, 1H), 6.61 (d, J = 7.7 Hz, 1H), 6.53 (s, 1H), 4.89 (s, 2H), 4.45 (s, 2H), 4.19 (s, 2H), 3.65 (s, 3H), 2^94 (m, 2H), 2.60 (m, 2H). EXAMPLE 700 METHYL {3-[(34I3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4 YL]METHYL}PHENOXY)METHYL]PHENOXY}ACETATE The title compound is isolated as a colorless oil prepared according to the procedure of Example 696 except using methyl (3-bromomethylphenoxy)acetate as the alkylating agent 1H NMR (CDCI3): d 8.96 (s, 1H), 8.11 (d, J = 8.5 Hz, 1H), 8.02 (d, J = 7.2 Hz, 1H), 7.51 (m, 1H), 7.18 (m, 7H), 6.90 (br s, 2H), 6.80 (m, 2H), 6.61 (d, J -7.7 Hz, 1H), 6.50 (s, 1H), 4.89 (s, 2H), 4.61 {s, 2H), 4.44 (s, 2H), 4.18 (s, 2H), 3.78 (s, 3H). EXAMPLE 701 METHY L{4-[(3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOUN-4- YL]METHYL}PHENOXY)METHYL]PHENOXY}ACETATE This colorless oil is prepared according to the procedure of Example 696 using methyl (4-bromomethylphenoxy)acetate as the alkylating agent. 1H NMR (CDC13): d 8.96 (s, 1H), 8.14 (d, J = 8.6 Hz, 1H), 8.03 (d, J = 7.3 Hz, 1H), 7.52 (m, 1H), 7.21 (m, , 7H), 7.10 (d, J= 7.3 Hz, 2H), 6.87 (d, J= 8.6 Hz, 2H), 6.80 (dd, J = 2.3, 8.2 Hz, 1H), 6.62 (d, J = 7.7 Hz, 1H), 6.50 (s, 1H), 4.85 (s, 2H), 4.63 (s, 2H), 4.45 (s, 2H), 4.18 (s, 2H), 3.81 (s, 3H). ; 237 WO 2005/058834 PCT/US2004/041399 EXAMPLE 702 3-[(3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]METHYL}PHENOXY)METHYL]BENZOICACID METHYL 3-[(3-{[3-BENZYL-8-{TRlFLUOROMETHYL)QUINOLIN-4 yl]methyl}phenoxy)methyl]benzoate and 1M aqueous LiOH in THF is stirred overnight. The reaction is acidified with dilute hydrochloric acid and extracted with ethyl acetate. The combined extracts are dried (Na2SO4) and concentrated to yield the title compound as a tan semi-solid. MS (ESI) m/z 528 ([M+H])+; MS (ESI) m/z 526 ([M-H])-. EXAMPLE 703 4-[(3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]METHYL}PHENOXY)METHYL]BENZOICACID The yellow semi-solid product is formed analogously to the procedure of Example 702. MS (ESI) m/z 528 ([M+H])+; MS (ESI) m/z 526 ([M-H])'. EXAMPLE 704 {3-[(3-{[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]METHYL}PHENOXY)METHYL]PHENYL}ACETICACID The yellow oil product is prepared according to the procedure of Example 702. MS (ESI) m/z 542 ([M+H])+; MS (ESI) m/z 540 ([M-H])EXAMPLE 705 3-{3-[(3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOUN-4-YL]METHYL}PHENOXY)METHYL]PHENYL}PROPANOICACID The yellow oil product is prepared according to the procedure of Example 702. MS (ESI) m/z 556 ([M+H])+; MS (ESI) m/z 554 ([M-H])EXAMPLE 706 {3-[(3-{[3-BENZYL-8-(TRlFLUOROM£THYL)QUINOLIN-4-YL]METHYL}PHENOXY)METHYL]PHENOXY}ACETICACID The yellow oil product is prepared according to the procedure of Example 702. MS (ESI) m/z 558 ([M+H])+; MS (ESI) m/z 556 ([M-H])238 WO 2005/058834 PCT7US2004/041399 EXAMPLE; 707 {4-[(3-{[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]METHYL}PHENOXY)METHYL]PHENOXY}ACETlCAClD The yellow oil product is prepared according to the procedure of Example 702. MS (ESI) m/z558 ([M+H])+; MS (ESI) m/z 556 ([M-H])EXAMPLE 708 3-[3-(8-CHLORO-3-METHYLQUINOLIN-4-YL)PHENOXY]-N-ETHYLBENZAMIDE To a stirred suspension of ethylamine hydrochloride (41 mg, 0.50 mmol) in toluene (2 mL) at ambient temperature under nitrogen is added 2.0M trimethyialuminum in toluene (0.25 mL, O.50 mmol). After 0.5 h, methyl 3-[3-(8-chlorp-3-methyIquinolin-4-yl)phenoxy]benzoate (101 mg, 0.25 mmol) is added and the reaction heated at 60-65 °C for 16 h. The cooied reaction is treated with water (2 mL), then 2M aq HC1 (1 mL) and extracted with dichloromethane (2x5 mL). The combined extracts are dried (MgSO4), concentrated in vacuo, and the resulting oil is chromatographed on silica gel using 50:50, then 75:25 ethyl acetaterhexane as eluent. The title compound is isolated as a glass (Rf - 0.3 in first solvent system, 101 mg). MS (ES) m/z 417.2; HRMS: calcd for C25H21C1N2O2 + H+, 417.13643; found (ESI, [M+H]+), 417.1357 EXAMPLE 709 METHYL 3-{3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENOXY}BENZOATE A mixture of 3-[3-benzyl-8-(trifluoromethyl)quinoIin-4-yl]phenol (2.65 g, 7.0 mmol), methyl 3-bromobenzoate (3.01 g, 14.0 mmol), CuO (1.01 g, 12.6 mol), and K2CO3 (1.93 g, 14.0 mmol) in dry pyridine (17.5 mL) are heated under nitrogen at 120 °C for 48 h. The cooled reaction is diluted with water (100 mL) and extracted with ether (2 x 100 mL). The dried (MgSO4) extracts are concentrated to a dark oil which is chromatographed on silica gel using 20:80 ethyl acetate:hexane as eluent isolating the title compound as a colorless tacky solid (R1 ~ 0.3, 1.53 g). MS (ESI) m/z 514; HRMS: calcd for C31H22F3NO3 + H+, 514.16245; found (ESI, [M+H]+), 514.1638 239 WO 2005/058834 PCT/US2004/041399 EXAMPLE 710 2-(3-{3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}PHENYL)PROPAN-2-OL To a stirred solution of methyl 3-{3-[3-benzyl-8-(triflu6romethyl)quinolin-4-yl]phenoxy}benzoate (128 mg, 0.25 mmol) in dry THF (2.5 mL) at 0 °C under nitrogen is treated with 3.0M MeMgBr in THF (0.50 mL, 1.50 mmol). The reaction is allowed to warm to ambient temperature over 2 h, then treated with 2M aq HC1 (3 mL) followed by brine (5 mL) and extracted with ethyl acetate (2x15 mL). The combined extracts are dried (MgSO4), concentrated in vacuo, and the resulting oil is chromatographed on silica gel using 1:1 ethyl acetate:hexane as eluent to afford the title compound as a slightly tacky solid (Rf - 0.5, 105 mg). mp EXAMPLE 711 2-{4-[3-(3-PHENYL~8-TRlFLUOROMETHYL-QUINOLIN-4-YL)-PHENOXYMETHYL]- PHENYL}-ETHANOL {4-[3-(3-Phenyl-8-trifluoromethy[-quinolin-4-yl)-phenoxymethyl]-phenyl}-acetic (0.051 g, 0.097 mmol) was dissolved into THF (3 mL) and stirred in an ice bath for 20 minutes. LAH (0.006 mg, 0.145 mmol) was added and the solution was stirred for an additional 60 minutes. The reaction was quenched with 2N HC1 and extracted with ethyl acetate. The combined organics were dried over magnesium sulfate and concentrated. The resulting material was purified via column chromatography using 5% ethyl acetate in hexane as the eluent. mp 50 °C; MS (ES) m/z 500.1. EXAMPLE 712 2-{4-[3-(3-PHENOXY-8-TRIFLUOROMETHYL-QUINOLIN-4-YL)- PHENOXYMETHYL]-PHENYL}-ETHANOL The title compound was prepared from [{4-[3-(3-Phenoxy-8-trifluoromethyl-quinolin-4- yl)-phenoxymethyl]-phenyl}-acetic acid according to the procedure of Example 711. MS (ES) m/z 516.0. , 240 WO 2005/058834 PCT/US2004/041399 EXAMPLE i713 3-{[3-(3-BENZYL-8-CHLOROQUINOUN-4-YL)PHENYL]AMINO}BENZAMIDE 3-{[3-(3-benzyl-8-chloroquinolin-4-yl)phenylJamino}benzoic acid was taken into benzene and to this was added thionyl chloride (2 eq.) and refluxed for 3 h. The j solvent was removed and the resulting material was dried under high vacuum. The acid chloride was then taken up into THF, cooled to 0 °C and to this was added excess concentrated ammonium hydroxide and stirred overnight. The reaction was placed directly on Prep HPLC for purification using 10-100% acetonitrile in water as the eluent to yield the benzamide HRMS: calid for C29H22C1N3O + H+, 464.15241; found (ESI, IM+H]+), 464.1544. EXAMPLE 714 3-{[3-(3-BENZYL-8-CHLOROQUINOLIN-4-YL)PHENYL]AMINO}-N-(2- HYDROXYETHYL)BENZAMIDE This compound was prepared via the procedure in Example 713 using ethanolamine in place of ammonium hydroxide. HRMS: calcd for C31H26C1N3O2 + H+, 508.17863; found (ESI, [M+H]+), 508.1786. EXAMPLE 715 3-{[3-(3-BENZYL-8-CHLOROQUINOLIN-4-YL)PHENYL]AMINO}-N- METHYLBENZAMIDE This compound was prepared via the procedure in Example 713 using methylamine in place of ammonium hydroxide. HRMS: calcd for C30H24C1N3O + H+, 478.16807; found (ESI, [M+H]+), 478.1703. EXAMPLE 716 3-{[3-(3-BENZYL-8-CHLOROQUlNOLIN-4-YL)PHENYL]AMINO}-N- ETHYLBENZAMIDE This compound was prepared via the procedure in Example 713 using ethylamine in place of ammonium hydroxide. HRMS: calcd for C31H26C1N3O + H+, 492.18371; found (ESI, [M+H]+), 492.1878. 241 WO 2005/058834 PCT/US2004/041399 EXAMPLE 717 3-{[3-(3-BENZYL-8-CHLOROQUINOLIN-4-YL)PHENYL]AMINO}-N- CYCLOPROPYLBENZAMIDE This compound was prepared via the procedure in Example 713 using cyclopropylamine in place of ammonium hydroxide. HRMS: calcd for C32H26C1N3O + H+, 504.18371; found (ESI, [M+H]+), 504.1826. EXAMPLE 718 3-{[3-(3-BENZYL-8-CHLOROQUINOLIN-4-YL)PHENYL]AMINO}-N- ISOPROPYLBENZAMIDE This compound was prepared via the procedure in Example 713 using isopropylamine in place of ammonium hydroxide. HRMS: calcd for C32H28C1N3O + H+, 506.19937; found (ESI, [M+H]+), 506.2003. EXAMPLE 719 3-{[3-(3-BENZYL-8-CHLOROQUINOLIN-4-YL)PHENYL]AMINO}-N,N- D1ETHYLBENZAMIDE This compound was prepared via the procedure in Example 713 using diethylamine in place of ammonium hydroxide. HRMS: calcd for C33H30CIN3O + H+, 520.21502; found (ESI, [M+H]+)t 520.2145. EXAMPLE 720 [3-(3-BENZYL-8-CHLOROQUINOLlN-4-YL)PHENYL][3-(PYRROLIDIN-1- YLCARBONYL)PHENYL]AMINE This compound was prepared via the procedure in Example 713 using pyrrolidine in place of ammonium hydroxide. HRMS: calcd for C33H28CIN3O + H+, 518.19937; found (ESI, [M+H]+), 518.2023. 242 WO 2005/058834 PCT/US2004/041399 EXAMPLE 721 [3-(3-BENZYL-8-CHLOROQUINOLlN-4-YL)PHENYL][3-(PIPERIDlN-1- YLCARBONYL)PHENYL]AMlNE This compound was prepared via the procedure in Example 713 using piperidine in place of ammonium hydroxide. HRMS: calcd for C34H30CIN3O + H+, 532.21502; found (ESI, [M+H]+), 532.2177. EXAMPLE 722 [3-(3-BENZYL-8-CHLOROQUINOLIN-4-YL)PHENYL3I3-(MORPHOLIN-4- YLCARBONYL)PHENYL]AMINE This compound was prepared via the procedure in Example 713 using morpholine in place of ammonium hydroxide. HRMS: calcd for C33H28CIN3O2 + H+, 534.19428; found (ESI, [M+H]+), 534.196. EXAMPLE 723 3-[3-(3-BENZYL-8-CHLOROQUINOLIN-4-YL)PHENOXY]-5-BROMOBENZONITRILE 3-(3-benzyl-8-chloroquinolin-4-yl)phenol (0.100 g, 0.289 mmol) was taken into NMP (1 mL) and to this was added NaH (0.0127 g, 0.318 mmol, 60% dispersion in oil) and stirred for 15 minutes. 3-Bromo-5-fluorobenzonitrile (0.116 g, 0.578 mmol) was added and the reaction was heated at 160 °C overnight. The reaction was cooled and quenched with water followed by extraction with ether. After drying and concentration the product was purified via Prep HPLC using 10-100%v acetonitrile in water as the eluent to yield 0.028 g of product. MS (ESI) m/z 526 ([M+H])+. EXAMPLE 724 3-BENZYL-4-{3-[3-BROMO-5-(TRIFLUOROMETHYL)PHENOXY]PHENYL}-8- CHLOROQUINOLINE This compound was prepared via the procedure in Example 723 using 1-bromo-3-fluoro-5-trifiuoromethylbenzene in place of 3-Bromo-5-fIuorobenzonitrile. MS (ESI) m/z 569 ([M+HJ)+. 243 WO 2005/058834 PCT/US2004/041399 EXAMPLE 725 3-[3-(3-BENZYL-8-CHLOROQUlNOLlN-4-YL)PHENOXY]-5- FLUOROBENZONITRILE This compound was prepared via the procedure in Example 723 using 3,5-difluorobenzonitrile in place of 3-bromo-5-fluorobenzonitrile. MS (ESI) m/z 465 ([M+H])+. EXAMPLE 726 3-BENZYL-4-[3-(3-BROMO-5-CHLORt>PHENOXY)PHENYL]-8- CHLOROQUINOLINE This compound was prepared via the procedure in Example 723 using 1~bromo-3-chloro-5-fluorobenzene in place of 3-bromo-5-fluorobenzonitrile. MS (ESI) m/z 536 EXAMPLE 727 N-{3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}-1N- 1MIDAZOLE-1-CARBOXIM1DAMIDE To imidazole (65 mg, 9.760 mmol) in CH2C12 (10 ml) at room temperature under nitrogen atmosphere bromonitrile (500 mg, 4.71 mmol) was added. The resulting mixture was heated at reflux for 1 hr. Cooling to room temperature, filtration and concentration in vacuo to a volume of approximately 10 ml. The resulting pale liquor was let stand at 0°C for 15 hrs. Filtration afforded a pale white powder for O(di-imidazol-1-yl)-methyleneamine (210 mg, 28% yield). To [4-(3-amino-phenyl)-8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone (132 mg, 3.389 mmol), aniline (213mg, 2.347 mmol) and C-(di-imidazol-1-yl)-methylerieamine (420 mg, 2.608 mmol) in THF (20 mg) was heated at reflux for 2.5 hrs. Concentration in vacuo and RP-HPLC (gradient water : acetonitrile) afforded the title compound as a yellow powder (20 mg, 14% yield). MS (ESI) m/z 486. 244 WO 2005/058834 PCT/US2004/041399 EXAMPLE 728 4-[({3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AM1NO)METHYL3BENZOICACID This compound was prepared according to the procedure of Example 66 from 3-(3- benzyl-8-trifluoromethyI-quinolin-4-yl)-phenyfamine and 4-formyl-benzo\c acid methyl ester MS (ESI) m/z 511. EXAMPLE 729 METHYL -N-{4-[({3-I3-BENZYL-8-(TRIFLUOROMETHYL)QUINOUN-4- YL]PHENYL}AMINO)METHYL] BENZOYL}GLYC1NATE To 4-{[3-(3-benzyl-8-trifluoromethyl-quinolin-4-yt)-phenylamino]-methyI}-benzoic acid (130 mg, 0.254 mnol), giyC1ne methyl ester (35mg, 0.279mmol) morpholine (102 mg, 1.014 mmol), EDC1 (58 mg, 0.304 mmol), and HOBT (41 mg, 0.304 mmol) in CH2C12 (15 ml) were combined at room temperature under a nitrogen atmosphere. The resulting mixture was stirred at room temperature under a nitrogen atmosphere for 15 hrs. Quenching with brine (15 ml), separation, drying MgSO4 of the organics and . concentration in vacuo. RP-HPLC (gradient water: acetonitrile) afforded the ester as an off white powder (88mg, 61% Yield). MS (ESI) m/z 582. EXAMPLE 730 METHYL -N-{4-[({3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL] BENZOYL}-D-LEUC1NATE This compound was prepared according to Example 729, substituting D-leuC1ne methyl ester. MS (ESI) m/z 638. EXAMPLE 731 ETHYL -N-{4-[({3-[3-BENZYL-8-(TRlfrLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]BENZOYL}-D-PHENYLALANINATE This compound was prepared according to Example 729, substituting D-phenyl alanine ethyl ester. MS (ESl) m/z 686. 245 WO 2005/058834 PCT/US2004/041399 EXAMPLE 732 N.{4-[({3_[3-BENZYL-8-(TRiFLUOROMETHYL)QU INOLIN-4- YL]PHENYL}AMINO)METHYL]BENZOYL}-D-LEUC1NE This compound was prepared according to the Example 729, substituting methyl -N- {4-[({3-[3-benzyt-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)rnethyl]benzoyl}-D- leuC1nate. MS (ESI) m/z 624.. ' EXAMPLE 733 N-{4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QU 1NOLIN-4- YL]PHENYL}AMINO)METHYL] BENZOYL}GLVC1NE This compound was prepared according to the procedure of example 66, substituting methyl N-{4-[({3-[3-benzyl-8-(trifluoromethyl)quinolin-4 yl]phenyl}amino)methyl]benzoyl}-glyCIne. MS (ESI) m/z 568. EXAMPLE 734 -N-{4-[({3-[3-BENZYL-8-aRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}AM1NO)METHYL]BENZOYL}-D-PHENYLALANINE This compound was prepared according to the procedure of example 66, substituting methyl -N-{4-[({3-[3-benzyl-8-(trifluoromethyl)quinolin-4 yl]phenyl}amino)methyl]benzoyl}-D-phenylalanine. MS (ESl) m/z 658. EXAMPLE 735 3-{3-[({3-[3-CYANO-8-(TRIFLUOROMETHYL)QU INOLIN-4-YL]PHENYL}AMINO)METHYL]PHENYL} PROPANOIC ACID This compound was prepared according to the procedure of example 66, substituting 3-(3-{[3-(3-cyano-8-trifluoromethyl-quinolin-4-yl)-phenylamino]-methyl}-phenyl)-propionic acid ethyl ester. MS (ESI) m/z 476. 246 WO 2005/058834 PCT/US2004/041399 EXAMPLE 736 ETHYL 3-{3-[({3-[3-CYANO-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AM]NO)METHYL]PHENYL}PROPANOATE This compound was prepared according to the procedure of example 66, substituting 4-(3-amino-phenyl)-8-trifluoromethyl-quinoline-3-carbonitrile and 3-(3-formyl-phenyl)-propionic acid methyl ester. MS (ESI) m/z 503.9. EXAMPLE 737 {4'-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QU/NOLIN-4- YL]PHENYL}AMiNO)METHYL]-1,1'-BIPHENYL-3-YL}ACETIC ACID This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and (4'-formyl-biphenyl-3-yl)- acetic acid methyl ester. MS (ESI) m/z 601. EXAMPLE 738 {4'-[({3-[3-BENZOYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]-1,f-BIPHENYL-3-YL}ACETIC ACID This compound was prepared according to the procedure of example 66, substituting [4-(3-amino-phenyl)~8-trifluoromethyl-quinolin-3-yl]-phenyl-methanone and (4'-formyl- biphenyl-3-yl)-acetic acid methyl ester. MS (ESI) m/z 615. EXAMPLE 739 4.{4_[2-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YLJPHENYL}AMINO)ETHYL]PIPERIDIN-1-YL}BENZOIC ACID This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 4-[4-(2-oxo-ethyl)- piperidin-1-yl]-benzoic acid methyl ester. MS (ESI) m/z 610. 247 WO 2005/058834 PCT/US2004/041399 EXAMPLE 740 (4-{[3-(8-CHLORO-3-PHENYLQUINOUN-4-YL)PHENOXY]METHYL}PHENYL)ACETICACID This compound was prepared according to the procedure of example 41, substituting (4_{[3-(8-Chloro-3-phenylquinolin-4-yl)phenoxy]methyl}phenyl)acetic acid methyl ester. MS (ESI) m/z 480. EXAMPLE 741 (4-{[3-(8-CHLORO-3-METHYLQUINOLIN-4-YL)PHENOXY]METHYL}PHENYL)ACETIC ACID This compound was prepared according to the procedure of example 41, substituting (4-{[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]methyl}phenyl)acetic acid methyl ester. MS (ESI) m/z 418. EXAMPLE 742 (4-{[3-(3-BENZYL-8-CHLOROQUINOLIN-4-YL)PHENOXY]METHYL}PHENYL)ACETlCACID This compound was prepared according to the procedure of example 66, substituting (4-{[3-(3-benzyl-8-chloroquinolin-4-yl)phenoxy]methyl}phenyl)acetJc acid methyl ester. MS (ESI) m/z 494. EXAMPLE 743 METHYL 2-(4-{[3-(8-CHLORO-3-PHENYLQUINOLIN-4- YL)PHENOXY]METHYL}PHENYL)-2-METHYLPROPANOATE This compound was prepared according to the procedure of example 41, substituting 3-(8-chloro-3-phenyl-quinolin-4-yl)-phenylarnine and 2-(4-bromomethyI-phenyl)-2- methyl-propionic acid methyl ester. MS (ESI), m/z 522. 248 WO 2005/058834 PC1YUS2004/041399 EXAMPLE 744 METHYL 2-(4-{[3-(3-BENZYL-8-CHLOROQUiNOLlN-4- YL)PHEN0XY]METHYL}PHENYL)-2 METHYLPROPANOATE This compound was prepared according to the procedure of example 41, substituting 3-(8-chloro-3-benznyl-quinolin-4-yl)-phenylamine and 2-(4-bromomethyl-phenyl)-2- methyl-propionic acid methyl ester. MS (ESI) m/z 536. EXAMPLE 745 2-(4-{[3-(8-CHLORO-3-PHENYLQUINOLIN-4-YL)PHENOXY]METHYL}PHENYL)-2- METHYLPROPANOIC ACID This compound was prepared according to the procedure of example 41, substituting 2-(4-{[3-(8-chloro-3-phenylquinolin-4-yl)phenoxy]methyl}phenyl)-2-methylpropanoic acid methyl ester. MS (ESI) m/z 506. EXAMPLE 746 2-(4-{[3-(3-BENZYL-8-CHLOROQUINOUN-4-YL)PHENOXY]METHYL}PHENYL)-2- METHYLPROPANOIC ACID This compound was prepared according to the procedure of example 41, substituting 2-(4-{[3-(3-benzyl-8-chloroquinolin-4-yl)phenoxy]methyl}phenyl)-2-methylpropanoic acid methyl ester. MS (ESI) m/z 520. EXAMPLE 747 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}{2,5- DIMETHYLBENZYL)AMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2,5-dimethyl- benzaldehyde. MS (ESI) m/z 497. 249 WO 2005/058834 PCT/US2004/041399 EXAMPLE 748 {3-[3-BENZYL-8 This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifiuoromethyl-quinolin-4-yl)-phenylamine and 2,3-dimethyl benzaldehyde. MS (ESI) m/z 497. EXAMPLE 749 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,6- DIMETHYLBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamineand2,6-dimethyl benzaldehyde. MS (ESI) m/z 497. EXAMPLE 750 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(1H-JMIDAZOL- 2-YLMETHYL)AMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4~yl)-phenylamine and 1 H-imidazole-2 carbaldehyde. MS (ESI) m/z 457. EXAMPLE'751 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QU)NOLIN-4-YL]PHENYL}{3-[3- (TRIFLUOROMETHYL)PHENOXY]BENZYL}AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin~4-y))-phenylamineand 3-(3-trifluoromethyl phenoxy)-benzaldehyde. MS (ESI) m/z 629. EXAMPLE 752 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLlN-4-YL]PHENYL}(2,6- DIMETHOXYBENZYL)AMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyI-8-trifluoromethy}-quinolin-4-yl)-phenylamine and 2,6 250 WO 2005/058834 PCT/US2004/041399 dimethoxybenzaldehyde. MS (ESI) m/z 529. : EXAMPLE 753 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUlNOLlN-4-YLJPHENYL}[3,5- BIS(BENZYLOXY)BENZYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin~4-yl)-phenylamine and 3,5-bis-benzyloxy benzaldehyde. MS (ESI) m/z 681. EXAMPLE 754 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLlN-4-YL]PHENYL}(2- METHOXYBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinoiin-4-yl)-phenylamine and 2 methoxybenzaldehyde. MS (ESI) m/z 499. EXAMPLE 755 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(4- METHYLBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamineand 4-methylbenzaidehyde. MS (ESI) m/z 483. EXAMPLE 756 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}[(1- OXIDOPYRIDlN-4-YL)METHYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trif luoromethyl-quinolin-4-yl)-phenylamine and 1 -oxidopyridin-4-yl benzaldehyde. MS (ESI) m/z 484. 251 WO 2005/058834 PCT/US2004/041399 EXAMPLE 757 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}[(4,5-DIMETHYL- 2-FURYL)METHYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamineand 3,4-dimethylfuraldehyde. MS (ESI) m/z 487. EXAMPLE 758 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}(1- NAPHTHYLMETHYL)AMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trif)uoromethyl-quinolin-4-yl)-phenylamineand naphthalene-1 carbaldehyde. MS (ESi) m/z 519. EXAMPLE 759 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(3,5- DIMETHOXYBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamineand 3,5 dimethoxylbenzaldehyde. MS (ESI) m/z 522. EXAMPLE 760 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,4- DlMETHOXYBENZYL)AM1NE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2,4 dimethoxylbenzaldehyde. MS (ESI) m/z 529. EXAMPLE 761 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2- NAPHTHYLMETHYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifiuoromethyl-quinolin-4-yl)-phenylamine and naphthalene-2 252 WO 2005/058834 PCT/US2004/041399 carbaldehyde. MS(ESI) m/z519. EXAMPLE 762 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[4- (DIPHENYLAMINO)BENZYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamineand 4-diphenylamino-benzaldehyde. MS (ESI) m/z 636. EXAMPLE 763 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUiNOLIN-4-YL]PHENYL}(4- ISOPROPYLBENZYL)AMINE This compound was prepared according to the1 procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 4 isopropylbenzaldehyde. MS (ESI) m/z 511. EXAMPLE 764 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2- NITROBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-triftuoromethyl-quinolin-4-yl)-phenylamine and 2-nitrobenzaldehyde. MS (ESI) m/z 512. EXAMPLE 765 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(3- NITROBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 3-nitrobenzaldehyde. MS (ESI) m/z 512. 253 WO 2005/058834 PCT/US2004/041399 EXAMPLE 766 . METHYL 2-(4-{[3-{8-CHLORO-3-METHYLQUINOLIN-4- YL)PHEN0XY]METHYL}PHENYL)-2METHYLPROPAN0ATE This compound was prepared according to the procedure of example 41, substituting 3-(8-chloro-3-methyl-quinolin-4-yl)-phenoI and \ 3-(4-bromomethyl-phenyl)-3-methyl- butyric acid methyl ester. MS (ESI) m/z 460. EXAMPLE 767 2-(4-{[3-(8-CHLORO-3-METHYLQUINOLIN-4-YL)PHENOXY]METHYL}PHENYL)-2- METHYL PROPANOIC ACID This compound was prepared according to the procedure of example 41, substituting methyl 2-(4-{[3-(8-chIoro-3-methylquinolin-4-yt)phenoxy]methyl}phenyl)-2 methylpropanoate. MS (ESI) m/z 446. EXAMPLE 768 5-[({3-[3-BENZYL-8-(TRFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINO)METHYL]-2-METHOXYPHENOL This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 3-hydroxy-4-methoxy~ benzaldehyde. MS (ESI) m/z 515. EXAMPLE 769 4-[({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}AMINO)METHYL]-2-METHOXYPHENOL This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyI-quinoIin-4-y))-phenylamine and 4-hydroxy~3-methoxy~ benzaldehyde. MS (ESI) m/z 515. EXAMPLE 770 2-[({3-[3-BENZYL-8-(TRtFLUOROMETHYL)QUlNOLIN-4- YL]PHENYL}AMINO)METHYL]BENZENE-1,4-DIOL This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyi-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2,5 254 WO 2005/058834 PCT/US2004/041399 dihydroxybenzaldehyde. MS (ESI) m/z 501. EXAMPLE 771 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2-FLUORO-5- NITROBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-fluoro-5 nitrobenzaldehyde. MS (ESI) m/z 532. EXAMPLE 772 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(5-BROMO-2- ETHOXYBENZYli) AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamineand 5-bromo-2-ethoxy benzaldehyde. MS (ESI) m/z 591. EXAMPLE 773 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(3-ETHOXY-4- METHOXYBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin~4~yl)-phenylamine and 3-ethoxy-4-methoxy benzaldehyde. MS (ESI) m/z 591. EXAMPLE 774 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,5- DIFLUOROBENZYL)AMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trif)uoromethyl-quinolin-4-yl)-phenylamineand 2,5 difluorobenzaldehyde. MS (ESI) m/z 505. 255 WO 2005/058834 PCT/US2004/041399 EXAMPLE 775 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(3,4- DIFLUOROBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4~yl)-phenylamineand 3,4 difluorobenzaldehyde. MS (ESI) m/z 505. EXAMPLE 776 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}(5-BROMO-2- METHOXYBENZYL) AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyI-8-trifluoromethyl-quinolin-4-yl)-phenylamineand 5-bromo-2 methoxybenzaldehyde. MS (ESI) m/z 577. EXAMPLE 777 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(5-BROMO-2- FLUOROBENZYL) AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyi-quinolin-4-yl)-phenylamine and 5-bromo-2-fluorobenz aldehyde. MS (ESI) m/z 565. EXAMPLE 778 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[2-FLUORO-3- (TRIFLUOROMETHYL)BENZYL}AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-fluoro-3-trifluoromethyl benzaldehyd.e. MS (ESI) m/z 555. 256 WO 2005/058834 PCT/US2004/041399 EXAMPLEI779 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2-FLUORO-5- METHOXYBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-fluoro-5-methoxy benzaldehyde. MS (ESI) m/z 517. EXAMPLE 780 {3-[3-BENZYL-8-(TRlFLUOROMETHYil)QUINOLIN-4-YL]PHENYL}[2,5- BIS(TRIFLUOROMETHYL) BENZYL]AMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2,5-bistrifluoromethyl benzaldehyde. MS (ESI) m/z 605. EXAMPLE 781 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2- METHYLBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-methylbenzaldehyde. MS (ESI) m/z 483. EXAMPLE 782 {3-[3-BENZYL-8-(TRiFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,4,6- TRIFLUOROBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2,4,6 trifluorobenzaldehyde. MS (ESI) m/z 523. 257 WO 2005/058834 PCTYCS2004/041399 EXAMPLE 783 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(3-FLUORO-4- METHOXYBENZYL) AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyI-8-trifluoromethyl-quinolin-4'yl)-phenylamine and 3-fluoro-4-methoxybenz aldehyde. MS (ESI) m/z 517. EXAMPLE 784 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}(CYCLOPROPYLMETHYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine arid cyclopropanecarbaldehyde. MS (ESI) m/z 433. EXAMPLE 785 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINQLIN-4-YL]PHENYL}[(2-METHYL-1H- IMIDAZOL-5-YL)METHYL]AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-methyl-3H-imidazole-4-carbaldehyde. MS (ESI) m/z 473. EXAMPLE 786 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(PYRIDIN-3- YLMETHYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and pyridine-3 carbaldehyde. MS (ESI) m/z470. EXAMPLE 787 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOUN-4-YL]PHENYL}(PYRlD)N-4- YLMETHYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and pyridine-4 258 WO 2005/058834 PCT/US2004/041399 carbaldehyde. MS (ESI) m/z 47.0. EXAMPLE 788 H4-({3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}OXY)PHENYL]ETHANE-1,2-DIOL This compound was prepared according to the procedure of example 34, substituting {4-[3-(3-benzyl-8-trifluoromethyl-quinol}n-4-yl)-benzyloxy]-phenyl}-oxo-aceticacJd ethyl ester. MS (ESI) m/z 570. EXAMPLE 789 ETHYL [4-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]BENZYL}OXY)PHENYL](OXO) ACETATE This compound was prepared according to the procedure of example 69, substituting [3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylJ-rnethanol. MS (ESI) m/z 530. EXAMPLE 790 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUlNOUN-4-YL]PHENYL}(3- THIENYLMETHYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and thiophene-3 carbaldehyde. MS (ESI) m/z 475. EXAMPLE 791 {3'[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(3- FURYLMETHYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and furan-3-carbaldehyde. MS (ESI) m/z 459. 259 WO 2005/058834 PCT/US2004/041399 EXAMPLE 792 (3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[2- (TRIFLUOROMETHOXY)BENZYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyi-8-trif(uoromethyI-quinolin-4-yl)-phenylamine and 2-trifluoromethoxy benzaldehyde. MS (ESI) m/z 553. EXAMPLE 793 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[3-CHLORO-2- FLUORO-6-(TRIFLUOROMETHYL)BENZYL]AMINE This compound, was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8~trifluoromethyl-quinolin-4-yl)-phenylamine and 3-chloro~2-fluoro-6-trifluoro methyl-benzaldehyde. MS (ESI) m/z 587. EXAMPLE 794 {3-[3-BENZY1-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(PYRIDIN-2- YLMETHYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyI-8-trifluoromethyl-quinolin-4-yl)-phenylamine and pyridine-2- carbaldehyde. MS (ESI) m/z 470. EXAMPLE 795 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[4- (TRIFLUOROMETHOXY)BENZYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-84ftfluoromethyl-quinolin-4-yl)-phenylamine and 4-trifluoromethoxy-benz aldehyde. MS (ESI) m/z 551. EXAMPLE 796 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}(4-CHLORO-3- FLUOROBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyI-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 4-chloro-3-fluoro 260 WO 2005/058834 PCT/US2004/041399 benzaldehyde. MS (ESI) m/z 519. EXAMPLE 797 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[2-FLUORO-5- (TRIFLUOROMETHYL) This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-fluoro-5 trifluoromethyl-benzaldehyde. MS (ESI) m/z 553. EXAMPLE 798 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}[3- (TRIFLUOROMETHOXY)BENZYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 3-trifluoromethoxy-benzaldehyde. MS (ESI) m/z 553. EXAMPLE 799 -N-(1-BENZOFURAN-2-YLMETHYL)-3-[3-BENZYL-8- (TRIFLUOROMETHYL)QUINOLIN-4-YL]ANILINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and benzofuran-2 carbaldehyde. MS (ESI) m/z 509. EXAMPLE 800 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(QUINOLIN-3- YLMETHYL)AMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and quinoline-3 carbaldehyde. MS (ESI) m/z 518. 261 WO 2005/058834 PCT/US2004/041399 EXAMPLE 801 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,4- DlETHOXYBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2,4-diethoxy- benzaldehyde. MS (ESI) m/z 557. EXAMPLE 802 3,3'-(3-PHENYLQUINOLINE-4,8-DIYL)DIPHENOL This compound was prepared according to the procedure of example 1, substituting 4-bromo-8-chloro-3-phenyl-quinoline and 3-hydroxybenzeneboronic acid MS (ESI) m/z 390. EXAMPLE 803 2-(4-{[3-(8-CHLORO-3-METHYLQUINOLlN-4-YL)PHENOXY]METHYL}PHENYL)PROPANOICACID This compound was prepared according to the procedure of example 41, substituting 3-(8-chloro-3-methyl-quinolin-4-yl)-phenol and 2-(4-bromomethyl-phenyl)-propionic acid methyl ester. MS (ESI) m/z 432. EXAMPLE 804 3-BENZYL-4-{3-[(5-BROMO-2-METHOXYBENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 41, substituting 3-(3-benzyl-8-chloro-quinolin-4-yl)~phenoi and 1-bromo~2-bromomethyl-4-methoxy-benzene. MS (ESI) m/z 578. EXAMPLE 805 3-BENZYL-4-{3-[(2,3-DIMETHYLBENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-chloro-quino)in-4-y))-phenol and (2,3-dimethy)-phenyl)-methanol. MS (ESI) m/z 498. 262 WO 2005/058834 PCT/US2004/041399 EXAMPLE 806 3-BENZYL-4-{3-[(2-METHOXYBENZYL)OXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-chloro-quinolin-4-yl)-phenol and (2-methoxyphenyl)-methanol. MS (ESI) m/z 500. EXAMPEL 807 (2R)-2-(4-{[3-(8-CHLORO-3-METHYLQUINOLIN-4-YL)PHENOXYJMETHYL}PHENYL)PROPANOICACID This compound was prepared according to the procedure of example 41, substituting 3-(8-chloro-3-methyl-quinolin-4-yl)-phenol and. 2-(4-bromomethyl-phenyl)-propionic acid methyl ester. Purification by supercritical fluid chromatography (MeOH / CO2). Electronic C1rcular dichroism CD Xmax = + 6 mdeg @ 226 nm (EtOH). MS (ESI) m/z 432. EXAMPLE 808 (2S)-2-(4-{[3-(8-CHLORO-3-METHYLQUlNOLIN-4-YL)PHENOXY]METHYL}PHENYL)PROPANOlCACID This compound was prepared according to the procedure of example 41, substituting 3-(8-chloro-3-methyl-quinolin-4-yl)-phenol and 2-(4-bromomethyl-phenyl)-propionic acid methyl ester. Purification by supercritical fluid chromatography (MeOH / CO2). Electronic C1rcular dichroism CD A,max = - 4 mdeg @ 225 nm (EtOH). MS (ESI) m/z 432. EXAMPLE 809 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}[(2-METHOXY-1- NAPHTHYL) METHYLJAM1NE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-methoxy-naphthalene-1-carbaldehyde. MS (ESI) m/z 379. 263 WO 2005/058834 PCT/US2004/041399 EXAMPLE 810 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2- CHLOROBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyI-quinolin-4-yl)-phenylamineand 1-bromomethyl-2-chloro-benzene. MS (ESI) m/z 503. EXAMPLE 811 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(6-BROMO-1,3- BENZODIOXOL-5-YL)METHYL]AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin~4-yl)-phenylamineand 6-bromo benzo[1,3]dioxo(e-5-carbaIdehyde. MS (ESI) m/z 591. EXAMPLE 812 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUlNOLlN-4-YL]PHENYL>B]S(2- CHLOROBENZYL)AMINE This compound was prepared according to the procedure of example 41, substituting 3-(3-benzyl-8-trifiuoromethyl-quinolin-4-yl)-phenylamine and 1 -bromomethyI-2-chloro-benzene MS (ESI) m/z 627. EXAMPLE 813 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}[(6-METHOXY-2- NAPHTHYL) METHYL]AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 6-methoxy-naphthalene-2-carbaldehyde. MS (ESI) m/z 549. 264 WO 2005/058834 PCT/US2004/041399 EXAMPLE 814 -N-(9-ANTHRYLMETHYL)-3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOL)N-4-YL] ANILINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and anthracene-9-carbaldehyde. MS (ESI) m/z 569. EXAMPLE 815 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2- ISOPROPOXYBENZYL)AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolih-4-yl)-phenylamine and 2-isopropoxy-benzaldehyde. MS (ESI) m/z 527. EXAMPLE 816 3-BENZYL~4-(3-{[2-(DlFLUOROMETHOXY)BENZYL]OXY}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenol and (2-difiuoromethoxy-phenyl)-methano). MS (ESI) m/z 535. EXAMPLE 817 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL3PHENYL}[2,4- BlS(TRIFLUOROMETHYL)BENZYLJAMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2,4-bis-trifluoromethyl-benzaldehyde. MS (ESI) m/z 602. EXAMPLE 818 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[4-FLUORO-2- (TRiFLUOROMETHYL) BENZYLjAMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 4-fluoro-2 265 WO 2005/058834 PCT/US2004/041399 trifluoromethyl-benzaidehyde. MS (ESI) w/z 552. EXAMPLE 819 {3-[3-BENZYL-8-(TRlFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[2-CHLORO-3- (TRIFLUOROMETHYL) BENZYLjAMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyt-quinolin-4-yl)-phenylamineand 2-chIoro-3 trifluoromethyl-benzaldehyde. MS (ESI) m/z 552. EXAMPLE 820 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(2,6- DICHLOROPYRIDIN-4-YL)METHYL]AMlNE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2,6-dichIoro-pyridine-4-carbaldehyde. MS (ESI) m/z 535. EXAMPLE 821 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(3-BROMO-5- IODO-4-METHYL-2-THIENYL)METHYL]AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 3-bromo-5-iodo-4-methyl-thiophene-2-carbaldehyde. MS (ESI) m/z 693. EXAMPLE 822 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLlN-4-YL]PHENYL}[(3-METHYL-1- BENZOTHIEN-2-YL)METHYL]AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 3-methyl benzo[b]thiophene-2-carbaldehyde. MS (ESI) m/z 539. 266 WO 2005/058834 PCT/US2004/041399 EXAMPLE 823 -N-(1-BENZOTHtEN-3-YLMETHYL)-3-[3-BENZYL-8- (TRlFLU0R0METHYL)QUIN0LIN-4-YL]AN)LINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifiuoromethyl-quinolin-4-yl)-phe|nylamine and benzo[b]thiophene-3- carbaldehyde. MS (ESI) m/z 525. EXAMPLE 824 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(5-BROMO-2- THIENYL)METHYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifiuoromethyl-quinolin-4-yl)-phenylamine and 5-bromo-thiophene-2-carbaldehyde. MS (ESI) m/z 553. EXAMPLE 825 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(5-METHYL-2- THIENYL)METHYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 5-methyl-thiophene-2-carbaldehyde. MS (ESI) m/z 489. EXAMPLE 826 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[2- (DIFLUOROMETHOXY)BENZYL] AMINE This compound was prepared according to the procedure of example 66, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenylamine and 2-difluoromethoxy-benzaldehyde. MS (ESI) m/z 535. 267 WO 2005/058834 PCTYUS2004/041399 EXAMPLE 827 3-BENZYL-4-(3-{[2-(TRIFLUOROMETHOXY)BENZYL]OXY}PHENYL)-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenol and (2-trifluoromethoxy-phenyl)-methanol. MS (ESI) m/z 554. EXAMPLE 828 3-BENZYL-4-[3-(1,2,3,4-TETRAHYDRONAPHTHALEN-1-YLMETHOXY)PHENYL]-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenol and (1,2,3,4-tetrahydro naphthalen-1-yl)-methanol. MS (ESI) m/z 524. EXAMPLE 829 3-BENZYL-4-[3-(2,3-DIHYDRO-1H-INDEN-1-YLMETHOXY)PHENYL]-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenol and indan-1-yl-methanol. MS (ESI) m/z 510. EXAMPLE 830 3-BENZYL-4-[3-(1-PHENYLETHOXY)PHENYL]-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-trifluoromethyl-quinoiin~4-yl)-phenol and 1-phenyl-ethanol. MS (ESI) m/z 484. 268 WO 2005/058834 PCT/US2004/041399 EXAMPLE 831 3-BENZYL-4-{3-[1-(2-CHLOROPHENYL)ETHOXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenol and 1 -(2-chloro-phenyl)-ethanol. MS(ESI)m/z519. EXAMPLE 832 3-BENZYL-4-{3-[1-(2,5-DlCHlOROPHENYL)ETHOXY]PHENYL}-8- (TRIFLUOROMETHYL)QUINOLINE This compound was prepared according to the procedure of example 69, substituting 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-phenol and 1-(2,5-dichloro-phenyl) ethanol. MS (ESI) m/z 553. EXAMPLE 833 3-(3-BENZYL-8-CHLOROQUINOLIM-4-YL)PHENOL The title compound was prepared from 4-bromo-8-chioro-3-methy)-quinoline and 3-hydroxyphenyl boronic acid according to the procedure of Example 1. MS (ES) m/z 343.9. EXAMPLE 834 3-(8-CHLORO-3-METHYLQUINOLlN-4-YL)PHENOL The title compound was prepared from 3-benzyl-4-bromo-8-chloro-quinoline and 3-hydroxyphenyl boronic acid according to the procedure of Example 1. MS (ES) m/z 267.9. EXAMPLE 835 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUlNOLIN-4-YL]PHENYL}[4- (TRIFLUOROMETHYL)BENZYL]AMlNE The title compound was prepared from {3-[3-benzyl-8-(trifIuoromethyl)quinolin-4-yl]phenyl}amine and 4-trifluorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 537; 269 WO 2005/058834 PCT/US2004/041399 EXAMPLE 836 ETHYL2-[4-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]PROPANOATE The title compound was prepared from 3-[3-benzyl-8~(trifluoromethyl)quinolin-4-yl]phenof and 2-(4-Bromomethyl-phenyl)-propi6nic acid propyl ester as in the procedure of Example 43. MS m/z 570; EXAMPLE 837 METHYL 2-[4-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QU(NOLIN-4- YL]PHENOXY}METHYL)PHENYL]-2-METHYLPROPANOATE The title compound was prepared from 3-[3-benzyl-8-(trifluoromethyl)quinoIin-4~ yljphenol and 2-(4-Bromomethyl-phenyl)-2-methyl-propionic acid ethyl ester as in the procedure of Example 43. MS m/z 570; EXAMPLE 838 {3-[3-(2-METHYLPHENYL)-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENYL}AMINE This compound was prepared according to the procedure of Example 1 step 5, using 4-Bromo-3-o-tolyl-8-trifluoromethyl-quinoline and substituting 3-aminophenyl boronic acid for phenyl boronic acid. mp148-151°C, MS(ES)m/z378.9; EXAMPLE 839 (3-{8-(TRiFLUOROMETHYL)-3-[2-(TRIFLUOROMETHYL)PHENYL]QUINOLlN-4- YL}PHENYL)AMlNE This compound was prepared according to the procedure of Example 1 step 5, using 4-Bromo-3-o-trifluoromethylphenyl-8-trifIuoromethyl-quinoline and substituting 3-aminophenyl boronic acid for phenyl boronic acid. 270 WO ^005/058834. PCT/US2004/041399 EXAMPLE 840 ETHYL[4-({3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}METHYL)PHENYL]ACETATE The title compound was prepared from 3-[3-benzyl-8-(trif)uorornethyl)quinolin-4-yljphenoland (4-Bromomethyi-phenyl)-acetic acid propyl ester as in the procedure of. Example 43. MS (ESI) m/z 556; EXAMPLE 841 [4-((1 S)-1 -{3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4- YL]PHENOXY}ETHYL)PHENYL]ACETICACID The title compound was prepared using the procedure of example 69 using 3-[3-benzyi-8-(trifluoromethyl)quinolin-4-yl]phenol as the phenol and [4-(1-Hydroxy-ethyl)-phenylj-acetic acid ethyl ester as the alcohol .MS (ESI) m/z 540; EXAMPLE 842 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}(2,3,5- TRICHLOROBENZYL)AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 2,3,5-triichlorobenzaldehyde according to the procedure of step 1, Example 66. MS (ESI) m/z 571. EXAMPLE 843 {3-[3-BENZYL-8-(TRIFLUOROMETHYL)QUINOLIN-4-YL]PHENYL}[(1-METHYL-1H- lNDOL-6-YL)METHYL]AMINE The title compound was prepared from {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amine and 6-formy-1-methylindole to the procedure of step 1, Example 66. MS (ESI) m/z 522. By procedures similar to those in the preceding examples, the following Examples 844 to 1203 were prepared. 271 WO 2005/058834 PC17US2004/041399 Example Name MS HRMS Example Number of Similar Procedure Example 844 methyl 4-(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenoxy)butanoate MS (ES) m/z 572.0; HRMS: calcd for S34H2BF3NO4 + H+, 572.20432; found (ESI, [M+HD, 572.2064; 478 Example 845 methyl 5-(4-{3-[3-benzyl-8-(trifluoromethyl)quinotin-4-yl]phenoxy}phenoxy)pentanoate MS (ESl) m/z I 586; HRMS: calcd for C35H30F3NO4 + H+, 586.21997; found (ESI, [M+H]+), 586.2192; 478 Example 846 4-(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenoxy)butanoic acid MS (ES) m/z 556.0; 66 Example 847 5-(4-{3-[3-benzyl~8-(trifluoromethyl)quinorin-4-y))phenoxy}phenoxy)pentano'ic acid MS (ES) m/z 570.0; HRMS: calcd for C34H28F3NO4 + H+, 572.20432; found (ESI, [M+H]+), 572.2042; 66 Example 848 3-[3-(4-chlorobenzyl)-8-(trifIuoromethyl)quinolin-4-yllphenol MS (ESI) m/z l 414; HRMS: calcd for C23H15C1F3NO + H+, ' 414.08670; found (ESl, [M+H]+), 414.0859; 457 Example 849 methyl {[4-({3-[3-(4-chlorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetate MS (ES) m/z 605.9; 44 Example 850 methyl 3-[4-({3-[3-methyl-8-(trifluorornethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate HRMS: calcd for C20H,4F3NO3 + H+, 480.17810; found (ESI, [M+H]+), 480.1776; 365 Example 851 3-[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenoxy)methyl]ben zoic acid MS (ES) m/z i 603.9; HRMS: calcd for C37H26F3NO4 H+, 606.18867; found (ESI, [M+HD, 606.1906; 66 272 WO 2005/058834 PCT/US2004/041399 Example 852 3-[4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-rt]phenoxy}methyl)phenyl]propa noic acid HRMS: calcd for"27H22F3NO3 +H+, 466.16245; found (ESI, [M+H]*), 466.1631; 216 Exam pie 853 3-[3-(2-phenytethyl)-8-(trifluoromethyl)quinolin-4- ;yl]phenol MS (ES)) m;2 394.4 (M+H)+, 392.3 (M-H)+ 457 Example 854 3-[3-(2,4,6-trifluorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenol MS (ESI) m/z 433.7 (M+H)+, 431.9 (M-H)+ 457 Example 855 3-[3-(3-phenylpropyl)-8-(trifluoromethyl)quinolin-4-yl]phenol iMS (ES) m/z 406.0; 457 Exam pie 856 3-[3-(4-phenylbutyl)-8-(trifluoromethyl)quinolin-4-yijphenol MS (ES) m/z 420.0; 457 Example 857 3-[3-(5-phenylpentyl)-8- , (trifluoromethyl)quinolin-4-yl]phenol MS (ESI) m/z 436; 457 Example 858 3-[3-(diphenylmethyl)-8-(trifluoromethyl)quinolin-4-yl]phenol MS (ESI) m/z 456; 457 Example 859 [4-({3-[3-(2,4,6-trifluorobenzyl)-8-(trifluorornethyl)quinolin-4~ yl]phenoxy}methyl)phenyl]acetic acid MS (ESI) m/z 582; 66 Example 860 [4-({3-[3-(2-methylphenyl)-8- , (trif)uoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]aceiie acid : MS (ESI) m/z 528.2 (M+H)+, 526.2 (M-H)+ 66 Example 861 3-[4-({3-[3-(2-methylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noic acid MS (ESI) m/z 542.1 (M+H)+ 540.2 (M-H)+ 66 Example 862 3-[4-({3-[3-(Z,4,6-trifluorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noic acid MS (ESI) m/z 596.1 (M+H)+ 594.0 (M-H)+ 66 Example 863 3-[4- 273 WO 2005/058834 PCT/US2004/041399 Example 864 3-{4-[(3-{8-(trifluoromethyl)-3-[2-trifiuorornethyl)phenyl]quinolin-4-yl}phenoxy)methyl]phenyl}propa noic acid i^S (ES)) m/2 95.9 (W+H)+, 93.8 (M-H)+ 66 Example 865 3-[4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa namide HRMS: calcd for Co7H23F3N202 + H+, 465.17844; found (ESI, [M+H]+), 465.1777; 713 Example 866 4-{3-[(4-fluorobenzyl)oxy]phenyl}-3-methyl-8-(trifluoromethyl)quirioline HRMS: calcd • for C24H17F4NO + H+, 412.13190; found (ESI, [M+H]+), 412.1331; 365 Example 867 4-{3-[(2-chlorobenzyl)oxy]phenyl}-3-methyl-8-(trtfJuorometJTyQquinoline HRMS: calcd for C24H17C1F3NO + H+, 428.10235; found (ESI, [M+H]*), 428.104; 365 Example 868 [4-({3-[3-methy)-8-(trifluoromethyl)quino)in-4-yl]phenoxy}methyl)phenoxy]acet onitrile HRMS: calcd for+ H+, 449.14714; found (ESt, [M+H]+), 449.1494; 365 Example 869 2-{2-[4-({3-[3-methyl-8- (trifluoromethyl)quinoiin-4-yl]phenoxy}methyl)phenoxy]ethy l}-1 H-isoindoIe-1,3(2H)-dione HRMS: calcd for C34Hj5F3N2O4 + H+, 583.18392; found (ESI, [M+H]+), 583.1832; 365 Example 870 methyl [4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]aceate HRMS: calcd for C27H22F3NO4 + H+, 482.15737; found (ESI, [M+H]+), 482.1578; 365 Example 871 methyl [3-({3-[3-methyl-8-(trifluorornethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]ace ate HRMS: calcd for C27H22F3NO4 + H+, 482.15737; found (ESI, [M+H]-), 482.1553; 365 274 WO 2005/058834 PCT/US2004/041399 Example 872 3-[4-({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-l]phenoxy}methyl)phenyl]propa noic acid iMS (ESi) m/z §28; 41 Example 873 imethyl 3-[4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]prop-2-ynoate HRMS: calcd for CJSHZOFSNOS + H+, 476.14680; found (ESl, [M+H]+), 476.1452; 365 Example 874 methyl {[4-({3-[3-methyI-8- ; (trifluorornethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetate HRMS: calcd for C28H24F3NO4 + H+, 496.17302; found (ESI, [M+H]*), 496.1765 365 Example 875 methyl {[3-({3-[3-methyl-8- ' (trifluoromethyl)quinolin-4-yl]phenoxy}metbyl)benzyl]oxy}a cetate i HRMS: calcd forC2sH24F3NO4 +H+, 496.17302; found (ESI, [M+H]+), 496.1756; 365 Example 876 3-[8-(trifluoromethyl)quinolin-4-yllphenoi MS (ESI) m/z 290; 42 Example 877 3-[3-(2-ethylpheny))-8-(trifluoromethyl)quinolin-4-yl]phenol MS (ES) m/z 391.9; HRMS: calcd for C24Hi8F3NO + H+, 394.14132; found (ESI, [M+H]"1"), 394.1398; 457 Example 878 3-[3-(2-isopropylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenol MS (ES) m/z 405.9; HRMS: calcd for CZsHZoF3NO + H+, 408.15697; found (ESI, [M+H]+), 408.1552; 457 Example 879 [4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]ace ic acid HRMS: calcd for CaiHsoFaNCXt H+, 468.14172; found (ESI, [M+H]+), 468.1411; 216 Example 880 [3-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy>methyl)phenoxy]ace ic acid HRMS: calcd for C26H20F3NO4 H+, 468.14172; found (ESI, [M+H]+), 468.1413; 216 275 WO 2005/058834 PCT/US2004/041399 Example 881 3-[4-({3-[3-methyI-8-(trifluorornethyl)quinolin-4-yl]phenox'y}methyl)phenyl]prop-2-ynoic acid 1HNMR (CDC13): d 04-1429-INH; CONSISTENT HRMS: calcd for CzTHisFaNOa + H+, 462.13115; found (ESI, [M+HD, 462.1307; 216 Example 882 (2E)-3-[4-({3-[3-methyl-8-(tr)fluoromethyl)quinolin-4-yl)phenoxy}methyl)phenyl]acryli . c acid HRMS: calcd for C27H20F3NO3 + H+, 464.14680; found (ESI, [M+H]+), 464.1449; 216 Example 883 {[4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetic acid - HRMS: calcd forC27H22F3NO4 +H+, 482.15737; found (ESI, [M+HD, 482.1563; 216 Example 884 {[3-({3-[3-methyI~8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetic acid HRMS: calcd for CazHaFaNC}, + H+, 482.15737; found (ESI, [M+HD; 482.1559; 216 Example 885 methyl {[3-({3-[3-(4-chiorobenzyl)-8-(trifluorornethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetate MS (ESI) m/z . 606; HRMS: calcd for C34H27C)F3NO + H+, 606.16535; found (ESI, [M+H]+), 606.1656; 44 Example 886 methyl 3-[4-({3-[3-(4-chlorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate MS (ES) m/z '• 590.0; HRMS: calcd ¦ for C34H27C1F3NO + H+, 590.17043; found (ESI,[M+HD, 590.17; 44 Example 887 methyl [4-({3-[3-(4-chlorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy}ace ate l\ks (ESI) m/z i 592; HRMS: calcd for C33H25C1F3NO + H+, 592.14970; found (ESI,[M+HD, 592.1487; 44 Example 888 methyl [3-({3-[3-(4-chlorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]ace ate MS (ESI) m/z 592; HRMS: calcd for C33H25C1F3NO + H+, 592.14970; found (ESI,[M+HD. 592.1516; 44 276. WO 2005/058834 PCT/US2004/041399 Example 889 methyl 3-[4-({3-[3-(2-ethylphenyl)-8~ (trifluoromethyl)quinolin-4-l]phenoxy}methyl)phenyl]propa noate MS (ESI) m/2 570; HRMS; calcd for S35H30F3NO3 + H+, 570.22505; found (ESI, [M+H]+), 570.2228; 478 Example 890 methyl 3-[4-({3-[3-(2-isopropylphenyl)-8-(trifluorornethy))quinolin-4-yl]phenoxy}methyl)phenyl]propa noate l (MS (ESI) m/z 584; HRMS: calcd for C36H32F3NO3 + H+, 584.24070; found (ESI, [M+H]+), 584.2404; 478 Example 891 [4-({3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]acetic acid MS (ESI) m/z 438- 41 Example 892 [4-({4-fluoro-3-[3-ph enyl-8-(trifluorometbyl)quinoiin-4-yl]phenoxy}methyl)pheny)]acetic acid MS (ESI) m/z 532" 41 Example 893 3-[4-({3-[3-(2-ethylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noic acid MS (ESI) m/z 556; HRMS: calcd for CMHajFsNOa + H+, 556.20940; found (ESI, [M+H]+), 556.2069; 66 Example 894 3-[4-({3-[3~(2-isopropy]phenyl)-8-(trifluoromethyl)qu inolin-4-yl]phenoxy}methyl)phenyl]propa noic acid MS (ESI) m/z 570" HRMS: calcd for CasHsoFsNCb + H+, 570.22505; found (ESI, [M+H]+), 570.2247; 66 Example 895 {4-[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenoxy)methyl]phe nyl}acetic acid MS (ESI) m/z 620; 66 Example 896 {[4-({3-[3-(4-chlorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetic acid HRMS: calcd for C33H25C1F3NO4 + H+, 592.14970; found (ESI, [M+H]+), 592.1481; 66 Example 897 {[3-({3-[3-(4-chlorobenzyl)-8-(trifluoromethyl)qui nolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetic acid MS (ESI) m/z 592; HRMS: calcd for C33H25C)F3NO4 + H+, 592.14970; found (ESI, [M+H]*), 592.148; 66 277 WO 2005/058834 PCT/US2004/041399 Example 898 3-[4-({3-[3-(4-chlorob enzyl)-8-(trifluoromethyl)quinolin-4-l]phenoxy}methyl)phenyl]propa noic acid MS (ESI) m/z 576; HRMS: calcd for CMH25C1F3NO3 + H+, 576.15478; found (ESI, [M+H]+), 576.1572; 66 Example 899 [4-({3-[3-(4-chlorobenzyl)-8-(trifluoromethyl)quinoIin-4-yl]phenoxy}methyl)phenoxy)acet ic acid MS (ESI) m/z 578; HRMS: calcd for C32H23C1F3NO4 + H+, 578.13405; found (ESI, [M+H]+), 578.1355; 66 Example 900 [3-({3-[3-(4-chlorobenzyl)-8-(trifluorornethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]acet ic acid MS (ESH m/z 578; HRMS: calcd for C32H23C1F3NO4 + H+, 578.13405; found (ESI, [M+H]+), 578.1315; 66 Example 901 methyl 4-({3-[3-(4-chIorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzoate MS (BS)} m/z 562; HRMS: calcd for C32H23C1F3NO3 + H+, 562.13913; found (ESI, [M+H]+), 562.1404; 44 Example 902 methyl 3-[3-({3-[3-methyl-8-(trif luoromethyl)qu i nolin-4-yl]phenoxy}rnet.hyl)phenyl]propa noate HRMS: calcd for C2BH24F3NO3 + H+, 480.17810; found (ESI, rM+H]+), 480.1792; 365 Example 903 {3-[3-methyl-8-(trifluorornethyl)quinolin-4-yl]phenyl}amine HRMS: calcd for C17Hi3F3N2 + H+, 303.11036; found (ESI, [M+H]*), 303.11; 390 Example 904 3-[3-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noic acid HRMS: calcd for C27HMF3NO3 + H+, 466.16245; found (ESI, [M+H]*), 466.1609; 216 Example 905 2-[4-({3-[3-methyl-8-(trjfluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noic acid HRMS: calcd for • C^H^FaNOs + H+, 466.16245; found (ESI, [M+H]*), 466.1612; 365 Example 906 3-(4-chlorobenzyl)-4-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 532; HRMS: calcd for C32H25C1F3NO + H+, 532.16495; 44 278 WO 2005/058834 PCT/US2004/041399 found (ESI, [M+H]+), 532.163; Example 907 4-({3-[3-(4-chlorobenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzoic acid MS (ESI) m/z 548; HRMS: calcd for 31H21C1F3NO3 + H+, 548.12348; found (ESI, [M+H]+), 548.1227; 66 Example 908 methyl 2-[4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate HRMS: calcd for Cja^FsNOs + H+, 480.17810; found (ESI, [M+H]+), 480.1771; 365 Example 909 4-(3-methoxyphenyl)-3-methyl-8-(trifluoromethyl)quinoiine MS (ES) m/z 318.2; HRMS: calcd for C-mH-uFsNO + H+, 318.11002; found (ESI, [M+H]+), 318.1092; 43 Example 910 4-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline HRMS: calcd for C26H22F3NO + H+, 422.17262; found (ES), [M+H]+), 422.1711; 43 Example 911 4-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-3-methyi-8-(trifluoromethyl)quinoline HRMS: calcd for C26H22F3NO + H+, 422.17262; found (ESI, [M+H]+), 422.173; 43 Example 912 methyl 3~[3-({3~[3-(2-ethylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate MS (ESI) m/z 570; 478 Example 913 methyl 3-[3-({3-[3-(2-isopropylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate MS (ESl) m/z 584; 478 Example 914 [4-({3-[3-(2-ethylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]acetic acid MS (ESl) m/z 542; 66 279 WO 2005/058834 PCT/US2004/041399 Example 915 3-[3-({3-[3-(2-ethylphenyl)-8-(trifluorornethyl)quinoHn-4-yl]phenoxy}methyl)phenyl]propa noic acid MS (ESI) m/z 556; HRMS: catcd for -34H2eF3NO3 + H+, 556.20940; found (ESI, [M+H]+), 556.2094; 66 Example 916 3-[3-({3-[3-(2-isopropylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noic acid MS (ESI) m/z 570; HRMS: calcd for CasHsoFsNOa + H+, 570.22505; found (ESI, [M+H]+), 570.2226; 66 Example 917 methyl 2-methyl-2-[4-{{3-(;3-methyl-8-(trifluorornethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate HRMS: calcd for CzgHzsFaNOa + H+, 494.19375; found (ES), [M+H]+), 494.193; 365 Example 918 3-[3-(2~methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoi HRMS: calcd-for C34H,eF3NO + H+, 394.14132; found (ESI, [M+H]+), 394.1409; 457 Example 919 2-methyl-2-|;4-({3-[3-methy(-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noic acid HRMS: calcd for C2aH24F3NO3 + H+, 480.17810; found (ESI, [M+H]+), 480.176; ^ 66 Example 920 ethyl [3-({3-[3-(2~ethylphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenylJaceta e MS (ESI) m/z 570; HRWIS: calcd for C35H3oF3N03 + H+, 570.22505; found (ESI, [M+H]+), 570.2226; 478 Example 921 4-{3-[(2,5-dim ethyl benzyl )oxy]phenyl}-8-(triftuorornethyl)quinoline MS (ESI) m/z 4O8; HRMS: calcd for C25H20F3NO + H+, 408.15697; found (ESI, [M+H]+), 408.1563; 44 Example 922 4-{3-[(2- chlorobenzyl)oxyjphenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 414; HRMS: calcd for C23Hi5C1F3NO 413.07943; found (ESI, [H+Mf), 414.0868 44 Example 923 4-{3-[(3,4-dimethylbenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 408.0; HRMS: calcd for C25H20F3NO + H+, 408.15697; 44 280 WO 2005/058834 PCT/US2004/041399 found (ESI, [M+H]+), 408.1574; Example 924 dimethylbenzyl)oxy]phenyl}-3-(2-methylbenzyl)-8-(trifluoromethyl)quinoline HRMS: calcd for C33H28F3NO + H+, 512.21957; found (ESI, [M+H]+), 512.2179; 43 Example 925 4-{3-[(2,6-dimethylbenzyl)oxy]phenyl}-3-(2-methylbenzyl)-8-(trifluoromethyl)quinoline HRMS: calcd for C33H28F3NO, 511.21230; found (ESI, [H+Mf), 512.2217 '43 Example 926 [4-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]acetic acid HRMS: calcd for C33H2eF3NO3, 541.18648; found (ESI, [H+Mf), 542.1927 366 Example 927 4~{3-[(2,6-dimethylbenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 408.1; HRMS: calcd for C25H2oF3NO + H+, 408.15697; found (ESI, [M+H]+), 408.1596 44 Example 928 4-{3-[(3-fluorobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline . MS (ESI) m/z 398; HRMS: calcd for C23H15F4NO + H+, 398.11625; found (ESI, [M+H]+), 398.1173; 44 Example 929 2-[4-({3-[3-(2-methylbenzyl)-8-(trifiuoromethyl)quino)in-4-yl]phenoxy}methyl)phenyl]ethan ol HRMS: calcd for C33H28F3NO2 527.20721; found (ESI, [H+M]+), 528.2133 365 Example 930 ethyl [3-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]aceta e HRMS: calcd for C35H30F3NO3 H+, 570.22505; found (ESI, [M+Hft, 570.223; 365 Example 931 [4~({3-[3-(2-methylbenzy))-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]ace onitrile HRMS: calcd for C33H25F3N2O + H+, 539.19409; found (ESI, [M+H]+), 539.1935; 365 281 WO 2005/058834 PCT/US2004/041399 Example 932 methyl [4-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-l]phenoxy}methyl)phenoxy]acet ate HRMS: calcd for -34H2BF3NO4 + H+, 572.20432; found (ESI, ' [M+H]+), 572.2025; 365 Example 933 [3-({3-[3-(2-ethylphenyl)-8-(trifluoromethy))quinolin-4-yl]phenoxy}methyl)pheny)]acetic acid i iMS (ES) m/z 539.9; HRMS: calcd for C33H26F3NO3 + H+, 542.19375; found (ESI, [IVH-H]4"), 542.1921; 66 Example 934 methyl [3-({3-[3~(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]acet ate HRMS: calcd for C34H28F3NO4 + H+, 572.20432; found (ESI, [M+-H]+), 572.2052; 365 Example 935 methyl 3-[4-({3-[3-(2-methy)benzyl)-8-(trifluoromethyf)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate : HRMS: calcd for C35H30F3NO3 + H+, 570.22505; found (ESI, [M+HD, 570.2228; 365 Example 936 methyl 3-[3-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate HRMS: calcd for C35H3DF3NO3 + H+, 570.22505; found (ESI, [M+H]+), 570.2238; 365 Example 937 methyl 3-[4-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]prop-2-ynoate HRMS: calcd for CssHaeFsNOa + H+, 566.19375; found (ESI, [M+H]+), 566.1946; 365 Example 938 4-{3-[(2,6-dichlorobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 448; HRMS: calcd for C23HMC12F3NO •»- H+, 448.04773; found (ESI, tM+H]+), 448.0496; 44 Example 939 4-{3-[(2,6-difluorobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 416; HRMS: calcd for C23H-,4F5NO + H+, 416.10683; found (ESI, [M+H]+), 416.1065; 44 282 WO 2005/058834 PCTAJS2004/041399 Example 940 methyl [3-({3-[8-(trifluoromethyl)quinolin-4-l]phenoxy}methyl)phenoxy]acet ate MS (ESI) mfz 468; HRMS: calcd for 26H2oF3N04 + H+, 468.14172; found (ESI, [M+H]+), 468.141; 44 Example 941 methyl [4-({3-[8-(trifiuorornethyl)quinolin-4-l]phenoxy}methyl)phenoxy]acet ate MS (ES) mfz 468.0; HRMS: calcd for S26H2oF3N04 + H+, 468.14172; found (ESI, [M+H]+), 468.144; 44 Example 942 methyl {[3-({3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetate MS (ES) m/z 482.0; HRMS: calcd for C27Hz>F3NO,, + H+, 482.15737; found (ESI, [M+H]+), 482.1556; 44 Example 943 methyl (2£)-3-[4-({3-[3-(2-methylbenzy))-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]acryla te HRMS: calcd for C3sH28F3NO3 + H+, 568.20940; found (ESI, [M+HD, 568.2104; 365 Example 944 methyl 2-methyl-2-[4-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate HRMS: calcd for C36H32F3NO3 + - H+, 584.24070; found (ESI, [M+H]+), 584.2426; 365 Example 945 4-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ES) m/z 498.1; HRMS; calcd for C32H26F3NO + H+, 498.20392; found (ESI, [M+H]+), 498.2034; 478 Example 946 4-{3-[(2~ fluorobenzyl)oxy]phenyl}-3-(2-methylphenyl)~8-(trifluoromethyl)quinoline MS (ES) m/z 488.0; HRMS: calcd for C30H21F4NO + H+, 488.16320; found (ESI, [M+H]+), 488.1666 478 Example 947 4-{3-[(2,6-dimethyibenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ES) m/z 498.1; HRMS: calcd for C32H26F3NO + H+, 498.20392; found (ESI, [M+H]+), 498.2038; 478 283 WO 2005/058834 PCT/US2004/041399 Example 948 4-{3-[(2-fluoro-5-nitrobenzyl)oxy]phenyl}-3-(2-methylpheny))-8-(trifluoromethyl)quinoline MS (ES) m/z 533.0; . HRMS: calcd forC3oH2oF4N203+ H+, 533.14828; found (ESI, [M+H]+), 533.1472; 478 Example 949 ethyl [4-({3-[3-(2-ethylphenyl)-8-(trifluoromethyl)quinolin-4-l]phenoxy}methyl)phenyl]acetat e MS (ES) m/z 570.1; 478 Example 950 . methyl {[3-({3-[3-(2-methylbenzyl)-8~ (trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetate HRMS: calcd for C35H30F3NO4 + H+, 586.21997; found (ESI, [M+H]+), 586.2219; , 365 Example 951 methyl {4-[({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-y)]phenyl}amino)methyl]phenyl}a cetate MS (ES) m/z 527.0; HRMS: calcd for CssHasFaNjOz + H+, 527.19409; found (ESI, IM+H]+), 527.1966; 66 Example 952 methyl {[4-({3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyl]oxy}a cetate MS (ES) m/z 482.0; HRMS: calcd for C27H22F3NO4 + H+, 482.15737; found (ESI, [M+H]+), 482.1574; 44 Example 953 methyl 3-[4-({3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noate MS (ES) m/z 466.0; HRMS: calcd for C27Hj2F3NO3 + H+, 466.16245; found (ESI, [M+Kf), 466.1628; 44 Example 954 methyl 3-[3-({3-[8-(trifiuoromethyl)quinolin-4-y)]phenoxy}methyl)phenyl]propa noate MS (ES) m/z 466.0; HRMS: calcd for C27H22F3NO3 + H+, 466.16245; found (ESI, [M+H]+), 466.1627; 44 Example 955 4-{3-[(2,5-difluorobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 416.0; HRMS: calcd for C23H,4F6NO + H+, 416.10683; found (ESI, [M+H]+), 416.1063; 44 Example 956 [4-({3-[8-(trifluoromethy()quinolin-4-yl]phenoxy}methyl)phenoxy]ace onitrile MS (ES) m/z 435.0; HRMS: calcd for C25H17F3N2O + H+, 435.13149; found (ES), 44 284 WO 2005/058834 PCT/US2004/041399 [M+H]+), 435.1329; Example 957 4-{3-[(2,4-difluorobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES)'m/z 416.0; HRMS: calcd for C33H14FSNO + H+. 416.10683; found (ESI, [M+H]+), 416.1065; 44 Example 958 4-{3-[(2,5-dichlorobenzyl)oxy]phenyl}-8-(triftuoromethyl)quinoline MS (ES) m/z 447.9; HRMS: caicd for 23H,4C12F3NO + H+, 448.04773; found (ESI, [M+H}+), 448.0461; 44 Example 959 [3-({3-[3-(2-methyIbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]acetic acid HRMS: calcd for C33H26F3NO3 + H+, 542.19375; found (ESl, [M+H]+), 542.1937; 216 Example 960 [4-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methy()phenoxy]acet ic acid HRMS: calcd for C33H26F3NO4 + H+, 558.18867; found (ESI, [M+H]+), 558.1889; 216 Example 961 [3-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]acet ic acid HRMS: calcd for C33H26F3NO4 + H+, 558.18867; found (ESI, [M+H]+), 558.189; 216 Example 962 ethyl [4-({3-[3-(2-isopropylphenyl)-8~ (trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]aceta e MS (ES) m/z 584.1; 478 Example 963 3-[4-({3-[3-(2-methytbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noic acid HRMS: calcd for C34H2oF3N03 H+, 556.20940; found (ESI, [M+H]+), 556.2083; 216 Example 964 3-[3-({3-[3-(2-methyIbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]prop noic acid HRMS: calcd for C34H28F3NO3 H+, 556.20940; found (ESI, [M+H]+), 216 285 WO 2005/058834 PCT/US2004/041399 i 556.2083; Example 965 3-[4-({3-[3-(2-methylbenzyl}-8-(trifluoromethyl)quinolin-4-yl3phenoxy}methyl)phenyl]prop-2-ynoic acid HRMS: calcd for C34H24F3NO3 + H+, 552.17810; found (ESI, [M+H]+), 552.1771; 216 Example 966 (2£)-3-[4-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinoIfn-4-yl]phenoxy}methyl)phenyl]acryli c acid l HRMS: calcd for C34H26F3NO3 + H+, 554.19375; found (ESI, [M+H]+), 554.193; 216 Example 967 2-methyI-2-[4-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]propa noie acid i HRMS: calcd for C35H30F3NO3 + H+, 570.22505; found (ESI, [M+H]+), 570.2244; 66 Example 968 {[3-({3-[3-(2-methylbenzyl)-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzyfjoxy}a cetic acid HRMS: calcd for C34H20F3NO4 + H+, 572.20432; found (ESI, [M+H]+), 572.2034; 216 Example 969 4-[3-(2-{1-[2-(1N-indol-3-yl)ethyl]-iN-indol-3-yl}ethoxy)phenyl]-8-(trifluoromethyl)quinoline MS (ES) m/z 574.1; HRMS: calcd for CssHajFsNsO + H+, 576.22572; found (ESI, [M+H]+), 576.2236; 44 Example 970 [3-({3-[8- : (trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]ace ic acid MS (ESI) m/z 454; HRMS: calcd for C;5H,8F3NO4 + H+, 454.12607; found (ESJ, [M+H]+), 454.1244; 41 Example 971 [4-({3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]ace ic acid MS (ESS) m/z 454; HRMS: calcd for C25H1aF3NO4 + H+, 454.12607; found (ESI, [M+H]+), 454.1265; 41 Example 972 methyl 4-({3-[8-(trifIuoromethyl)quinol/n-4-yllphenoxy}methyl)benzoate MS (ES) m/z 438.0; HRMS: calcd for C25H18F3NO3 + H+, 438.13115; found (ESI, 44 286 WO 2005/058834 PCTYUS2004/041399 IM+H]+), 438.13; Example 973 methyl 4-({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzoate iMS (ES) m/z 514.1; HRMS: calcd for 3iH22F3NO3 + H+, 514,16245; found (ESI, [M+H]+), 514.1653 44 Example 974 methyl 4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)benzoate HRMS: calcd for C26H2oF3N03 + H+, 452.14680; found (ESI, [IVI+H]+), 452.146; 365 Example 975 methyl 3-({3-[3-methyl-8-(trifluorornethyl)quinolin-4-yl]phenoxy}methyl)benzoate HRMS: calcd for C26H20F3NO3 + H+, 452.14680; found (ESI, [M+H]+), 452.1488; 365 Example 976 ethyl [3-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]aceta e HRMS: calcd for C28H24F3NO3 + H+ 480.17810; found (ESI, [M+H]*), 480.178; 365 Example 977 4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-ynphenoxy}methyl)benzoic aC1c HRMS: calcd for C2sH18F3NO3 + H+, 438.13115; found (ESI, [M+H]+), 438.1335; 216 Example 978 3-({3-[3-methyl-8-(trifluoromethyl)quinolin-4~ y)]phenoxy}methyl)benzoic acid HRMS: calcd for C26H18F3NO3 H+, ,438.13115; found (ESI, [M+H]*), 438.132; 216 Example 979 [3-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]aceti acid HRMS: calcd for C26H2oF3N03 H+, 452.14680; found (ESl, [M+H]+), 452.1457; . 216 Example 980 {[3-({3-[8-(trifluoromethyl)quinolin~4~ yl]phenoxy}me\hyl)benzy)]oxy}a cetic acid MS (ESI) m/z 468; HRMS: calcd for C26H?oF3N04 H+, 468.14172; found (ESI, [M+H]+), 41 287 WO 2005/058834 PCT/US2004/041399 i 468.1441; Example 981 {[4-({3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}rnethyl)benzyl]oxy}a cetic acid MS (ESI) m/z 468; HRMS:-calcd forC26H2oF3N04 +H+, 468.14172; found (ESI. [M+H]+), 468.1436; 41 Example 982 3-[4-({3-[8-(trifluorornethyl)quinolirt-4-yl]phenoxy}methyl)pbenyl]propa noic acid MS (ESI) m/z 452; HRMS: calcd for C26H20F3NO3 + H+, 452.14680; found (ES), [M+H]+), 452.1461; 41 Example 983 3-[3-({3-[8-(trifluorom ethyl )qu inolin-4-yl]phe noxy}m ethyl )phenyl]propa noic acid MS (ESI) m/z 452; HRMS: calcd for C26H2oF3N03 + H+, 452.14680; found (ESI, [M+H]*), 452.1474; 41 Example 984 4-{3-[2-(1tt-indol-3-yl)ethoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 433; HRMS: calcd for CzeHigFsNjO + H+, 433.15222; found (ESt, [M+H]*), 433.1506; 44 Example 985 4-({3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}metbyl)benzoic acid MS (ESI) m/z 424; HRMS: calcd for C24H16F3NO3 + H+, 424.11550; found (ESI, (M+H]+), 424.116; 41 Example 986 3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzoic acid MS (ES) m/z 422.0; HRMS: calcd for C24Hi6F3NO3 + H+, 424.11550; found (ESI, [M+H]+), 424.115; 66 Example 987 methyl 3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzoate MS (ESl) m/z 438; HRMS: calcd for C25H16F3NO3 + H+, 438.13115; found (ESI, [M+H]*), 438.1339 709 Example 988 methyl 4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzoate MS (ESI) m/z 438; HRMS: calcd for C25H1BF3NO3 H+, 438.13115; found (ESI, 709 288 WO 2005/058834 PCT/US2004/041399 [M+H]+), 438.1331; Example 989 4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzoic acid MS m/z 04-1790-IMN; HRMS: calcd for CZJH^FSNOS + H+, 424.11550; found (ESI, [M+H]+), 424.1153; 66 Example 990 4-{3-f(2-methoxybenzyl)oxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline HRMS: calcd for C25H2oi::3N02 + H+, 424.15189; found (ESI, [M+H]+), 424.1512; 43 Example 991 3-methyl-4-{3-[(2-nitrobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline HRMS: calcd for C24HirF3N2O3 + H+, 439.12640; found (ESI, tM+H]+), 439.1255; 43 Example 992 4-{3-[(3-fluorobenzyl)oxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline HRMS: calcd for C24H17F4NO + H+, 412.13190; found (ESt, [M+H]+), 412.1335; 43 Example 993 4-{3-[(3-bromobenzyl)oxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline HRMS: calcd for C24Hi?BrF3NO + H+, 472.05183; found (ESI, [M+H]+), 472.0543; 43 Example 994 3-({3-[3-methyl-8-(trifluoromethy])quinolin-4-yl]phenoxy}methyl)benzonifrile HRMS: calcd for C?5Hi7F3N2O + H+, 419.13657; found (ESI, [M+H]+), 419.1354; 43 Example 995 4-{3~[(3-methoxybenzyl)oxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline HRMS: calcd for O5H20F3NO, + H+, 424.15189; found (ESI, [M+H]+), 424.1498; 43 Example 996 3-methyl-4-{3-[(3-nitrobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline HRMS: calcd for C24H17F3N2O3 + H+, 439.12640; found (ESI, JM+H]+), 43 289 WO 2005/058834 PCT/US2004/041399 439.1243; Example 997 4-{3-[(4-methoxybenzyl)oxy]phenyl}-3-rnethyl-8-(trifluoromethyl)quinoline HRMS: calcd for 25HZoF3NOz + H+, 424.15189; found (ESI, [M+H]+), 424.1516; 43 Example 998 4-{3-[(2,5-dichlorobenzyl)oxy]phenyl}-3-methy)~8-{trif)uoromethyl)quinoline HRMS: calcd for C24H16C12F3NO + H+, 462.06338; found (ESI, [M+H]*), 462.0624; 43 Example 999 4-{3-[(2,5-difluorobenzyl)oxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline HRMS: calcd for C24H,SF5NO + H+, 430.12248; found (ESI, [M+H]+), 430.1225; 43 Example 1000 4-{3-[(2,6-dichlorobenzyl)oxy]phenyl}-3-methyl-8- (trifluoromethyl)quinoline HRMS: calcd for C24H16Cl2F3NO + H+, 462.06338; found (ESI, [M+H]+). 462.0636; 43 Example 1001 4-{3-[(2,6-difluorobenzyl)oxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline HRMS: calcd for C24HieFsNO + H+,' 430.12248; found (ESI, [M+H]*), 430.1212; 43 Example 1002 3-methy)-4-[3-(2-naphthylmethoxy)phenyl]-8-(trifluorometfiyl)quinoline HRMS: caicd for C2aH2oF3NO + H+, 444.15697; found (ESI, [M+H}+), 444.1574; 43 Example 1003 3-m ethyl-4-[3-(pyridiri-3-ylmethoxy)phenyl]-8-(trifluoromethy))quinoline HRMS: calcd for C23H,7F3N2O H+, 395.13657; found (ESI, [M+H]*), 395.1363; 43 Example 1004 3-methyi-4-[3-(quinolin-2-y 1m eth oxy)phenyl]-8-(trifluoromethyl)quinoline HRMS: calcd for C27Hi9F3N2O -v H+, 445.15222; found (ESI, [M+H]*), 43 290 WO 2005/058834 PCT/US2004/041399 - 445.1517; Example 1005 4-{3-[(3-chlorobenzy))oxy]phenyl}-3-methyi-8-(trifluorornethyl)quinoline HRMS: calcd for C24H17C1F3NO + H+, 428.10235; found (ESI, [M+H]+), 428.1038; 43 Example 1006 3-methyl-4-{3-[(3-methy)benzyt)oxy]phenyl}-8-(trifluoromethy))quinoline i HRMS: calcd for C25H2oF3NO + H+, 408.15697; found (ESI, [M+H]+), 408.1566; 43 Example 1007 4-{3-[(3-ethoxybenzyl)oxy]pheny[}-3-methyl-8-(trifluoromethyl)quinoline HRMS: calcd forCo5H22F3NO2 +H+, 438.16754; found (ESI, [M+H]+), 438.1671; 43 Example 1008 3-methyl-4-{3-[(3-propoxybenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline HRMS: calcd forC27H24F3NO2 +H+. 452.18319; found (ESI, [M+H]+), 452.1818; 43 Example 1009 4-{3-[(3-isobutoxybenzyl)oxy]phenyl}-3-methyi-8-(trifluoromethyl)quinoline HRMS: calcd for C28H26F3NO2 + H+, 466.19884; found (ESI, [M+H]+), 466.198; 43 Example 1010 4-{3-[(2,5-difluorobenzyl)oxy]phenyl}-3-(2 methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 506; HRMS: calcd for CaoHjoFsNO + H+, 506.15378; found (ESI, [M+H]+), 506.1565; 478 Example 1011 4-(3-{[2,5-bis(trifluoromethyl)benzyl]oxy}p enyl)-3-(2-methylphenyl)-8-(trifluoromethy))quinoline MS (ESI) m/z 606; HRMS: calcd for C32H20F3NO + H+, 606.14739; found (ESI, [M+H]+), 606.1492; 478 Example 1012 4-{3-[(2-bromo-5-methoxybenzyl)oxy]phenyl}-3-(2-methyiphenyl)-8-(trifluoromethyl)quinoiine MS (ESI) m/z 573; HRMS: calcd for C31H23BrF3NO + H+, 578.09370; found (ESI, fM+H]+), 478 291 WO 2005/058834 PCT/US2004/041399 578.0931; Example 1013 4-{3-[(2-chloro-5-fluorobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 522; 478 Example 1014 4-{3-[(5-bromo-2-methoxybenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 578; HRMS; calcd for C31H23BrF3NO2 + H+, 578.09370; found (ESI, IM+H]+), 578.095; 478 Example 1015 4-{3-[(5-bromo-2-fluorobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyQguinoline MS (ESI) m/z 566; HRMS: calcd for C3oH2oBrF4NO + H+, 566.07371; found (ESI, [M+H]+), 566.0758; 478 Example 1016 4-{3-[(2-methoxy-5-nitrobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-{trifluoromethyl)quinoline MS (ESI) m/z 545; HRMS: calcd for C31H23F3N2O4 + H+, 545.16827; found (ESI, [M+H]+), 545.1661; 478 Example 1017 4-{3-[(2,6-dichlorobenzyl)oxy]phenyl}-3-(2 methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 538; HRMS: calcd for C3oHZoC12F3NO + H+, 538.09468; found (ESI, [M+HD, 538.0931; 478 Example 1018 4-{3-[(2,6-difluorobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 506; HRMS: calcd for C3oH2oF5NO + H+, 506.15378; found (ESI, IM+H]+), 506.1525; 478 Example 1019 4-[3-(benzyloxy)phenyl]-3-phenyl-8-(trifltroromethyl)quinoline MS (ESI) m/z 456; HRMS: calcd for C29HaoF3NO + H+, 456.15697; found (ESI, [M+H]+), 456.1571; 44 Example 1020 4-{3-[(2,5-dimethylbenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 484; HRMS: calcd for C3iH24F3NO + H+, 484.18827; found (ESI, [M+H]*), 484.1889; 44 292 WO 2005/058834 PCT/US2004/041399 Example 1021 4-{3-[(2,5-difluorobenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 492; HRMS: calcd for C29H1BFSNO + H+, 492.13813; found (ESI, [M+H]+), 492.1399; 44 Example 1022 4-{3-[(2,5-dich)orobenzyl)oxy]phenyl}-3-pheny)-8-(trifluoromethyl)quinoline MS (ESI) m/z 524; HRMS: calcd for OwH^azFsNO + H+, 524.07903; found (ESI, [M+H]+), 524.1779 44 Example 1023 4-{3-[(4-fluoro-3-nitrobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) 533; viz HRMS: calcd for C3oH2oF4N203 + H+, 533.14828; found (ESI, [M+H]+), 533.1483; 478 Example 1024 3-(2-methyIphenyl)-4-{3-[(4-nitrobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 515; HRMS: calcd for C30H2tF3N2O3 + H+, 515.15770; found (ESI, [M+Hl*), 515.16; 478 Example 1025 4-{3-[(5-chloro-2-fluorobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifiuoromethyl)quinoline MS (ESI) m/z 522; HRMS: calcd for C30H20ClF4NO + H+, 522.12423; found (ESI, [M+H]+), 522.1249; 478 Example 1026 4-{3-[(3-methoxybenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 486; HRMS: calcd for C3oH22F3N02 + H+, 486.16754; found (ESI, IM+H]+), 486.1667; 44 Example 1027 4-{3-[(4-isopropylbenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 498; HRMS: calcd for C32H26F3NO + H+, 498.20392; found (ESI, [M+H]+), 498.2076 44 Example 1028 4-{3-[(3,4-dimethylbenzyl)oxy]phenyl}-3-phenyl-8-' (trifluoromethyl)quinoline MS (ESI) m/z 484; HRMS: calcd for C3iH24F3NO + H+, 484.18827; found (ESI, [M+H]+), 484.1859; 44 293 WO 2005/058834 PCT/US2004/041399 Example 1029 4-{3-[(2,6-dimethy)benzyl)oxy]phenyl}-3-phenyl-8-{trifluoromethyl)quinoline iMS (ESI) m/z 484; ' HRMS: calcd for C3iH24F3NO + H+, 484.18827; found (ESI, [M+H]+), 484.1871; 44 Example 1030 4-{3-[(2-chlorti-4-fluorobenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 508; HRMS: calcd for C29H18ClF4lMO + H+, 508.10858; found (ESI, IM+H]+), 508.1072; 44 Example 1031 4-(3~{[2,5-bis(trifluoromethyl)benzyl]oxy}ph enyl)-3-phenyl-8-(trifluoromethyl)quinoline IMS (ESI) m/z 592; HRMS: caicd for C3IHIBF8NO + H+, 592.13174; found (ESI, [M+H]+), 592.1306; 44 Example 1032 4-(3-{[2-chloro-3-(trifluoromethyl)benzyl]oxy}phen y))-3-phenyl-8-(trifluoromethyl)quinbline MS (ESI) m/z 558; HRMS: calcd for CaoH^C1FgNO + H+, 558.10538; found (ESI, [M+H]+), 558.1071; 44 Example -1033 4-{3-[(2-chloro-5~ fluorobenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethy()quinoline MS (ESI) m/z 508; HRMS: calcd for CzgHwC1F^NO + H+, 508.10858; found (ESI, [M+H]+), 508.1062; 44 Example 1034 4-{3-[(3,4-dichlorobenzyl)oxy]phenyl}-3-phenyl-8-(trifiuoromethyl)quinoline MS (ESl) m/z 524; HRMS: calcd for C29H18Cl2F3NO + H+, 524.07903; found (ESI, [M+H]+), 524.0778; 44 Example 1035 4-{3-[(2,6- dichlorobenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 524; HRMS: calcd for C29H18C12F3NO + H+, 524.07903; found (ESI, [M+H]+), 524.0815; 44 Example 1036 4-{3-[(2,6-difluorobenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 492; 44 Example 1037 4-{3-[(2,4-difluorobenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 492; HRMS: calcd for C29HieF5NO + H+,. 492.13813; found (ESI, 44 294 WO 2005/058834 PCT/US2004/041399 [M+H]+), 492.1371; Example 1038 3-[3-(2-ethynyiphenyl)-8-(trifluoromethyl)quinolin-4-yl]phenol MS (ESI) m/z 390; 676 Example 1039 4-{3-K2,3-difluorobenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ES) m/z 492.1; HRMS: calcd for C29HIBF5NO + H+, 492.13813; found (ESI, [M+H]+), 492.1367; 44 Example 1040 N-[(5-methyl-2-thienyl)methyl]-3-[3-methyl-8-(trifluorornethyl)quinolin-4-yl]aniline HRMS: calcd for C23H19F3N2S + H+, 413.12938; found (ESI, [M+H]+), 413.1292; 66 Example1041 -N-[(5-ethyl-2-furyl)methyl]-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yllaniline HRMS: calcd for C2«H21F3N2O + H+, 411.16787; found (ESI, [M+HD, 411.169; 66 Example 1042 N-[(4,5-dimethyl-2-furyl)methyl]-3-[3-methyl-8-(trifluoromethyl)quinoIin-4-y)]aniline HRMS: calcd for C24H21F3N2O + H+, 411.16787; found (ESI, [M+H]*), 411.169; 66 Example 1043 N-(2-fluoro-5-methoxybenzyl)-3-[3-methyl-8-(trifluorornethyl)quinolin-4-yl]aniline HRMS: calcd for C25H2oF4N20 + ' H+, 441.15845; found (ESI, [M+H]*), 441.1581; 66 Example 1044 -N-(2-bromo-5-methoxybenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yljaniline HRMS: calcd for C25HaoBrF3N2C + H+, 501.07838; found (ESI, [M+H]*), 501.0788; 66 Example 1045 -N-(2,3-dimethoxybenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]aniline HRMS: calcd for CZ6H23F3N2O + H+, 453.17844; found (ESI, [M+H]+), 453.1808; 66 295 WO 2005/058834 PCT/US2004/041399 Example 1046 -N-(2,4-dimethoxybenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yljaniline i HRMS: calcd for C26HJ3F3N2O2 + H+, 453.17844; found (ESI, [M+H]+), 453.1787; 66 Example 1047 -N-(3,4-dimethoxybenzyl)-3-i;3-methyl-8-(trifluoromethyl)quino)in-4-yl]aniline HRMS: calcd for+ H+, 453.17844; found (ESt, [M+H]+), 453.1808; 66 Example 1048 -N-(3,5-dimethoxybenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]aniline j ] HRMS: calcd for C26H23F3N2O2 + H+, 453.17844; found (ESI, [M+H]+), 453.1792; 66 Example 1049 N-(2,3-dimethyIbenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yljanilfne HRMS: calcd orCp6H23F3N2 + H+, 421.18861; found (ESI, [M+H]+), 421.1896; 66 Example 1050 N-(4-isopropyIbenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]aniline HRMS: calcd or C27H25F3N2 + H+, 435.20426; found {ESI, [M+H]+), 435.2059; 66 Example 1051 {3-[3-methyl-8-(trifluoromethyl)quinoiin-4-yl]phenyl}(1-naphthylmethyl)amine - HRMS: calcd forC2SH2iF3N2 + H+, 443.17296; found (ESI, [M+H]+), 443.1733; 66 Example 1052 (3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}(2-naphthylmethyl)amine HRMS: calcd for C26H2iF3N + H+, 443.17296; found (ESI, [M+H]+), 443.1754 66 Example 1053 {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}(quinolin-3-ylmethyl)amine, HRMS: calcd for QJ7H20F3N + H+, 444.16821; found (ESI, [M+H]+), 444.1686; 66 Example 1054, -N-(1 ~benzofuran-2-ylmethyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-y)]aniline HRMS: calcd for C26Hi9F3N2O H+, 433.15222; found (ESI, [M+H]+), 433.1536; 66 296 WO 2005/058834 PCT/US2004/041399 Example 1055 N-[(5-methyl-2-furyl)methyl]-3-[3~methyl-8-(trifluoromethyl)quinolin-4-yl]aniline HRMS: calcd for23H1gF3N2O +H+, 397.15222; found (ESI, [M+H]+), 397.1528; 66 Example 1056 methyl {4-[({3-[3-methyl-8-(trifluoromethyl)quinolin-4-l]phenyl}amino)methyl]phenyl}a cetate i HRMS: calcd for C2rH23F3N2O2 + H+, 465.17844; found (ESI, [M+HD, 465.1797; 66 Example 1057 methyl 2-{4-[({3-[3-metbyl-8-(trif)uoromethyl)quinolin-4-l]phenyl}amino)methyl]phenyl}p ropanoate HRMS: calcd for CjaHzsFsNzOa + H+, 479.19409; found {ESI, [M+H]*), 479.1933; 66 Example 1058 methyl 2-methyl-2-{4~K{3-[3-methyl-8-(trifluoromethyl)quinolii>4-yl3phenyl}amino)methyl]phenyl}p ropanoate HRMS: calcd for CzgH^FaNj-Oj + H+, 493.20974; found (ESI, [M+H]+), 493.2089; 66 Example 1059 4-{3-[(4-fluorobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 488; HRMS: calcd for C30H21F4NO + H+, 488.16320; found (ESI, [M+HD, 488.1635; 478 Example 1060 4-(3~{[5-fluoro~2-(trifluoromethyl)benzyl]oxy}pben y))-3-(2-methy)phenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 556; HRMS: calcd for C3iH2oF7NO + H+, 556.15059; found (ESI, [M+H]+), 556.1496; 478 Example 1061 4-(3-{[2-chloro-5-(trifluoromethyl)benzyl]oxy}phen yl)-3-(2-methylphenyl)-8-(trifluoromethyl)quinoiine MS (ESi) m/z 572; HRMS: calcd for C31H20C1F6NO + H+, 572.12104; found (ESI, [M+HD, 572.1196; 478 Example 1062 4-{3-[(2-chloro-4-fluorobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 522; HRMS: calcd for CaoHaoC1F^NO + H+, 522.12423; found (ES), [M+H]+), 522.1254; 478 297 WO 2005/058834 PCT/US2004/041399 Example 1063 4-{3-[(2-chlorobenzyl)oxy]phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 504; HRMS: calcd for C30H21C1F3NO + H+, 504.13365; found (ESI, [M+H]+), 504.1335," 478 Example 1064 4-(3-{[2-chloro-3-trifluoromethyl)benzyl]oxy}phen yl)-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 572; HRMS: calcd for C3iH2oC1F6NO + H+, 572.12104; found (ESI, [M+H]+), 572.119; 478 Example 1065 4-(3-{[5-chloro-2-trifluoromethyl)benzyl]oxy}phen yl)-3-(2-methy)phenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 572; HRMS: calcd for C3iH2oClF6NO + H+, 572.12104; found (ES), [M+H]+), 572.1216; 478 Example 1066 4-{3-[(2-fluoro-4-nitro benzyl )oxy] phenyl}-3-(2-methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) m/z 533; HRMS: calcd for C3oH2oF4N203 + H+, 533.14828; found (ESI, [M+HJ*), 533.1478; 478 Example 1067 4-[3-(1-naphthylmethoxy)pheny)]-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 506; HRMS: calcd for CssHjaFsNO + H+, 506.17262; found (ESI, [M+H]+), 506.1727; 44 Example 1068 4-{3-[(2-methoxybenzyl)oxy]pheny)}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 486; HRMS: calcd for C30H22F3NO2 + H+, 486.16754; found (ESI, [M+H]+), 486.1673; 44 Example 1069 4-{3-[(2,3-dimethylbenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 484; HRMS: calcd for C3,H24F3NO + H+, 484.18827; found (ESI, [M+H]+). 484.19; 44 Example 1070 4-{3-[(3,5-dimethoxybenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) m/z 516; 44 Example 1071 methyl [4-({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]ace ate MS (ESI) m/z 544; HRMS: calcd for C32H24F3NO4 + H+, 544.17302; found (ESI, 44 298 WO 2005/058834 PCT/US2004/041399 [M+HD, 544.1744; Example 1072 4-{3-[(2,3-imethoxybenzyl)oxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline MS (ESI) mlz 516; HRMS: calcd for C3iH24F3NO3 + H+, 516.17810; found (ESI, [M+H]+), 516.1794; 44 Example 1073 4-(3-{[5-chloro-2-(trifluoromethyl)benzyl]oxy}phen yl)-3-phenyl-8-(trifluoromethyl)quinoline iMS (ESI) mlz 558; HRMS: calcd for CaoH^C1FeNO + H+, 558.10538; found (ESI, [M+HD, 558.106; 44 Example 1074 4-{3-[(4-bromo-2-nitrobenzyl)oxy]phenyl}-3-(2~ methylphenyl)-8-(trifluoromethyl)quinoline MS (ESI) mlz 593; 478 Example 1075 {4-[({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}a cetic acid HRMS: calcd for C26H2iF3N2O2 + H+, 451.16279; found (ESI, [M+HD, 451.1609; 66 Example 1076 2-{4-[({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl}p ropanoic acid HRMS: calcd for C2?H23F3N2Oz + H+, 465.17844; found (ESi, [M+H]+), 465.177; 66 Example 1077 2-methyl-2-{4-[({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)methyl]phenyl} ropanoic acid HRMS: calcd forC2BH25F3N2O2+ H+, 479.19409; found (ESI, [M+H]+), 479.1932; 66 Example 1078 (2R)-2-[4-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]prop£ noic acid HRMS; calcd for C27H22F3NO3 H+, 466.16245; found (ESI, [M+H]+), 466.1634; 366 Example 1079 (2S)-2-[4-({3-[3-methyl-8-(trif luorom ethyl)q uinolin-4-yl]phenoxy}methyl)phenyl]prop noic acid HRMS: calcd for C27H22F3NO3 H+, 466.16245; found (ESI, [M+H]+), 466.1631; 366 299 WO 2005/058834 PCT/US2004/041399 Example 1080 3-benzyl-4-{3-[(2-chlorobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) mfz 504; 478 Example 1081 3-benzyl-4-{3-[(2-fIuorobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 488; 478 Example 1082 3-benzyI-4-{3-[(4-fluorobenzyl)oxy]phenyl}-8-(trrfluoromethyljquinoline MS (ESI) m/z 488; 478 Example 1083 3-benzyl-4-{3-[(4-nitrobenzyl)oxy]phenyl}-8-(trifluorometbyl)quinoline MS (ESI) m/z 515; 478 Example 1084 3-benzyl-4-[3-(3-chloro-4-fluorophenoxy)phenyl]-8-(trffiuoromethyl)quinoline MS (ESI) m/z 508; HRMS: calcd for . C29H1SC1F4NO + H+, 508.10858; found (ESI, [M+Hl*), 508.1096; 519 Example 1085 3-benzyl-4-[3-(3-methylphenoxy)phenyl]-8-(trifluoromethyl)quinoline MS (ESI) m/z 470; HRMS: calcd forC3DH22F3NO +H+, 470.17262; found {ESI, IM+H]+), 470.1759 519 Example 1086 3-benzy)-8-(trif)uoromethy])-4-{3 [3-(trifluoromethyl)phenoxy]phenyl] quinoline MS (ESI) m/z ' 524; HRMS: calcd for C3oH19F6NO + H+, 524.14436; found (ESl, IM+H]+), 524.1441; 519 Example 1087 3-benzyl-4-[3-(3-chlorophenoxy)phenyl]-8-(trifluoromethyl)quinoline MS (ESI) m/z 490; HRMS: calcd forC2gHigC1F3NO+ H+, 490.11800; found (ESI, [M+H]+), 490.1157; 519 Example 1088 3-benzyl-4-[3-(3,5-dimethylphenoxy)phenyl]-8-(trifluoromethyl)quinoline MS (ESI) m/z 484; HRMS; calcd for C31H24F3MO + H+, 484.18827; found (ESI, [M+HD, 484.1869; 519 Example 1089 3-benzyl-4-[3-(4-fluorophenoxy)phenyl]-8-(trifluoromethyl)quino)ine MS (ESl) m/z 474; HRMS: calcd for CHtoF^NO -t H+, 474.14755; found (ESI, ' [M+H]+), 474.1492; 519 300 WO 2005/058834 PCT/US2004/041399 WO 2005/058834 PCT/US2004/041399 Example 1090 3-benzy!-4-[3-(2~ naphthyloxy)phenyl]-8-(trifluoromethyl)quinoline MS (ESI} m/z 506; HRMS: calcd for C33H22F3NO + H+, 506.17262; found (ESI, [M+Hf), 506.1752; 519 Example 1091 3-benzy!-4-[3-(3,5-difluorophenoxy)phenyl]-8-(trifluoromethyl)quinoline MS (ESI) m/z 492; HRMS: caicd for C29H1SF5NO + H+, 492.13813; found (ESI, [M+HO, 492.1386; 519 Example 1092Example 1093 (3-{3-[3-methyl-8-(trifluoromethy))quinolin-4-yl]phenoxy}phenyl)methanol(4-{3-[3-methyl~8-(trifluoromethy!)quinolin-4-yl]phenoxy}phenyl)methanol MS (ESI) m/z 410;MS (ESI) m/z 410; HRMS: calcd for Ci4H18F3NO2 + H+, 410.13624; found (ES), [M+Hf), 410.1362; HRMS: calcd for C24H18FSNOS + H+, 410.13624; found (ESI, [M+Hf), 410.1342; 415 415 Example 1094 3-benzyl-4-[3-(3,5-dichlorophenoxy)phenyl]-8-(trifluoromethyl)quinoline MS (ESI) m/z 524; HRMS: calcd for C29HiaCl2F3NC + H+, 524.07903; found (ESI, [M+H]+), 524.0775; 519 Example 1095 N/-(2,5-dimethylbenzyI)-3-[3-methyl-8-(trifluoromethyl)quino)in-4-yljaniline HRMS: calcd for C25H23F3N + H+, 421.18861; found (ESI, [M+Hf), 421.1897; 66 Example 1096 N-(5-fluoro-2-methoxybenzyl)-3-[3-methyl-8-(triffuoromethyl)quinolin-4-yl]aniline HRMS: calcd for C25H20F4N20 H+, 441.15845; found (ESI, [M+HJ*), 441.1575; 66 Example 1097 N-[5-fluoro-2-(trifluoromethyl)benzy!]-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yi]aniline HRMS: calcd for C25H17F7N + H+, 479.13527; found (ESI, [M+Hf), 479.1375; 266 301 WO 2005/058834 PCT/US2004/041399 Example 1098 -N-[2-fluoro-5-(trifluoromethyl)benzyl]-3-[3-methyl-8-{trifluorornethyl)quinolin-4-yl]aniline HRMS-, calcd for C2sHi7F?N2 + H+, 479.13527; found (ESI, [M+H]*), 479.1344; 66 Example 1099 N-(5-ethoxy-2-fluorobenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]aniline HRMS: calcd for C26H22F4N2O + H+, 455.17410; found (ESl-FTiVlS, [M+H]1+), 455.17452; 66 Example 1100 N-(2-fluoro-5-propoxybenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]aniline HRMS: calcd for CZ7HZ^AH2O + H+, 469.18975; found (ESI-FT^AS, [M+H}1+), 469.1399; 66 t,Example 1101 -N-(2-bromo-5-ethoxybenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]aniline HRMS: caicd for CaeHjaBrFjNaO + H+, 515.09403; found (ESI-. FTMS, [M+H]1*), 515.09469; 66 Example 1102 -N-(2,6-dimethylbenzyl)-3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]aniline HRMS: calcd for C2GH23F3N2 + H+, 421.18861; found (ESI-FTMS, [M+H]1*), 421.18907; 66 Example 1103 {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}[2-(trifluoromethoxy)benzyl]amine HRMS: calcd for C25H1BF6N2O + H+, 477.13961; found (ESI-FTMS, [M+H]1+), 477.13955; 66 Example 1104 {3-[3-methyl-8-(trif)uoromethyl)quinolin-4-yl]phenyl}[3-(trifluoromethoxy)benzyljamine HRMS: calcd for C25H18F6N2O H+, 477.13961; found (ESI-FTMS, [M+H]1*), 477.13957; 66 ExampU 1105' -N-(2-fluoro-6-methoxybenzyl)-3 [3-methyl-8-(trifluoromethy[)quinolin-4-yl]aniline HRMS: calcd for C25H2oF4N20 H+, 441.15845; found (ESI-FTMS, JM+Uf*), 66 302 WO 2005/058834 PCT/US2004/041399 441.15891; Example 1106 -N-(3-fluoro-4-methoxybenzyl)-3~ [3-methyl-8-(trifluoromethyl)quinolin-4-yl]aniline i HRMS: calcd for C25H2oF,N20 + H+, 441.15845; found (ES)-FTMS, [M+H11+), 441.15917; 66 Example 1107 -N-(2-ethoxy-3-methoxybenzyl)-3-[3-methyl^8-(trifluoromethyl)quinolin-4-yllaniline VIS (ESI) m/z 467 ([M+H])* 66 Example 1108 -N- Example 1109 N-(1 H-indol-5-ylmethyl)-3~[3-methyl-8-(trifluororneihyl)quinolin-4~ yHaniline HRMS: calcd for C26H20F3N3 + H+, 432.16821; found (ESI-FTMS, [M+H]1+), 432.16886; 66 Example 1110 3-(2-methylphenyl)-8-(trifluoromethyl)-4-{3-[(3,4,5-trimethoxybenzyl)oxy]phenyl}qui noline MS m/z 560; 478 Example 1111 3-benzyl-4-{3-[(5-brom o-2-fluorobenzyl)oxy]phenyl}~8-(trifluoromethyl)quinoline MS m/z 566; 478 Example 1112 [4-({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenoxy]acet ic acid MS (ESI) m/z 530; HRMS: calcd forH+, 530.15737; found (ESI-FTMS, [M+H]1+), 530.1573; 41 Example 1113 3-({3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)-4-fluorobenzonitrile MS (ESI) m/z 513; 478 303 WO 2005/058834 PCT/US2004/041399 Example 1114 - -N-[2-chloro-3-(trifluoromethyl)benzyl]-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]aniline MS (ESI) m/z 557; HRMS: calcd for 3oH19C1FeN2 + H+, 557.12137; found {ESl-FTMS, [M+Hl"), 557.12108; 66 Example 1115 -N-(1 H-indol-5-ylmethyl)-3~[3-Pjhenyl-8-(trifluorornethy])quinolin-4-yllaniiine MS (ESI) m/z 492; 66 Example 1116 4-fluoro-3-({3-[3~(2-methylphenyl)-8-(trifluorornethyl)quinolin-4-yl]phenoxy}methyl)benzonitrile MS (ESI) m/z 513.2 (M+H)+ 478 Example 1117 3-benzyl-8-fluoro-4-(3-methoxyphenyOquinoline MS (ESI) m/z 344; HRMS: calcd for C23Hi8FNO + H+, 344.14452; found (ESI, [M+H]*), 344.1457; 457 Example 1118 N-(2,3-dihydro-1,4-benzodioxin-6-ylmethyl)-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]aniline MS (ES) m/z 513.2; HRMS: calcd for C3iH23F3N2O2 + H+, 513.17844; found (ESI-FT/MS, [M+H]1*), 513.1789; 66 Example 1119 -N-(1 f/-indol-6-yimethyl)-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]aniline MS (ES) m/z 492.1; HRMS: calcd for C31H22F3N + H+, 494.18386; found (ESI-FT/MS, [M+H]1+), 494.1837; 66 Example 1120 N-(1 -naphthylmethyl)-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]aniline . MS (ES) m/z 505.2; HRMS: calcd for C33HMF3N + H+, 505.18861; found (ESl-FT/MS, [M+HI1*), 505.1879; 66 Example 1121 {3-[3-phenyl-8-(trif[uoromethyl)quinolin-4-yl]phenyl}[2-(trifluoromethoxy)benzyl]amine MS (ES) m/z 539.1; HRMS: calcd for C3oH2oF8N20 H+, 539.15526; found fESI-FT7MS, [M+H11+), 539.1563; 66 304 WO 2005/058834 PCT/US2004/041399 Example 1122 -N-[2~fluoro-5-(trifluoromethyl)benzyl]-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]aniline IMS (ES) m/z 539.1; HRMS: calcC1 or C-JOH19F7N2 + H+, 54115092; found (ESI-FT/MS, [M+H]1*), 541.1504; 66 Example 1123 -N-(2,3-dimethylbenzyl)-3-[3-phenyl-8-{trifluoromethy))quino)in-4-yljaniline MS (ES) m/z 483.2; HRMS: calcd for C3iH25F3N2 + H+, 483.20426; found (ESl-FT/MS, [M+H]1t), 483.2046; 66 Example 1124 -N-(2,3-dimethoxybenzyl)-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]aniline MS (ES) m/z 515.1; HRMS: calcd for C3iH25F3N2O2 + H+, 515.19409; found (ESI-FT;MS,[M+H]1+), 515.194; 66 Example 1125 3-[({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}am ino)m ethyl]benzon rile 1 MS (ES) m/z 478.1; HRMS: calcd for C3oH2oF3N3 + H+, 480.16821; found (ESI-FT^MS, [M+H]1*), 480.1677; 66 Example 1126 . -N-[(1 -methyi-1 H-indol-2-yl)methyl]-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]aniline MS (ES) m/z 508.2; HRMS: calcd for C32H24F3N3 + H+, 508.19951; found (ESf-FT/MS, [M+H]u), 508.2; 66 Example 1127 N-[(1 -acetyl-1 H-indol-3-yl)methyl]-3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]aniline MS (ES) m/z 536.1; HRMS: calcd for C33H24F3N3O + H+, 536.19442; found (ESl-FT/MS, [M+H]1+), 536.195; 66 Example 1128 4-{3-[(5-ethynyl-2-fluorobenzyl)oxy]phenyl}-3-(2-m ethyl phenyl)-8-(trifluoromethyl)quiholine MS (ES) m/z 512.1; 676 Example 1129 3-benzyl-8-chloro-4-(3-nitrophenyl)quinoline HRMS: calcd for C^sC1NzO + H+, 375.08948; found (ESI-FT/MS, [M+HJ1+), 375.0901; 457 305 WO 2005/058834 PCT/US2004/041399 HRMS: calcd forC22Hi5C1N2O->; + H+, ; 375.08948; found (ESI-Example 3-benzyl-8-chloro-4-(4- MS (ES) m/z [™F), 1130 nitrophenyl)quinoline 375.1; 375.0901; . 457 3-benzyl-4-{3-[(5-ethynyl-2-Example fluorobenzyl)oxy]phenyl}-8- MS(ESWZ 1131 (trifluoromethyl)quinoline 512.1; 676 HRMS: calcd for CzzH^C1Na + H+, 345.11530; found (ESI-Example [4-(3-benzyl-8~chloroquinolin-4- MS(ESI) m/z [M+Hfi, 1132 yl)phenyl1amine 345; 345.1151; 457 HRMS: calcd for C29H2oF3N02 + H+, 472.15189;(3-{3-[3-phenyl-8- f°™lS' Example (trifluoromethyl)quinolin-4- MS (ESI) m/z [M+Hfi, 1133 yl]phenoxy}phenyl)methanol 472; 472.1517; 519 HRMS: calcd for : C29H2oF3N02 + H+, 472.15189;(4-{3-[3-phenyl-8- ^rluT' Example (trifluoromethyl)quinolin-4- Ms(ES\) m/z (M+H]1+), 1134 yl]phenoxy}phenyl)methanol 472; 472.1513; 519 4-{3-[(5-ethyl-2-fluorobenzyl)oxy]phenyl}-3-(2-Example methylphenyl)-8- MS (ES)) m/z 1135 (trifluoromethyl)quinoline 516; 678 4-{3-t(2-fluoro-5-vinylbenzyl)oxy]phenyl}-3-(2-Example methylphenyl)-8- MS(ES) m/z 1136 (trifluoromethyl)quinoline 514.2; 676 HRMS: calcd for C26H21F,N2O2 + H+,ethyl 3-({3-[3-methyl-8- tu)S, Example (trifluoromethyl)quinolin-4- [M+H]+), 1137 yl]phenyl}amino)benzoate 451.1638; 110 HRMS: calcd for C22H17C1N2 + H+, ^ 345.11530; found (ESI Example [3-(3-benzyl-8-chloroquinolin-4- tM+H]+),1138 yl)phenyl]amine 345.1171; 60 306 WO 2005/058834 PCT/US2004/041399 Example 1139 3-benzyl-4-{3-[(2-fluoro~5-vinylbenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 514.2; 676 Example 1140 3-benzyl-4-(3-{[2-chloro-3-trifliiorornethyl)benzyl]oxy}phen yl)-8-(trifluoromethyl)quinoline MS (ES) m/z 572.1; 478 Example 1141 3-benzyl-4-{3-[(3-bromobenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 548.1; 478 Example 1142 3-[3,8-bis(trifluoromethy()quinolin-4-yl]phenol MS (ES) m/z 356.1; 457 Example 1143 [4-({3-[3,8-bis(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]acetic acid MS (ES) m/z 504.1; 66 Example 1144 methyl 2-[4-({3-[3,8-bis(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]-2-methylpropanoate MS (ES) m/z 548.2; 478 Example 1145 2-[4-({3-[3,8-bis(trifluoromethyl)quinoiin-4-yl]phenoxy}methyl)phenyl]-2-methylpropanoic acid MS (ES) m/z 532.1; 66 Example 1146 4-(3-{[2-chloro-3-(trifluoromethyl)benzyl]oxy}phen yl)-3-(2,4,6-trifluorobenzyl)-8-(trifluoromethyl)quinoline MS (ES) m/z 626.2; 478 Example1147 ethyl 3-{[3-(3-benzyl-8-chloroquinolin-4-yl)phenyl]amino}benzoate HRMS: calcd for C31H25C1N2O2 + H+, 493.16773; found (ESI, [M+H]+), 493.1676; 110 Example 1148 [3-({3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}amino)phenyl]methan ol HRMS: calcd for C24H10F3N2O H+, 409.15222; found (ESI, [M+H]+), 409.1528; 415 Example 1149 (3-{[3-(3-benzyi-8-chloroquinolin-4-yl)phenyl]amino}phenyl)methan ol HRMS: calcd for C29H23C1N2O H+, 451.15717; found (ESI, [M+H]+), 451.1592; 415 307 WO 2005/058834 PCT/US2004/041399 Example 1150 4-(3-brom ophenyl )-8-chloro-3-methylquinoiine MS (ES) m/z 332.1; HRMS: calcd for CeHnBrClN + H+, 331.98361; found (ESI, JM+H]+), 331.9853; 457 Example 1151 3-benzyl-4-(3-bromophenyl)-8~ chloroquinoline MS (ES) m/z 408.1; HRMS: calcd for CzzHisBrC1N + H-v, 408.01491; found (ESI, [M+H]+), 408.0145; 457 Example 1152 2-methyl-2-[4-({3-t3-(2,4,6-trifluorobenzyl)-8-(trifl uoromethyl)quinolin~4-yl]phenoxy}methyl)phenyl]propa noic acid MS m/z 04-2798-IMN; 66 Example 1153 2~(3-{[3-(3-benzyl~8-ch)oroquinolin-4-yl)plienyl]amino}phenyl)propan-2-ol HRMS: calcd for C31H27C1N2O + H+, 479.18847; found (ESI, [M+H]+),479.189; 710 Example 1154 3-{[3-(3-benzyl-8-chloroquinoiin-4-yl)phenyl]amino}ben2oic acid HRMS: calcd for C29HsiClN2Oa + H+, 465.13643; found (ESI, [M+H]+), 465.1355; 110 Example 1155 (3-{3-[3-benzyl-8-(trifluoromethyl)quinoiin-4-Yl|p_henoxyjphenyl)methanol MS (ES) m/z 486.2; HRMS: calcd for C3aH22F3NO2 + H+, 486.16754; found (ESI, fM+H]+), 486.1691; 415 Example 1156 methyl 3-{3-(8-chloro-3-methyiquinolii>4~ yl)phenoxy]benzoate MS (ES) m/z 404.2; HRMS: calcd for Q,4HIBC1NO3 H+, 404.10480; found (ESt, [M+H]+), 404.1063; 709 Example 1157 4-(3-rnethoxyphenyl)-3-(2,4,6-trifluorobenzyl)-8-(trifluoromethyl)quinoline MS (ES) m/z 448.1; 457 Example 1158 methyl 3-bromo-2,6-dimethoxy 4-({3-[3-pheny)-8-i (trifluoromethyl)quinoiin~4-yl]phenoxy}methyl)benzoate MS (ES) m/z 652.1; HRMS: calcd for C33H25BrF3NC + H+, 652.094,10; found (ESI, [M+H]+), 652.0978; 44 308 WO 2005/058834 PCT/US2004/041399 Example 1159 [4-({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]metha nol MS (ES) m/z 486 2- HRMS: calcd for C30H22F3NO2 + H+, 486.16754; found (ESI, [M+H]+), 486 169" 519 Example 1160 {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}methanol MS (ES) m/z 376.1; HRMS: calcd for C23H1BC1NO2 + H+, 376.10988; found (ESI, [M+H]+), 376.109; 415 Example 1161 2-{3~[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}propan-2-ol MS (ES) m/z 404.2; HRMS: calcd for CzsH^ClNOz + H+, 404.14118; found (ESI, IM+H]*), 404.1414; 710 Example 1162 8-ch loro-4-(3-{[2-chloro-3-(trifluoromethyl)benzyl]oxy}phen yl)-3-pbenylquinoline MS (ES) m/z 524.1; HRMS: calcd for C29HiaC12F3NO + H+, 524.07903; found (ESI, [M+H]+), 524.0784; 44 Example 1163 [3-({3-[3-phenyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}methyl)phenyl]metha nol MS (ES) m/z 486.2; HRMS: calcd for CaoH^FaNOj + H+, 486.16754; found (ES),[M+HD, 486.1684; 44 Example 1164 3-benzyl-4-(3-{[2-fluoro-3-(trifluoromethyl)benzyl]oxy}phen yl)-8-(trifluoromethyl)quinoline MS (ES) m/z 556.1; 478 Example 1165 3-benzyl-4-{3-[(3-ethynylbenzyl)oxy]phenyl}-8-(trifluoromethyl)quinoline MS (ES) m/z 494.2; 676 Example 1166 methyl 3-{[3-(3-benzyl-8-chloroquinolin-4-yl)phenyl]amino}benzoa{e HRMS: caicd for C30H23C1N2O2 + H+, 479.15208; found (ES), [M+H]+), 479.1502; 110 Example 1167 -N-[3-(3-benzyl-8-chloroquinolin 4-y|)phenyl]-3,5-dimethylaniline HRMS: calcd for C30H25C1N + H+, 449.17790; found (ESI, [M+H]+), 449.1782; 119 309 PCT/XJS2004/041399 WO 2005/058834 HRMS: calcd for l C32H28C1N3O +i H+,3-{[3-(3-benzyl-8-chloroquinolin- SS' Example 4-y))phenyl]amino}--N- j [M+H]+),' 1168 propylbenzamide 506.1993; 708 3-benzyl-4-{3-[{4-bromo-2-Example fluorobenzy))oxy]phenyf}-8- MS(ESI) m/z 1169 (trifluoromethyl)quinoline 566; 478 4-(3-methoxyphenyl)-3~(2-Example methylpheny1)-8- MS(.ES) m/z 1170 (trifluoromethyl)quinoline 394.2; 457 3-[3-(2-chloro-6-fiuoropheny))-8-Example (trifIuorornethyl)quinolin-4-1171 y)]phenol MS m/z 418; 457 , HRMS: calcd forCazHzaBrFaNOs3-bromo-2,6~dimethoxy-4-({3-[3~ + H+, phenyl-8- ^07844; 1- , -r, 1 11 . ,. » found (ESI, Example (trifluoromethyl)quinolin-4- MS(ES) m/z [M+H]+),1172 yl]phenoxy}methyl)benzoic acid 638.0; 638.0815; 41 HRMS: calcd for C^H,9C)N2O2 + H+,3-[3-(8-chIoro-3-methylquinolin- ^^ Example 4-yl)phenoxy]--N- MS(ES)m/z [M+H]+), 1173 methylbenzamide 403.2; 403.123 708 HRMS: calcd for C28Hi9C1F2Nz + H+ 457.12776;Example N-[3-(3-benzyl-8-chIoroquino)in- [M+H]+), ' 1174 4-y0j)heny]]-3,5-difluoroaniline 457.1273; 110 HRMS: calcd for C2SH19C13N2 + H+, 489.06866;Example N-[3-(3-benzyl-8-chioroquinolin- °pw+Hr), ' 1175 4-yl)^henylJ-3,5-dichloroani)ine 489.0213 110 HRMS: calcd for C28H,9Br2C1Nz + H+, .576.96762;Example N-[3-(3-benzyl-8-chloroquinolin- °[M+HV), ' 1176 4-yl)phenyl]-3,5-dibromoaniline 576.9662; 110 HRMS: calcd for C2BH20C1NO, + H+, 438.12553;Example {4-[3-(8-chloro-3-phenylquinolin- MS (ES) m/z ^WH-H]*), ' 1177 4-y))phenoxy]phenyl}methanol 438.2; 438.1239; 519 310 WO 2005/058834 PCT/US2004/041399 HRMS: calcd for ' C3oH22C1N03 + H+,methyl 3-[3-(3-benzyl-8- £JJ»g Example chloroquinolm-4- MS(ES) m/z [M+H]+), 1178 yl)phenoxy]benzoate 480.2; 480.1376; 519 HRMS: calcd for C30H20F3NO3 + H+,methyl 4-{3-[3-phenyl-8- f5°°^4®8°: _ , rik .,. J ., ,v . ,. . found (ESI, Example (tnfluoromethyl)quino)in-4- MS(ES) m/z [M+H]+), 1179 yl]phenoxy}benzoate 499.9; 500.1456; 519 3-[3-(2-prop-1-yn-1-ylphenyl)-8-Exampie (trifluorornethyl)quinolin-4- MS(ESI) m/z 1180 yl]phenol 404; 676 2-[4-( 3-hydroxy phen y I )-8-Example (trifluoromeihyl)quinolin-3- MS (ES)) m/z 1181 yl]benzonitrile 391; 676Example 3-benzyl-8-(trifluoromethyl)-4-(3- Ms (ESI) m/z 1182 vinylphenyl)quinoline 390; 676 Example 3-[8-(trifluoromethyl)-3-(2- MS (ES)) m/z 1183 vinylphenyl)quinolin-4-yl3phenol 392; 676 2,6-dimethoxy-4-({3-[3-phenyl-8-Example (trifluoromethyl)quinoIin-4- MS (ESI) m/z 1184 yl]phenoxy}methyl)benzoic acid 560; 41 3-[3-(2-prop-1-en-1-ylphenyl)-8- Mg ^ Example (trifluoromethyl)quinolin-4- 405 g7 (M+H)+, 1185 yljphenol 404.0 (M-H)+ ' 676 3-benzyI-4-{3-[(2-fluoro-4-Example vinylbenzyl)oxy]phenyl}-8- ES| (|VJ+H)+ = 1186 (trifluoromethyl)quino(ine 514. 676 3-benzyl-8-chloro-4-[3-(3,5-Example difluorophenoxy)phenyl]quinolin MS(ESI)458 1187 e m/z(fM+H])+ 519 3-benzyl-8-chloro-4-[3-(3,5-Example dimethylphenoxy)phenyl]quinoli MS (ESI) 450 1188 ne mfe([M+H])+ 519 HRMS: calcd for C33H27F3N2O2 + H+, 0 ;o TQ uOr,T»l « 541.20974;3-{3-[3-benzyl-8- found (ESU Example (trifluoromethyl)quinohn-4- MS(ESI) m/z [M+HD, 1189 yl]phenoxy}-N-propylbenzamide 541; 541.21; 708 311 WO 2005/058834 PCT/US2004/041399 Example 1190 3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}--N-isopropylbenzamide MS (ESI) m/z 541; ; HRMS: calcd for CasHz/FaNjOz + H+, 541.20974; found (ESI, [M+H]+), 541.2088- 708 Example 1191 3-{3-[3-benzyl-8-(trifiuoromethyl)quino)in-4-ylJphenoxy}-N-,-N-diethylbenzamide MS (ESI) m/z 555; 708 Example 1192 3-benzyl-4-{3-[3-(pyrrolidin-1-ylcarbonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 553; ; HRMS: calcd forC34H27F3N2O2+ H+, 553.20974; found (ESI, IM+H]+). 553.2108; 708 Example 1193 3-benzyl-4-{3-[3-(piperidin-1-ylcarbonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 567; HRMS: calcd forC35H29F3N2O2+ H+, 567.22539; found (ESI, [M+H]+), 567.2275; 708 Example 1194 3~benzyl-4-{3-[3-(rnorpholin-4-ylcarbonyl)phenoxyjphenyl}-8-(trifluoromethyl)quinoline MS (ESI) m/z 569; 708 Example 1195 3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-propylbenzamide MS (ESI) m/z 431; HRMS: calcd forC26H23ClN2O2+ H+, 431.15208: found (ESI, (M+H]+), 431.1519; 708 Example 1196 3-[3-(8-chloro-3-methyiquinolin-4-yl)phenoxy]--N-isopropylbenzamide MS (ESI) m/z 431; HRMS: calcd for C26H23C1N2O2 + H+, 431.15208; found (ESI, [M+H]+), 431.1501; 708 Example 1197 3-[3-(8-chloro-3-me{hylquinolin-4-yl )phen oxy]~/V, N-diethylbenzamide MS (ESI) m/z 445; HRMS: calcd for C27H25C1N2O2 + H+, 445.16773; found (ESI, [M+H]+), 445.1694; 708 Example 1198 8-chloro-3-m ethyl-4-{3-[3-(pyrrolidin-1-ylcarbonyl)phenoxy]phenyl}quin oline MS (ESI) m/z 443; 708 312 WO 2005/058834 PCT/US2004/041399 Example 1199 8-ch)oro-3-methy)-4-{3-[3-(piperidin-1-ylcarbonyl)phenoxyjphenyl}quin oline fMS (ESI) m/z 457; HRMS: caicd forC28H2sC1N2O2+ H+, 457.16773; found (ESI, [M+H]+), 457.1673; 708 Example 1200 8-chloro-3-methyI-4-{3-[3-(morpholin-4-ylcarbonyl)phenoxy]phenyl}quin oline MS (ESI) m/z 459; 708 Example 1201 3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-(3-methoxyphenyl)benzamide MS (ESI) m/z495; 708 Example 1202 3-benzyl-4-{3-[(2-fluoro-5-prop-1 -yn-1 -ylbenzyl)oxy]phenyl}-8-(tnfluorornethyl)quinoline MS (ESI) m/z 526; 676 Example 1203 -N-[3-(3-benzyl~8-chloroquinolin-4-yl)phenyl]-N-,3,5-trimethylaniline MS (ESI) m/z ABA ([M+H])+; 43 It is intended that each of the patents, applications, and printed publications including books mentioned in this patent document be hereby incorporated by reference in their entirety. This application claims priority benefit of U.S. Provisional Application Ser. No. 60/529,009 filed 12/12/03, and U.S. Provisional Application Ser. No. 60/600,296 filed 8/10/04, each of which is incorporated by reference herein in its entirety. As those skilled in the art will appreC1ate, numerous changes and modifications may be made to the preferred embodiments of the invention without departing from the spirit of the invention. It is intended that all such variations fail within the scope of the invention. 313 WO 2005/058834 PCT7US2004/041399 WHAT IS CLAIMED IS: 1. A compound of formula i having the structure: wherein: R1 is -H or d to C3 alkyi; X1 is a bond, d to C5 alkyl, -C(O)-, -C(=CR8R9)-; -O-, -S(O)r, -NRB-, -CR8R9-, -CHR23, -CRsCORg)-, -C(OR8)2-, -CR8(OC(0)R9)-, -C=NOR9-, -C(O)NR8-, -CH2O-, -CH2S-, -CH2NR8-, -OCH2-; -SCH2-, -NR8CH2-, or R2 is H, d to C6 alkyl, C2 to C6 alkenyl, C2 to C6 alkynyl, C3 to C6 cycloalkyl, -CH2OH, C7 to d-i arylalkyl, phenyl, naphthyl, C1 to C3 perfluoroalkyl, CN, C(O)NH2, CO2R12 or phenyl substituted independently by one or more of the groups independently selected from C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 alkynyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2> -NR8R9, -CN, -OH, and d to C3 alkyl substituted with 1 to 5 fluorines, or R2 is a heterocycle selected from the group consisting of pyridine, thiophene, benzisoxazole, benzothiophene, oxadiazole, pyrrole, pyrazole, imidazole and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1, to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, and C1 to C3 alkyl substituted with 1 to 5 fluorines; X2 is a bond or -CH2-; R3 is phenyl, naphthyl, or phenyl or naphthyl substituted independently by one to four groups independently selected from C1 to C3 alkyl, hydroxy, phenyl, acyl, halogen, -NH2, -CN, -NO2, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, NR14R15, -C(O)R10, -C(O)NR10R11, -C(O)NR11A, -C(O)R10, -CH=CHR8, -WA, -C=CA, -CH=CHA, -WYA, -WYNR11 314 WO 2005/058834 PCT/US2004/041399 A, -WYR10> -WY(CH2)jA, -WCHRnCCH2-A, -W(CH2)jA, -WCCH2),R10,. -.' CHR11W(CHz)jR10, -CHRnW(CH2)A –CHRnNR11YA, -CHRnNR11YR11, pyrrole, -W(CH2)iA(CH2)kD(CH2)pZ, ; -W(CR18Ri9)A(CH2)kD(CH2)pZ, -(CH2)jWA(CH2>icD(CH2)pZ, -CH=CHA(CH2)KD(CH2)PZ, -C=CA(CH2)kD(CH2)pZ, -W(CH2)jC5CA{CH2)kD(CH2)pZ, and -W(CH2),Z, or R3 is a heterocyde selected from pyridine, pyrimidine, thiophene, furan, benzothiophene, indole, benzofuran, benzimidazole, benzothiazole, benzoxazoie, and quinoiine, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, hydroxy, phenyl, acy), halogen, -NH2, -CN, -NO2, C1 to C3 perfluoroalkyl, C1 to C3 alkyi substituted, with 1 to 5 fluorines, -C(O)R10 - C(O)NR10R11, -C(O)NR11A> -C=CR8, -CH=CHR8, -WA, -C=CA, -CH=CHA, -WYA, -WYR10, -WY(CH2)jA, -W(CH2)jA, -CHR11NR12YA, -CHR11NR12YR10, -CHR11W(CH2)iA, -CHR11NR12YA, -CHR11NR12YR10, -WCHR11NR12YR10, -W(CH2)iA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ, -(CH2),WA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, -W(CH2),CsCA(CH2XD(CH2)pZ, and -W(CH2)jZ; W is a bond, -O-, -S-, -S(O>, -S(O)2-, -NR1r, or-N(COR12)-; Y is -CO-, -S(O)2-, -CONR13, -CONR13CO-, -CONR13SO2-, -C(NCN)-, -CSNR13, -C(NH)NR13, or -C(O)O-; j is 0 to 3; k is 0 to 3; t is 0 to 2; D is a bond, -CH=CH-, -CSCI -C=, -C(O)-, phenyl, -O-, -NH-, -S-, -CHR14-, -CR14R15- , -OCHR14-, -OCR14R15-, or -CH(OH)CH(OH)-; p is 0 to 3; Z is -COzRu, -CONR10R11, -C(=NR10)NR11R12, -CONH2NH2, -CN, -CH2OH, -NR16R17, phenyl, CONHCH(R20)COR12, phthalimide, pyrrolidine-2,5-dione, thiazoiidine-2,4-dione,' tetrazolyl, pyrrole, indoie, oxazoie, 2-thioxo-1,3-thiazolinin-4-one, C1 to C7 amines, C3 to CT cyclic amines, or C1 to C3 alkyi substituted with one to two OH groups; wherein said pyrrole is optionally substituted with one or two substituents independently selected from the group consisting of -CO2CH3, -CO2H, -COCH3, -CONH2 and -CN; wherein 315 WO 2005/058834 PCT/US2004/041399 said C1 to C7 amines are optionally substituted with one to two substituents independently selected from the group consisting of -OH, halogen, -OCH3, and -C=CH; wherein said phenyl is optionally substituted with CO2R11, and wherein said C3 to C7 cyclic amines are optionally substituted with one or two substituents independently selected from the group consisting of -OH -CH2OH, C1 to C3 alkyl, -CH2OCH3l -CO2CH3, and -CONH2, and wherein said oxazole is optionally substituted with CH2CO2R11; A is phenyl, naphthyl, tetrahydronaphthyl, indan or biphenyl, each of which may be optionally substituted by one to four groups independently selected from halogen, C1 to C3 alkyl, C2 to C4 alkenyl, C2 to CA alkynyl, acyl, hydroxy, halogen, -CN, -NO2, -CO2R11, -CH2CO2R11, phenyl, C1 to C3 perfluoroalkoxy, C1 to C3 perfluoroalkyl, -NR10R11, -CHJNR-10RH, -SR11, C1 to C6 alkyl substituted with 1 to 5 fluorines, C1 to C3 alkyl substituted with 1 to 2 -OH groups, C1 to C6 alkoxy optionally substituted with 1 to 5 fluorines, or phenoxy optionally substituted with 1 to 2 CF3 groups; or A is a heterocycle selected from pyrrole, pyridine, pyridine-N-oxide, pyrimidine, pyrazole, thiophene, furan, quinoline, oxazole, thiazole, imidazole, isoxazole, indole, benzo[1,3]-dioxole, benzo[1,2,5]-oxadiazole, isochromen-1-one, benzothiophene, benzofuran, 2,3-dihydrobenzo[1,43~dioxine, bitheinyl, quinazolin-2,4-91,3H]dione, and 3-H-isobenzofuran-1-one, each of which may be optionally substituted by one to three groups independently selected from halogen, C1 to C3 alkyl, acyl, hydroxy, -CN, -NO2, C1 to C3 perfluoroalkyl, -NR-10R11, -CHaNRioR,-,, -SRn, C1 to C3 alkyl substituted with 1 to 5 fluorines, and C1 to C3 alkoxy optionally substituted with 1 to 5 fluorines; R4, R5, and R6 are each, independently, -H or -F; R7 is hydrogen, C -j to C4 alkyl,. C1 to C4 perfluoroalkyl, halogen, -NO2, -CN, phenyl or phenyl substituted with one or two groups independently selected from halogen, C1 to C2 alkyl and OH; provided that if R7 is hydrogen, then R3 is selected from: (a) phenyl substituted by-VV(CH2)jA(CH2)kD(CH2)pZ, -W(CR18Ri9)A(CH2)kD(CH2)pZ, -(CH2)jWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or -W(CH2)jCsCA(CH2)kD(CH2)pZ, wherein the phenyl moiety is further optionally 316 WO 2005/058834 PCT/US2004/041399 . substituted with one or two groups independently selected from d to C2 alky], G, to Co perfluoroalkyl, halogen, and CN; and (b) a heterocycle selected from pyridine, pyrimidine, thiophene, and furan, each of which is substituted by one of-W(CH2)jA(CH2)kD(CH2)pZ, -W(CR1BR19)A(CH2)kD(CH2)pZ, -(CH2),WA{CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or -W(CH2)jCsCA(CH2)kD(CH2)pZ; further provided that if X-|R2 forms hydrogen, then R3 is selected from: (a) phenyl substituted by -W(CH2)iA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ, -(CH2),WA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)pZ, or -W(CH2)jCsCA(CH2)kD(CH2)pZ, wherein the phenyl moiety is further optionally, substituted with one or two groups independently selected from C1 to C2 alkyl, C1 to C2 perfluoroalkyl, halogen, and C1M; and (b) a heterocycle selected from pyridine, pyrimidine, thiophene, and furan, each of which is substituted by one of-W(CH2)jA(CH2)kD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ) -(CH2)jWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -CsCA(CH2)kD(CH2)pZ, or -W(CH2)iC=CA(CH2)kD(CH2)pZ; further provided that R3 and R7 cannot both be hydrogen; each R8 is independently -H, or C1 to C3 alkyl; each R9 is independently -H, or d to C3 alkyl; each R10 is independently -H, -OH, d to C3 alkoxy, C1 to C7 alkyl, C3 to C7 alkenyl, C3 to C7 alkynyl, C3 to C7 cycloaikyl, -CH2CH2OCH3, 2-methyl-tetrahydro-furan, 2-methyl-tetrahydro-pyran, 4-methyl-piperidine, morpholine, pyrrolidine, or phenyl optionally substituted with one or two C1 to C3 alkoxy groups, wherein said C1 to C7 alkyl is optionally substituted with 1, 2 or 3 groups independently selected from C1 to C3 alkoxy, C1 to C3 thioalkoxy and CN; each R-M is independently -H, C1 to C3 alkyl or R22; or R10 and R11f when attached to the same atom, together with said atom form: a 5 to 7 membered saturated ring, optionally substituted by 1 to 2 groups independently selected from C1 to C3 alkyl, OH and d-C3 alkoxy; or 317 WO 2005/058834 PCT/US2004/041399 a 5 to 7 membered ring containing 1 or 2 heteroatoms, optionally substituted by 1 to 2 groups independently selected from C1 to C3 alkyl, OH and C1-C3 alkoxy; each R12 is independently -H, or C, to C3 alkyl; each R13 is independently -H, or C1 to C3 alkyl; each R14 and R15 is, independently, C1 to C7 alkyl, C3 to C8 cycloalkyl, C2 to C7 alkenyl, C2 to C7 alkynyl, -OH, -F, C7 to d4 arylalkyl, where said arylalkyl is optionally substituted with 1 to 3 groups independently selected from NO2, C1 to C6 alkyl, C1 to C3 perhaloalkyl, halogen, CH2CO2R11, phenyl and d to C3 alkoxy, or R14 and R15 together with the atom to which they are attached can form a 3 to 7 membered saturated ring; each R16 and R17 is, independently, hydrogen, C1 to C3 alkyl, C1 to C3 alkenyl, d to C3 alkynyl, phenyl, benzyl or C3 to C8 cycloalkyl, wherein said C1 to C3 alkyl is optionally substituted with one OH group, and wherein said benzyl is optionally substituted with 1 to 3 groups selected from C1 to C3 alkyl and d to . C3 alkoxy; or R16 and R17, together with the atom to which they are attached, can form a 3 to 8 membered heterocycle which is optionally substituted with one or two substituents independently selected from the group consisting of d to C3 alkyl, -OH, CH2OH, -CH2OCH3, -CO2CH3) and -CONH2; each R18 and R19 is, independently, d to C3 alkyl; each R20 is independently H, phenyl, or the side chain of a naturally occurring alpha amino acid; each R22 is independently arylalkyl optionally substituted with CH2COOH; and each R23 is phenyl; or a pharmaceutically acceptable salt thereof. 2. A compound according to Claim 1, wherein R1 is -H, X1 is a bond, -C(O)-, -O-, -S(O)t-, -NR8-, or -CR8R9-; R2 is C1 to C6 alkyl, phenyl, or phenyl substituted independently by one or more of the groups independently selected from C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 318 WO 2005/058834 PCT/US2004/041399 alkynyl, C1 to C3 alkoxy, C^ to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, - . OH, and C1 to C3 alkyl substituted with 1 to 5 fluorines, or R2 is a heterocycle selected from the group consisting of pyridine, thiophene, benzisoxazole, benzothiophene, oxadiazole, pyrrole, pyrazole, imidazole and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, and C1 to C3 alkyl substituted with 1 to 5 fluorines; X2 is a bond or -CH2-; R3 is phenyl, naphthyl, or phenyl or naphthyl substituted independently by one to four groups independently selected from C1 to C3 alkyl, hydroxy, phenyl, acyl, halogen, -NH2, -CN, -NO2, C1 to C3 perfluoroalkyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, -C(O)R10, -C(O)NR10R11, -C(O)NR11A, -C=CR8, -CH=CHR8, -WA, -CHCA, -CH=CHA, -WYA, -WYR10, -WY(CH2)jA, -WCHR11(CH2)j,A, -W(CH2)jA, -W(CH2)jR10, -CHR11W(CH2)]R10, CHR11W(CH2)jA, -CHR11NR12YA, -CHR11NR12YR10, and pyrrole, or R3 is a heterocycle selected from pyridine, pyrimidine, thiophene, furan, benzothiophene, indole, benzofuran, benzimidazole, benzothiazole, benzoxazole, and quinoline, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, hydroxy, phenyl, acyl, halogen, -NH2, -CN, -NO2, C1 to C3 perfluoroalkyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, -C(O)R10, -C(O)NR10R11, -C(O)NR11A, -C=CR8, -CH=CHR8, -WA, -C^CA, -CH=CHA, -WYA, -WYR10, -WY(CH2)jA, -W(CH2)jA, -W(CH2)jR10, -CHR11W(CH2)JR10, -CHR11W(CH2)jA, -CHR11NR12YA, and -CHR11NR12YR10; W is a bond, -O-, -S-, -S(O)-, -S(O)2-, -NR11-, or-N(COR12)-; Y is -CO-, -S(O)2-, -CONR13, -CONR13CO-, -CONR13SO2-, -C(NCN)-, -CSNR13, -C(NH)NR13, or-C(O)O-; j is 0 to 3; t is 0 to 2; A is phenyl, naphthyl, tetrahydronaphthyi, or phenyl substituted by one to four groups independently selected from halogen, C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 alkynyl, acyl, C1 to C3 alkoxy, hydroxy, halogen, -CN, -NO2, -COzR1i, - 319 WO 2005/058834 PCT/US2004/041399 CH2CO2R11, phenyl, phenoxy, C1 to C3 perfluoroalkoxy, C1 to C3 perfluoroalkyl, -NR10R11. -CH2NR10R11, -SR11, C1 to C3 alkyl substituted with 1 to 5 fluorines, C1 to C6 alkyl substituted with 1 to 2 -OH groups, and C1 to C6 alkoxy optionally substituted with 1 to 5 fluorines; or A is a heterocycle selected from pyrrole, pyridine, pyrimidine, thiophene, furan, quinoline, oxazole, thiazole, imidazole, isoxazole, indole, benzo[1,3]-dioxole, benzo[1,2,5]-oxadiazole, isochromen-1-one, and 3-H-isobenzofuran-1 -one, each of which may be optionally substituted by one to three groups independently selected from halogen, C1 to C3 alkyl, acyl, C1 to C3 alkoxy, hydroxy, halogen, -CN, -NG2, C1 to C3 perfluoroalkyl, -NR10R11. -CH2NR10R11, -SR11, C1 to C6 alkyl substituted with 1 to 5 fluorines, and C1 to C6 alkoxy optionally substituted with 1 to 5 fluorines; R4, R5, R6 are each, independently, -H; R7 is C1 to C4 alkyl, C, to C4 perfluoroalkyl, or halogen; each R8 is independently -H, or C1 to C2 alkyl; each R9 is independently -H, or C1 to C2 alkyl; each R10 is independently-H,C1 to C7 alkyl, C2 to C7 alkenyl, or C3 to C7 cycloalkyl; each Rn is independently -H, or C, to C3 alkyl; each R12 is independently -H, or C1 to C3 alkyl; or a pharmaceutically acceptable salt thereof. 3. A compound according to Claim 2, wherein X1 is a bond, -C(O)-, or -CR8R9-; R2 is phenyl substituted independently by one or more of the groups independently selected from C1 to C3 alkyl, C2 to C4 alkenyl, C2 to C4 alkynyl, C1 to C3 alkoxy, C1 to C3 perfluoroalkyl, halogen, -NO2, -NR8R9, -CN, -OH, and C1 to C3 alkyl substituted with 1 to 5 fluorines, or R2 is a heterocycle selected from the group consisting of pyridine, thiophene, and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C3 320 WO 2005/058834 PCT/US2004/041399 perfluoroaikyl, halogen, -NO2, -NR8R9, CN, and C1 to C3 alkyl substituted with . 1 to 5 fluorines, X2 is a bond; R3 is phenyl substituted independently by one to four groups independently selected from hydroxy, halogen, C1 to C3 perfluoroaikyl, C1 to C3 alkyl substituted with 1 to 5 fluorines, -C=CR6, -CH=CHR8, -WA, -C=CA, -WYA, -WY(CH2)jA -. W(CH2)jA, -WCHR11(CH2)jA and -CHR11W(CH2)jA; or a pharmaceutically acceptable salt thereof. 4. A compound according to Claim 1, wherein R1 is H; X1 is a bond, -C(O) -, -O-, -S(O)t-, -NR8-, -CR8R9-, or -CR8(OR9)-; R2 is C1 to C6 alkyl, C2 to C6 alkenyl, C2 to C6 alkynyl, C3 to C8 cyC1oaikyl, -CH2OH, CF3, CN, phenyl, or phenyl substituted by one to four groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C2 perfluoroaikyl, halogen, -NO2, -NR8R9, -CN, and C1 to C2 alkyl substituted with 1 to 3 fluorines, or R2 is a heterocycle selected from pyridine, thiophene, and furan, each of which may be optionally substituted with one to three groups independently selected from C1 to C3 alkyl, C1 to C3 alkoxy, C1 to C2 perfluoroaikyl, halogen, ~NO2, -NR8R9, -CN, and C1 to C2 alkyl substituted with 1 to 3 fluorines; X2 is a bond or -CH2-; R3 is phenyl substituted by -W(CH2)jA(CH2)kD(CH2)pZ, W(CR18R19)A(CH2)kD(CH2)pZ, -(CH2)jWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -CSCA(CH2)kD(CH2)pZ, or W(CH2)jC=CA(CH2)kD(CH2)pZ, and further optionally substituted with one or two groups independently selected from C1 to C2 alkyl, C1 to C2 perfiuoroalkyl, halogen, and -CN, or R3 is a heterocycle selected from pyridine, pyrimidine, thiophene, and furan, each of which is optionally substituted by -W(CH2)jA(CH2)kD(CH2)pZ, -W(CR18R19}A(CH2)kD(CH2)pZ, -(CH2)iWA(CH2)kD(CH2)pZ, -CH=CHA(CH2)kD(CH2)pZ, -C=CA(CH2)kD(CH2)PZ, or -W(CH2)jC=CA(CH2)kD(CH2)pZ; W is a bond, -O-, -S-, -S(O), -S(O)2-, -NR11, or -N(COR12)-; j is 0 to 3; 321 WO 2005/058834 PCT/US2004/041399 k is 0 to 3; t is 0 to 2; D is a bond, -CH=CH-, -C=C1 phenyl, -O-, -NH-; -S-, -CHR14-, -CR14R15- -OCHR14-, -OCR14R15-, or -CH(OH)CH(OH)-; p is 0 to 3, Z is -CO2R11, -CONR10R11, -C(=NR10)NR11R12 -CONH2NH2, -CN, -CH2OH, - NR16R17, CONHCH(R20)CO12, phthalimide, pyrrolidine-2,5-dione, thiazoHdine- 2,4-dione, tetrazolyl, pyrrole, C1 to C7 amines, C3 to C7 cyclic amines, or C1 to C3 alkyl substituted with one to two OH groups; wherein said pyrrole is optionally substituted with one or two substituents independently selected from the group consisting of -CO2CH3, -CO2H, -COCH3,and -CN; wherein said C1 to C7 amines are optionally substituted with one to two substituents independently selected from the group consisting of -OH, halogen, -OCH3, and -C=CH; and wherein said C3 to C7 cyclic amines are optionally substituted with one or two substituents independently selected from the group consisting of -OH -CH2OH, -CH2OCH3, -CO2CH3, and -CONH2; A is phenyl, or phenyl substituted by one to four groups independently selected from halogen, acyl, C1 to C3 alkyl, C1 to C3 alkoxy, hydroxy, halogen, -CN, -MO2, C1 to C3 perfluoroalkyl, -NR10R11, -CH2NR10R11, -SR11, and C1 to C2 alkyl substituted with 1 to 3 fluorines; or A is a heterocycle selected from pyrrole, pyridine, pyrimidine, thiophene, indole, oxazole, and furan, which may be optionally substituted by one to three groups independently selected from halogen, acyl, C1 to C3 alkyl, C1 to C3 alkoxy, hydroxy, -CN, -NO2, C1 to C3 perfluoroalkyl, -NR10R11, -CH2NR10R11, -SR11, and C1 to C2 alkyl substituted with 1 to 3 fluorines; R4, R5, R6 are -H; R7 is hydrogen, C1 to C4 alkyl, C1 to C4 perfluoroalkyl, or halogen; each R8 is independently -H, or C1 to C2 alkyl; each R9 is independently -H, or C1 to C2 alkyl; each R10 is independently -H, or C, to C3 alkyl; each Rn is independently -H, or C1 to C3 alkyl; or R10 and R11, when attached to the same atom, together with said atom form: 322 WO 2005/058834 PCT/US2004/041399 a 5 to 7 membered saturated ring, optionally substituted by 1 to 2 groups independently selected from C1 to C3 alkyl, OH and C1-C3 alkoxy, or a 5 to 7 membered ring containing 1 or 2 heteroatoms, optionally substituted by 1 to 2 groups independently selected from C1 to C3 alkyl, OH and C1-C3 alkoxy; each R12 is independently-H, or C1 to C3 alkyl; each R14, and R15 is, independently, C1 to C7 alkyl, C3 to C8 cycloalkyl, C2 to C7 alkenyl, C2 to C7 alkynyl, -OH, -F, C7 to C14 arylalkyl, where said arylalkyl is optionally substituted with 1 to 3 groups independently selected from NO2, C1 to C6 alkyl, C1 to C3 perhaloalkyl, halogen and C1 to C3 alkoxy, or R14 and R15 together with the atom to which they are attached can form a 3 to 7 membered saturated ring; each R16 and R17 is, independently, hydrogen, C1 to C3 alkyl, C1 to C3 alkenyl, C1 to C3 alkynyl, or C3 to C8 cycloalkyl, wherein said C1 to C3 alkyl is optionally substituted with one OH group; or R16 and R17, together with the atom to which they are attached, can form a 3 to 8 membered heterocycle which is optionally substituted with one or two substituents independently selected from the group consisting of C1 to C3 alkyl, -OH, CH2OH, -CH2OCH3, -CO2CH3, and -CONH2; each R18 and R19 is, independently C1 to C3 alkyl; or a pharmaceutically acceptable salt thereof. 5. A compound according to Claim 4, wherein X1 is a bond, -C(O) -, or -CR8R9-; R2 is C1 to C6 alkyl, CF3, CN, phenyl, or phenyl substituted by one to four groups independently selected from C1 to C2 perfluoroalkyl, halogen, and C1 to C2 alkyl substituted with 1 to 3 fluorines, or R2 is a heterocycle selected from thiophene, and furan, which may be optionally substituted with one to three groups independently selected from C1 to C2 perfluoroalkyl, halogen, and C1 to C2 alkyl substituted with 1 to 3 fluorines; X2 is a bond; R3 is phenyl substituted by -W(CH2)jA(CH2)KD(CH2)pZ, -W(CR18R19)A(CH2)kD(CH2)pZ, -C5CA(CH2)kD(CH2)pZ, or -(CH2)jWA(CHz)kD(CH2)pZ, and further optionally 323 |
|---|
01443-kolnp-2006 assignment-1.1.pdf
01443-kolnp-2006 correspondence others-1.1.pdf
01443-kolnp-2006 form-3-1.1.pdf
01443-kolnp-2006-assignment.pdf
01443-kolnp-2006-correspondence others.pdf
01443-kolnp-2006-description complete.pdf
01443-kolnp-2006-international publication.pdf
01443-kolnp-2006-international search authority report.pdf
01443-kolnp-2006-priority document.pdf
1443-KOLNP-2006-AMANDED CLAIMS.pdf
1443-KOLNP-2006-ASSIGNMENT.pdf
1443-KOLNP-2006-CORRESPONDENCE.pdf
1443-KOLNP-2006-DESCRIPTION (COMPLETE).pdf
1443-KOLNP-2006-EXAMINATION REPORT REPLY RECIEVED.pdf
1443-KOLNP-2006-EXAMINATION REPORT.pdf
1443-KOLNP-2006-FORM 13 1.1.pdf
1443-KOLNP-2006-FORM 3 1.1.pdf
1443-KOLNP-2006-GRANTED-ABSTRACT.pdf
1443-KOLNP-2006-GRANTED-CLAIMS.pdf
1443-KOLNP-2006-GRANTED-DESCRIPTION (COMPLETE).pdf
1443-KOLNP-2006-GRANTED-FORM 1.pdf
1443-KOLNP-2006-GRANTED-FORM 2.pdf
1443-KOLNP-2006-GRANTED-SPECIFICATION.pdf
1443-KOLNP-2006-OTHERS 1.1.pdf
1443-KOLNP-2006-PETITION UNDER RULE 137-1.1.pdf
1443-KOLNP-2006-PETITION UNDER RULE 137.pdf
1443-KOLNP-2006-REPLY TO EXAMINATION REPORT.pdf
| Patent Number | 253756 | |||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Indian Patent Application Number | 1443/KOLNP/2006 | |||||||||||||||||||||||||||||||||||||||||||||
| PG Journal Number | 34/2012 | |||||||||||||||||||||||||||||||||||||||||||||
| Publication Date | 24-Aug-2012 | |||||||||||||||||||||||||||||||||||||||||||||
| Grant Date | 22-Aug-2012 | |||||||||||||||||||||||||||||||||||||||||||||
| Date of Filing | 29-May-2006 | |||||||||||||||||||||||||||||||||||||||||||||
| Name of Patentee | WYETH | |||||||||||||||||||||||||||||||||||||||||||||
| Applicant Address | FIVE GIRALDA FARMS, MADISON, NJ 07940-0874 | |||||||||||||||||||||||||||||||||||||||||||||
Inventors:
|
||||||||||||||||||||||||||||||||||||||||||||||
| PCT International Classification Number | C07D 215/14 | |||||||||||||||||||||||||||||||||||||||||||||
| PCT International Application Number | PCT/US2004/041399 | |||||||||||||||||||||||||||||||||||||||||||||
| PCT International Filing date | 2004-12-10 | |||||||||||||||||||||||||||||||||||||||||||||
PCT Conventions:
|
||||||||||||||||||||||||||||||||||||||||||||||