Title of Invention

"ANGIOGENIC AGENT COMPRISING AT LEAST ONE OF A THYROID HORMONE AND ANALOG THEREOF"

Abstract ABSTRACT "ANGIOGENIC AGENT COMPRISING AT LEAST ONE OF A THYROID HORMONE AND ANALOG THEREOF" An angiogenic agent comprising at least one of a thyroid hormone and analog thereof conjugated to a poljmer forming a conjugated thyroid compound wherein the conjugated thyroid compound binds to the cell surface at the cell membrane level and does not activate signal transduction.
Full Text THYROID HORMONE ANALOGS AND METHODS OF USE
FIELD OF THE INVENTION
This invention relates to thyroid hormone, thyroid hormone analogs and derivatives,
and polymeric forms thereof. Methods of using such compounds, and pharmaceutical
compositions containing same are also disclosed. The invention also relates to methods of
preparing such compounds.
BACKGROUND OF THE INVENTION
Thyroid hormones, L-thyroxine (T4) and L-triiodothyronine (T3), regulate many
different physiological processes in different tissues in vertebrates. Most of the actions of
thyroid hormones are mediated by the thyroid hormone receptor ("TR"), which is a member
of the nuclear receptor superfamily of ligand-activated transcription regulators. This
superfamily also includes receptors for steroid hormones, retinoids, and 1,25-
dihydroxyvitamin D3. These receptors are transcription factors that can regulate expression
of specific genes in various tissues and are targets for widely used drugs, such as tamoxifen,
an estrogen receptor partial antagonist. There are two different genes that encode two
different TRs, TRa and TRfl These two TRs are often co-expressed at different levels in
different tissues. Most thyroid hormones do not discriminate between the two TRs and bind
both with similar affinities.
Gene knockout studies in mice indicate that TRp plays a role in the development of
the auditory system and in the negative feedback of thyroid stimulating hormone by T3 in
the pituitary, whereas TRa modulates the effect of thyroid hormone on calorigenesis and on
the cardiovascular system. The identification of TR antagonists could play an important
role in the future treatment of hypothyroidism. Such molecules would act rapidly by
directly antagonizing the effect of thyroid hormone at the receptor level, a significant
improvement for individuals with hypothyroidism who require surgery, have cardiac
disease, or are at risk for life-threatening thyrotoxic storm.
Thus, there remains a need for the development of compounds that selectively
modulate thyroid hormone action by functioning as isoform-selective agonists or
antagonists of the thyroid hormone receptors (TRs) would prove useful for medical therapy.
Recent efforts have focused on the design and synthesis of thyroid hormone (T3/T4)
antagonists as potential therapeutic agents and chemical probes. There is also a need for the
development oi thyromimetic compounds that are more accessible than the natural hormone
and have potentially useful receptor binding and activation properties.
Thyroid hormone receptor preferentially binds 3,5,3'-triiodo-L-thyronine (T3), a
hormone analogue derived by tissue deiodination of circulating L-thyroxine (T4). However,
the ability of T4 and T3 to activate intracellular signal transduction cascades, independently
of TR, has recently been described by several laboratories. Acting independently of TR,
thyroid hormone also modulates activity of the plasma membrane Na+/H+ exchanger,
stimulable ATPase, several other ion pumps or channels, and GTPase activity of
synaptosomes. Studies from several laboratories have demonstrated the ability of thyroid
hormone to activate the MAPK signal transduction cascade. These pathways typically are
activated by physical and chemical signals at the cell surface. Although the kinetics and
analog specificity for binding of thyroid hormone to the plasma membrane have been
repeatedly reported, a cell surface receptor that accounts for these TR-dependent actions for
thyroid hormone has not been previously identified.
Our laboratory has shown in the CV-1 monkey fibroblast cell line, which lacks
functional TR, and in other cells that T4 activates the mitogen-activated protein kinase
(MAPK; ERK112) signaling cascade and promotes the phosphorylation and nuclear
translocation of MAPK as early as lOmin following application of a physiological
concentration of T4. In nuclear fractions of thyroid hormone-treated cells, we have
described complexes of activated MAPK and transactivator nucleoproteins that are
substrates for the serine kinase activity of MAPK. These proteins include signal transducer
and activator of transcription (STAT)-la, STAT3, p53, estrogen receptor (ER)-a and, in
cells containing TR, the nuclear thyroid hormone receptor for T3 (TRpl). Thyroid
hormone-directed MAPK-dependent phosphorylation of these proteins enhances their
transcriptional capabilities. The effects of T4- induced MAPK activation are blocked by
inhibitors of the MAPK signal transduction pathway and by tetraiodothyroacetic acid
(tetrac), a thyroid hormone analog which inhibits Tq binding to the cell surface. Thyroid
hormone-activated MAPK may also act locally at the plasma membrane, e.g., on the
N"VH+antiporter, rather than when translocated to the cell nucleus. A cell surface receptor
for T4, that is linked to activation of the MAPK cascade has not previously been identified.
Integrins are a family of transmembrane glycoproteins that form noncovalent
heterodimers. Extracellular domains of the integrals interact with a variety of ligands,
including extracellular matrix glycoproteins, and the intracellular domain is linked to the
cytoskeleton. Thyroid hormone was shown a decade ago to influence the interaction of
integrin with the extracellular matrix protein, laminin, but the mechanism was not known.
Integrin aV(33 has a large number of extracellular protein ligands, including growth factors,
and upon ligand-binding can activate the MAPK cascade. Several of the integrins contain
an Arg-Gly-Asp ("RGD") recognition site that is important to the liganding of matrix and
other extracellular proteins that contain an Arg-Gly-Asp sequence.
Thus, it would be desirable to identify and provide an initiation site for the induction
of MAPK signaling cascades in cells treated with thyroid hormones, or analogs and
polymers thereof, thereby providing for methods of modulating growth factors and other
polypeptides whose cell surface receptors clustered around this initiation site.
It is estimated that five million people are afflicted with chronic stable angina in the
United States. Each year 200,000 people under the age of 65 die with what is termed
"premature ischemic heart disease." Despite medical therapy, many go on to suffer
myocardial infarction and debilitating symptoms prompting the need for revascularization
with either percutaneous transluminal coronary angioplasty or coronary artery bypass
surgery. It has been postulated that one way of relieving myocardial ischemia would be to
enhance coronary collateral circulation.
Correlations have now been made between the anatomic appearance of coronary
collateral vessels ("collaterals") visualized at the time of intracoronary thrombolitic therapy
during the acute phase of myocardial infarction and the creatine kinase time-activity curve,
infarct size, and aneurysm formation. These studies demonstrate a protective role of
collaterals in hearts with coronary obstructive disease, showing smaller infarcts, less
aneurysm formation, and improved ventricular function compared with patients in whom
collaterals were not visualized. When the cardiac myocyte is rendered ischemic, collaterals
develop actively by growth with DNA replication and mitosis of endothelial and smooth
muscle cells. Once ischemia develops, these factors are activated and become available for
receptor occupation, which may initiate angiogenesis after exposure to exogenous heparin.
Unfortunately, the "natural" process by which angiogenesis occurs is inadequate to reverse
the ischemia in almost all patients with coronary artery disease.
During ischemia, adenosine is released through the breakdown of ATP. Adenosine
participates in many cardio-protective biological events. Adenosine has a role in
hemodynamic changes such as bradycardia and vasodilation, and adenosine has been
suggested to have a role in such unrelated phenomena as preconditioning and possibly the
reduction in reperfusion injury (Ely and Berne, Circulation, 85: 893 (1992).
Angiogenesis is the development of new blood vessels from preexisting blood
vessels (Mousa, S. A., In Angiogenesis Inhibitors and Stimulators: Potential Thierapeutic
Implications,, Landes Bioscience, Georgetown, Texas; Chapter 1, (2000)). Physiologically,
angiogenesis ensures proper development of mature organisms, prepares the womb for egg
implantation, and plays a key role in wound healing. The development of vascular
networks during embryogenesis or normal and pathological angiogenesis depends on
growth factors and cellular interactions with the extracellular matrix (Breier et al., Trends in
Cell Biology 6:454-456 (1996); Folkman, Nature Medicine 1:27-31 (1995); Risau, Nature
386:671-674 (1997). Blood vessels arise during embryogenesis by two processes:
vasculogenesis and angiogenesis (Blood etal., Bioch. Biophys. Acta 1032:89-118 (1990).
Angiogenesis is a multi-step process controlled by the balance of pro- and anti-angiogenic
factors. The latter stages of this process involve proliferation and the organization of
endothelial cells (EC) into tube-like structures. Growth factors such as FGF2 and VEGF are
thought to be key players in promoting endothelial cell growth and differentiation.
Control of angiogenesis is a complex process involving local release of vascular
growth factors (P Carmeliet, Ann NY Acad Sci 902:249-260, 2000), extracellular matrix,
adhesion molecules and metabolic factors (RJ Tomanek, GC Schatteman, Anat Rec
261:126-135, 2000). Mechanical forces within blood vessels may also play a role (O
Hudlicka, Molec Cell Biochem 147:57-68,1995). The principal classes of endogenous
growth factors implicated in new blood vessel growth are the fibroblast growth factor (FGF)
family and vascular endothelial growth factor (VEGF)(G Pages, Ann NY Acad Sci
902:187-200, 2000). The mitogen-activated protein kinase (MAPK; ERK1/2) signal
transduction cascade is involved both in VEGF gene expression and in control of
proliferation of vascular endothelial cells.
Intrinsic adenosine may facilitate the coronary flow response to increased
myocardial oxygen demands and so modulate the coronary flow reserve (Ethier et al., Am.
J. Physiol., HI 31 (1993) demonstrated that the addition of physiological concentrations of
adenosine to human umbilical vein endothelial cell cultures stimulates proliferation,
possibly via a surface receptor. Adenosine may be a factor for human endothelial cell
growth and possibly angiogenesis. Angiogenesis appears to be protective for patients with
obstructive blood flow such as coronary artery disease ("CAD"), but the rate at which blood
vessels grow naturally is inadequate to reverse the disease. Thus, strategies to enhance and
accelerate the body's natural angiogenesis potential should be beneficial in patients with
CAD.
Similarly, wound healing is a major problem in many developing countries and
diabetics have impaired wound healing and chronic inflammatory disorders, with increased
use of various cyclooxygenase-2 (CoX2) inhibitors. Angiogenesis is necessary for wound
repair since the new vessels provide nutrients to support the active cells, promote
granulation tissue formation and facilitate the clearance of debris. Approximately 60% of
the granulation tissue mass is composed of blood vessels which also supply the necessary
oxygen to stimulate repair and vessel growth. It is well documented that angiogenic factors
are present in wound fluid and promote repair while antiangiogenic factors inhibit repair.
Wound angiogenesis is a complex multi-step process. Despite a detailed knowledge about
many angiogenic factors, little progress has been made in defining the source of these
factors, the regulatory events involved in wound angiogenesis and in the clinical use of
angiogenic stimulants to promote repair. Further complicating the understanding of wound
angiogenesis and repair is the fact that the mechanisms and mediators involved in repair
likely vary depending on the depth of the wound, type of wound (burn, trauma, etc.), and
the location (muscle, skin, bone, etc.). The condition and age of the patient (diabetic,
paraplegic, on steroid therapy, elderly vs infant, etc) can also determine the rate of repair
and response to angiogenic factors. The sex of the patient and hormonal status
(premenopausal, post menopausal, etc.) may also influence the repair mechanisms and
responses. Impaired wound healing particularly affects the elderly and many of the 14
million diabetics in the United States. Because reduced angiogenesis is often a causative
agent for wound healing problems in these patient populations, it is important to define the
angiogenic factors important in wound repair and to develop clinical uses to prevent and/or
correct impaired wound healing.
Thus, there remains a need for an effective therapy in the way of angiogenic agents
as either primary or adjunctive therapy for promotion of wound healing, coronary
angiogenesis, or other angiogenic-related disorders, with minimum side effects. Such a
therapy would be particularly useful for patients who have vascular disorders such as
myocardial infarctions, stroke or peripheral artery diseases and could be used
prophylactically in patients who have poor coronary circulation, which places them at high
risk of ischemia and myocardial infarctions.
Thyroid hormones, analogs, and polymeric conjugations play important roles in the
development of the brain. Increasing evidence suggests that the deprivation of polymeric
thyroid hormones in the early developmental stage causes structural and functional deficits
in the CNS, but the precise mechanism underlying this remains elusive.
The mammalian nervous system comprises a peripheral nervous system (PNS) and a
central nervous system (CNS, comprising the brain and spinal cord), and is composed of
two principal classes of cells: neurons and glial cells. The glial cells fill the spaces between
neurons, nourishing them and modulating their function. Certain glial cells, such as
Schwann cells in the PNS and oligodendrocytes in the CNS, also provide a myelin sheath
that surrounds neural processes. The myelin sheath enables rapid conduction along the
neuron. In the peripheral nervous system, axons of multiple neurons may bundle together in
order to form a nerve fiber. These, in turn, may be combined into fascicles or bundles.
During development, differentiating neurons from the central and peripheral nervous
systems send out axons mat grow and make contact with specific target cells. In some cases,
axons must cover enormous distances; some grow into the periphery, whereas others are
confined within the central nervous system. In mammals, this stage of neurogenesis is
complete during the embryonic phase of life and neuronal cells do not multiply once they
have fully differentiated.
A host of neuropathies have been identified that affect the nervous system. The
neuropathies, which may affect neurons themselves or associated glial cells, may result
from cellular metabolic dysfunction, infection, exposure to toxic agents, autoimmunity,
malnutrition, or ischemia. In some cases, the cellular neuropathy is thought to induce cell
death directly. In other cases, the neuropathy may induce sufficient tissue necrosis to
stimulate the body's immune/inflammatory system and the immune response to the initial
injury then destroys neural pathways.
Where the damaged neural pathway results from CNS axonal damage, autologous
peripheral nerve grafts have been used to bridge lesions in the central nervous system and to
allow axons to make it back to their normal target area. In contrast to CNS neurons, neurons
of the peripheral nervous system can extend new peripheral processes in response to axonal
damage. This regenerative property of peripheral nervous system axons is thought to be
sufficient to allow grafting of these segments to CNS axons. Successful grafting appears to
be limited, however, by a number of factors, including the length of the CNS axonal lesion
to be bypassed, and the distance of the graft sites from the CNS neuronal cell bodies, with
successful grafts occurring near the cell body.
Within the peripheral nervous system, this cellular regenerative property of neurons
has limited ability to repair function to a damaged neural pathway. Specifically, the new
axons extend randomly, and are often misdirected, making contact with inappropriate
targets that can cause abnormal function. For example, if a motor nerve is damaged,
regrowing axons may contact the wrong muscles, resulting in paralysis. In addition, where
severed nerve processes result in a gap of longer than a few millimeters, e.g., greater than
10 millimeters (mm), appropriate nerve regeneration does not occur, either because the
processes fail to grow the necessary distance, or because of misdirected axonal growth.
Efforts to repair peripheral nerve damage by surgical means has met with mixed results,
particularly where damage extends over a significant distance. In some cases, the suturing
steps used to obtain proper alignment of severed nerve ends stimulates the formulation of
scar tissue which is thought to inhibit axon regeneration. Even where scar tissue formation
has been reduced, as with the use of nerve guidance channels or other tubular prostheses,
successful regeneration generally still is limited to nerve damage of less than 10 millimeters
in distance. In addition, the reparative ability of peripheral neurons is significantly inhibited
where an injury or neuropathy affects the cell body itself or results in extensive
degeneration of a distal axon.
Mammalian neural pathways also are at risk due to damage caused by neoplastic
lesions. Neoplasias of both the neurons and glial cells have been identified. Transformed
cells of neural origin generally lose their ability to behave as normal differentiated cells and
can destroy neural pathways by loss of function. In addition, the proliferating tumors may
induce lesions by distorting normal nerve tissue structure, inhibiting pathways by
compressing nerves, inhibiting cerbrospinal fluid or blood supply flow, and/or by
stimulating the body's immune response. Metastatic tumors, which are a significant cause of
neoplastic lesions in the brain and spinal cord, also similarly may damage neural pathways
and induce neuronal cell death.
One type of morphoregulatory molecule associated with neuronal cell growth,
differentiation and development is the cell adhesion molecule ("CAM"), most notably the
nerve cell adhesion molecule (N-CAM). The CAMs are members the immunoglobulin
super-family. They mediate cell—cell interactions in developing and adult tissues through
homophilic binding, i.e., CAM-CAM binding on apposing cells. A number of different
CAMs have been identified. Of these, the most thoroughly studied are N-CAM and L-CAM
(liver cell adhesion molecules), both of which have been identified on all cells at early
stages of development, as well as in different adult tissues. In neural tissue development, NCAM
expression is believed to be important in tissue organization, neuronal migration,
nerve-muscle tissue adhesion, retinal formation, synaptogenesis, and neural degeneration.
Reduced N-CAM expression also is thought to be associated with nerve dysfunction. For
example, expression of at least one form of N-CAM, N-CAM-180, is reduced in a mouse
demyelinating mutant. Bhat, Brain Res. 452: 373-377 (1988). Reduced levels of N-CAM
also have been associated with normal pressure hydrocephalus, Werdelin, Acta Neurol.
Scand. 79: 177-181 (1989), and with type II schizophrenia. Lyons, et al., Biol. Psychiatry
23: 769-775 (1988). In addition, antibodies against N-CAM have been shown to disrupt
functional recovery in injured nerves. Remsen, Exp. Neurobiol. 110: 268-273 (1990).
Currently no satisfactory method exists to repair the damage caused by traumatic
injuries of motor neurons and diseases of motor neurons. There are 15,000 to 18,000 new
cases of spinal cord injury each year in the United States. In addition, there are
approximately 200,000 survivors of spinal cord injury. The annual cost of care for these
patients exceeds $7 billion. The pathophysiology following acute spinal cord trauma is a
complex and not fully understood mechanism. The primary tissue damage caused by
mechanical trauma occurs immediately and is irreversible. Allen, J. Am. Med. Assoc. 57:
878-880 (1911). Experimental evidence indicates that much of the post-traumatic tissue
damage is the result of a reactive process that begins within minutes after the injury and
continues for days or weeks. Janssen, et al., Spine 14: 23-32 (1989) and Panter, et al.,
(1992). This progressive, self-destructive process includes pathophysiological mechanisms
such as hemorrhage, post-traumatic ischemia, edema, axonal and neuronal necrosis, and
demyelinization followed by cyst formation and infarction. For review, see Tator, et al., J.
Neurosurg, 75: 15-26 (1991) and Faden, Crit. Rev. Neurobiol. 7: 175-186 (1993). Proposed
injurious factors include electrolyte changes whereby increased intracellular calcium
initiates a cascade of events (Young, J. Neurotrauma 9, Suppl. 1: S9-S25 (1992) and Young,
J. Emerg. Med 11: 13-22 (1993)), biochemical changes with uncontrolled transmitter
release (Liu, et al., Cell 66: 807-815 (1991) and Yanase, et al., J. Neurosurg 83: 884-888
(1995), arachidonic acid release, free-radical production, lipid peroxidation (Braughler, et
al., J. Neurotrauma 9, Suppl. 1: S1-S7 (1992), eicosanoid production (Demediuk, et al., J.
Neurosci. Res. 20: 115-121 (1988), endogenous opioids (Faden, et al., Ann Neurol. 17: 386-
390 (1985), metabolic changes including alterations in oxygen and glucose (Faden, Crit.
Rev. Neurobiol. 7: 175-186 (1993)), inflammatory changes (Blight, J. Neurotrauma 9,
Suppl. 1: S83-S91 (1992), and astrocytic edema (Kimelberg, J. Neurorrauma 9, Suppl. 1:
S71-S81 (1992). For the past 400 years surgical approaches including laminectomy and
decompression, accompanied by fusion, have been the most commonly practiced treatment
strategies. Hansebout, "Early Management of Acute Spinal Cord Injury", pp. 181-196
(1982) and Janssen, et al., Spine 14: 23-32 (1989). However, these procedures have not
involved the application of techniques to augment the regenerative properties of spinal cord
tissue.
A host of diseases of motor neurons have been identified, including demyelinating
diseases, myelopathies, and diseases of motor neurons such as amyotrophic lateral sclerosis
("ALS"). INTERNAL MEDICINE, ch. 121-123 (4th ed., J. H. Stein, ed., Mosby, 1994).
Multiple sclerosis ("MS") is the most common demyelinating disorder of the central
nervous system, causing patches of sclerosis (i.e., plaques) in the brain and spinal cord. MS
has protean clinical manifestations, depending upon the location and size of the plaque.
Typical symptoms include visual loss, diplopia, nystagmus, dysarthria, weakness,
paresthesias, bladder abnormalities, and mood alterations. Myriad treatments have been
proposed for this long-term variable illness. The list of proposed treatments encompasses
everything from diet to electrical stimulation to acupuncture, emotional support, and various
forms of immunosupressive therapy. None have proved to be satisfactory.
Progressive loss of lower and upper motor neurons occurs in several diseases (e.g.,
primary lateral sclerosis, spinal muscular atrophy, benign focal amyotrophy). However,
ALS is the most common form of motor neuron disease. Loss of both lower and upper
motor neurons occur in ALS. Symptoms include progressive skeletal muscle wasting,
weakness, gasciculations, and cramping. Some cases have predominant involvement of
brainstem motoneurons (progressive bulbar palsy). Unfortunately, treatment of motor
neuron and related diseas is largely supportive at this time. INTERNAL MEDICINE, ch.
123 (4th ed., J. H. Stein, ed., Mosby, 1994).
Accordingly, there is a need in the art for treatments of motor neurons disorders and
injuries, and related deficits in neural functions. It is, therefore, an object of the present
invention to provide compositions and methods for stimulating angiogenesis, for inducing
neuronal differentiation, and for preventing the death or degeneration of neuronal cells.
The tyrosines are iodinated at one (monoiodotyrosine) or two (diiodotyrosine) sites
and then coupled to form the active hormones (diiodotyrosine + diiodotyrosine -»
tetraiodothyronine [thyroxine, T4]; diiodotyrosine + monoiodotyrosine ->triiodothyronine
[Ta]. Another source of Ta within the thyroid gland is the result of the outer ring
deiodination of T4 by a selenoenzyme: type I 5r-deiodinase (5'D-I). Thyroglobulin, a
glycoprotein containing Ta and T4 within its matrix, is taken up from the follicle as colloid
droplets by the thyroid cells.
Lysosoraes containing proteases cleave T3 and T4 from thyroglobulin, resulting in
release of free T3 and T4. The iodotyrosines (monoiodotyrosine and diiodotyrosine) are also
released from thyroglobulin, but only very small amounts reach the bloodstream. Iodine is
removed from them by intracellular deiodinases, and this iodine is used by the thyroid
gland.
The T4 and Ta released from the thyroid by proteolysis reach the bloodstream, where
they are bound to thyroid hormone-binding serum proteins for transport. The major thyroid
hormone-binding protein is thyroxine-binding globulin ("TBG"), which has high affinity
but low capacity for T4 and T3. TBG normally accounts for about 75% of the bound
hormones. Other thyroid hormone-binding proteins—primarily thyroxine-binding
prealbumin, also called transthyretin ("TTR"), which has high affinity but low capacity for
T4, and albumin, which has low affinity but high capacity for T4 and T3—account for the
remainder of the bound serum thyroid hormones. About 0.03% of the total serum T4 and
0.3% of the total serum Ta are free and in equilibrium with the bound hormones. Only free
T4 and T3 are available to the peripheral tissues for thyroid hormone action.
Thyroid hormones have two major physiologic effects: (1) They increase protein
synthesis in virtually every body tissue. (T3 and T4 enter cells, where Ta, which is derived
from the circulation and from conversion of T4 to Ta within the cell, binds to discrete
nuclear receptors and influences the formation of mRNA.) (2) Ta increases QI consumption
by increasing the activity of the Na+, K+-ATPase (Na pump), primarily in tissues
responsible for basal O2 consumption (ie, liver, kidney, heart, and skeletal muscle). The
increased activity of Na+, K+-ATPase is secondary to increased synthesis of this enzyme;
therefore, the increased O2 consumption is also probably related to the nuclear binding of
thyroid hormones. However, a direct effect of Ta on the mitochondrion has not been ruled
out. T3 is believed to be the active thyroid hormone, although T4 itself may be biologically
active.
The pool of thyroid hormones critical for the biological actions of the hormones is
the pool of free thyroid hormone. The size of this pool is determined for short time periods
by uptake/release of thyroid hormones into/from cell and binding/release of thyroid
hormones by thyroid hormone-binding proteins. Both proportions and absolute
concentrations of these proteins differ in blood plasma and cerebrospinal fluid ("CSF"). The
most pronounced difference is found for transthyretin ("TTR"), which is the only thyroid
hormone-binding plasma protein synthesized in the brain (Schreiber G, Southwell BR,
Richardson SJ. Hormone delivery systems to the brain-transthyretin. Exp Clin Endocrinol
Diabetes. 1995;103(2):75-80). TTR is also distinct from the other two thyroid hormonebinding
plasma proteins in humans by the absence of generic deficiencies. TTR gene
expression was initiated during evolution much earlier in the brain than in the liver. The
structure of the domains of TTR involved in thyroxine (TR) T4 binding has been
completely conserved for 350 million years. These observations point to a special functional
significance of TTR in the brain. It is proposed that this is the determination of the level of
free T4 in the extracellular compartment of the brain. T4 can then be converted in the brain
to triiodothyronine T3 by specific deiodinases. This T3 can interact with receptors in the
cell nuclei, regulating gene transcription.
Alzheimer's disease is a severe neurodegenerative disorder, and currently about 4
million Americans suffer from this disease. As the aging population continues to grow, this
number could reach 14 million by the middle of next century unless a cure or prevention is
found. At present, there is no sensitive and specific premortem test for early diagnosis of
this disease. Alzheimer's disease is currently diagnosed based on the clinical observation of
cognitive decline, coupled with the systematic elimination of other possible causes of those
symptoms. The confirmation of the clinical diagnosis of "probable Alzheimer's disease" can
only be made by examination of the postmortem brain. The Alzheimer's disease brain is
characterized by the appearance of two distinct abnormal proteinaceous deposits in regions
of the brain responsible for learning and memory (e.g., cerebral cortex and hippocampus).
These deposits are extracellular amyloid plaques, which are characteristic of Alzheimer's
disease, and intracellular neurofibillary tangles ("NFTs"), which can be found in other
neurodegenerative disorders as well. Amyloid peptides are typically either 40 or 42 ammo
acids in length ("AMO" or "A1"42", respectively) and are formed from abnormal processing
of a larger membrane-associated protein of unknown function, the amyloid precurser
protein ("APP"). Oligomeric aggregates of these peptides are thought to be neurotoxic,
eventually resulting in synaptic degeneration and neuronal loss. The amount of amyloid
deposition roughly correlates with the severity of symptoms at the time of death.
In the past, there have been several attempts for the design of radiopharmaceuticals
that could be used as diagnostic agents for a premortem diagnosis of Alzheimer's disease.
Bornebroek et al. showed that the amyloid-associated protein serum amyloid P component
(SAP), labeled with 123I, accumulates at low levels in the cerebral cortex, possibly in vessel
walls, of patients with cerebral amyloidosis (Bomebroek, M., et al., Nucl. Med. Comnum.
(1996), Vol. 17, pp. 929-933).
Saito et al. proposed a vector-mediated delivery of 123I -labeled A1"40 through the
blood-brain barrier. It is reported that the iodinated A1"40 binds A amyloid plaque in tissue
sections (Saito, Y., et al., Proc. Natl. Acad. Sci. USA 1995, Vol. 92, pp. 10227-10231). U.S.
Pat. No. 5,231,000 discloses antibodies with specificity to A4 amyloid polypeptide found in
the brain of Alzheimer's disease patients. However, a method to deliver these antibodies
across the blood-brain barrier has not been described. Zhen et al. described modifications
of the amyloid-binding dye known as "Congo Red.TM.", and complexes of these modified
molecules with technetium and rhenium. The complexes with radioactive ions are purported
to be potential imaging agents for Alzheimer's disease (Zhen et al., J. Med. Chem. (1999),
Vol. 42, pp. 2805-2815). However, the potential of the complexes to cross the blood-brain
barrier is limited.
A group at the University of Pennsylvania in the U.S.A. (Skovronsky, M., et al.,
Proc. Natl. Acad. Sci. 2000, Vol. 97, pp. 7609-7614) has developed a fluorescently^abeled
derivative of Congo Red that is brain permeable and that non-specifically binds to amyloid
materials (that is, peptides in-pleated sheet conformation). This compound would need to be
radiolabeled and then run through pre-clinical screens for pharmacokinetics and toxicity
before clinical testing. In contrast, our invention utilizes derivatives of naturally occurring
substances alone or in combinations for the diagnosis, prevention, and treatment of
Alzheimer's disease. Klunk et al. reported experiments with a derivative of Congo
Red.TM., Chrysamine G ("CG"). It is reported that CG binds synthetic-amyloid well in
vitro, and crosses the blood-brain barrier in normal mice (Klunk et al., Neurobiol. Aging
(1994), Vol. 15, No. 6, pp. 691-698). Bergstrom et al. presented a compound labeled with
!23I as a potential radioligand for visualization of Ml and M2 muscarinic acetylcholine
receptors in Alzheimer's disease (Bergstrom et al., Eur. J. Nucl. Med. (1999), Vol. 26, pp.
1482-1485).
Recently, it has been discovered that certain specific chemokine receptors are
upregulated in the brains of patients with Alzheimer's disease (Horuk, R. et al., J. Immunol.
(1997), Vol. 158, pp. 2882-2890); Xia et al., J. NeuroVirol (1999), Vol. 5, pp. 32-41). In
addition, it has been recently shown that the chemokine receptor CCR1 is upregulated in the
brains of patients with advanced Alzheimer's disease and absent in normal-aged brains
(Halks-Miller et al, CCR1 Immunoreactiviry in Alzheimer's Disease Brains, Society for
Neuroscience Meeting Abstract, #787.6, Volume 24, 1998). Antagonists to the CCR1
receptor and their use as anti-inflammatory agents are described in the PCT Published
Patent Application, WO 98/56771.
None of the above described proposals have resulted in a clinical development of an
imaging agent for the early diagnosis of Alzheimer's disease. Accordingly, there is still a
clinical need for a diagnostic agent that could be used for a reliable and early diagnosis of
Alzheimer's disease. Additionally, the proposed strategies would also be useful for the
inhibition of amyloid plaque formation or buildup in Alzheimer patients. Accordingly, it is
an object of the present invention to provide compositions and methods for the early
diagnosis, prevention, and treatment of neurodegenerative diseases, sucli as, for example
Alzheimer's disease.
It is interesting to note that angiogenesis also occurs in other situations, but which
are undesirable, including solid tumour growth and metastasis; rheumatoid arthritis;
psoriasis; scleroderma; and three common causes of blindness - diabetic retinopathy,
retrolental fibroplasia and neovascular glaucoma (in fact, diseases of the eye are almost
always accompanied by vascularization. The process of wound angiogenesis actually has
many features in common with rumour angiogenesis. Thus, there are some conditions, such
as diabetic retinopathy or the occurrence of primary or metastatic tumors, where
angiogenesis is undesirable. Thus, there remains a need for methods by which to inhibit the
effect of angiogenic agents for the treatment of cancers.
SUMMARY OF THE INVENTION
The invention is based, in part, on the discovery that thyroid hormone, thyroid
hormone analogs, and their polymeric forms, act at the cell membrane level and have proangiogenic
properties that are independent of the nuclear thyroid hormone effects.
Accordingly, these thyroid hormone analogs and polymeric forms (i.e., angiogenic agents)
can be used to treat a variety of disorders. Similarly, the invention is also based on the
discovery that thyroid hormone analog antagonists inhibit the pro-angiogenic effect of such
analogs, and can also be used to treat a variety of disorders.
Accordingly, in one aspect the invention features methods for treating a condition
amenable to treatment by promoting angiogenesis by administering to a subject in need
thereof an amount of a polymeric form of thyroid hormone, or an analog thereof, effective
for promoting angiogenesis. Examples of such conditions amenable to treatment by
promoting angiogenesis are provided herein and can include occlusive vascular disease,
coronary disease, erectile dysfunction, myocardial infarction, ischemia, stroke, peripheral
artery vascular disorders, and wounds.
Examples of thyroid hormone analogs are also provided herein and can include
triiodothyronine (T3), levothyroxine (T4), 3,5-dimethyl-4-(4'-hydroy-3'-isopropylbenzyl)-
phenoxy acetic acid (GC-1), or 3,5-diiodothyropropionic acid (DITPA), tetraiodothyroacetic
acid (TETRAC), and triiodothyroacetic acid (TRIAC). Additional analogs are in Figure 20
Tables A-D. Thes analogs can be conjugated to polyvinyl alcohol, acrylic acid ethylene copolymer,
polylactic acid, or agarose. The conjugation is via covalent or non-covalent bonds
depending on the polymer used.
In one embodiment the thyroid hormone, thyroid hormone analogs, or polymeric
forms thereof are administered by parenteral, oral, rectal, or topical means, or combinations
thereof. Parenteral modes of administration include, for example, subcutaneous,
intraperitoneal, intramuscular, or intravenous modes, such as by catheter. Topical modes of
administration can include, for example, a band-aid.
In another embodiment, the thyroid hormone, thyroid hormone analogs, or
polymeric forms thereof can be encapsulated or incorporated in a microparticle, liposome,
or polymer. The polymer can include, for example, polyglycolide, polylactide, or copolymers
thereof. The liposome or microparticle has a size of about less than 200
nanometers, and can be administered via one or more parenteral routes, or another mode of
administration. In another embodiment the liposome or microparticle can be lodged in
capillary beds surrounding ischemic tissue, or applied to the inside of a blood vessel via a
catheter.
Thyroid hormone, thyroid hormone analogs, or polymeric forms thereof according
to the invention can also be co-administered with one or more biologically active substances
that can include, for example, growth factors, vasodilators, anti-coagulants, anti-virals, antibacterials,
anti-inflammatories, immuno-suppressants, analgesics, vascularizing agents, or
cell adhesion molecules, or combinations thereof. In one embodiment, the thyroid hormone
analog or polymeric form is administered as a bolus injection prior to or post-administering
one or more biologically active substance.
Growth factors can include, for example, transforming growth factor alpha
("TGFa"), transforming growth factor beta ("TGFp"), basic fibroblast growth factor,
vascular endothelial gro\vth factor, epithelial growth factor, nerve growth factor, plateletderived
growth factor, and vascular permeability factor. Vasodilators can include, for
example, adenosine, adenosine derivatives, or combinations thereof. Anticoagulants
include, but are not limited to, heparin, heparin derivatives, anti-factor Xa, anti-thrombin,
aspirin, clopidgrel, or combinations thereof.
In another aspect of the invention, methods are provided for promoting angiogenesis along
or around a medical device by coating the device with a thyroid hormone, thyroid hormone
analog, or polymeric form thereof according to the invention prior to inserting the device
into a patient. The coating step can further include coating the device with one or more
biologically active substance, such as, but not limited to, a growth factor, a vasodilator, an
anti-coagulant, or combinations thereof. Examples of medical devices that can be coated
with thyroid hormone analogs or polymeric forms according to the invention include stents,
catheters, cannulas or electrodes.
In a further aspect, the invention provides methods for treating a condition amenable
to treatment by inhibiting angiogenesis by administering to a subject in need thereof an
amount of an anti-angiogenesis agent effective for inhibiting angiogenesis. Examples of the
conditions amenable to treatment by inhibiting angiogenesis include, but are not limited to,
primary or metastatic tumors, diabetic retinopathy, and related conditions. Examples of the
anti-angiogenesis agents used for inhibiting angiogenesis are also provided by the invention
and include, but are not limited to, tetraiodothyroacetic acid (TETRAC), triiodothyroacetic
acid (TRIAC), monoclonal antibody LM609, XT 199 or combinations thereof. Such antiangiogenesis
agents can act at the cell surface to inhibit the pro-angiogenesis agents.
In one embodiment, the anti-angiogenesis agent is administered by a parenteral, oral,
rectal, or topical mode, or combination thereof. In another embodiment, the antiangiogenesis
agent can be co-administered with one or more anti-angiogenesis therapies or
chemotherapeutic agents.
In yet a further aspect, the invention provides compositions (i.e., angiogenic agents)
that include thyroid hormone, and analogs conjugated to a polymer. The conjugation can be
through a covalent or non-covalent bond, depending on the polymer. A covalent bond can
occur through an ester or anhydride linkage, for example. Examples of the thyroid hormone
analogs are also provided by the instant invention and include levothyroxine (T4),
triiodothyronine (T3), 3,5-dimethyl-4-(4'-hydroy-3'-isopropylbenzyl)-phenoxy acetic acid
(GC-1), or 3,5-diiodothyropropionic acid (DITPA). In one embodiment, the polymer can
include, but is not limited to, polyvinyl alcohol, acrylic acid ethylene co-polymer, polylactic
acid, or agarose.
In another aspect, the invention provides for pharmaceutical formulations including
the angiogenic agents according to the present invention in a pharmaceutically acceptable
carrier. In one embodiment, the pharmaceutical formulations can also include one or more
pharmaceutically acceptable excipients.
The pharmaceutical formulations according to the present invention can be
encapsulated or incorporated in a liposome, microparticle, or polymer. The liposome or
microparticle has a size of less than about 200 nanometers. Any of the pharmaceutical
formulations according to the present invention can be administered via parenteral, oral,
rectal, or topical means, or combinations thereof. In another embodiment, the
pharmaceutical formulations can be co-administered to a subject in need thereof with one or
more biologically active substances including, but not limited to, growth factors,
vasodilators, anti-coagulants, or combinations thereof.
In other aspects, the present invention concerns the use of the polymeric thyroid
hormone analogs and pharmaceutical formulations containing said hormone, for the
restoration of neuronal functions and enhancing survival of neural cells. For the purpose of
the present invention, neuronal function is taken to mean the collective physiological,
biochemical and anatomic mechanisms that allow development of the nervous system
during the embryonic and postnatal periods and that, in the adult animal, is the basis of
regenerative mechanisms for damaged neurons and of the adaptive capability of the central
nervous system when some parts of it degenerate and can not regenerate.
Therefore, the following processes occur in order to achieve neuronal function:
denervation, reinnervation, synaptogenesis, synaptic repression, synaptic expansion, the
sprouting of axons, neural regeneration, development and organisation of neural paths and
circuits to replace the damaged ones. Therefore, the suitable patients to be treated with the
polymeric thyroid hormone analogs or combinations thereof according to the present
invention are patients afflicted with degenerative pathologies of the central nervous system
(senile dementia like Alzheimer's disease, Parkinsonism, Huntington's chorea, cerebellarspinal
adrenoleucodystrophy), trauma and cerebral ischemia.
In a preferred embodiment, methods of the invention for treating motor neuron
defects, including amyotrophic lateral sclerosis, multiple sclerosis, and spinal cord injury
comprise administering a polymeric thyroid hormone analog , or combinations thereof, and
in combination with growth factors, nerve growth factors, or other pro-angiogenesis or
neurogenesis factors. Spinal cord injuries include injuries resulting from a tumor,
mechanical trauma, and chemical trauma. The same or similar methods are contemplated to
restore motor function in a mammal having amyotrophic lateral sclerosis, multiple sclerosis,
or a spinal cord injury. Administering one of the aforementioned polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors also provides a prophylactic function. Such administration has the effect of
preserving motor function in a mammal having, or at risk of having, amyotrophic lateral
sclerosis, multiple sclerosis, or a spinal cord injury. Also according to the invention,
polymeric thyroid hormone analogs alone or in combination with nerve growth factors or
other neurogenesis factors administration preserves the integrity of the nigrostriatal
pathway.
Specifically, methods of the invention for treating (pre- or post-symptomatically)
amyotrophic lateral sclerosis, multiple sclerosis, or a spinal cord injury comprise
administering a polymeric thyroid hormone analog alone or in combination with nerve
growth factors or other neurogenesis factors. In a particularly-preferred embodiment, the
polymeric thyroid hormone analog alone or in combination with nerve growth factors or
other neurogenesis factors is a soluble complex, comprising at least one polymeric thyroid
hormone analog alone or in combination with nerve growth factors or other neurogenesis
factors.
In one aspect, the invention features compositions and therapeutic treatment
methods comprising administering to a mammal a therapeutically effective amount of a
morphogenic protein ("polymeric thyroid hormone analog alone or in combination with
nerve growth factors or other neurogenesis factors"), as defined herein, upon injury to a
neural pathway, or in anticipation of such injury, for a time and at a concentration sufficient
to maintain the neural pathway, including repairing damaged pathways, or inhibiting
additional damage thereto.
In another aspect, the invention features compositions and therapeutic treatment
methods for maintaining neural pathways. Such treatment methods include administering to
the mammal, upon injury to a neural pathway or in anticipation of such injury, a compound
that stimulates a therapeutically effective concentration of an endogenous polymeric thyroid
hormone analog. These compounds are referred to herein as polymeric thyroid hormone
analogs alone or in combination with nerve growth factors or other neurogenesis factors-
stimulating agents, and are understood to include substances which, when administered to a
mammal, act on tissue(s) or orgari(s) that normally are responsible for, or capable of,
producing a polymeric thyroid hormone analog alone or in combination with nerve growth
factors or other neurogenesis factors and/or secreting a polymeric thyroid hormone analog
alone or in combination with nerve growth factors or other neurogenesis factors, and which
cause endogenous level of the polymeric thyroid hormone analogs alone or in combination
with nerve growth factor or other neurogenesis factors to be altered.
In particular, the invention provides methods for protecting neurons from the tissue
destructive effects associated with the body's immune and inflammatory response to nerve
injury. The invention also provides methods for stimulating neurons to maintain their
differentiated phenotype, including inducing the redifferentiation of transformed cells of
neuronal origin to a morphology characteristic of untransformed neurons. In one
embodiment, the invention provides means for stimulating production of cell adhesion
molecules, particularly nerve cell adhesion molecules ("N-CAM"). The invention also
provides methods, compositions and devices for stimulating cellular repair of damaged
neurons and neural pathways, including regenerating damaged dendrites or axons. In
addition, the invention also provides means for evaluating the status of nerve tissue, and for
detecting and monitoring neuropathies by monitoring fluctuations in polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors levels.
In one aspect of the invention, the polymeric thyroid hormone analogs alone or in
combination with nerve growth factors or other neurogenesis factors described herein are
useful in repairing damaged neural pathways of the peripheral nervous system. In particular,
polymeric thyroid hormone analogs alone or in combination with nerve growth factors or
other neurogenesis factors are useful for repairing damaged neural pathways, including
transected or otherwise damaged nerve fibers. Specifically, the polymeric thyroid hormone
analogs alone or in combination with nerve growth factor or other neurogenesis factors
described herein are capable of stimulating complete axonal nerve regeneration, including
vascularization and reformation of the myelin sheath. Preferably, the polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors are provided to the site of injury in a biocompatible, bioresorbable carrier capable of
maintaining the polymeric thyroid hormone analogs alone or in combination with nerve
growth factors or other neurogenesis factors at the site and, where necessary, means for
directing axonal growth from the proximal to the distal ends of a severed neuron. For
example, means for directing axonal growth may be required where nerve regeneration is to
be induced over an extended distance, such as greater than 10 mm. Many carriers capable of
providing these functions are envisioned. For example, useful carriers include substantially
insoluble materials or viscous solutions prepared as disclosed herein comprising larninin,
hyaluronic acid or collagen, or other suitable synthetic, biocompatible polymeric materials
such as polylactic, polyglycolic or polybutyric acids and/or copolymers thereof. A preferred
carrier comprises an extracellular matrix composition derived, for example, from mouse
sarcoma cells.
In a particularly preferred embodiment, a polymeric thyroid hormone analog alone
or in combination with nerve growth factors or other neurogenesis factors is disposed in a
nerve guidance channel which spans the distance of the damaged pathway. The channel acts
both as a protective covering and a physical means for guiding growth of a neurite. Useful
channels comprise a biocompatible membrane, which may be tubular in structure, having a
dimension sufficient to span the gap in the nerve to be repaired, and having openings
adapted to receive severed nerve ends. The membrane may be made of any biocompatible,
nonirritating material, such as silicone or a biocompatible polymer, such as polyethylene or
polyethylene vinyl acetate. The casing also may be composed of biocompatible,
bioresorbable polymers, including, for example, collagen, hyaluronic acid, polylactic,
polybutyric, and polyglycolic acids. In a preferred embodiment, the outer surface of the
channel is substantially impermeable.
The polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other neurogenesis factors may be disposed in the channel in association with a
biocompatible carrier material, or it may be adsorbed to or otherwise associated with the
inner surface of the casing, such as is described in U.S. Pat. No. 5,011,486, provided that
the polymeric thyroid hormone analogs alone or in combination with nerve growth factors
or other neurogenesis factors is accessible to the severed nerve ends.
In another aspect of the invention, polymeric thyroid hormone analogs alone or in
combination with nerve growth factors or other neurogenesis factors described herein are
useful to protect against damage associated with the body's immune/inflarnrnatory response
to an initial injury to nerve tissue. Such a response may follow trauma to nerve tissue,
caused, for example, by an autoimmune dysfunction, neoplastic lesion, infection, chemical
or mechanical trauma, disease, by interruption of blood flow to the neurons or glial cells, or
by other trauma to the nerve or surrounding material. For example, the primary damage
resulting from hypoxia or ischemia-reperfusion following occlusion of a neural blood
supply, as in an embolic stroke, is believed to be immunologically associated. In addition, at
least part of the damage associated with a number of primary brain tumors also appears to
be immunologically related. Application of a polymeric thyroid hormone analog alone or in
combination with nerve growth factors or other neurogenesis factors, either directly or
systemically alleviates and/or inhibits the immunologically related response to a neural
injury. Alternatively, administration of an agent capable of stimulating the expression
and/or secretion in vivo of polymeric thyroid hormone analogs alone or in combination
with nerve growth factors or other neurogenesis factors expression, preferably at the site of
injury, may also be used. Where the injury is to be induced, as during surgery or other
aggressive clinical treatment, the polymeric thyroid hormone analogs alone or in
combination with nerve growth factors or other neurogenesis factors or agent may be
provided prior to induction of the injury to provide a neuroprotective effect to the nerve
tissue at risk.
Generally, polymeric thyroid hormone analogs alone or in combination with nerve
growth factors or other neurogenesis factors useful in methods and compositions of the
invention are dimeric proteins that induce morphogenesis of one or more eukaryotic (e.g.,
mammalian) cells, tissues or organs. Tissue morphogenesis includes de novo or regenerative
tissue formation, such as occurs in a vertebrate embryo during development. Of particular
interest are polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other neurogenesis factors that induce tissue-specific morphogenesis at least of
bone or neural tissue. As defined herein, a polymeric thyroid hormone analog alone or in
combination with nerve growth factor or other neurogenesis factors comprises a pair of
polypeptides that, when folded, form a dimeric protein that elicits morphogenetic responses
in cells and tissues displaying thyroid receptors. That is, the polymeric thyroid hormone
analogs alone or in combination with nerve growth factors or other neurogenesis factors
generally induce a cascade of events including all of the following in a morphogenically
permissive environment: stimulating proliferation of progenitor cells; stimulating the
differentiation of progenitor cells; stimulating the proliferation of differentiated cells; and,
supporting the growth and maintenance of differentiated cells. "Progenitor" cells are
uncommitted cells that are competent to differentiate into one or more specific types of
differentiated cells, depending on their genomic repertoire and the tissue specificity of the
permissive environment in which morphogenesis is induced. An exemplary progenitor cell
is a hematopoeitic stem cell, a mesenchymal stem cell, a basement epithelium cell, a neural
crest cell, or the like. Further, polymeric thyroid hormone analogs alone or in combination
with nerve growth factors or other neurogenesis factors can delay or mitigate the onset of
senescence- or quiescence-associated loss of phenotype and/or tissue function. Still further,
polymeric thyroid hormone analogs alone or in combination with nerve growth factors or
other neurogenesis factors can stimulate phenotypic expression of a differentiated cell type,
including expression of metabolic and/or functional, e.g., secretory, properties thereof. In
addition, polymeric thyroid hormone analogs alone or in combination with nerve growth
factor or other neurogenesis factors can induce redifferentiation of committed cells (e.g.,
osteoblasts, neuroblasts, or the like) under appropriate conditions. As noted above,
polymeric thyroid hormone analogs alone or in combination with nerve growth factors or
other neurogenesis factors that induce proliferation and/or differentiation at least of bone or
neural tissue, and/or support the growth, maintenance and/or functional properties of neural
tissue, are of particular interest herein.
Of particular interest are polymeric thyroid hormone analogs alone or in
combination with nerve growth factors or other neurogenesis factors which, when provided
to a specific tissue of a mammal, induce tissue-specific morphogenesis or maintain the
normal state of differentiation and growth of that tissue. In preferred embodiments, the
present polymeric thyroid hormone analog alone or in combination with nerve growth
factors or other neurogenesis factors induce the formation of vertebrate (e.g., avian or
mammalian) body tissues, such as but not limited to nerve, eye, bone, cartilage, bone
marrow, ligament, tooth dentin, periodontium, liver, kidney, lung, heart, or gastrointestinal
lining. Preferred methods may be carried out in the context of developing embryonic tissue,
or at an aseptic, unscarred wound site in post-embryonic tissue.
Other aspects of the invention include compositions and methods of using thyroid
hormone analogs and polymers thereof for imaging and diagnosis of neurodegenerative
disorders, such as, for example, Alzheimer's disease. For example, in one aspect, the
invention features T4 analogs that have a high specificity for target sites when administered
to a subject in vivo. Preferred T4 analogs show a target to non-target ratio of at least 4:1, are
stable in vivo and substantially localized to target within 1 hour after administration. In
another aspect, the invention features pharmaceutical compositions comprised of a linker
attached to the T4 analogs for Technetium, indium for gamma imaging using single photon
emission ("SPECT") and with contrast agents for MRI imaging. Additionally, halogenated
analogs that bind TfR can inhibit the formation of amyloid fibrils and thus can be utilized
for the prevention and treatment of Alzheimer's disease. Such compounds can also be used
with positron emission tomography ("PET") imaging methods.
In other aspects, the invention also includes compositions and methods for
modulating actions of growth factors and other polypeptides whose cell surface receptors
are clustered around integrin ctVpS, or other cell surface receptors containing the amino
acid sequence Arg-Gly-Asp ("ROD"). Polypeptides that can be modulated include, for
example, insulin, insulin-like growth factors, epidermal growth factors, and interferon-y.
The details of one or more embodiments of the invention have been set forth in the
accompanying description below. Although any methods and materials similar or
equivalent to those described herein can be used in the practice or testing of the present
invention, the preferred methods and materials are now described. Other features, objects,
and advantages of the invention will be apparent from the description and from the claims.
In the specification and the appended claims, the singular forms include plural references
unless the context clearly dictates otherwise. Unless defined otherwise, all technical and
scientific terms used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. All patents and publications cited
in this specification are incorporated by reference in their entirety.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Effects of L-T4 and L-T3 on angiogenesis quantitated in the chick
CAM assay. A, Control samples were exposed to PBS and additional samples to 1 nM T3
or 0.1 umol/L T4 for 3 days. Both hormones caused increased blood vessel branching in
these representative images from 3 experiments. B, Tabulation of mean ±SEM of new
branches formed from existing blood vessels during the experimental period drawn from 3
experiments, each of which included 9 CAM assays. At the concentrations shown, T3 and
T4 caused similar effects (1.9-fold and 2.5-fold increases, respectively, in branch
formation). **P CAM samples,
Figure 2. Tetrac inhibits stimulation of angiogenesis by T4 and agarose-linked
T4 (T4-ag). A, A 2.5-fold increase in blood vessel branch formation is seen in a
representative CAM preparation exposed to 0.1 umol/L T4 for 3 days. In 3 similar
experiments, there was a 2.3-fold increase. This effect of the hormone is inhibited by tetrac
(0.1 umol/L), a T4 analogue shown previously to inhibit plasma membrane actions of T4.13
22
Tetrac alone does not stimulate angiogenesis (C). B, T4-ag (0.1 umol/L) stimulates
angiogenesis 2.3-fold (2.9-fold in 3 experiments), an effect also blocked by tetrac. C,
Summary of the results of 3 experiments that examine the actions of tetrac, T4-ag, and T4 in
the CAM assay. Data (means ±SEM) were obtained from 10 images for each experimental
condition in each of 3 experiments. **P agarose-treated samples with PBS-treated control samples.
Figure 3. Comparison of the proangiogenic effects of FGF2 and T4. A, Tandem
effects of T4 (0.05 umol/L) and FGF2 (0.5 iag/mL) in submaximal concentrations are
additive in the CAM assay and equal the level of angiogenesis seen with FGF2 (1 ug/mL in
the absence of T4). B, Summary of results from 3 experiments that examined actions of
FGF2 arid T4 in the CAM assay (means ±SEM) as in A. *P results of treated samples with those of PBS-treated control samples in 3 experiments.
Figure 4. Effect of anti-FGF2 on angiogenesis caused by T4 or exogenous
FGF2. A, FGF2 caused a 2-fold increase in angiogenesis in the CAM model in 3
experiments, an effect inhibited by antibody (ab) to FGF2 (8 ug). T4 also stimulated
angiogenesis 1.5-fold, and this effect was also blocked by FGF2 antibody, indicating that
the action of thyroid hormone in the CAM model is mediated by an autocrine/paracrine
effect of FGF2 because T4 and T3 cause FGF2 release from cells in the CAM model (Table
1). We have shown previously mat a nonspecific IgG antibody has no effect on
angiogenesis in the CAM assay. B, Summary of results from 3 CAM experiments mat
studied the action of FGF2-ab in the presence of FGF2 or T4. *P indicating significant effects in 3 experiments studying the effects of thyroid hormone and
FGF2 on angiogenesis and loss of these effects in the presence of antibody to FGF2.
Figure 5. Effect of PD 98059, a MAPK (ERK1/2) signal transaction cascade
inhibitor, on angiogenesis induced by T4,T3, and FGF2. A, Angiogenesis stimulated by
T4 (0.1 umol/L) and T3 (1 nmol/L) together is fully inhibited by PD 98059 (3 umol/L). B,
Angiogenesis induced by FGF2 (1 fig/mL) is also inhibited by PD 98059, indicating that the
action of the growth factor is also dependent on activation of the ERK1/2 pathway. In the
context of the experiments involving T4-agarose (T4-ag) and tetrac (Figure2) indicating
that T4 initiates its proangiogenic effect at the cell membrane, results shown in A and B are
consistent with 2 roles played by MAPK in the proangiogenic action of thyroid hormone:
ERK1/2 transduces the early signal of the hormone that leads to FGF2 elaboration and
transduces the subsequent action of FGF2 on angiogenesis. C, Summary of results of 3
experiments, represented by A and B, showing the effect of PD98059 on the actions of T4
and FGF2 in the CAM model. *P from 3 experiments.
Figure 6. T4 and FGF2 activate MAPKin ECV304 endothelial cells. Cells were
prepared in Ml 99 medium with 0.25% hormone-depleted serum and treated with T4 (0.1
umol/L) for 15 minutes to 6 hours. Cells were harvested and nuclear fractions prepared as
described previously. Nucleoproteins, separated by gel electrophoresis, were
immunoblotted with antibody to phosphorylated MAPK (pERKl and pERK2, 44 and 42
kDa, respectively), followed by a second antibody linked to a luminescence-detection
system. A (3-actin immunoblot of nuclear tractions serves as a control for gel loading in
each part of this figure. Each immunoblot is representative of 3 experiments. A, T4 causes
increased phosphoiylation and nuclear translocation of ERKl/2 in ECV304 cells. The effect
is maximal in 30 minutes, although the effect remains for >6 hours. B, ECV304 cells were
treated with the ERKl/2 activation inhibitor PD 98059 (PD; 30 umol/L) or the PKC
inhibitor CGP41251 (CGP; 100 nmol/L) for 30 minutes, after which 10 "7 M T4 was added
for 15 minutes to cell samples as shown. Nuclei were harvested, and this representative
experiment shows increased phosphorylation (activation) of ERKl/2 by T4 (lane 4), which
is blocked by both inhibitors (lanes 5 and 6), suggesting that PKC activity is a requisite for
MAPK activation by T4 in endothelial cells. C, ECV304 cells were treated with either T4
(10 "7 mol/L), FGF2 (10 ng/mL), or both agents for 15 minutes. The figure shows pERKl/2
accumulation in nuclei with either hormone or growth factor treatment and enhanced
nuclear pERKl/2 accumulation with both agents together.
Figure 7. T4 increases accumulation ofFGF2 cDNA in ECV304 endothelial
cells. Cells were treated for 6 to 48 hours with T4 (10 "7 moVL) and FGF2 and GAPDH
cDNAs isolated from each cell aliquot. The levels ofFGF2 cDNA, shown in the top blot,
were corrected for variations in GAPDH cDNA content, shown in the bottom blot, and the
corrected levels ofFGF2 are illustrated below in the graph (mean ±SE of mean; n = 2
experiments). There was increased abundance of FGF2 transcript in RNA extracted from
cells treated with T4 at all time points. *P ANOVA of values at each time point to control value.
Figure 8. 7 Day Chick Embryo Tumor Growth Model. Illustration of the Chick
Chorioallantoic Membrane (CAM) model of tumor implant
Figure 9. T4 Stimulates 3D Wound Healing. Photographs of human dermal
fibroblast cells exposed to T4 and control, according to the 3D Wound Healing Assay
described herein.
Figure 10. T4 Dose-Dependently Increases Wound Healing, Day 3. As
indicated by the graph, T4 increases wound healing (measured by outmigrating cells) in a
dose-dependent manner between concentrations of 0.1 uM and LOuM. This same increase
is not seen in concentrations of T4 between l.OuM and 3.0uM.
Figure 11. Effect of unlabeled T4 and T3 on I"12S-T4 binding to purified integrin.
Unlabeled T4 (lO^M to 10"nM) or T3 (lO-4M to 10~8M) were added to purified ctVpS
integrin (2ug/sample) and allowed to incubate for 30 min. at room temperature. Two
microcuries of 1-125 labeled T« was added to each sample. The samples were incubated for
20 min. at room temperature, mixed with loading dye, and run on a 5% Native gel for 24
hrs. at 4°C at 45mA. Following electrophoresis, the gels were wrapped in plastic wrap and
exposed to film. W25-T4 binding to purified aVp3 is unaffected by unlabeled T4 in the
range of 10" M to 10" M, but is competed out in a dose-dependent manner by unlabeled X*
at a concentration of 10"6M. Hot T4 binding to the integrin is almost completely displaced
by lO^M unlabeled T4. TS is less effective at competing out T4 binding to aVß3, reducing
the signal by 11%, 16%, and 28% at 10~6M, 10'5M, and lO^M T3, respectively.
Figure 12. Tetrac and an RGD containing peptide, but not an RGE containing
peptide compete out T4 binding to purified aVp3. A) Tetrac addition to purified aVp3
reduces l~ns-labeled Tt binding to the integrin in a dose dependent manner. 10"8M tetrac is
ineffective at compering out hot T4 binding to the integrin. The association of T4 and oVp3
was reduced by 38% in the presence of 10"7M tetrac and by 90% with 10"5M tetrac.
Addition of an RGD peptide at 10"5M competes out T4 binding to ccV(33. Application of 10"
5M and 10"*M RGE peptide, as a control for the RGD peptide, was unable to diminish hot
T4 binding to purified uVp3. B) Graphical representation of the tetrac and RGD data from
panel A. Data points are shown as the mean ± S.D. for 3 independent experiments.
Figure 13. Effects of the monoclonal antibody LM609 on T4 binding to aVp3.
A) LM609 was added to aVp3 at the indicated concentrations. One (ig of LM609 per
sample reduces labeled T4 binding to the integrin by 52%. Maximal inhibition of T4
binding to the integrin is reached when concentrations of LM609 are 2ug per sample and is
maintained with antibody concentrations as high as 8ug. As a control for antibody
specificity, lOug/sample Cox-2 mAB and 1 Dug/sample mouse IgG were added to aVp3
prior to incubation with T4. B) Graphical representation of data from panel A. Data points
are shown as the mean ± S.D. for 3 independent experiments.
Figure 14. Effect of RGD, RGE, tetrac, and the mAB LM609 on T4-induced
MAPK activation. A) CV-1 cells (50-70% confluency) were treated for 30 rain, with 10"7
M T4 (10~7 M total concentration, 10"10M free concentration. Selected samples were treated
for 16 hrs with the indicated concentrations of either an RGD containing peptide, an RGE
containing peptide, tetrac, or LM609 prior to the addition of T4. Nuclear proteins ere
separated by SDS-PAGE and immunoblotted with anti-phospho-MAPK (pERKl/2)
antibody. Nuclear accumulation of pERKl/2 is diminished in samples treated with 10"6 M
RGD peptide or higher, but not significantly altered in samples treated with 10"4 M RGE.
pERKl/2 accumulation is decreased 76% in CVI cells treated with lO M tetrac, while 10"
5M and higher concentrations of tetrac reduce nuclear accumulation of pERKl/2 to levels
similar to the untreated control samples. The monoclonal antibody to aVp3 LM609
decrease accumulation of activated MAPK in the nucleus when it is applied to CVI cultures
a concentration of lu.g/ml. B) Graphical representation of the data for RGD, RGE, and
tetrac shown in panel A. Data points represent the mean ± S.D. for 3 separate experiments.
Figure 15. Effects of siRNA to aV and p3 on T4 induced MAPK activation.
CV1 cells were transfected with siRNA (100 nM final concentration) to aV, P3, or aV and
(33 together. Two days after transfection, the cells were treated with 10"7M T4. A) RT-PCR
was performed from RNA isolated from each transfection group to verify the specificity and
functionality of each siRNA. B) Nuclear proteins from each transfection were isolated and
subjected to SDS-PAGE.
Figure 16. Inhibitory Effect of aVp3 mAB (LM609) on T4-stimulated
Angiogenesis in the CAM Model. A) Samples were exposed to PBS, T4 (0.1 uM), or T4
plus 1 Omg/ml LM609 for 3 days. Angiogenesis stimulated by T4 is substantially inhibited
by the addition of the aB3 monoclonal antibody LM609. B) Tabulation of the mean ±
SEM of new branches formed from existing blood vessels during the experimental period.
Data was drawn from 3 separate experiments, each containing 9 samples in each treatment
group. C, D) Angiogenesis stimulated by T4 or FGF2 is also inhibited by the addition of
the aVp3 monoclonal antibody LM609 or XT 199.
Figure 17. Polymer Compositions of Thyroid Hormone Analogs - Polymer
Conjugation Through an Ester Linkage Using Polyvinyl Alcohol. In this preparation
commercially available polyvinyl alcohol (or related co-polymers) can be esterified by
treatment with the acid chloride of thyroid hormone analogs, namely the acid chloride form.
The hydrochloride salt is neutralized by the addition of triethylamine to afford triethylamine
hydrochloride which can be washed away with water upon precipitation of the thyroid
hormone ester polymer form for different analogs. The ester linkage to the polymer may
undergo hydrolysis in vivo to release the active pro-angiogenesis thyroid hormone analog.
Figure 18. Polymer Compositions of Thyroid Hormone Analogs - Polymer
Conjugation Through an Anhydride Linkage Using Acrylic Acid Ethylene Copolymer.
This is similar to the previous polymer covalent conjugation however this time it
is through an anhydride linkage that is derived from reaction of an acrylic acid co-polymer.
This anhydride linkage is also susceptible to hydrolysis in vivo to release thyroid hormone
analog. Neutralization of the hydrochloric acid is accomplished by treatment with
triethylamine and subsequent washing of the precipitated polyanhydride polymer with water
removes the triethylamine hydrochloride byproduct. This reaction will lead to the formation
of Thyroid hormone analog acrylic acid co-polymer + triethylamine. Upon in vivo
hydrolysis, the thyroid hormone analog will be released over time that can be controlled
plus acrylic acid ethylene Co-polymer.
Figure 19. Polymer Compositions of Thyroid Hormone Analogs - Entrapment
in a Polylactic Acid Polymer. Polylactic acid polyester polymers (PLA) undergo
hydrolysis //; vivo to the lactic acid monomer and this has been exploited as a vehicle for
drug delivery systems in humans. Unlike the prior two covalent methods where the thyroid
hormone analog is linked by a chemical bond to the polymer, this would be a non-covalent
method that would encapsulate the thyroid hormone analog into PLA polymer beads. This
reaction will lead to the formation of Thyroid hormone analog containing PLA beads in
water. Filter and washing will result in the formation of thyroid hormone analog containing
PLA beads, which upon in vivo hydrolysis will lead to the generation of controlled levels of
thyroid hormone plus lactic acid.
Figure 20. Thyroid Hormone Analogs Capable of Conjugation with Various
Polymers. A-D show substitutions required to achieve various thyroid hormone analogs
which can be conjugated to create polymeric forms of thyroid hormone analogs of the
invention.
Figure 21. In vitro 3-D Angiogenesis Assay Fig. 21 is a protocol and
illustration of the three-dimensional in vitro sprouting assay for human micro-vascular
endothelial on fibrin-coated beads.
Figure 22. In Vitro Sprout Angiogenesis of HOMEC in 3-D Fibrin Fig. 22 is an
illustration of human micro-vascular eudothelial cell sprouting in three dimensions
under different magnifications
Figures 23A-E. Release of platelet-derived wound healing factors in the
presence of low level collagen
Figures 24A-B. Unlabeled T4 and T3 displace [125I]-T4 from purified integrin.
Unlabeled T4 (10"u M to 10"4 M) orT3 (10"8 to KT4 M) were added to purified integrin (2 ng/sample) prior to the addition of [125I]-T4. (a) [125I]-T4 binding to purified
aVb3 was unaffected by unlabeled T4 in the range of 10~n M to 10~7 M, but was displaced
in a concentration-dependent manner by unlabeled T4 at concentrations > 10"6 M. T3 was
less effective at displacing T4 binding to ocV(33. (b) Graphic presentation of the T4and T3
data shows the mean ± S.D. of 3 independent experiments.
Figures 25A-B. Tetrac and an RGD-containing peptide, but not an RGBcontaining
peptide, displace T4 binding to purified ocV|33. (a) Pre-incubation of purified
aVp3 with tetrac or an RGD-containing peptide reduced the interaction between the
integrin and [125I]-T4in a dose-dependent manner. Application of 10~5 M and 10"4 M RGB
peptide, as controls for the RGD peptide, did not diminish labeled T4 binding to purified
ctVp3. (b) Graphic presentation of the tetrac and RGD data indicates the mean ± S.D. of
results from 3 independent experiments.
Figures 26A-B. Integrin antibodies inhibit T4 binding to aVp3. The
antibodies LM609 and SC7312 were added to ctVp3 at the indicated concentrations (p.g/ml)
30 min prior to the addition of [125I]-T4. Maximal inhibition of T4 binding to the integrin
was reached when the concentration of LM609 was 2 |J.g/ml and was maintained with
antibody concentrations as high as 8 u.g/ml. SC7312 reduced T4 binding to ocVp3 by 46%
at 2 μg/ml antibody/sample and by 58% when 8|j.g/ml of antibody were present. As a
control for antibody specificity, 10 iig/ml of anti-ccVp3 mAb (P1F6) and 10 (J.g/ml mouse
IgG were added to aV(33 prior to incubation with T4. The graph shows the mean ± S.D. of
data from 3 independent experiments.
Figures 27A-B. Effect of RGD and RGB peptides, tetrac, and the mAb
LM609 on T4-induced MAPK activation, (a) Nuclear accumulation of pERKl/2 was
diminished in samples treated with 10"6 M RGD peptide or higher, but not significantly
altered in samples treated with up tolO"4 M RGB. pERKl/2 accumulation in CV-1 cells
treated with 105 M tetrac and T4 were similar to levels observed in the untreated control
samples. LM609, a monoclonal antibody to aVp3, decreased accumulation of activated
MAPK in the nucleus when it was applied to CV-1 cultures in a concentration of 1 ug/ml.
(b) The graph shows the mean ± S.D. of data from 3 separate experiments. Immunoblots
with a-tubulin antibody are included as gel-loading controls.
Figures 28A-B. Effects of siRNA to aV and (33 on T4-induced MAPK
activation. CV-1 cells were transfected with siRNA (100 nM final concentration) to aV, p3,
or aV and P3 together. Two days after transfection, the cells were treated with 10-7 M T4
or the vehicle control for 30 min. (a) RT-PCR was performed with RNA isolated from each
transfection group to verify the specificity and functionality of each siRNA. (b) Nuclear
proteins from each set of transfected cells were isolated, subjected to SDS-PAGE, and
probed for pERKl/2 in the presence or absence of treatment with T4. In the parental cells
and in those treated with scrambled siRNA, nuclear accumulation of pERKl/2 with T4 was
evident. Cells treated with siRNA to aV or P3 showed an increase in pERKl/2 in the
absence of T4, and a decrease with T4 treatment. Cells containing aV and P3 siRNAs did
not respond to T4 treatment.
Figures 29A-B. Inhibitory effect of aVp3 mAb (LM609) on T4-stimulated
angiogenesis in the CAM model. CAMS were exposed to filter disks treated with PBS, T4
(10-7 M),or T4 pluslO ng/ml LM609 for 3 days, (a) Angiogenesis stimulated by T4 was
substantially inhibited by the addition of the ctVp3 monoclonal antibody LM609. (b)
Tabulation of the mean ± SEM of new branches formed fiom existing blood vessels during
the experimental period is shown. ***P samples with ri 4-treated samples in 3 separate experiments, each containing 9 images per
treatment group. Statistical analysis was performed by 1-way ANOVA.
DETAILED DESCRDPTION OF THE INVENTION
The features and other details of the invention will now be more particularly
described with references to the accompanying drawings, and as pointed out by the claims.
For convenience, certain terms used in the specification, examples and claims are collected
here. Unless otherwise defined, all technical and scientific terms used herein have the same
meaning as commonly understood by one of ordinary skill in the art to which this invention
pertains.
As used herein, the term "angiogenic agent" includes any compound or substance
that promotes or encourages angiogenesis, whether alone or in combination with another
substance. Examples include, but are not limited to, T3, T4, T3 or T4-agarose, polymeric
analogs of T3, T4, 3,5-dimethyl-4-(4'-hydroy-3'-isopropylbenzyl)-phenoxy acetic acid
(GC-1), or DiTPA. In contrast, the terms "anti-angiogenesis agent" or anti-angiogenic
agent" refer to any compound or substance that inhibits or discourages angiogenesis,
whether alone or in combination with another substance. Examples include, but are not
limited to, TETRAC, TRIAC, XT 199, and mAb LM609.
As used herein, the term "myocardial ischemia" is defined as an insufficient blood
supply to the heart muscle caused by a decreased capacity of the heart vessels. As used
herein, the term "coronary disease" is defined as diseases/disorders of cardiac function due
to an imbalance between myocardial function and the capacity of coronary vessels to supply
sufficient blood flow for nonnal function. Specific coronary diseases/disorders associated
with coronary disease which can be treated with the compositions and methods described
herein include myocardial ischemia, angina pectoris, coronary aneurysm, coronary
thrombosis, coronary vasospasm, coronary artery disease, coronary heart disease, coronary
occlusion and coronary stenosis.
As used herein the term "occlusive peripheral vascular disease" (also known as
peripheral arterial occlusive disorder) is a vascular disorder-involving blockage in the
carotid or femoral arteries, including the iliac artery. Blockage in the femoral arteries causes
pain and restricted movement. A specific disorder associated with occlusive peripheral
vascular disease is diabetic foot, which affects diabetic patients, often resulting in
amputation of the foot.
As used herein the terms "regeneration of blood vessels," "angiogenesis,"
"revascularization," and "increased collateral circulation" (or words to that effect) are
considered as synonymous. The term "pharmaceutically acceptable" when referring to a
natural or synthetic substance means that the substance has an acceptable toxic effect in
view of its much greater beneficial effect, while the related the term, "physiologically
acceptable," means the substance has relatively low toxicity. The term, "co-administered"
means two or more drugs are given to a patient at approximately the same time or in close
sequence so that their effects run approximately concurrently or substantially overlap. This
term includes sequential as well as simultaneous drug administration.
"Pharmaceutically acceptable salts" refers to pharmaceutically acceptable salts of
thyroid hormone analogs, polymeric forms, and derivatives, which salts are derived from a
variety of organic and inorganic counter ions well known in the art and include, by way of
example only, sodium, potassium, calcium, magnesium, ammonium, tetra-alkyl ammonium,
and the like; and when the molecule contains a basic functionality, salts of organic or
inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate,
oxalate and the like can be used as the pharmaceutically acceptable salt. The term also
includes both acid and base addition salts.
"Pharmaceutically acceptable acid addition salt" refers to those salts which retain the
biological effectiveness and properties of the free bases, which are not biologically or
otherwise undesirable, and which are formed with inorganic acids such as hydrochloric
acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic
acids such as acetic acid, propionic acid, pymvic acid, maleic acid, malonic acid, succinic
acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic
acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like. Particularly
preferred salts of compounds of the invention are the monochloride salts and the dichloride
salts.
"Pharmaceutically acceptable base addition salt" refers to those salts which retain
the biological effectiveness and properties of the free acids, which are not biologically or
otherwise undesirable. These salts are prepared from addition of an inorganic base or an
organic base to the free acid. Salts derived rrom inorganic bases include, but are not limited
to, the sodium, potassium, lithium, ammonium, calcium, magnesium, zinc, aluminum salts
and the like. Preferred inorganic salts are the ammonium, sodium, potassium, calcium, and
magnesium salts. Salts derived from organic bases include, but are not limited to, salts of
primary, secondary, and tertiary amines, substituted amines including naturally occurring
substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine,
trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-
dimethylaminoethanol, 2-diethylaminoethanol, trimethamine, dicyclohexylamine, lysine,
arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine,
glucosamine, methylglucamine, theobromine, purities, piperazine, piperidine, Nethylpiperidine,
polyamine resins and the like. Particularly preferred organic bases are
isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline
and caffeine.
"Ureido" refers to a radical of the formula -N(H)--C(O)~NH2.
It is understood from the above definitions and examples that for radicals containing
a substituted alkyl group any substitution thereon can occur on any carbon of the alkyl
group. The compounds of the invention, or their pharmaceutically acceptable salts, may
have asymmetric carbon atoms in their structure. The compounds of the invention and their
pharmaceutically acceptable salts may therefore exist as single enantiomers,
diastereoisomers, racemates, and mixtures of enantiomers and diastereomers. All such
single enantiomers, diastereoisomers, racemates and mixtures thereof are intended to be
within the scope of this invention. Absolute configuration of certain carbon atoms within
the compounds, if known, are indicated by the appropriate absolute descriptor R or S.
Separate enantiomers can be prepared through the use of optically active starting
materials and/or intermediates or through the use of conventional resolution techniques,
e.g., enzymatic resolution or chiral HPLC.
As used herein, the phrase "growth factors" or "neurogenesis factors" refers to
proteins, peptides or other molecules having a growth, proliferative, differentiative, or
trophic effect on cells of the CMS or PNS. Such factors may be used for inducing
proliferation or differentiation and can include, for example, any trophic factor that allows
cells of the CNS or PNS to proliferate, including any molecule which binds to a receptor on
the surface ol the cell to exert a trophic, or growth-inducing effect on the cell. Preferred
factors include, but are not limited to, nerve growth factor ("NGF"), epidermal growth
factor ("EOF"), platelet-derived growth factor ("PDGF"), insulin-like growth factor
("IGF"), acidic fibroblast growth fator ("aFGF" or "FGF-I"), basic fibroblast growth factor
("bFGF" or "FGF-2"), and transforming growth factor-alpha and -beta ("TGF-a" and
"TGF-P").
"Subject" includes living organisms such as humans, monkeys, cows, sheep, horses,
pigs, cattle, goats, dogs, cats, mice, rats, cultured cells therefrom, and transgenic species
thereof. In a preferred embodiment, the subject is a human. Administration of the
compositions of the present invention to a subject to be treated can be carried out using
known procedures, at dosages and for periods of time effective to treat the condition in the
subject. An effective amount of the therapeutic compound necessary to achieve a
therapeutic effect may vary according to factors such as the age, sex, and weight of the
subject, and the ability of the therapeutic compound to treat the foreign agents in the
subject. Dosage regimens can be adjusted to provide the optimum therapeutic response.
For example, several divided doses may be administered daily or the dose may be
proportionally reduced as indicated by the exigencies of the therapeutic situation.
"Administering" includes routes of administration which allow the compositions of
the invention to perform their intended function, e.g., promoting angiogenesis. A variety of
routes of administration are possible including, but not necessarily limited to parenteral
(e.g., intravenous, intra-arterial, intramuscular, subcutaneous injection), oral (e.g., dietary),
topical, nasal, rectal, or via slow releasing microcarriers depending on the disease or
condition to be treated. Oral, parenteral and intravenous administration are preferred modes
of administration. Formulation of the compound to be administered will vary according to
the route of administration selected (e.g., solution, emulsion, gels, aerosols, capsule). An
appropriate composition comprising the compound to be administered can be prepared in a
physiologically acceptable vehicle or earner and optional adjuvants and preservatives. For
solutions or emulsions, suitable carriers include, for example, aqueous or alcoholic/aqueous
solutions, emulsions or suspensions, including saline and buffered media, sterile water,
creams, ointments, lotions, oils, pastes and solid carriers. Parenteral vehicles can include
sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated
Ringer's or fixed oils. Intravenous vehicles can include various additives, preservatives, or
fluid, nutnent or electrolyte replenishes (See generally, Remington's Pharmaceutical
Science, 16th Edition, Mack, Ed. (1980)).
"Effective amount" includes those amounts of pro-angiogenic or anti-angiogenic
compounds which allow it to perform its intended function, e.g., promoting or inhibiting
angiogenesis in angiogenesis-related disorders as described herein. The effective amount
will depend upon a number of factors, including biological activity, age, body weight, sex,
general health, severity of the condition to be treated, as well as appropriate
pharmacokinetic properties. For example, dosages of the active substance may be from
about O.Olmg/kg/day to about 500mg/kg/day, advantageously from about O.lmg/kg/day to
about lOOmg/kg/day. A therapeutically effective amount of the active substance can be
administered by an appropriate route in a single dose or multiple doses. Further, the
dosages of the active substance can be proportionally increased or decreased as indicated by
the exigencies of the therapeutic or prophylactic situation.
"Pharmaceutically acceptable carrier" includes any and all solvents, dispersion
media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying
agents, and the like which are compatible with the activity of the compound and are
physiologically acceptable to the subject. An example of a pharmaceutically acceptable
carrier is buffered normal saline (0.15M Nad). The use of such media and agents for
pharmaceutically active substances is well known in the art. Except insofar as any
conventional media or agent is incompatible with the therapeutic compound, use thereof in
the compositions suitable for pharmaceutical administration is contemplated.
Supplementary active compounds can also be incorporated into the compositions.
"Additional ingredients" include, but are not limited to, one or more of the
following: excipients; surface active agents; dispersing agents; inert diluents; granulating
and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring
agents; coloring agents; preservatives; physiologically degradable compositions such as
gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents;
dispersing or wetting agents; emulsifying; agents, demulcents; buffers; salts; thickening
agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing
agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Other
"additional ingredients" which may be included in the pharmaceutical compositions of the
invention are known in the art and described, e.g., in Remington's Pharmaceutical Sciences.
Compositions
Disclosed herein are angiogenic agents comprising thyroid hormones, analogs
thereof, and polymer conjugations of the hormones and their analogs. The disclosed
compositions can be used for promoting angiogenesis to treat disorders wherein
angiogenesis is beneficial. Additionally, the inhibition of these thyroid hormones, analogs
and polymer conjugations can be used to inhibit angiogenesis to treat disorders associated
with such undesired angiogenesis. As used herein, the term "angiogenic agent" includes
any compound or substance that promotes or encourages angiogenesis, whether alone or in
combination with another substance. Examples include, but are not limited to, T3, T4, T3
or T4-agarose, polymeric analogs of T3, T4, 3,5-dimethyl-4-(4'-hydroy-3'-
isopropylbenzyl)-phenoxy acetic acid (GC-1), or DITPA.
Polymer conjugations are used to improve drug viability. While many old and new
therapeutics are well-tolerated, many compounds need advanced drug discovery
technologies to decrease toxicity, increase circulatory time, or modify biodistribution. One
strategy for improving drug viability is the utilization of water-soluble polymers. Various
water-soluble polymers have been shown to modify biodistribution, improve the mode of
cellular uptake, change the permeability through physiological barriers, and modify the rate
of clearance through the body. To achieve either a targeting or sustained-release effect,
water-soluble polymers have been synthesized that contain drug moieties as terminal
groups, as part of the backbone, or as pendent groups on the polymer chain.
Representative compositions of the present invention include thyroid hormone or
analogs thereof conjugated to polymers. Conjugation with polymers can be either through
covalent or non-covalent linkages. In preferred embodiments, the polymer conjugation can
occur through an ester linkage or an anhydride linkage. An example of a polymer
conjugation through an ester linkage using poly vinyl alcohol is shown in Figure 17. In this
preparation commercially available polyvinyl alcohol (or related co-polymers) can be
esterified by treatment with the acid chloride of thyroid hormone analogs, including the acid
chloride form. The hydrochloride salt is neutralized by the addition of triethylamine to
afford triethylamine hydrochloride which can be washed away with water upon
precipitation of the thyroid hormone ester polymer form for different analogs. The ester
linkage to the polymer may undergo hydrolysis in vivo to release the active proangiogenesis
thyroid hormone analog.
An example of a polymer conjugation through an anhydride linkage using acrylic
acid ethylene co-polymer is shown in Figure 18. This is similar to the previous polymer
covalent conjugation, however, this time it is through an anhydride linkage that is derived
from reaction of an acrylic acid co-polymer. This anhydride linkage is also susceptible to
hydrolysis in vivo to release thyroid hormone analog. Neutralization of the hydrochloric
acid is accomplished by treatment with triethylamine and subsequent washing of the
precipitated polyanhydride polymer with water removes the triethylamine hydrochloride
byproduct. This reaction will lead to the formation of Thyroid hormone analog acrylic acid
co-polymer + triethylamine. Upon in vivo hydrolysis, the thyroid hormone analog will he
released over time that can be controlled plus acrylic acid ethylene Co-polymer.
Another representative polymer conjugation includes thyroid hormone or its analogs
conjugated to polyethylene glycol (PEG). Attachment of PEG to various drugs, proteins
and liposomes has been shown to improve residence time and decrease toxicity. PEG can
be coupled to active agents through the hydroxyl groups at the ends of the chains and via
other chemical methods. Peg itself, however, is limited to two active agents per molecule.
In a different approach, copolymers of PEG and amino acids were explored as novel
biomaterials which would retain the biocompatibility properties of PEG, but which would
have the added advantage of numerous attachment points per molecule and which could be
synthetically designed to suit a variety of applications.
Another representative polymer conjugation includes thyroid hormone or its analogs
in non-covalent conjugation with polymers. This is shown in detail in Figure 19. A
preferred non-covalent conjugation is entrapment of thyroid hormone or analogs thereof in a
polylactic acid polymer. Polylactic acid polyester polymers (PLA) undergo hydrolysis in
vivo to the lactic acid monomer and this has been exploited as a vehicle for drug delivery
systems in humans. Unlike the prior two covalent methods where the thyroid hormone
analog is linked by a chemical bond to the polymer, this would be a non-covalent method
that would encapsulate the thyroid hormone analog into PLA polymer beads. This reaction
will lead to the formation of Thyroid hormone analog containing PLA beads in water. Filter
and washing will result in the formation of thyroid hormone analog containing PLA beads,
which upon in vivo hydrolysis hydrolysis will lead to the generation of controlled levels of
thyroid hormone plus lactic acid.
Still further, compositions of the present invention include thyroid hormone analogs
conjugated to retinols (e.g., retinoic acid (i.e., Vitamin A), which bind to the thyroid
hormone binding protein transthyretin ("TTR") and retinoic binding protein ("RBP").
Thyroid hormone analogs can also be conjugated with halogenated srilbesterols, alone or in
combination with retinoic acid, for use in detecting and suppressing amyloid plaque. These
analogs combine the advantageous properties of T4-TTR, namely, their rapid uptake and
prolonged retention in brain and amyloids, with the properties of halogen substiruents,
including certain useful halogen isotopes for PET imaging including fluorine-18, iodine-
123, iodine-124, iodine-131, broniine-75, bromine-76, bromine-77 and bromine-82.
Furthermore, nanotechnology can be used for the creation of useful materials and
structures sized at the nanometer scale. The main drawback with biologically active
substances is fragility. Nanoscale materials can be combined with such biologically active
substances to dramatically improve the durability of the substance, create localized high
concentrations of the substance and reduce costs by minimizing losses. Therefore,
additional polymeric conjugations include nano-particle formulations of thyroid hormones
and analogs thereof. In such an embodiment, nano-polymers and nano-particles can be
used as a marix for local delivery of thyrid hormone and its analogs. This will aid in time
controlled delivery into the cellular and tissue target.
Compositions of the present invention include both thyroid hormone, analogs, and
derivatives either alone or in covalent or non-covalent conjugation with polymers.
Examples of representative analogs and derivatives are shown in Figure 20, Tables A-D.
Table A shows T2, T3, T4, and bromo-derivatives. Table B shows alanyl side chain
modifications. Table C shows hydroxy groups, diphenyl ester linkages, and Dconfigurations.
Table D shows tyrosine analogs.
The terms "anti-angiogenesis agent" or anti-angiogenic agent" refer to any
compound or substance that inhibits or discourages angiogenesis, whether alone or in
combination with another substance. Examples include, but are not limited to, TETRAC,
TRIAC, XT 199, and mAb LM609.
The Role of Thyroid Hormone, Analogs, and Polymeric Conjugations in Promoting
Angiogenesis
The pro-angiogenic effect of thyroid hormone analogs or polymeric forms depends
upon a non-genomic initiation, as tested by the susceptibility of the hormonal effect to
reduction by pharmacological inhibitors of the MAPK signal transduction pathway. Such
results indicates that another consequence of activation of MAPK by thyroid hormone is
new blood vessel growth. The latter is initiated nongenomically, but of course, requires a
consequent complex gene transcription program. The ambient concentrations of thyroid
hormone are relatively stable. The CAM model, at the time we tested it, was thyroprival
and thus may be regarded as a system, which does not reproduce the intact organism.
The availability of a chick chorioallantoic membrane (CAM) assay for angiogenesis
has provided a model in which to quantitate angiogenesis and to study possible mechanisms
involved in the induction by thyroid hormone of new blood vessel growth. The present
application discloses a pro-angiogenic effect of T^ that approximates that in the CAM model
of FGF2 and that can enhance the action of suboptimal doses of FGF2. It is further
disclosed that the pro-angiogenic effect of the hormone is initiated at the plasma membrane
and is dependent upon activation by T4 of the MAPK signal transduction pathway. As
provided above, methods for treatment of occlusive peripheral vascular disease and
coronary diseases, in particular, the occlusion of coronary vessels, and disorders associated
with the occlusion of the peripheral vasculature and/or coronary blood vessels are disclosed.
Also disclosed are compositions and methods for promoting angiogenesis and/or recruiting
collateral blood vessels in a patient in need thereof. The compositions include an effective
amount of Thyroid hormone analogs, polymeric forms, and derivatives. The methods
involve the co-administration of an effective amount of thyroid hormone analogs, polymeric
forms, and derivatives in low, daily dosages for a week or more with other standard proangiogenesis
growth factors, vasodilators, anticoagulants, thrombolytics or other vascularrelated
therapies.
The CAM assay has been used to validate angiogenic activity of a variety of growth
factors and compounds believed to promote angiogenesis. For example, T4 in physiological
concentrations was shown to be pro-angiogenic in this in vitro model and on a molar basis
to have the activity of FGF2. The presence of PTU did not reduce the effect of T4,
indicating that de-iodination of T,t to generate TS was not a prerequisite in this model. A
summary of the pro-angiogenesis effects of various thyroid hormone analogs is listed in
label 1.
(Table Removed)
The appearance of new blood vessel growth in this model requires several days,
indicating that the effect of thyroid hormone was wholly dependent upon the interaction of
the nuclear receptor for thyroid hormone (TR) with the hormone. Actions of
iodothyronines that require intranuclear complexing of TR with its natural ligand, TI, are by
definition, genomic, and culminate in gene expression. On the other hand, the preferential
response of this model system to T4-rather than TS, the natural ligand of TR-raised the
possibility that angiogenesis might be initiated nongenomically at the plasma membrane by
T4 and culminate in effects that require gene transcription. Non-genomic actions of T4 have
been widely described, are usually initiated at the plasma membrane and may be mediated
by signal transduction pathways. They do not require intranuclear ligand of iodothyronine
and TR, but may interface with or modulate gene transcription. Non-genomic actions of
steroids have also been well described and are known to interface with genomic actions of
steroids or of other compounds, Experiments carried out with T4 and tetrac or with agarose-
T4 indicated that the pro-angtogenic effect of 1$ indeed very likely was initiated at the
plasma membrane. Tetrac blocks membrane-initiated effects of T/i, but does not, itself,
activate signal transduction. Thus, it is a probe for non-genomic actions of thyroid
hormone. Agarose-14 is thought not to gain entry to the cell interior and has been used to
examine models for possible cell surface-initiated actions of the hormone. Investigations of
the pro-angiogenic effects of thyroid hormone in the chick chorioallantoic membrane
("CAM") model demonstrate that generation of new blood vessels from existing vessels
was promoted two- to three-fold by either L-thyroxine (T4) or 3,5,3'-triiodo-L~thyronine
(T^) at 10~7- 10~9 M. More interestingly, T4-agarose, a thyroid hormone analog that does
not cross the cell membrane, produced a potent pro-angiogenesis effect comparable to that
obtained with T-j or IV
In part, this invention provides compositions and methods for promoting
angiogenesis in a subject in need thereof. Conditions amenable to treatment by promoting
angiogenesis include, for example, occlusive peripheral vascular disease and coronary
diseases, in particular, the occlusion of coronary vessels, and disorders associated with the
occlusion of the peripheral vasculature and/or coronary blood vessels, erectile dysfunction,
stroke, and wounds. Also disclosed are compositions and methods for promoting
angiogenesis and/or recruiting collateral blood vessels in a patient in need thereof. The
compositions include an effective amount of polymeric forms of thyroid hormone analogs
and derivatives and an effective amount of an adenosine and/or nitric oxide donor. The
compositions can be in the form of a sterile, injectable, pharmaceutical formulation that
includes an angiogenically effective amount of thyroid hormone-like substance and
adenosine derivatives in a physiologically and pharmaceutically acceptable carrier,
optionally with one or more excipients.
Myocardial Infarction
A major reason for heart failure following acute myocardial infarction is an
inadequate response of new blood vessel formation, i.e., angiogenesis. Thyroid hormone
and its analogs are beneficial in heart failure and stimulate coronary angiogenesis. The
methods of the invention include, in part, delivering a single treatment of a thyroid hormone
analog at the time of infarction either by direct injection into the myocardium, or by
simulation of coronary injection by intermittent aortic ligation to produce transient
isovolumic contractions to achieve angiogenesis and/or ventricular remodeling.
Accordingly, in one aspect the invention features methods for treating occlusive
vascular disease, coronary disease, myocardial infarction, ischemia, stroke, and/or
peripheral artery vascular disorders by promoting angiogenesis by administering to a subject
in need thereof an amount of a polymeric form of thyroid hormone, or an analog thereof,
effective for promoting angiogenesis.
Examples of polymeric forms of thyroid hormone analogs are also provided herein
and can include triiodothyronine (T3), levothyroxine (T4), (GC-1), or 3,5-
diiodothyropropionic acid (DITPA) conjugated to polyvin)'! alcohol, acrylic acid ethylene
co-polymer, polylactic acid, or agarose.
The methods also involve the co-administration of an effective amount of thyroid
hormone-like substance and an effective amount of an adenosine and/or NO donor in low,
daily dosages for a week or more. One or both components can be delivered locally via
catheter. Thyroid hormone analogs, and derivatives in vivo can be delivered to capillary
beds surrounding ischemic tissue by incorporation of the compounds in an appropriately
sized liposome or microparticle. Thyroid hormone analogs, polymeric forms and derivatives
can be targeted to ischemic tissue by covalent linkage with a suitable antibody.
The method may be used as a treatment to restore cardiac function after a
myocardial infarction. The method may also be used to improve blood flow in patients with
coronary artery disease suffering from myocardial ischemia or inadequate blood flow to
areas other than the heart including, for example, occlusive peripheral vascular disease (also
known as peripheral arterial occlusive disease), or erectile dysfunction.
Wound Healing
Wound angiogenesis is an important part of the proliferative phase of healing-
Healing of any skin wound other than the most superficial cannot occur without
angiogenesis. Not only does any damaged vasculature need to be repaired, but the increased
local cell activity necessary for healing requires an increased supply of nutrients from the
bloodstream. Moreover, the endothelial cells which form the lining of the blood vessels are
important in themselves as organizers and regulators of healing.
Thus, angiogenesis provides a new microcirculation to support the healing wound.
The new blood vessels become clinically visible within the wound space by four days after
injury. Vascular endothelial cells, fibroblasts, and smooth muscle cells all proliferate in
coordination to support wound granulation. Simultaneously, re-epithelialization occurs to
reestablish the epithelial cover. Epithelial cells from the wound margin or from deep hair
follicles migrate across the wound and establish themselves over the granulation tissue and
provisional matrix. Growth factors such as keratinocyte growth factor (KGF) mediate this
process. Several models (sliding versus rolling cells) of epithelialization exist.
As thyroid hormones regulate metabolic rate, when the metabolism slows down due
to hypothyroidism, wound healing also slows down. The role of topically applied thyroid
hormone analogs or polymeric forms in wound healing therefore represents a novel strategy
to accelerate wound healing in diabetics and in non-diabetics with impaired wound healing
abilities. Topical adminstration can be in the form of attachment to a band-aid.
Additonally, nano-polymers and nano-particles can be used as a marix for local delivery of
thyrid hormone and its analogs. This will aid in time-controlled delivery into the cellular
and tissue target.
Accordingly, another embodiment of the invention features methods for treating
wounds by promoting angiogenesis by administering to a subject in need thereof an amount
of a polymeric form of thyroid hormone, or an analog thereof, effective for promoting
angiogenesis. For details, see Examples 9A and 9B.
The Role of Thyroid Hormone, Analogs, and Polymeric Conjugations in Combination with
Nerve Growth Factors in Inducing and Maintaining Neuronal Cells
Contrary to traditional understanding of neural induction, the present invention is
partly based on the unexpected finding that mechanisms that initiate and maintain
angiogenesis are effective promoters and sustainers of neurogenesis. These methods and
compositions are useful, for example, for the treatment of motor neuron injury and
neuropathy in trauma, injury and neuronal disorders. This invention discloses the use of
various pro-angiogenesis strategies alone or in combination with nerve growth factor or
other neurogenesis factors. Pro-angiogenesis factors include polymeric thyroid hormone
analogs as illustrated herein. The polymeric thyroid hormone analogs and its polymeric
conjugates alone or in combination with other pro-angiogenesis growth factors known in the
ait and with nerve growth factors or other neurogenesis factors can be combined for optimal
neurogenesis.
Disclosed are therapeutic treatment methods, compositions and devices for
maintaining neural pathways in a mammal, including enhancing survival of neurons at risk
of dying, inducing cellular repair of damaged neurons and neural pathways, and stimulating
neurons to maintain their differentiated phenotype. Additionally, a composition containing
polymeric thyroid hormone analogs, and combinations thereof, in the presence of antioxidants
and/or anti-inflammatory agents demonstrate neuronal regeneration and protection.
The present invention also provides thyroid hormones, analogs, and polymeric
conjugations, alone or in combination with nerve growth factors or other neurogenesis
factors, to enhance survival of neurons and maintain neural pathways. As described herein,
polymeric thyroid hormone analogs alone or in combination with nerve growth factors or
other neurogenesis factors are capable of enhancing survival of neurons, stimulating
neuronal CAM expression, maintaining the phenotypic expression of differentiated neurons,
inducing the redifferentiation of transformed cells of neural origin, and stimulating axonal
growth over breaks in neural processes, particularly large gaps in axons. Morphogens also
protect against tissue destruction associated with immunologically-related nerve tissue
damage. Finally, polymeric thyroid hormone analogs alone or in combination with nerve
growth factors or other neurogenesis factors may be used as part of a method for monitoring
the viability of nerve tissue in a mammal.
The present invention also provides effects of polymeric thyroid hormones on
synapse formation between cultured rat cortical neurons, using a system to estimate
functional synapse formation in vitro. Exposure to 10-9 M polymeric thyroid hormones,
3,5,3'-triiodothyronine or thyroxine, caused an increase in the frequency of spontaneous
synchronous oscillatory changes in intracellular calcium concentration, which correlated
with the number of synapses formed. The detection of synaptic vesicle-associated protein
synapsin I by immunocytochemical and immunoblot analysis also confirmed that exposure
to thyroxine facilitated synapse formation. The presence of amiodarone, an inhibitor of 5'-
deiodinase, or amitrole, a herbicide, inhibited the synapse formation in the presence of
thyroxine. Thus, the present invention also provides a useful in vitro assay system for
screening of miscellaneous chemicals that might interfere with synapse formation in the
developing CNS by disrupting the polymeric thyroid system.
As a genera] matter, methods of the present invention maybe applied to the
treatment of any mammalian subject at risk of or afflicted with a neural tissue insult or
neuropathy. The invention is suitable for the treatment of any primate, preferably a higher
primate such as a human. In addition, however, the invention may be employed in the
treatment of domesticated mammals which are maintained as human companions (e.g.,
dogs, cats, horses), which have significant commercial value (e.g., goats, pigs, sheep, cattle,
sporting or draft animals), which have significant scientific value (e.g., captive or free
specimens of endangered species, or inbred or engineered animal strains), or which
otherwise have value.
The polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other neurogenesis factors described herein enhance cell survival, particularly of
neuronal cells at risk of dying. For example, fully differentiated neurons are non-mitotic and
die in vitro when cultured under standard mammalian cell culture conditions, using a
chemically defined or low serum medium known in the art. See, for example, Charness, J.
Biol. Chem. 26: 3164-3169 (1986) and Freese, et al., Brain Res. 521: 254-264 (1990).
However, if a primary culture of non-mitotic neuronal cells is treated with polymeric
thyroid analog alone or in combination with nerve growth factor or other neurogenesis
factors, the survival of these cells is enhanced significantly. For example, a primary culture
of striatal basal ganglia isolated from the substantia nigra of adult rat brain was prepared
using standard procedures, e.g., by dissociation by trrturation with pasteur pipette of
substantia nigra tissue, using standard tissue culturing protocols, and grown in a low serum
medium, e.g., containing 50% DMEM (Dulbecco's modified Eagle's medium), 50% F-12
medium, heat inactivated horse serum supplemented with penicillin/streptomycin and 4 g/1
glucose. Under standard culture conditions, these cells are undergoing significant cell death
by three weeks when cultured in a serum-free medium. Cell death is evidenced
morphologically by the inability of cells to remain adherent and by changes in their
ultrasrructural characteristics, e.g., by chromatin clumping and organelle disintegration.
Specifically, cells remained adherent and continued to maintain the morphology of viable
differentiated neurons. In the absence of thyroid analog alone or in combination with nerve
growth factor or other neurogenesis factors treatment, the majority of the cultured cells
dissociated and underwent cell necrosis.
Dysfunctions in the basal ganglia of the substantia nigra are associated with
Huntington's chorea and parkinsoiiism in vivo. The ability of the polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors defined herein to enhance neuron survival indicates that these polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors will be useful as part of a therapy to enhance survival of neuronal cells at risk of
dying in vivo due, for example, to a neuropathy or chemical or mechanical trauma. The
present invention further provides that these polymeric thyroid hormone analogs alone or in
combination with nerve growth factors or other neurogenesis factors provide a useful
therapeutic agent to treat neuropathies which affect the striatal basal ganglia, including
Huntington's chorea and Parkinson's disease. For clinical applications, the polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors may be administered or, alternatively, a polymeric thyroid hotmone analog alone or
in combination with nerve growth factors or other neurogenesis factors-stimulating agent
may be administered.
The thyroid hormone compounds described herein can also be used for nerve tissue
protection from chemical trauma. The ability of the polymeric thyroid hormone analogs
alone or in combination with nerve growth factors or other neurogenesis factors described
herein to enhance survival of neuronal cells and to induce cell aggregation and cell—cell
adhesion in redifferentiated cells, indicates that the polymeric thyroid hormone analogs
alone or in combination with nerve growth factors or other neurogenesis factors will be
useful as therapeutic agents to maintain neural pathways by protecting the cells defining the
pathway from the damage caused by chemical trauma. In particular, the polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors can protect neurons, including developing neurons, from the effects of toxins known
to inhibit the proliferation and migration of neurons and to interfere with cell-cell adhesion.
Examples of such toxins include ethanol, one or more of the toxins present in cigarette
smoke, and a variety of opiates. The toxic effects of ethanol on developing neurons induces
the neurological damage manifested in fetal alcohol syndrome. The polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors also may protect neurons from the cytotoxic effects associated with excitatory amino
acids such as glutamate.
For example, ethanol inhibits the cell—cell adhesion effects induced in polymeric
thyroid analog alone or in combination with nerve growth factor or other neurogenesis
factors-treated NG108-15 cells when provided to these cells at a concentration of 25-50
mM. Half maximal inhibition can be achieved with 5-10 mM ethanol, the concentration of
blood alcohol in an adult following ingestion of a single alcoholic beverage. Ethanol likely
interferes with the homophilic binding of CAMs between cells, rather than their induction,
as polymeric thyroid analog alone or in combination with nerve growth factor or other
neurogenesis factors-induced N-CAM levels are unaffected by ethanol. Moreover, the
inhibitory effect is inversely proportional to polymeric thyroid analog alone or in
combination with nerve growth factor or other neurogenesis factors concentration.
Accordingly, it is envisioned that administration of a polymeric thyroid analog alone or in
combination with nerve growth factor or other neurogenesis factors or polymeric thyroid
analog alone or in combination with nerve growth factor or other neurogenesis factorsstimulating
agent to neurons, particularly developing neurons, at risk of damage from
exposure to toxins such as ethanol, may protect these cells from nerve tissue damage by
overcoming the toxin's inhibitory effects. The polymeric thyroid analog alone or in
combination with nerve growth factor or other neurogenesis factors described herein also
are useful in therapies to treat damaged neural pathways resulting from a neuropathy
induced by exposure to these toxins.
The in vivo activities of the polymeric thyroid hormone analogs alone or in
combination with nerve growth factors or other neurogenesis factors described herein also
are assessed readily in an animal model as described herein. A suitable animal, preferably
exhibiting nerve tissue damage, for example, genetically or environmentally induced, is
injected intracerebrally with an effective amount of a polymeric thyroid hormone analogs
alone or in combination with nerve growth factor or other neurogenesis factors in a suitable
therapeutic formulation, such as phosphate-buffered saline, pH 7. The polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other neurogenesis
factors preferably is injected within the area of the affected neurons. The affected tissue is
excised at a subsequent time point and the tissue evaluated morphologically and/or by
evaluation of an appropriate biochemical marker (e.g., by polymeric thyroid hormone
analogs alone or in combination with nerve growth factors or other neurogenesis factors or
N-CAM localization; or by measuring the dose-dependent effect on a biochemical marker
for CNS neurotrophic activity or for CNS tissue damage, using for example, glial librillary
acidic protein as the marker. The dosage and incubation time will vary with the animal to be
tested. Suitable dosage ranges for different species may be determined by comparison with
established animal models. Presented below is an exemplary protocol for a rat brain stab
model.
Briefly, male Long Evans rats, obtained from standard commercial sources, are
anesthetized and the head area prepared for surgeiy. The calvariae is exposed using standard
surgical procedures and a hole drilled toward the center of each lobe using a 0.035K wire,
just piercing the calvariae. 25 ml solutions containing either polymeric thyroid analog alone
or in combination with nerve growth factor or other neurogenesis factors (e.g., OP-1, 25
mg) or PBS then is provided to each of the holes by Hamilton syringe. Solutions are
delivered to a depth approximately 3 mm below the surface, into the underlying cortex,
corpus callosum and hippocampus. The skin then is sutured and the animal allowed to
recover.
Three days post surgery, rats are sacrificed by decapitation and their brains
processed for sectioning. Scar tissue formation is evaluated by imrnunofluorescence staining
for glial fibrillary acidic protein, a marker protein for glial scarring, to qualitatively
determine the degree of scar formation. Glial fibrillary acidic protein antibodies are
available commercially, e.g., from Sigma Chemical Co., St. Louis, Mo. Sections also are
probed with anti-OP-1 antibodies to determine the presence of OP-1. Reduced levels of glial
fibrillary acidic protein are anticipated in the tissue sections of animals treated with the
polymeric thyroid analog alone or in combination with nerve growth factor or other
neurogenesis factors, evidencing the ability of polymeric thyroid analog alone or in
combination with nerve growth factor or other neurogenesis factors to inhibit glial scar
formation and stimulate nerve regeneration.
The Role of ^Thyroid Hormone, Analogs, and Polymeric Conjugations for Brain Imaging,
Diagnosis, and Therapies; of Neurodegenerative Diseases
The present invention relates to novel pharmaceutical and radiopharmaceuticals
useful for the early diagnosis, prevention, and treatment of neurodegenerative disease, such
as, for example, Alzheimer's disease. The invention also includes novel chemical
compounds having specific binding in a biological system and capable of being used for
positron emission tomography (PET), single photon emission (SPECT) imaging methods,
and magnetic resonance (MRI) imaging methods. The ability of T4 and other thyroid
hormone analogs to bind to localized ligands within the body makes it possible to utilize
such compounds for m situ imaging of the ligands by PET, SPECT, MRI, and similar
imaging methods. In principle, nothing need be known about the nature of the ligand, as
long as binding occurs, and such binding is specific for a class of cells, organs, tissues or
receptors of interest.
PET imaging is accomplished with the aid of tracer compounds labeled with a
positron-emitting isotope (Goodman, M. M. Clinical Positron Emission Tomography,
Mosby Yearbook, 1992, K. F. Hubner et al., Chapter 14). For most biological materials,
suitable isotopes are few. The carbon isotope, UC, has been used for PET, but its short halflife
of 20.5 minutes limits its usefulness to compounds that can be synthesized and purified
quickly, and to facilities that are proximate to a cyclotron where the precursor C11 starting
material is generated. Other isotopes have even shorter half-lives. N13 has a half-life of 10
minutes and O15 has an even shorter half-life of 2 minutes. The emissions of both are more
energetic than those of C1'. Nevertheless, PET studies have been carried out with these
isotopes (Hubner, K. F., in Clinical Positron Emission Tomography, Mosby Year Book,
1992, K. F. Hubner, et al., Chapter 2). A more useful isotope, 18F, has a half-life of 110
minutes. This allows sufficient time for incorporation into a radio-labeled tracer, for
purification and for administration into a human or animal subject. In addition, facilities
more remote from a cyclotron, up to about a 200 mile radius, can make use of F18 labeled
compounds. Disadvantages of 18F are the relative scarcity of fluorinated analogs that have
functional equivalence to naturally-occurring biological materials, and the difficulty of
designing methods of synthesis that efficiently utilize the starting material generated in the
cyclotron. Such starting material can be either fluoride ion or fluorine gas. In the latter case
only one fluorine atom of the bimolecular gas is actually a radionuclide, so the gas is
designated F-F18. Reactions using F-F18 as starting material therefore yield products having
only one half the radionuclide abundance of reactions utilizing K. F18 as starting material.
On the other hand, F18 can be prepared in curie quantities as fluoride ion for incorporation
into a radiophannaceutical compound in high specific activity, theoretically 1.7 Ci/nmol
using carrier-free nucleophilic substitution reactions. The energy emission of F18 is 0.635
MeV, resulting in a relatively short, 2.4 mm average positron range in tissue, permitting
30 high resolution PET images.
SPECT imaging employs isotope tracers that emit high energy photons (.gamma.-
emitters). The range of useful isotopes is greater than for PET, but SPECT provides lower
three-dimensional resolution. Nevertheless, SPECT is widely used to obtain clinically
significant information about analog binding, localization and clearance rates. A useful
isotope for SPEC"T imaging is I12' a-gamma.-emitter with a 13.3 hour half life. Compounds
labeled with I " can be shipped up to about 1000 miles from the manufacturing site, or the
isotope itself can be transported for on-site synthesis. Eighty-five percent of the isotope's
emissions are 159 KeV photons, which is readily measured by SPECT instrumentation
currently in use. The compounds of the invention can be labeled with Technetium.
Technetium-99m is known to be a useful radionuclide for SPECT imaging. The T4 analogs
of the invention are joined to a Tc-99ra metal cluster through a 4-6 carbon chain which can
be saturated or possess a double or triple bond.
Use of F18 labeled compounds in PET has been limited to a few analog compounds.
Most notably, 18F-fluorodeoxyglucose has been widely used in studies of glucose
metabolism and localization of glucose uptake associated with brain activity. 18F-Lfluorodopa
and other dopamine receptor analogs have also been used in mapping dopamine
receptor distribution.
Other halogen isotopes can serve for PET or SPECT imaging, or for conventional
tracer labeling. ITiese include 75Br, 76Br, 77Br and 82Br as having usable half-lives and
emission characteristics. In general, the chemical means exist to substitute any halogen
moiety for the described isotopes. Therefore, the biochemical or physiological activities of
any halogenated homolog of the described compounds are now available for use by those
skilled in the art, including stable isotope halogen homolog. Astatine can be substituted for
other halogen isotypes. 2l°At, for example, emits alpha particles with a half-life of 8.3h.
Other isotopes also emit alpha particles with reasonably useful half-lives. At-substituted
compounds are therefore useful for brain therapy, where binding is sufficiently brainspecific.
Numerous studies have demonstrated increased incorporation of carbohydrates and
amiuo acids into malignant brain cells. This accumulation is associated with accelerated
proliferation and protein synthesis of such cells. The glucose analog 18F-2-fluoro-2-deoxy-
D-glucose (2-FDG) has been used for distinguishing highly malignant brain brains from
normal brain tissue or benign growths (DiChiro, G. et al. (1982) Neurology (NY) 32:1323-
1329. However, fluoriue-18 labeled 2-FDG is not the agent of choice for detecting low
grade brain brains because high uptake in normal tissue can mask the presence of a brain. In
addition, fluorine-18 labeled 2-FDG is not the ideal radiopharmaceutical for distinguishing
lung brains from infectious tissue or detecting ovarian carcinoma because of high uptake of
the 2-FDG radioactivity in infectious tissue and in the bladder, respectively. The naturally
occurring amino acid methionine, labeled with carbon-11, has also been used to distinguish
malignant tissue fro in normal tissue. But it too has relatively high uptake in normal tissue.
Moreover, the half-life of carbon-11 is only 20 minutes; therefore Cl 1 methionine can not
be stored for a long period of time.
Cerebrospinal fluid ("CSF") transthyretin ("TTR"), the main CSF thyroxine (T4)
carrier protein in the rat and the human is synthesized in the choroid plexus ("CP"). After
injection of ~ 1-T4 in the rat, radioactive T4 accumulates first in the CP, then in the CSF
and later in the brain (Chanoine JP, Braverman LE. The role of transthyretin in the transport
of thyroid hormone to cerebrospinal fluid and brain. Acta Med Austriaca. 1992; 19 Suppl
1:25-8).
Compounds of the invention provide substantially improved PET imaging for areas
of the body having amyloid protein, especially of the brain. All the available positronemitting
isotopes which could be incorporated into a biologically-active compound have
short half-lives. The practical utility of such labeled compounds is therefore dependent on
how rapidly the labeled compound can be synthesized, the synthetic yield and the
radiochemical purity of the final product. Even the shipping time from the isotope source, a
cyclotron facility, to the hospital or laboratory where PET imaging is to take place, is
limited. A rough calculation of the useful distance is about two miles per minute of half-life.
Thus C11, with a half-life of 20.5m is restricted to about a 40 mile radius from a source
whereas compounds labeled with F18 can be used within about a 200 mile radius. Further
requirements of an l8F-labeled compound are that it have the binding specificity for the
receptor or target molecule it is intended to bind, that non-specific binding to other targets
be sufficiently low to permit distinguishing between target and non-target binding, and that
the label be stable under conditions of the test to avoid exchange with other substances in
the test environment. More particularly, compounds of the invention must display adequate
binding to the desired target while failing to bind to any comparable degree with other
tissues or cells.
A partial solution to the stringent requirements for PET imaging is to employ
.gamma-emitting isotopes in SPECT imaging. I123 is a commonly used isotopic marker for
SPECT, having a half-life of 13 hours for a useful range of over 1000 miles from the site of
1 "71 synthesis. Compounds of the invention can be rapidly and efficiently labeled with I for
use in SPECT analysis as an alternative to PET imaging. Furthermore, because of the fact
that the same compound can be labeled with either isotope, it is possible for the first time to
compare the results obtained by PET and SPECT using the same tracer.
The specificity of brain binding also provides utility for I-substituted compounds of
the invention. Such compounds can be labeled with short-lived I for SPECT imaging or
with longer-lived 125I for longer-term studies such as monitoring a course of therapy. Other
iodine and bromine isotopes can be substituted for those exemplified.
5 The compounds of the invention therefore provide improved methods for brain
imaging using PET and SPECT. The methods entail administering to a subject (which can
be human or animal, for experimental and/or diagnostic purposes) an image-generating
amount of a compound of the invention, labeled with the appropriate isotope and then
measuring the distribution of the compound by PET if F18 or other positron emitter is
10 employed, or SPECT if I123 or other gamma emitter is employed. An image-generating
amount is that amount which is at least able to provide an image in a PET or SPECT
scanner, taking into account the scanner's detection sensitivity and noise level, the age of the
isotope, the body size of the subject and route of administration, all such variables being
exemplary of those known and accounted for by calculations and measurements known to
15 those skilled in the art without resort to undue experimentation.
It will be understood that compounds of the invention can be labeled with an isotope
of any atom or combination of atoms in the structure. While F18,1123, and I125 have been
emphasized herein as being particularly useful for PET, SPECT and tracer analysis, other
uses are contemplated including those flowing from physiological or pharmacological
20 properties of stable isotope homolog and will be apparent to those skilled in the art.
The invention also provides for technetium (Tc) labeling via Tc adducts. Isotopes of
Tc, notably Tc99"1, have been used for brain imaging. The present invention provides Tccomplexed
adducts of compounds of the invention, which are useful for brain imaging. The
adducts are Tc-coordination complexes joined to the cyclic amino acid by a 4-6 carbon
25 chain which can be saturated or possess a double or triple bond. Where a double bond is
present, either E (trans) or Z (cis) isomers can be synthesized, and either isomer can be
employed. Synthesis is described for incorporating the 99mTc isotope as a last step, to
maximize the useful life of the isotope.
The following methods were employed in procedures reported herein. 18F-Fluoride
30 was produced from a Seimens cyclotron using the O(p,n) F reaction with 11 MeV
protons on 95% enriched 18O water. All solvents and chemicals were analytical grade and
were used without further purification. Melting points of compounds were determined in
capillary tubes by using a Buchi SP apparatus. Thin-layer chromatographic analysis (TLC)
was performed by using 250-mm thick layers of silica gel G PF-254 coated on aluminum
51
(obtained from Analtech, Inc.). Column chromatography was performed by using 60-200
mesh silica gel (Aldrich Co.). Infrared spectra (IR) were recorded on a Beckman ISA
specrrophotometer with NaCl plates. Proton nuclear magnetic resonance spectra (1H NMR)
were obtained at 300 MHz with a Nicolet high-resolution instrument.
In another aspect, the invention is directed to a method of using a compound of the
invention for the manufacture of a radiopharmaceutical for the diagnosis of Alzheimer's
disease in a human. In another aspect, the invention is directed to a method of preparing
compounds of the invention.
The compounds of the invention as described herein are the thyroid hormone
analogs or other TTR binding ligands, which bind to TTR and have the ability to pass the
blood-brain barrier. The compounds are therefore suited as in vivo diagnostic agents for
imaging of Alzheimer's disease. The detection of radioactivity is performed according to
well-known procedures in the art, either by using a gamma camera or by positron emission
tomography (PET).
Preferably, the free base or a pharmaceutically acceptable salt form, e.g. a
monochloride or dichloride salt, of a compound of the invention is used in a galenical
formulation as diagnostic agent. The galenical formulation containing the compound of the
invention optionally contains adjuvants known in the art, e.g. buffers, sodium chloride,
lactic acid, surfactants etc. A sterilization by filtration of the galenical formulation under
sterile conditions prior to usage is possible.
The radioactive dose should be in the range of 1 to 100 mCi, preferably 5 to 30 mCi,
and most preferably 5 to 20 mCi per application.
Of the various aspects of the invention, certain compounds (for example, compounds
disclosed in Examples 16-20) are preferred. Especially preferred are such compounds for
use as diagnostic agents in positron emission tomography (PET).
The compounds of the present invention may be administered by any suitable route,
preferably in the form of a pharmaceutical composition adapted to such a route, and in a
dose effective to bind TTR in the brain and thereby be detected by gamma camera or PET.
Typically, the administration is parenteral., e.g., intravenously, intraperitoneally.,
subcutaneously, intradermally, or intramuscularly. Intraveneous administration is preferred.
Thus, for example, the invention provides compositions for parenteral administration which
comprise a solution of contrast media dissolved or suspended in an acceptable carrier, e.g.,
serum or physiological sodium chloride solution.
Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions,
parenteral vehicles such as sodium chloride, Ringer's dextrose, etc. Examples of nonaqueous
solvents are propylerie glycol, polyethylene glycol, vegetable oil and injectable
organic esters such as ethyl oleate. Other pharmaceutically acceptable carriers, non-toxic
excipients, including salts, preservatives, bufers and the like, are described, for instance, in
REMMINGTON'S PHARMACEUTICAL SCIENCES, 15.sup.th Ed. Easton: Mack
Publishing Co., pp. 1405-1412 and 1461-1487 (1975) and THE NATIONAL
FORMULARY XIV., 14.sup.th Ed. Washington: American Pharmaceutical Association
(1975). Aqueous earners, are preferred.
Pharmaceutical composition of this invention are produced in a manner known per
se by suspending or dissolving the compounds of this invention—optionally combined with
the additives customary in galenic pharmacy—in an aqueous medium and then optionally
sterilizing the suspension or solution. Suitable additives are, for example, physiologically
acceptable buffers (such as, for instance, tromethamine), additions of complexing agents
(e.g., diethylenetriaminepentaacetic acid) or—if required—electrolytes, e.g., sodium chloride
or—if necessary—antioxidants, such as ascorbic acid, for example.
If suspensions or solutions of the compounds of this invention in water or physiological
saline solution are desirable for enteral administration or other purposes, they are mixed
with one or several of the auxiliary agents (e.g.. inethylcellulose, lactose, mannitol) and/or
tensides (e.g., lecithins, "Tween", "Myrj") and/or flavoring agents to improve taste (e.g.,
ethereal oils), as customary in galenic pharmacy.
The compositions may be sterilized by conventional, well known sterilization
techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for
use as is, or lyophilized, the lyophilized preparation being combined with a sterile solution
prior to administration. The compositions may contain pharmaceutically acceptable
auxiliary substances as required to approximate physiological conditions, such as pH
adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for
example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium
chloride, sorbitan monolaurate, triethanolamine oleate, etc.
For the compounds according to the invention having radioactive halogens, these
compounds can be shipped as "hot" compounds, i.e., with the radioactive halogen in the
compound and administered in e.g., a physiologically acceptable saline solution. In the case
of the metal complexes, these compounds can be shipped as "cold" compounds, i.e., without
the radioactive ion, and then mixed with Tc-generator eluate or Re-generator eluate.
The Role of Thyroid Hormone, Analogs, and Polymeric Conjugations in Modulating the
Actions of Polypeptides Whose Cell Surface Receptors are Clustered Around I n t e g r i n 3 ,
or other RGD-containing Compounds
Integrin aVp3 is a heterodimeric plasma membrane protein with several
extracellular matrix protein ligands containing an an amino acid sequence Arg-Gly-Asp
("ROD"). Using purified integrin, we discovered that integrin ccVp3 binds T4 and that this
interaction is perturbed by aVp3 antagonists. Radioligand-binding studies revealed that
purified aVp3 binds T4 with high affinity (EC50, 371 pM), and appears to bind T4
preferentially over T3. This is consistent with previous reports that show MAPK activation
and nuclear translocation, as well as hormone-induced angiogenesis, by T4, compared to
T3. Integrin aVp3 antagonists inhibit binding of T4 to the integrin and, importantly,
prevent activation by T4 of the MAPK signaling cascade. This functional consequence-
MAPK activation—of hormone-bindmg to the integrin, together with inhibition of the
MAPK-dependent pro- angiogenic action of thyroid hormone by integrin otVp3 antagonists,
allow us to describe the iodothyronine-binding site on the integrin as a receptor. It should
be noted that 3-iodothyronamine, a thyroid hormone derivative, has recently been shown by
Scanlan et al. to bind to a trace amine receptor (TAR I), but the actions of this analog
interestingly are antithetic to those of T4 and T3.
The traditional ligands of integrins are proteins. That a small molecule, thyroid
hormone, is also a ligand of an integrin is a novel finding. The present invention also
discloses that, resveratrol, a polyphenol with some estrogenic activity, binds to integrin
aVp3 with a functional cellular consequence, apoptosis, different from those that result
from the binding of thyroid hormone. The site on the integrin at which T4 binds is at or
near the RGD binding groove of the heterodimeric integrin. It is possible, however, that
aVp3 binds T4 elsewhere on the protein and that the occupation of the RGD recognition
site by tetrac or by RGD-containing peptides allosterically blocks the T4 binding site or
causes a confomiational change within the integrin mat renders the T4 site unavailable.
Accordingly, the modulation by T4 of the laminin-integrin interaction of astrocytes may be
a consequence of binding of the hormone to the integrin. The possibility thus exists that at
the cell exterior thyroid hormone may affect the liganding by integrin aVp3 of extracellular
matrix proteins in addition to laminin.
Actions ot'T4 that are nongenomic in mechanism have been well documented in
recent years. A number of these activities are MAPK-mediated. We have shown that initial
steps in activation of the MAPK cascade by thyroid hormone, including activation of
protein kina.se C, are sensitive to GTPyS and pertussis toxin, indicating that the plasma
membrane receptor for thyroid hormone is G protein-sensitive. It should be noted that
certain cellular functions mediated by integrin aVp3 have been shown by others to be G
protein-modulated. For example, site-directed mutagenesis of the RGD binding domain
abolishes the ability of the nucleotide receptor P2Y2 to activate Go, while the activation of
Gq, was not affected. Wang et al. demonstrated that an integrin-associated protein,
IAP/CD47, induced smooth muscle cell migration via Gj-mediated inhibition of MAPK
activation.
In addition to linking the binding of T4 and other analogs by integrin ctV|33 to
activation of a specific intracellular signal transduction pathway, the present invention also
discloses that the liganding of the hormone by the integrin is critical to induction by T4 of
MAPK-dependent angiogenesis. In the CAM model, significant vessel growth occurs after
48-72 h of T4 treatment, indicating that the plasma membrane effects of T4 can result in
complex transcriptiona] changes. Thus, what is initiated as a nongenomic action of the
hormone—transduction of the cell surface T4 signal—interfaces with genomic effects of the
hormone that culminate in neovascularization. Interfaces of nongenomic and genomic
20 actions of thyroid hormone have previously been described, e.g., MAPK-dependent
phosphorylation at Ser-142 of TRJ31 that is initiated at the cell surface by T4 and that results
in shedding by TR of corepressor proteins and recruitment of coactivators. The instant
invention also discloses that T4 stimulates growth of C-6 glial cells by a MAPK-dependent
mechanism that is inhibited by RGD peptide, and mat thyroid hormone causes MAPKmediated
serine- phosphorylation of the nuclear estrogen receptor (ERcc) in MCF-7 cells by
a process we now know to be inhibitable by an RGD peptide. These findings in several cell
lines all support the participation of the integrin in functional responses of cells to thyroid
hormone.
Identification of aV{33 as a membrane receptor for thyroid hormoneindicates clinical
significance of the interaction of the integrin and the hormone and the downstream
consequence of angiogenesis. For example, oxV(33 is overexpressed in many tumors and this
overexpression appears to play a role in tumor invasion and growth. Relatively constant
circulating levels of thyroid hormone can facilitate tumor-associated angiogenesis. In
addition to demonstrating the pro-angiogenic action of T4 in the CAM model here and
elsewhere, the present invention also discloses that human dermal microvascular endothelial
cells also form new blood vessels when exposed to thyroid hormone. Local delivery of
aVp3 antagonists or tetrac around tumor cells might inhibit thyroid hormone- stimulated
angiogenesis. Although tetrac lacks many of the biologic activities of thyroid hormone, it
does gain access to the interior of'certain cells. Anchoring of tetrac, or specific RGD
antagonists, to non-immunogenic substrates (agarose or polymers) would exclude the
possibility that the compounds could cross the plasma membrane, yet retain as shown here
the ability to prevent T4-induced angiogenesis. The agarose-T4 used in the present studies
is thus a prototype for a new family of thyroid hormone analogues that have specific cellular
effects, but do not gain access to the cell interior.
Accordingly, the Examples herein identify integrin ccVp3 as a cell surface receptor
for thyroid hormone (L-thyroxine, T4) and as the initiation site for T4-induced activation of
intracellular signaling cascades. aV(33 dissociably binds radiolabeled T4 with high affinity;
radioligand-binding is displaced by tetraiodothyroacetic acid (tetrac), aV[33 antibodies and
by an integrin RGD recognition site peptide. CV-1 cells lack nuclear thyroid hormone
receptor but bear plasma membrane ctVp3; treatment of these cells with physiological
concentrations of T4 activates the MAPK pathway, an effect inhibited by tetrac, RGD
peptide and aVpS antibodies. Inhibitors of T4-binding to the integrin also block the MAPKmediated
pro- angiogenic action of T4. T4-induced phosphorylation of MAPK is blocked by
siRNA knockdown of ctV and P3. These findings indicate that T4 binds to aVp3 near the
RGD recognition site and show that hormone-binding to consequences.
The Role of Thyroid Hormone, Analogs, and Polymeric Conjugations in Inhibiting
Angiogenesis
The invention also provides, in another part, compositions and methods for
inhibiting angiogenesis in a subject in need thereof. Conditions amenable to treatment by
inhibiting angiogenesis include, for example, primary or metastatic tumors and diabetic
retinopathy. The compositions can include an effective amount of TETRAC, TRIAC or
mAb LM609. The compositions can be in the form of a sterile, injectable, pharmaceutical
formulation that includes an anti-angiogenically effective amount of an anti-angiogenic
substance in a physiologically and phamiaceuticaUy acceptable carrier, optionally with one
or more excipients.
In a further aspect, the invention provides methods for treating a condition amenable
TO treatment by inhibiting angiogenesis by administering to a subject in need thereof an
amount of an anti-angiogenesis agent effective for inhibiting angiogenesis.
Examples of the anti-angiogenesis agents used for inhibiting angiogenesis are also
provided by the invention and include,, but are not limited to, tetraiodothyroacetic acid
(TETRAC), triiodothyroacetic acid (TRIAC), monoclonal antibody LM609, or
combinations thereof. Such anti-angiogenesis agents can act at the cell surface to inhibit the
pro-angiogenesis agents.
Cancer-Related New Blood Vessel Growth
Examples of the conditions amenable to treatment by inhibiting angiogenesis include,
but are not limited to, primary or metastatic tumors, including, but not limited to glioma and
breast cancer. In such a method, compounds which inhibit the thyroid hormone-induced
angiogenic effect are used to inhibit angiogenesis. Details of such a method is illustrated in
Example 12.
Diabetic Reitinorjathy
Examples of the conditions amenable to treatment by inhibiting angiogenesis include,
but are not limited to diabetic retinopathy, and related conditions. In such a method, compounds
which inhibit the thyroid hormone-induced angiogenic effect are used to inhibit angiogenesis.
Details of such a method is illustrated in Examples 8A and B.
It is known that proliferative retiuopathy induced by hypoxia (rather than diabetes)
depends upon alphaV (aV) integrin expression (E Chavakis et al, Diabetologia 45:262-267,
2002). It is proposed herein that thyroid hormone action on a specific integrin alphaVbeta-3
(aVfS3) is permissive in the development of diabetic retinopathy. Integrin ccVp3 is identified
herein as the cell surface receptor for thyroid hormone. Thyroid hormone, its analogs, and
polymer conjugations, act via this receptor to induce angiogenesis.
Method^fTreatment_and F'orrnulations
Thyroid hormone analogs, polymeric forms, and derivatives can be used in a method for
promoting angiogenesis in a patient in need thereof. The method involves the co-administration
of an effective amount of thyroid hormone analogs, polymeric forms, and derivatives in low,
daily dosages for a week or more. The method may be used as a treatment to restore cardiac
function after a myocardial infarction. The method may also be used to improve blood flow in
patients with coronaiy artery disease suffering from myocardial ischemia or inadequate blood
flow to areas other than the heart, for example, peripheral vascular disease, for example,
peripheral arterial occlusive disease, where decreased blood flow is a problem.
The compounds can be administered via any medically acceptable means which is
suitable for the compound to be administered, including oral, rectal, topical or parenteral
(including subcutaneous, intramuscular and intravenous) administration. For example,
adenosine has a very short half-life. For this reason, it is preferably administered intravenously.
However, adenosine A.sub.2 agonists have been developed which have much longer half-lives,
and which can be administered through other means. Thyroid hormone analogs, polymeric
forms, and derivatives can be administered, for example, intravenously, oral, topical, intranasal
administration.
In some embodiments, the thyroid hormone analogs, polymeric forms, and derivatives
are administered via different means.
The amounts of the thyroid hormone, its analogs, polymeric forms, and derivatives
required to be effective in stimulating angiogenesis will, of course, vary with the individual
being treated and is ultimately at the discretion of the physician. The factors to be considered
include the condition of the patient being treated, the efficacy of the particular adenosine A2
receptor agonist being used, the nature of the formulation, and the patient's body weight.
Occlusion-treating dosages of thyroid hormone analogs or its polymeric forms, and derivatives
are any dosages that provide the desired effect.
The compounds described above are preferably administered in a formulation including
thyroid hormone analogs or its polymeric forms, and derivatives together with an acceptable
carrier for the mode of administration. Any formulation or drug delivery system containing the
active ingredients, which is suitable for the intended use, as are generally known to those of
skill in the art, can be used. Suitable pharmaceutically acceptable carriers for oral, rectal, topical
or parenteral (including subcutaneous, intraperitoneal, intramuscular and intravenous)
administration are known to those of skill in the art. The carrier must be phaimaceutically
acceptable in the sense of being compatible with the other ingredients of the formulation and
not deleterious to the recipient thereof.
Formulations suitable for parenteral administration conveniently include
sterileaqueous preparation of the active compound, which is preferably isotonic with the
blood of the recipient. Thus, such formulations may conveniently contain distilled water,
5% dextrose in distilled water or saline. Useful formulations also include concentrated
solutions or solids containing the compound of formula (I), which upon dilution with an
appropriate solvent give a solution suitable for parental administration above.
For enteral administration, a compound can be incorporated into an inert carrier in
discrete units such as capsules, cachets, tablets or lozenges, each containing a predetermined
amount of the active compound; as a powder or granules; or a suspension or solution in an
aqueous liquid or non-aqueous liquid, e.g., a syrup, an elixir, an emulsion or a draught.
Suitable carriers may be starches or sugars and include lubricants, flavorings, binders, and
other materials of the same nature.
A tablet may be made by compression or molding, optionally with one or more
accessory ingredients. Compressed tablets maybe prepared by compressing in a suitable
machine the active compound in a free-flowing form, e.g., a powder or granules, optionally
mixed with accessory ingredients, e.g., binders, lubricants, inert diluents, surface active or
dispersing agents. Molded tablets may be made by molding in a suitable machine, a mixture
of the powdered active compound with any suitable carrier.
A syrup or suspension may be made by adding the active compound to a
concentrated, aqueous solution of a sugar, e.g., sucrose, to which may also be added any
accessory ingredients. Such accessory ingredients may include flavoring, an agent to retard
crystallization of the sugar or an agent to increase the solubility of any other ingredient, e.g.,
as a polyhydric alcohol, for example, glycerol or sorbitol.
Formulations for rectal administration may be presented as a suppository with a
conventional carrier, e.g., cocoa butter or Witepsol S55 (trademark of Dynamite Nobel
Chemical, Germany), for a suppository base.
Alternatively, the compound may be administered in liposomes or microspheres (or
aucroparticles). Methods for preparing liposomes and microspheres for administration to a
jatient are well known to those of skill in the art. U.S. Pat. No. 4,789,734, the contents of
which are hereby incorporated by reference, describes methods for encapsulating biological
materials iu liposomes. Essentially, the material is dissolved in an aqueous solution, the
appropriate phospholipids and lipids added, along with surfactants if required, and the
material dialyzed or sonicated, as necessary. A review of known methods is provided by G.
Gregoriadis, Chapter 14, "Liposomes," Drug Carriers in Biology and Medicine, pp. 287-341
(Academic Press, 1979).
Microspheres formed of polymers or proteins are well known to those skilled in the
art, and can be tailored for passage through the gastrointestinal tract directly into the blood
stream. Alternatively, the compound can be incorporated and the microspheres, or
composite of microspheres, implanted for slow release over a period of time ranging from
days to months. See, for example, U.S. Pat. Nos. 4,906,474,4,925,673 and 3,625,214, and
Jein, TIPS 19:155-157 (1998), the contents of which are hereby incorporated by reference.
In one embodiment, the thyroid hormone analogs or its polymeric forms, and
adenosine derivatives can be formulated into a liposome or microparticle, which is suitably
sized to lodge in capillary beds following intravenous administration. When the liposome or
microparticle is lodged in the capillary beds surrounding ischemic tissue, the agents can be
administered locally to the site at which they can be most effective. Suitable liposomes for
targeting ischemic tissue are generally less than about 200 nanometers and are also typically
unilamellar vesicles, as disclosed, for example, in U.S. Pat. No. 5,593,688 to
Baldeschweiler, entitled "Liposomal targeting of ischemic tissue," the contents of which are
hereby incorporated by reference.
Preferred microparticles are those prepared from biodegradable polymers, such as
polyglycolide, polylactide and copolymers thereof. Those of skill in the art can readily
determine an appropriate carrier system depending on various factors, including the desired
rate of drug release and the desired dosage.
In one embodiment, the formulations are administered via catheter directly to the
inside of blood vessels. The administration can occur, for example, through holes in the
catheter. In those embodiments wherein the active compounds have a relatively long half
life (on the order of 1 day to a week or more), the formulations can be included in
biodegradable polymeric hydrogels, such as those disclosed in U.S. Pat. No. 5,410,016 to
Hubbell et al. These polymeric hydrogels can be delivered to the inside of a tissue lumen
and the active compounds released over time as the polymer degrades. If desirable, the
polymeric hydrogels can have microparticles or liposomes which include the active
compound dispersed therein, providing another mechanism for the controlled release of the
active compounds.
The formulations may conveniently be presented in unit dosage form and may be
prepared by any of the methods well known in the art of pharmacy. All methods include the
step of bringing the active compound into association with a carrier, which constitutes one
or more accessory ingredients. In general, the formulations are prepared by uniformly and
intimately bringing the active compound into association with a liquid carrier or a finely
divided solid carrier and then, if necessary, shaping the product into desired unit dosage
form.
The formulations can optionally include additional components, such as various
biologically active substances such as growth factors (including TGF-.beta., basic fibroblast
growth factor (FGF2), epithelial growth factor (EOF), transforming growth factors .alpha,
and .beta. (TGF alpha, and beta.), nerve growth factor (NGF), platelet-derived growth factor
(PDGF), and vascular endothelial growth factor/vascular permeability factor (VEGF/VPF)),
antiviral, antibacterial, anti-inflammatory, immuno-suppressant, analgesic, vascularizing
agent, and cell adhesion molecule.
In addition to the aforementioned ingredients, the formulations may further include
one or more optional accessory ingredient(s) utilized in the art of pharmaceutical
formulations, e.g., diluents, buffers, flavoring agents, binders, surface active agents,
thickeners, lubricants, suspending agents, preservatives (including antioxidants) and the
like.
Formulations and Methods of Treatment
Polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other neurogenesis factors inducers, or agonists of polymeric thyroid hormone
analogs alone or in combination with nerve growth factors or other neurogenesis factors
receptors of the present invention may be administered by any route which is compatible
with the particular polymeric thyroid hormone analog alone or in combination with nerve
growth factors or other neurogenesis factors, inducer, or agonist employed. Thus, as
appropriate, administration may be oral or parenteral, including intravenous and
61
intraperitoneal routes of administration. In addition, administration may be by periodic
injections of a bolus of the polymeric thyroid hormone analog alone or in combination with
nerve growth factors or other neurogenesis factors, inducer or agonist, or may be made
more continuous by intravenous or intraperitoneal administration from a reservoir which is
external (e.g., an i.v. bag) or internal (e.g., a bioerodable implant, or a colony of implanted,
polymeric thyroid analog alone or in combination with nerve growth factor or other
neurogenesis factors-producing cells).
Therapeutic agents of the invention (i.e., polymeric thyroid hormone analogs alone
or in combination with nerve growth factors or other neurogenesis factors, inducers or
agonists of polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other neurogenesis factors receptors) may be provided to an individual by any
suitable means, directly (e.g., locally, as by injection, implantation or topical administration
to a tissue locus) or systemically (e.g., parenterally or orally). Where, the agent is to be
provided parenterally, such as by intravenous, subcutaneous, intramolecular, ophthalmic,
intraperitoneal, intramuscular, buccal, rectal, vaginal, intraorbital, intracerebral, intracranial,
intraspinal, intraventricular, intrathecal, intracisternal, intracapsular, intranasal or by aerosol
administration, the agent preferably comprises part of an aqueous or physiologically
compatible fluid suspension or solution. Thus, the polymeric thyroid hormone analogs
alone or in combination with nerve growth factors or other neurogenesis factors carrier or
vehicle is physiologically acceptable so that in addition to delivery of the desired agent to
the patient, it does not otherwise adversely affect the patient's electrolyte and/or volume
balance. The fluid medium for the agent thus can comprise normal physiologic saline (e.g.,
9.85% aqueous NaCl, 0.15M, pH 7-7.4).
Association of the dimer with a polymeric thyroid hormone analog pro domain
results in the pro form of the polymeric thyroid hormone analog which typically is more
soluble in physiological solutions than the corresponding mature form.
Useful solutions for parenteral administration may be prepared by any of the
methods well known in the pharmaceutical art, described, for example, in REMINGTON'S
PHARMACEUTICAL SCIENCES (Gennaro, A., ed.), Mack Pub., 1990. Formulations of
the therapeutic agents of the invention may include, for example, polyalkylene glycols such
as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes, and the like.
Formulations for direct administration, in particular, may include glycerol and other
compositions of high viscosity to help maintain the agent at the desired locus.
Biocompatible, preferably bioresorbable, polymers, including, for example, hyaluronic acid,
collagen, tricalciurn phosphate, polybutyrafe, lactide, and glycolide polymers and
lactide/glycolide copolymers, may be useful excipients to control the release of the agent in
vivo. Other potentially useful parenteral delivery systems for these agents include ethylenevinyl
acetate copolymer particles, osmotic pumps, implantable infusion systems, and
liposomes. Formulations for inhalation administration contain as excipients, for example,
lactose, or may be aqueous solutions containing, for example, polyoxyethylene-94auryl
ether, glycocholate and deoxycholate, or oily solutions for administration in the form of
nasal drops, or as a gel to be applied intranasally. Formulations for parenteral administration
may also include glycocholate for buccal administration, methoxysalicylate for rectal
administration, or cutric acid for vaginal administration. Suppositories for rectal
administration may also be prepared by mixing the polymeric thyroid hormone analogs
alone or in combination with nerve growth factors or other neurogenesis factors, inducer or
agonist with a non-irritating excipient such as cocoa butter or other compositions which are
solid at room temperature and liquid at body temperatures.
Formulations for topical administration to the skin surface may be prepared by
dispersing the polymeric thyroid hormone analogs alone or in combination with nerve
growth factors or other neurogenesis factor's, inducer or agonist with a dermatologically
acceptable carrier such as a lotion, cream, ointment or soap. Particularly useful are carriers
capable of forming a film or layer over the skin to localize application and inhibit removal.
For topical administration to internal tissue surfaces, the agent may be dispersed in a liquid
tissue adhesive or other substance known to enhance adsorption to a tissue surface. For
example, hydroxypropylcellulose or fibrinogen/thrombin solutions may be used to
advantage. Alternatively, tissue-coating solutions, such as pectin-containing formulations
maybe used.
Alternatively, the agents described herein may be administered orally. Oral
administration of proteins as therapeutics generally is not practiced, as most proteins are
readily degraded by digestive enzymes and acids in the mammalian digestive system before
they can be absorbed into the bloodstream. However, the polymeric thyroid hormone
analogs alone or in combination with nerve growth factors or other neurogenesis factors
described herein typically are acid stable and protease-resistant (see, for example, U.S. Pat.
No. 4,968,590). In addition, OP-1, has been identified in mammary gland extract, colostrum
and 57-day milk. Moreover, the OP-1 purified from mammary gland extract is
morphogenically-active and is also detected in the bloodstream. Maternal administration,
via ingested milk, may be a natural delivery route of TGF-P superfamily proteins. Letterio,
etal., Science 264: 1936-1938 (1994), report that TGF-P is present in murine milk, and that
radiolabelled TGF-P is absorbed by gastrointestinal mucosa of suckling juveniles. Labeled,
ingested TGF-P appears rapidly in intact form in the juveniles' body tissues, including lung,
heart and liver. Finally, soluble form polymeric thyroid hormone analogs alone or in
combination with nerve growth factors or other neurogenesis factors, e.g., mature polymeric
thyroid hormone analogs alone or in combination with nerve growth factors or other
neurogenesis factors with or without anti-oxidant or anti-inflammatory agents. These
findings, as well as those disclosed in the examples below, indicate that oral and parenteral
administration are viable means for administering TGF-P superfamily proteins, including
the polymeric thyroid analog alone or in combination with nerve growth factor or other
neurogenesis factors, to an individual. In addition, while the mature forms of certain
polymeric thyroid analog alone or in combination with nerve growth factor or other
neurogenesis factors described herein typically are sparingly soluble, the polymeric thyroid
analog alone or in combination with nerve growth factor or other neurogenesis factors form
found in milk (and mammary gland extract and colostrum) is readily soluble, probably by
association of the mature, morphogenically-active form with part or all of the pro domain of
the expressed, full length polypeptide sequence and/or by association with one or more milk
components. Accordingly, the compounds provided herein may also be associated with
molecules capable of enhancing their solubility in vitro or in vivo.
Where the polymeric thyroid hormone analogs alone or in combination with nerve
growth factors or other neurogenesis factors is intended for use as a therapeutic for
disorders of the CNS, an additional problem must be addressed: overcoming the blood-brain
barrier, the brain capillary wall structure that effectively screens out all but selected
categories of substances present in the blood, preventing their passage into the brain. The
blood-brain barrier can be bypassed effectively by direct infusion of the polymeric thyroid
hormone analogs into the brain, or by intranasal administration or inhalation of formulations
suitable for uptake and retrograde transport by olfactory neurons. Alternatively, the
polymeric thyroid hormone analogs can be modified to enhance its transport across the
blood-brain barrier. For example, truncated forms of the polymeric thyroid hormone analogs
alone or in combination with nerve growth factors or other neurogenesis factors or a
polymeric thyroid hormone analog alone or in combination with nerve growth factor or
other neurogenesis factors-stimulating agent may be most successful. Alternatively, the
polymeric thyroid hormone analogs alone or in combination with nerve growth factors or
other neurogenesis factors, inducers or agonists provided herein can be derivatized or
conjugated to a lipophilic moiety or to a substance that is actively transported across the
blood-brain barrier, using standard means known to those skilled in the art. See, for
example, Pardridge, Endocrine Reviews 7: 314-330 (1986) and U.S. Pat. No. 4,801,575.
The compounds provided herein may also be associated with molecules capable of
targeting the polymeric thyroid hormone analogs alone or in combination with nerve
growth factors or other neurogenesis factors, inducer or agonist to the desired tissue. For
example, an antibody, antibody fragment, or other binding protein that interacts specifically
with a surface molecule on cells of the desired tissue, may be used. Useful targeting
molecules may be designed, for example, using the single chain binding site technology
disclosed in U.S. Pat. No. 5,091,513. Targeting molecules can be covalently or noncovalently
associated with the polymeric thyroid hormone analogs alone or in combination
with nerve growth factors or other neurogenesis factors, inducer or agonist.
As will be appreciated by one of ordinary skill in the art, the formulated
compositions contain therapeutically-effective amounts of the polymeric thyroid hormone
analogs alone or in combination with nerve growth factors or other neurogenesis factors,
inducers or agonists thereof. That is, they contain an amount which provides appropriate
concentrations of the agent to the affected nervous system tissue for a time sufficient to
stimulate a detectable restoration of impaired central or peripheral nervous system function,
up to and including a complete restoration thereof. As will be appreciated by those skilled in
the art, these concentrations will vary depending upon a number of factors, including the
biological efficacy of the selected agent, the chemical characteristics (e.g., hydrophobicity)
of the specific agent, the formulation thereof, including a mixture with one or more
excipients, the administration route, and the treatment envisioned, including whether the
active ingredient will be administered directly into a tissue site, or whether it will be
administered systernically. The preferred dosage to be administered is also likely to depend
on variables such as the condition of the diseased or damaged tissues, and the overall health
status of the particular mammal. As a general matter, single, daily, biweekly or weekly
dosages of 0.00001-1000 mg of a polymeric thyroid analog alone or in combination with
nerve growth factor or other neurogenesis factors are sufficient in the presence of antioxidant
and / or anti-iriflaminatory agents, with 0.0001-100 mg being preferable, and 0.001
to 10 mg being even more preferable. Alternatively, a single, daily, biweekly or weekly
dosage of 0.01-1000 .nm.g/kg body weight, more preferably 0.01-10 mg/kg body weight,
may be advantageously employed. The present effective dose can be administered in a
single dose or in a plurality (two or more) of installment doses, as desired or considered
appropriate under the specific circumstances. A bolus injection or diffusable infusion
formulation can be used. If desired to facilitate repeated or frequent infusions, implantation
of a semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intracapsular)
maybe advisable.
The polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other neurogenesis factors, inducers or agonists of the invention may, of course,
be administered alone or in combination with other molecules known to be beneficial in the
treatment of the conditions described herein. For example, various well-known growth
factors, hormones, enzymes, therapeutic compositions, antibiotics, or other bioactive agents
can also be administered with the polymeric thyroid hormone analogs alone or in
combination with nerve growth factors or other neurogenesis factors. Thus, various known
growth factors such as NGF, EOF, PDGF, IGF, FGF, TGF-ce, and TGF-p, as well as
enzymes, enzyme inhibitors, antioxidants, anti-inflammatory agents, free radical scavenging
agents, antibiotics and/or ehemoattractant/chemotactic factors, can be included in the
present polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other neurogenesis factors formulation.
Materials & Methods
Reagents: All reagents were chemical grade and purchased from Sigma Chemical
Co. (St. Louis, MO) or through VWR Scientific (Bridgeport, NT). Cortisone acetate, bovine
serum albumin (BSA) and gelatin solution (2% type B from bovine skin) were purchased
from Sigma Chemical Co. Fertilized chicken eggs were purchased from Charles River
Laboratories, SPAFAS Avian Products & Services (North Franklin, CT). T4 , 3,5,3'-
triiodo-L-thyronine (T3), tetraiodothyroacetic acid (tetrac), T4 -agarose, 6-N-propyl-2-
thiouracil (PTU), RGD-contaming peptides, and RGB-containing peptides were obtained
from Sigma; PD 98059 from Calbiochem; and CGP41251 was a gift fromNovartis Pharma
(Basel, Switzerland). Polyclonal anti-FGF2 and monoclonal anti- p-actin were obtained
from Santa Crux Biotechnology and human recombinant FGF2 and VEGF from Invitrogen.
Polyclonal antibody to phosphorylated ERK1/2 was from New England Biolabs and goat
anti-rabbit IgG from DAKO. Monoclonal antibodies to ocVpS (SC73 12) and a-tubulin
(E9) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Normal mouse IgG
and HRP-conjugated goat anti-rabbit Ig were purchased from Dako Cytomation
(Carpinteria, CA). Monoclonal antibodies to aV|33 (LM609) and aVp5 (P1F6), as well as
purified aV(33, were purciiased from Chemicon (Temecula, CA). L-[125I]-l>4(specific
activity, 1250 p.( 'i/ug) was obtained from Perkin Elmer Life Sciences (Boston, MA),
Chorioallantoic membrane (CAM) Model of Angiogenesis: In vivo
iSfeovascularization was examined by methods described previously. 9-12 Ten-day-old
chick embryos were purchased from SPAFAS (Preston, CT) and incubated at 37°C with
55% relative humidity. A hypodermic needle was used to make a small hole in the shell
concealing the air sac, and a second hole was made on the broad side of the egg, directly
over an avascular portion of the embryonic membrane that was identified by candling. A
false air sac was created beneath the second hole by the application of negative pressure at
the first hole, causing the CAM to separate from the shell. A window approximately 1.0 cm
2 was cut in the shell over the dropped CAM with a small-crafts grinding wheel (Dremel,
division of Emerson Electric Co.), allowing direct access to the underlying CAM. FGF2
(1/ig/mL) was used as a standard proangiogenic agent to induce new blood vessel branches
on the CAM of 10-day-old embryos. Sterile disks of No. 1 filter paper (Whatman
International) were pretreated with 3 mg/mL cortisone acetate and 1 mmol/L PTU and air
dried under sterile conditions. Thyroid hormone, hormone analogues, FGF2 or control
solvents, and inhibitors were then applied to the disks and the disks allowed to dry. The
disks were then suspended in PBS and placed on growing CAMs. Filters treated with T4 or
FGF2 were placed on the first day of the 3-day incubation, with antibody to FGF2 added
minutes later to selected samples as indicated. At 24 hours, the MAPK cascade inhibitor PD
98059 was also added to CAMs topically by means of the filter disks.
Microscopic Analysis of CAM Sections: After incubation at 37°C with 55%
relative humidity for 3 days, the CAM tissue directly beneath each filter disk was resected
from control and treated CAM samples. Tissues were washed 3X with PBS, placed in 35-
mm Petri dishes (Nalge Nunc), and examined under an SV6 stereomicroscope (Zeiss) at
X50 magnification. Digital images of CAM sections exposed to filters were collected using
a 3-charge-coupled device color video camera system (Toshiba) and analyzed with Image-
Pro software (Media Cybernetics), The number of vessel branch points contained in a
circular region equal to the area of each filter disk were counted. One image was counted in
each CAM preparation, and findings from 8 to 10 CAM preparations were analyzed for
each treatment condition (thyroid hormone or analogues, FGF2, FGF2 antibody, PD
98059). In addition, each experiment was performed 3 times. The resulting angiogenesis
index is the mean ±SEM of new branch points in each set of samples.
FGF2 Assays: ECV304 endothelial cells were cultured in Ml99 medium supple
merited with 10% fetal bovine serum. ECV304 cells (106 cells) were plated on 0.2% gelcoated
24-well plates in complete medium overnight, and the cells were then washed with
serum-free medium and treated with T4 or T3 as indicated. After 72 hours, the supernatants
were harvested and assays for FGF performed without dilution using a commercial ELISA
system (R&D Systems).
MAPK Activation: ECV304 endothelial cells were cultured in Ml99 medium with
0.25% hormone-depleted serum 13 for 2 days. Cells were men treated with T4 (10~7 mol/L)
for 15 minutes to 6 hours. In additional experiments, cells were treated with T4 or FGF2 or
with T4 in the presence of PD 98059 or CGP41251. Nuclear fractions were pre-pared from
all samples by our method reported previously, the proteins separated by polyacrylamide gel
electrophoresis, and transferred to membranes for immunoblotting with antibody to
phosphorylated ERK 1/2. The appearance of nuclear phosphorylated ERK1/2 signifies
activation of these MAPK isoforms by T4 .
Reverse Transcription-Polymerase Chain Reaction: Confluent ECV304 cells in
10-cm plates were treated with T4 (10~7 mol/L) for 6 to 48 hours and total RNA extracted
using guanidinium isothiocyanate (Biotecx Laboratories). RNA (1 ug) was subjected to
reverse transcription-polymerase chain reaction (RT-PCR) using the Access RT-PCR
system (Promega). Total RNA was reverse transcribed into cDNA at 48°C for 45 minutes,
then denatured at 94°C for 2 minutes. Second-strand synthesis and PCR amplification were
performed for 40 cycles with denaturation at 94°C for 30 s, annealing at 60°C for 60 s, and
extension at 68°C for 120 s, with final ex-tension for 7 minutes at 68°C after completion of
all cycles. PCR primers for FGF2 were as follows: FGF2 sense strand 5'-
TGGTATGTGGCACTGAAACG-3' (SEQ ID NO:1), antisense strand 5'
CTCAATGACCTGGCGAAGAC-3' (SEQ ID NO:2); the length of the PCR product was
734 bp. Primers for GAPDH included the sense strand 5'-
AAGGTCATCCCTGAGCTGAACG-3' (SEQ ID NO:3), and antisense strand 5'-
GGGTGTCGCTGTTGAAGTCAGA-3' (SEQ ID NO:4); the length of the PCR product
was 218 bp. The products of RT-PCR were separated by electrophoresis on 1.5% agarose
gels and visualized with ethidium bromide. The target bands of the gel were quantified
using Lablmage software (Kapelan), and the value for [FGF2/GAPDHJX10 calculated for
each rime point.
Statistical Analysis: Statistical analysis was performed by 1-way analysis of
variance (ANOV A) comparing experimental with respective control group and statistical
significance was calculated based on P In vivo angiogenesis in Matrigel FGFi or Cancer cell lines implant in mice: In
Vivo Murine Angiogenesis Model: The murine matrigel model will be conducted
according to previously described methods (Grant et al., 1991; Okada et al., 1995) and as
implemented in our laboratory (Powel et al., 2000). Briefly, growth factor free matrigel
(Becton Dickinson, Bedford MA) will be thawed overnight at 4°C and placed on ice.
Aliquots of matrigel will be placed into cold polypropylene tubes and FGF2, thyroid
hormone analogs or cancer cells (1 x 106 cells) will be added to the matrigel. Matrigel with
Saline, FGF2, thyroid hormone analogs or cancer cells will be subcutaneously injected into
the ventral midline of the mice. At day 14, the mice will be sacrificed and the solidified
gels will be resected and analyzed for presence of new vessels. Compounds A-D will be
injected subcutaneously at different doses. Control and experimental gel implants will be
placed in a micro centrifuge tube containing 0.5 ml of cell lysis solution (Sigma, St. Louis,
20 MO) and crushed with a pestle. Subsequently, the tubes will be allowed to incubate
overnight at 4°C and centrifuged at 1,500 x g for 15 minutes on the following day. A 200
(j.1 aliquot of cell lysate will be added to 1.3 ml of Drabkin's reagent solution (Sigma, St.
Louis, MO) for each sample. The solution will be analyzed on a spectrophotometer at a 540
nm. The absorption of light is proportional to the amount of hemoglobin contained in the
sample.
Tumor growth and metastasis - Chick Chorioallantoic Membrane (CAM) model
of tumor implant: The protocol is as previously described (Kim et al., 2001). Briefly, 1 x
107 tumor cells will be placed on the surface of each CAM (7 day old embryo) and
incubated for one week. The resulting tumors will be excised and cut into 50 mg fragments.
These fragments will be placed on additional 10 CAMs per group and treated topically the
following day with 25 ul of compounds (A-D) dissolved in PBS. Seven days later, tumors
will then be excised from the egg and tumor weights will be determined for each CAM.
Figure 8 is a diagrammatic sketch showing the steps involved in the in vivo tumor growth
model in the CAM.
The effects of TETRAC, TRIAC, and thyroid hormone antagonists on tumor growth
rate, tumor angiogeriesis, and tumor metastasis of cancer cell lines can be determined.
Tumor growth aud metastasis -Tumor Xenograft model in mice: The model is as
described in our publications by Kerr et al., 2000; Van Waes et al., 2000; Ali et al., 2001;
and Ali et al., 2001, each of which is incorporated herein by reference in its entirety). The
anti-cancer efficacy for TETRAC, TRIAC, and other thyroid hormone antagonists at
different doses and against different tumor types can be determined and compared.
Tumor growth and metastasis -Experimental Model of Metastasis: The model is
as described in our recent publications (Mousa, 2002; Amirkhosravi et al., 2003a and
2003b, each of which is incorporated by reference herein in its entirety). Briefly, B16
murine malignant melanoma cells (ATCC, Rockville, MD) and other cancer lines will be
cultured in RPMI1640 (Invitrogen, Carlsbad, CA), supplemented with 10% fetal bovine
serum, penicillin and streptomycin (Sigma, St. Louis, MO). Cells will be cultured to 70%
confluency and harvested with trypsin-EDTA (Sigma) and washed twice with phosphate
buffered saline (PBS). Cells will be re-suspended in PBS at a concentration of either 2.0 x
105 cells/ml for experimental metastasis. Animals: C57/BL6 mice (Harlan, Indianapolis,
Indiana) weighing 18-21 grams will be used for this study. All procedures are in
accordance with IACUC and institutional guidelines. The anti-cancer efficacy for
TETRAC, TRIAC, and other thyroid hormone antagonists at different doses and against
different tumor types can be determined and compared.
Effect of" thyroid hormone analogues on angiogenesis.
T4 induced significant increase in angiogenesis index (fold increase above basal) in
the CAM model. T3 at 0.001-1.0 iiM or T4 at 0.1-1.0 pM achieved maximal effect in
producing 2-2.5 fold increase in angiogenesis index as compared to 2-3 fold increase in
angiogenesis index by 1 ixg of FGF2 (Table 1 and Figure la and Ib). The effect of T4 in
promoting angiogenesis (2-2.5 fold increase in angiogenesis index) was achieved in the
presence or absence of PTU, which inhibit T4 to T3 conversion. T3 itself at 91-100 nM)-
induced potent pro-angiogenic effect in the CAM model. T4 agarose produced similar pro-
angiogenesis effect to that achieved by T4 The pro-angiogenic effect of either T4 or T4-
agarose was 100% blocked by TETRAC or TRIAC.
Enhancement of pro-angiogenic activity of FGF2 by sub-maximal concentrations
of T4.
The combination of T4 and FGF2 at sub-maximal concentrations resulted in an
additive increase in the angiogenesis index up to the same level like the maximal proangiogenesis
effect of either FGF2 or T4 (Figure 2).
Effects of MAPK cascade inhibitors on the pro-angiogenic actions of T4 and
FGf2 n the CAM model. The pro-angiogenesis effect of either T4 or FGF2 was totally
blocked by PD 98059 at 0.8 - 8 p.g (Figure 3).
Effects of specific integrin otvps antagonists on the pro-angiogenic actions of T4
and FGf2 n the CAM model. The pro-angiogenesis effect of either T4 or FGF2 was
totally blocked by the specific monoclonal antibody LM609 at 10 μg (Figure 4a and 4b).
The CAM assay has been used to validate angiogenic activity of a variety of growth
factors and other promoters or inhibitors of angiogenesis. In the present studies, T4 in
physiological concentrations was shown to be pro-angiogenic, with comparable activity to
that of FGF2. The presence of PTU did not reduce the effect of T4, indicating that deiodination
of T4 to generate Ta was not a prerequisite in this model. Because the appearance
of new blood vessel growth in this model requires several days, we assumed that the effect
of thyroid hormone was totally dependent upon the interaction of the nuclear receptor for
thyroid honnone (TR). Actions of iodothyronines that require intranuclear complexing of TR
with its natural ligand, Ta, are by definition, genomic, and culminate in gene expression.
On the other hand, the preferential response of this model system to T.4—rather than T3, the
natural ligand of TR raised the possibility that angiogenesis might be initiated nongnomic
ally at the plasma membrane by T.4 and culminate in effects that require gene
transcription. Non-genomic actions of 14 have been widely described, are usually initiated
at the plasma membrane and may be mediated by signal transduction pathways. They do
not require intranuclear ligand binding of iodothyronine and TR, but may interface with or
modulate gene transcription. Non-genomic actions of steroids have also been well-described
and are known to interface with genomic actions of steroids or of other compounds.
Experiments carried out with T4 and tetrac or with agarose-T4 indicated that the proangiogenic
effect of T^ indeed very likely was initiated at the plasma membrane. We have
shown elsewhere that tetrac blocks membrane-initiated effects of T4, but does not, itself,
activate signal transduction . Thus, it is a probe for non-genomic actions of thyroid
hormone. Agarose-T4 is thought not to gain entry to the cell interior and has been used by
us and others to examine models for possible cell surface-initiated actions of the hormone.
These results suggest that another consequence of activation of MAPKby thyroid
hormone is new blood vessel growth. The latter is initiated nongenomically, but of course
requires a consequent complex gene transcription program.
The ambient concentrations of thyroid hormone are relatively stable. The CAM
model, at the time we tested it, was thyroprival and thus may be regarded as a system,
which does not reproduce the intact organism. We propose that circulating levels of T4
serve, with a variety of other regulators, to modulate the sensitivity of vessels to
endogenous angiogenic factors, such as VEGF and FGF2.
Three-Dimensional Angiogenesis Assay
In Vitro Three-Dimensional Sprout Angiogenesis of Human Dermal Micro-Vascular
Endothelial Cells (HDMEC) Cultured on Micro-Carrier Beads Coated with Fibrin:
Confluent HDMEC (passages 5-10) were mixed with gelatin-coated Cytodex-3 beads with
a ratio of 40 cells per bead. Cells and beads (150-200 beads per well for 24-well plate) were
suspended with 5 ml EBM + 15% normal human serum, mixed gently every hour for first 4
hours, then left to culture in a CO2 incubator overnight. The next day, 10 ml of fresh EBM +
5% HS were added, and the mixture was cultured for another 3 hours. Before experiments,
the culture of EC-beads was checked; then 500 ul of PBS was added to a well of 24-well
plate, and 100 ul of the EC-bead culture solution was added to the PBS. The number of
beads was counted, and the concentration of EC/beads was calculated.
A fibrinogen solution (1 mg/ml) in EBM medium with or without angiogenesis
factors or testing factors was prepared. For positive control, 50 ng/ml VEGF + 25 ng/ml
FGF2 was used. EC -beads were washed with EBM medium twice, and EC-beads were
added to fibrinogen solution. The experiment was done in triplicate for each condition. The
EC-beads were mixed gently in fibrinogen solution, and 2.5 ul human thrombin (0.05 U/ul)
was added in 1 ml fibrinogen solution; 300 ul was immediately transfered to each well of a
24-well plate. The fibrinogen solution polymerizes in 5-10 minutes; after 20 minutes, we
added EBM + 20% normal human serum + 10 ug/ml aprotinin. The plate was incubated in a
CC>2 incubator. It takes about 24-48 hours for HDMEC to invade fibrin gel and form tubes.
A micro-carrier in vitro angiogenesis assay previously designed to investigate
bovine pulmonary artery endothelial cell augiogenic behavior in bovine fibrin gels [Nehls
and Drenckhahn, 1995a, b] was modified for the study of human microvascular endothelial
cell angiogenesis in three-dimensional ECM environments (Figures 1 and 2). Briefly,
human fibrinogen, isolated as previously described [Feng et al, 1999], was dissolved in
Ml99 medium at a concentration of 1 mg/ml (pH 7.4) and sterilized by filtering through a
0.22 micron filter. An isotonic 1.5 mg/ml collagen solution was prepared by mixing sterile
Vitrogen 100 in 5X Ml 99 medium and distilled water. The pH was adjusted to 7.4 by IN
NaOH. In certain experiments, growth factors and ECM proteins (such as VEGF, bFGF,
PDGF-BB, serum, gelatin, and fibronectin) were added to the fibrinogen or collagen
solutions. About 500 EC-beads were then added to the 1 mg/ml fibrinogen or 1.5 mg/ml
collagen solutions. Subsequently, EC-beads-collagen or EC-beads—fibrinogen suspension
(500 EC-beads/ml) was plated onto 24-well plates at 300 ul/well. EC-bead-collagen
cultures were incubated at 37°C to form gel. The gelling of EC-bead-fibrin cultures
occurred in less than 5 minutes at room temperature after the addition of thrombin to a final
concentration of 0.5 U/ml. After gelation, 1 ml of fresh assay medium (EBM supplemented
with 20% normal human serum for HDMEC or EBM supplemented with 10% fetal bovine
serum was added to each well. The angiogenic response was monitored visually and
recorded by video image capture. Specifically, capillary sprout formation was observed and
recorded with a Nikon Diaphot-TMD inverted microscope (Nikon Inc.; Melville, NY),
equipped with an incubator housing with a Nikon NP-2 thermostat and Sheldon #2004
carbon dioxide flow mixer. The microscope was directly interfaced to a video system
consisting of a Dage-MTI CCD-72S video camera and Sony 12" PVM-122 video monitor
linked to a Macintosh G3 computer. The images were captured at various magnifications
using Adobe Photoshop, The effect of angiogenic factors on sprout angiogenesis was
quantified visually by determining the number and percent of EC-beads with capillary
sprouts. One hundred beads (five to six random low power fields) in each of triplicate wells
were counted for each experimental condition. All experiments were repeated at least three
times.
Cell culture.
The African green monkey fibroblast cell line, CV-1 (ATCC, Manassas, VA), which
lacks the nuclear receptor for thyroid hormone, was plated at 5000 cells/cm2 and maintained
in DMEM, supplemented with 10% (v/v) heat-inactivated FBS, 100 U/ml penicillin, 100
(j.g/ml streptomycin, and 2mM L-glutamine. All culture reagents were purchased from
Invitrogen Corporation (Carlsbad, CA). Cultures were maintained in a 37°C humidified
chamber with 5% CC>2. The medium was changed every three days and the cell lines were
passaged at 80% confluency. For experimental treatment, cells were plated in 10-cm cell
culture dishes (Corning Incorporated, Corning, NY) and allowed to grow for 24 h in 10%
FBS-containing medium. The cells were then rinsed twice with phosphate buffered saline
(PBS) and fed with serum-free DMEM supplemented with penicillin, streptomycin, and
HEPES. After 48 h incubation in serum-free media, the cells were treated with a vehicle
control (final concentration of 0.004 N KOH with 0.4% polyethyleneglycol [v/v]) or T4
(10~7 M final concentration) for 30 min; media were then collected and free T4 levels were
determined by enzyme immunoassays. Cultures incubated with 10"7 M total T4 have 10"9 to
10"10 M free T4. Following treatment, the cells were harvested and the nuclear proteins
prepared as previously described.
Transient transfections with siRNA.
CV-1 cells were plated in 10-cm dishes (150,000 cells/dish) and incubated for 24 h
in DMEM supplemented with 10% FBS. The cells were rinsed in OPTI-MEM (Airibion,
Austin, TX) and transfected with siRNA (100 nM final concentration) to aV, P3, or aV and
P3 together using siPORT (Ambion) according to manufacturer's directions. Additional sets
of CV-1 cells were transfected with a scrambled siRNA, to serve as a negative control. Four
hours post-transfection, 7 ml of 10% FBS-containing media was added to the dishes and the
cultures were allowed to incubate overnight. The cells were then rinsed with PBS and
placed in serum-free DMEM for 48 h before treatment with T4.
RNA isolation and RT-PCR.
Total RNA was extracted from cell cultures 72 h post- transfection using the RNeasy
kit from Qiagen (Valencia, CA) as per manufacturer's instructions. Two hundred nanograms
of total RNA was reverse-transcribed using the Access RT-PCR system (Promega,
Madison, WI) according to manufacturer's directions. Primers were based on published
species-specific sequences: aV (accession number NM-002210) F-5'-
TGGGATTGTGGAAGGAG and R-5'- AAATCCCTGTCCATCAGCAT (319 bp product),
(33 (NM000212) F-S'-GTGTGAGTGCTCAGAGGAG andR-51-
CTGACTCAATCTCGTCACGG (5 15 bp product), and GAPDH (AF261085) F-5'-
GTCAGTGGTGGACCTGACCT and R-5'- TGAGCTTGACMGTGGTCG (212 bp
product), RT-PCR was performed in the Flexigene thermal cycler com TECHNE
(Burlington, NJ). After a 2 min incubation at 95"C, 25 cycles of the following steps were
performed: denaturation at 94'C for 1 min, annealing at 57'C for 1 min, and extension for 1
min at 68°C for 25 cycles. The PCR products were visualized on a 1.8% (wlv) agarose gel
stained with ethidium bromide.
Western blotting.
Aliquois of nuclear proteins (10 jag/lane) were mixed with Laemmli sample buffer
and separated by SDS-PAGE (10% resolving gel) and then transferred to nitrocellulose
membranes. After blocking with 5% non-fat milk in Tris-buffered saline containing 1%
Tween-20 (TBST) for 30 min, the membranes were incubated with a 1:1000 dilution of a
monoclonal antibody to phosphorylated p44/42 MAP kinase (Cell Signaling Technology,
Beverly, MA) in TBST with 5% milk overnight at 4°C. Following 3xlO-min washes in
TBST, the membranes were incubated with HRP-conjugated goat anti-rabbit Ig (1:1000
dilution) ftom DakoCytomation (Carpmteria, CA) in TBST with 5% milk for 1 h at room
temperature- The membranes were washed 3x5 min in TBST and immunoreactive proteins
were detected by chemiluminescence (ECL, Amersham). Band intensity was determined
using the VersaDoc 5000 Imaging system (Bio-Rad, Hercules, CA),
Radioligand binding assay.
Two p,g of purified aVp3 was mixed with indicated concentrations of test
compounds and allowed to incubate for 30 min at room temperature. [125I]-T4
(2 μCi) was then added and the mixture was allowed to incubate an additional 30 min at
20°C. The samples were mixed with sample buffer (50% glycerol, 0.1M Tris-HCl, pH 6.8,
and bromophenol blue) and runout on a 5% basic-native gel for 24 h at 45 mA in the cold.
The apparatus was disassembled and the gels were placed on filter paper, wrapped in plastic
wrap, and exposed to film. Band intensity was determined using the VersaDoc 5000
Imaging system.
Chick chorioallantoic membrane (CAM) assay (aVp3 studies).
Ten-day-old chick embryos were purchased £tom SPAFAS (Preston, CT) and were
incubated at 37°C with 55% relative humidity. A hypodermic needle was used to make a
small hole in the blunt end of the egg and a second hole was made on the broad side of the
egg, directly over an avascular portion of the embryonic membrane. Mild suction was
applied to the first hole to displace the air sac and drop the CAM away from the shell. Using
a Dremel model craft drill (Dremel, Racine, WI), a approx. 1.0 cm2 window was cut in the
shell over the false air sac, allowing access to the CAM. Sterile disks of No.l filter paper
(Whatman, Clifton, NJ) were pretreated with 3 mg/ml cortisone acetate and
ImMmpropylthiouracil and air dried under sterile conditions. Thyroid hormone, control
solvents, and the mAb LM609 were applied to the disks and subsequently dried. The disks
were then suspended in PBS and placed on growing CAMS. After incubation for 3 days, the
CAM beneath the filter disk was resected and rinsed with PBS. Each membrane was placed
in a 35 mm Petri dish and examined under an SV6 stereo-microscope at SOX magnification.
Digital images were captured and analyzed with Image-Pro software (Mediacybemetics).
The number of vessel branch points contained in a circular region equal to the filter disk
were counted. One image from each of 8-10 CAM preparations for each treatment condition
was counted, and in addition each experiment was performed 3 times.
The invention will be further illustrated in the following non-limiting examples.
Example 1. Effect of Thyroid Hormone on Angiogenesis: As seen in Figure 1A
and summarized in Figure IB, both L-T4 and L-T3 enhanced angiogenesis in the CAM
assay. T4, at a physiologic total concentration in the medium of 0.1 umol/L, increased blood
vessel branch formation by 2.5-fold (P 2-fold. The possibility that T4 was only effective because of conversion of T4 to T3 by
cellular 5'-monodeiodinase was ruled out by the finding that the deiodinase inhibitor PTU
had no inhibitory effect on angiogenesis produced by T4. PTU was applied to all filter
disks used in the CAM model. Thus, T4 and T3 promote new blood vessel branch formation
in a CAM model that has been standardized previously for the assay of growth factors.
Example 2. Effects of T4-Agarose and Tetrac: We have shown previously that
T4-agarose stimulates cellular signal transduction pathways initiated at the plasma
membrane in the same manner as T4 and that the actions of T4 and T4-agarose are blocked
by a deaminated iodothyronine analogue, tetrac, which is known to inhibit binding of T4 to
plasma membranes. In the CAM model, the addition of tetrac (0.1 umol/L) inhibited the
action of T4 (Figure 2A), but tetrac alone had no effect on angiogenesis (Figure 2C). The
action of T4-agarose, added at a hormone concentration of O.I umol/L, was comparable to
that of T4 in the CAM model (Figure 2B), and the effect of T4-agarose was also inhibited
by the action of tetrac (Figure 2B; summarized in 2C).
Example 3. Enhancement of Proangiogenic Activity of FGF2 by a Submaximal
Concentration of T4: Angiogenesis is a complex process that usually requires the
participation of polypeptide growth factors. The CAM assay requires at least 48 hours for
vessel growth to be manifest; thus, the apparent plasma membrane effects of thyroid
hormone in this model are likely to result in a complex transcriptional response to the
hormone. Therefore, we determined whether FGF2 was involved in the hormone response
and whether the hormone might potentiate the effect of subphysiologic levels of this growth
factor. T4 (0.05 umol/L) and FGF2 (0.5 ug/mL) individually stimulated angiogenesis to a
modest degree (Figure 3). The angiogenic effect of this submaximal concentration of FGF2
was enhanced by a subphysiologic concentration of T4 to the level caused by 1.0 ug FGF2
alone. Thus, the effects of submaximal hormone and growth factor concentrations appear to
be additive. To define more precisely the role of FGF2 in thyroid hormone stimulation of
angiogenesis, a polyclonal antibody to FGF2 was added to the filters treated with either
FGF2 or T4, and angiogenesis was measured after 72 hours. Figure 4 demonstrates that the
FGF2 antibody inhibited angiogenesis stimulated either by FGF2 or by T4 in the absence of
exogenous FGF2, suggesting that the T4 effect in the CAM assay was mediated by
increased FGF2 expression. Control IgG antibody has no stimulatory or inhibitory effect in
the CAM assay.
Example 4. Stimulation of FGF2 Release From Endothelial Cells by Thyroid
Hormone: Levels of FGF2 were measured in the media of ECV304 endothelial cells
treated with either T4 (0.1 umol/L) or T3 (0.01 umol/L) for 3 days. As seen in the Table 2,
T3 stimulated FGF2 concentration in the medium 3.6-fold, whereas T4 caused a 1.4-fold
increase. This finding indicates that thyroid hormone may enhance the angiogenic effect of
FGF2, at least in part, by increasing the concentration of growth factor available to
endothelial cells.
(Table Removed)
*P tP Example 5. Role of the ERK1/2 Signal Transduction Pathway in Stimulation of
Angiogenesis by Thyroid Hormone and FGF2: A pathway by which T4 exerts a
nongenomic effect on cells is the MAPK signal transduction cascade, specifically that of
ERK1/2 activation. We know that T4 enhances ERK1/2 activation by epidermal growth
factor. The role of the MAPK pathway in stimulation by thyroid hormone of FGF2
expression was examined by the use of PD 98059 (2 to 20 umol/L), an inhibitor of ERK1/2
activation by the tyrosine-threonine kinases MAPK kinase-1 (MEK1) and MEK2. The data
in the Table demonstrate that PD 98059 effectively blocked the increase in FGF2 release
from ECV304 endotbelial cells treated with either T4 or T3. Parallel studies of ERKl/2
inhibition were performed in CAM assays, and representative results are shown in Figure 5.
A combination of T3 and T4, each in physiologic concentrations, caused a 2.4-fold increase
in blood vessel branching, an effect that was completely blocked by 3 umol/L PD 98059
(Figure 5A), FGF2 stimulation of branch formation (2.2-fold) was also effectively blocked
by this inhibitor of ERKl/2 activation (Figure 5B). Thus, the proangiogenic effect of
thyroid hormone begins at the plasma membrane and involves activation of the ERKl/2
pathway to promote FGF2 release from endothelial cells. ERKl/2 activation is again
required to transduce the FGF2 signal and cause new blood vessel formation.
Example 6. Action of Thyroid Hormone and FGF2 on MAPK Activation
Stimulation of phosphorylation and nuclear translocadon of ERKl/2 MAPKs was studied in
ECV304 cells treated with T4 (10~7 mol/L) for 15 minutes to 6 hours. The appearance of
phosphorylated ERKl/2 in cell nuclei occurred within 15 minutes of T4 treatment, reached
a maximal level at 30 minutes, and was still apparent at 6 hours (Figure 6A). This effect of
the hormone was inhibited by PD 98059 (Figure 6B), a result to be expected because this
compound blocks the phosphorylation of ERKl/2 by MAPK kinase. The traditional protein
kinase C (PKC)-a, PKC-p, and PKC-y inhibitor CGP41251 also blocked the effect of the
hormone on MAPK activation in these cells., as we have seen with T4 in other cell lines.
Thyroid hormone enhances the action of several cytokines and growth factors, such as
interferon- y!3 and epidermal growth factor. In ECV304 cells, T4 enhanced the MAPK
activation caused by FGF2 in a 15-minute co incubation (Figure 6C). Applying
observations made in ECV304 cells to the CAM model, we propose that the complex
mechanism by which the hormone induces angiogenesis includes endothelial cell release of
FGF2 and enhancement of the autocrine effect of released FGF2 on angiogenesis.
Example 7. RT-PCR in ECV304 Cells Treated With Thyroid Hormone: The
final question addressed in studies of the mechanism of the proangiogenic action of T4 was
whether the hormone may induce FGF2 gene expression. Endothelial cells were treated
with T4 (10"7 mol/L) for 6 to 48 hours, and RT-PCR-based estimates ofFGF2 and GAPDH
KNA (inferred from cDNA measurements; Figure 7) were performed. Increase in
abundance ofFGF2 cDNA, corrected for GAPDH content, was apparent by 6 hours of
hormone treatment and was further enhanced by 48 hours.
Example 8A. Retinal Neovascularization model in mice (diabetic and nondiabetic):
To assess the pharmacologic activity of a test article on retinal
neovascularization, Infant mice are exposed to a high oxygen environment for 7 days and
allowed to recover, thereby stimulating the formation of new vessels on the retina. Test
articles are evaluated to determine if retinal neovascularization is suppressed. The retinas
are examined with hematoxylin-eosin staining and with at least one stain, which
demonstrates neovascularization (usually a Selectin stain). Other stains (such as PCNA,
PAS, GFAP, markers of angiogenesis, etc.) can be used. A summary of the model is below:
Animal Model
• Infant mice (P7) and their dams are placed in a hyper-oxygenated environment (70-
80%) for 7 days.
• On PI2, the mice are removed from the oxygenated environment and placed into a
normal environment
• Mice are allowed to recover for 5-7 days.
• Mice are then sacrificed and the eyes collected.
• Eyes are either frozen or fixed as appropriate
• The eyes are stained with appropriate histochemical stains
• The eyes are stained with appropriate immunohistochemical stains
• Blood, serum, or other tissues can be collected
• Eyes, with special reference to microvascular alterations, are examined for any and
all findings. Neovascular growth will be semi quantitatively scored. Image analysis
is also available.
Example 8B: Thyroid Hormone and Diabetic Retinopathy
A protocol disclosed in J de la Cruz et al., J Pharmacol Exp Ther 280:454-
459,1997, is used for the administration of Tetrac to rats that have streptozotocin (STZ)-
induced experimental diabetes and diabetic retinopathy. The endpoint is the inhibition by
Tetrac of the appearance of proliferative retinopathy (angiogenesis).
Example 9A. Wound Healing and Hemostatic Treatment Using Novel
Pharmaceutical Polymeric Formulation of Thyroid Hormone and Analogs
The present invention also includes a novel wound healing and hemostatic treatment
that include an immobilized thyroid hormone analog, preferably T4 analogs, calcium
chloride, and collagen. This novel formulation significantly controls both venous and
arterial hemorrhage, reduces bleeding time, generates fibrin/platelet plug, releases plateletderived
wound healing factors in a sustained manner in the presence of low level collagen,
and safe. Development of such a wound healing and hemostatic dressing can be very
valuable for short and long-term use in Combat Casualty Care. Pharmaceutical formulation
of immobilized L-thyroxine (T4) and globular hexasaccharide in a hydrogel or dressing
containing collagen and calcium chloride can be optimized. This novel Wound healing and
Hemostatic (WH formulation) treatment in hydrogel or dressing can also include the
addition of a microbicidal.
L-thyroxine conjugated to polymer or Immobilized on agarose demonstrated potent
stimulation of angiogenesis through activation of an adhesion cell surface receptor (integrin
ocvj33) leading to activation of an intracellular signaling event, which in turn leads to upregulation
of various growth factor productions. Additionaly, immobilized T4 induced
epithelial, fibroblast, and keratinocyte cell migration. Immobilized T4, but not T3 or other
analogs, enhanced collagen-induced platelet aggregation and secretion, which would
promote formation of the subject's own platelet plug. Furthermore, immobilized T4 also
promotes white blood cell migration, which could be critical for fighting infection. Hence,
immobilized T4 can help the body make more of a compound used to regenerate damaged
blood vessels, and it also increased the amount of white blood cells that makes free radicals
in the wound site. Free radicals help clear potentially pathogenic bacteria from a wound.
Thus, 14 or T4-agarose (10-100 nM), but not T3, DIPTA, or GC-1, is effective in
enhancing platelet aggregation and secretion (de-granulation). Accordingly, T4 (or analogs
and polymeric conjugations thereof, e.g., T4-agarose), in combination with 10 mM calcium
chloride, and with or without collagen, is preferred for wound healing. See Figs. 23 A-E.
THROMBOELASTOGRAPHY:
Thromboelastography (TEG) has been used in various hospital settings since its
development by Hartert in 1948. The principle of TEG is based on the measurement of the
physical viscoelastic characteristics of blood clot. Clot formation was monitored at 37°C in
an oscillating plastic cylindrical cuvette ("cup") and a coaxially suspended stationary piston
("pin") with a 1 mm clearance between the surfaces, using a computerized
Thrombelastograph (TEG Model 3000, Haemoscope, Skokie, IL). The cup oscillates in
either direction every 4.5 seconds, with a 1 second mid-cycle stationary period; resulting in
a frequency of 0.1 Hz and a maximal shear rate of 0.1 per second. The pin is suspended by
a torsion wire that acts as a torque transducer. With clot formation, fibrin fibrils physically
link the cup to the pin and the rotation of the cup as affected by the viscoelasticity of the
clot (Transmitted to the pin) is displayed on-line using an IBM-compatible personal
computer and customized software (Haemoscope Corp., Skokie, IL). The torque
experienced by the pin (relative to the cup's oscillation) is plotted as a function of time.
TEG assesses coagulation by measuring various parameters such as the time latency
for the initial initiation of the clot (R), the time to initiation of a fixed clot firmness (k) of
about 20 mm amplitude, the kinetic of clot development as measured by the angle (a), and
the maximum amplitude of the clot (MA). The parameter A measures the width of the
tracing at an)' point of the MA. Amplitude A in mm is a function of clot strength or
elasticity. The amplitude on the TEG tracing is a measure of the rigidity of the clot; the
peak strength or the shear elastic modulus attained by the clot, G, is a function of clot
rigidity and can be calculated from the maximal amplitude (MA) of the TEG tracing.
The following parameters were measured from the TEG tracing:
R, the reaction time (gelation time) represents the latent period before the
establishment of a 3-dimensional fibrin gel network (with measurable rigidity of
about 2 mm amplitude).
Maximum Amplitude (MA, in mm), is the peak rigidity manifested by the clot.
Shear elastic modulus or clot strength (G, dynes/cm2 ) is defined by:
G = (5000A)/(100-A).
Blood clot firmness is an important parameter for in vivo thrombosis and
hemostasis because the clot must stand the shear stress at the site of vascular injury, TEG
can assess the efficacy of different pharmacological interventions on various factors
(coagulation activation, thrombin generation, fibrin formation, platelet activation, plateletfibrin
interaction, and fibrin polymerization) involved in clot formation and retraction. The
effect of endotoxin (0.63 ug), Xa (0.25 nM), thrombin (0.3 mU), and TF (25 ng) on the
different clot parameters measured by computerized TEG in human whole blood is shown
in Table 3.
Blood Sampling: Blood was drawn from consenting volunteers under a protocol
approved by the Human Investigations Committee of William Beaumont Hospital. Using
the two syringe method, samples were drawn through a 21 gauge butterfly needle and the
initial 3 ml blood was discarded. Whole blood (WB) was collected into siliconized
Vacutainer tubes (Becton Dickinson, Rutherford, NJ containing 3.8% trisodium citrate such
that a ratio of citrate whole blood of 1:9 (v/v) was maintained. TEG was performed within
3 hrs of blood collection. Calcium was added back at 1-2.5 mM followed by the addition of
the different stimulus. Calcium chloride by itself at the concentration used showed only a
minimal effect on clot formation and clot strength.
Clot formation is initiated by thrombin-induced cleavage of Fibrinopeptide A from
fibrmogen. The resultant fibrin monomers spontaneously polymerize to form fibril strands
that undergo linear extension, branching, and lateral association leading to the formation of
a three-dimensional network of fibrin fibers. A unique property of network structures is
that they behave as rigid elastic solids, capable of resisting deforming shear stress. This
resistance to deformation can be measured by elastic modulus-an index of clot strength.
Unlike conventional coagulation tests (like the prothrombin time and partial thromboplastin
time) that are based only on the time to the onset of clot formation, TEG allows acquisition
of quantitative information allowing measurement of the maximal strength attained by
clots. Via the GPIIb/TIIa receptor, platelets bind fibrin(ogen) and modulate the viscoelastic
properties of clots. Our results demonstrated that clot strength in TF-TEG is clearly a
function of platelet concentration and platelets augmented clot strength ~8 fold under shear.
Different platelet GPIIb/nia antagonists (class I versus class II) behaved with distinct
efficacy in inhibiting platelet-fibrin mediated clot strength using TF-TEG under shear.
Statistical analysis
Data are expressed as mean ± SEM. Data were analyzed by either paired or group
analysis using the Student t test or ANOVA when applicable; differences were considered
significant at P (Table Removed)
Data represent mean ± SEM, n = 4, * P Platelet aggregation and de-granulation in whole blood using Impedance Technique:
The Model 560 Whole-Blood Aggregometer and the associated Aggro-Link Software from
the Chrono-Log Corporation were used in this study. Two electrodes are placed in diluted
blood and an electrical impulse is sent from one to the other. As the platelets aggregate
around the electrodes, the Chrono-Log measures the impedance of the electrical signal in
ohms of resistance7.
Blood Sampling:
Whole blood was drawn daily from healthy donors between the ages of 17 and 21
into 4.5 milliliter Vacutainer vials with 3.8% buffered sodium citrate (Becton Dickinson,
Rutherford, New Jersey). The blood was kept on a rocker to extend the life of the platelets,
and experiments were done within 5 hours of phlebotomy.
Procedure: For the control, 500 microliters of whole blood, 500 microliters of 0.9% saline,
and a magnetic stir bar were mixed into a cuvette, and heated for five minutes to 37 degrees
Celsius. Sub-threshold aggregation was induced with 5 microliters of 1-2 tig/ml Collagen,
which the Aggregometer measured for 6-7 minutes. The effects of T4, T4-agarose versus
T3 and other thyroid hormone analogs on collagen-induced aggregation and secretion were
tested. Ingerman-Wojenski C, Smith JB, Silver MJ. Evaluation of electrical aggregometry:
comparison with optical aggregometry, secretion of ATP, and accumulation of radiolabeled
platelets. J Lab Clin Med. 1983 Jan;101(l):44-52.
Cell migration assay.
Human granulocytes are isolated from shed blood by the method of Mousa et al. and
cell migration assays carried out as previously described (Methods In Cell Science, 19 (3):
179-187, 1997, and Methods In Cell Science 19 (3): 189-195,1997). Briefly, a neuroprobe
96 well disposable chemotaxis chamber with an 8 ura pore size will be used. This chamber
allow for quantitation of cellular migration towards a gradient of chemokme, cytokine or
extracellular matrix proteins. Cell suspension (45 ul of 2 x 10°) will be added to a
polypropylene plate containing 5 ill of test agents such as flavanoids or thyroid hormone
derivatives and incubated for 10 minutes at 22 °C. IL8 (0.1 -100 ng) with or without T3/ T4
(33 \i\) at 0.001 - 0.1 fiM will be added to the lower wells of a disposable chemotaxis
chamber, then assemble the chamber using the pre-framed filter. Add 25 pi of cell / test
agent suspension to the upper filter wells then incubate overnight (22 hours at 37 °C, 5%
CO2) in a humidified cell culture incubator. After the overnight incubation, non-migrated
cells and excess media will be gently removed using a 12 channel pipette and a cell scraper.
The filters will then washed twice in phosphate buffered saline (PBS) and fixed with 1 %
formaldehyde in PBS buffer. Membranes of migrated cells will be permeated with Triton X-
100 (0.2 %) then washed 2-3 times with PBS. The actin filaments of migrated cells will be
stained with Rhodamine phalloidin (12.8 lU/ml) for 30 minutes (22 °C). Rhodamine
phalloidin will be made fresh weekly and reused for up to 3 days, when stored protected
from light at 4°C. Chemotaxis will be quantitatively determined by fluorescence detection
using a Cytofluor II micro-filter fluorimeter (530 excitation / 590 emission). All cell
treatments and subsequent washings will be carried out using a uniquely designed
treatment/wash station (Methods In Cell Science, 19 (3): 179-187,1997). This technique
will allow for accurate quantitation of cell migration and provide reproducible results with
minimal inter and iiitra assay variability.
Cellular Migration assays:
These assays were performed using a Neuroprobe 96 well disposable chemotaxis
chamber with an 8 urn pore size. This chamber allowed for quantitation of cellular
migration towards a gradient of either vitronectm or osteopontin. Cultured cells were
removed following a standardized method using EDTA / Trypsin (0.01% / 0.025%).
Following removal, the cells were washed twice and resuspended (2x10^ /ml) in EBM
(Endothelial cell basal media, Clonetics Inc.). Add either vitronectin or osteopontin (33 ui)
at 0.0125 -100 jig/ml to the lower wells of a disposable chemotaxis chamber, and then
assemble using the preframed filter. The cell suspension (45 ul) was added to a
polypropylene plate containing 5 ul of test agent at different concentrations and incubated
for 10 minutes at 22 °C. Add 25 ul of cell / test agent suspension to the upper filter wells
then incubate overnight (22 hours at 37 °C) in a humidified cell culture incubator. After the
overnight incubation, non-migrated cells and excess media were gently removed using a 12
channel pipette and a cell scraper. The filters were then washed twice in PBS (no Ca+2 or
Mg+2) and fixed with 1% formaldehyde. Membranes of migrated cells were permeated
with Triton X-l 00 (0.2 %) then washed 2-3 times with PBS. The actin filaments of
migrated cells were stained with rhodamine phalloidin (12.8 lU/ml) for 30 minutes (22 °C).
Rhodamine phalloidin was made fresh weekly and reused for up to 3 days, when stored
protected from light at 4°C. Chemotaxis was quantitatively determined by fluorescence
detection using a Cytofluor II (530 excitation / 590 emission). All cell treatment and
subsequent washings were carried out using a uniquely designed treatment/wash station.
This station consisted of six individual reagent units each with a 30 ml volume capacity.
Individual units were filled with one of the following reagents: PBS, formaldehyde, Triton
X-l00, or rhodamine-phalloidin. Using this technique, filters were gently dipped into the
appropriate solution, thus minimizing migrated cell loss. This technique allowed for
maximum quantitation of cell migration and provided reproducible results with minimal
inter and intra assay variability (1,2).
Migration toward the extracellular Matrix Protein Vitronectin
Treatments Mean EC Migration
(Fluorescence Units) + SD
A. Non-Specific Migration 270 + 20
No Matrix in LC
B. Vitronectin (25 ug) in LC 6,116 ± 185
C. T3 (0.1 uM) UC /
Vitronectin (25 ug) in LC 22,016 + 385
D. T4 (0.1 uM) UC /
Vitronectin (25 ug) in LC 13,083 ± 276
C + XT199 (10 uM) 4,550 + 225
D + XT199 (10 uM) 3,890 + 420
C + PD (0.8 ug) 7,555 + 320
1) + PD (0.8 ug) 6,965 + 390
LC = Lower Chamber, UC = Upper chamber
Similar data were obtained with other potent and specific avb3 antagonists
such as LM609 and SM256
Example 9B. In vitro human epithelial and fibroblast wound healing: The in
vitro 2-dimensional wound healing method is as described in Mohamed S, Nadijcka D,
Hanson, V. Wound healing properties of cimetidine in vitro. Drug Intell Clin Pharm 20:
973-975; 1986, incorporated herein by reference in its entirety. Additionally, a 3-
dimensional wound healing method already established in our Laboratory will be utilized in
this study (see below). Data show potent stimulation of wound healing by thyroid hormone.
In Vitro 3D Wound Healing Assay of Human Dermal Fibroblast Cells:
Step 1: Prepare contracted collagen gels:
1) Coat 24-well plate with 350ul 2%BSA at RT for 2hr,
2) 80% confluent NHDF(normal human dermal fibroblast cells, Passage 5-9) are
trypsinized and neutralized with growth medium, centrifuge and wash once with
PBS
3) Prepare collagen-cell mixture, mix gently and always on ice:
Stock solution Final Concentration
SxDMEC IxDMEM
3mg/ml vitrogen 2mg/ml
ddH2O optimal
NHDF 2x10-5 cells/ml
FBS 1%
4) Aspire 2%BSA from 24 well plate, add collagen-cell mixture 350
ul/well, and incubate the plate in 37° C CO2 incubator.
5) After Ihr, add DMEM+5%FBS medium 0.5ml/well, use a lOul tip
Detach the collagen gel from the edge of each well, then incubate for 2days. The
fibroblast cells will contract the collagen gel
Step 2: Prepare 3D fibrin wound clot and embed wounded collagen culture
1) Prepare fibrinogen solution (Img/ml) with or without testing regents. 350ul
fibrinogen solution for each well in eppendorf tube.
Stockjolution Final Concentration
SxDMEC IxDMEM
Fibrinogen Img/ml
ddH2O optimal
testing regents optimal concentration
FBS I%or5%
2) Cut each contracted collagen gel from middle with scissors. Wash the gel with PBS
and transfer the gel to the center of each well of 24 well plate
3) Add 1.5ul of human thrombin (0.25U/ul) to each tube, mix well and then add the
solution around the collagen gel, the solution will polymerize in 10 mins.
After 20mins, add DMEM+l%(or 5%) FBS with or without testing agent,
450ul/well and incubate the plate in 37° C CO2 incubator for up to 5 days. Take pictures on
each day.
In vivo wound healing in diabetic rats:
Using an acute incision wound model in diabetic rats, the effects of thyroid hormone
analogs and its conjugated fonns are tested. The rate of wound closure, breaking strength
analyses and histology are performed periodically on days 3-21.
Methods:
Animals (Mice and Rats) in the study are given two small puncture wounds - WH is
applied to one of the wounds, and the other was covered with saline solution as a control.
Otherwise, the wounds are left to heal naturally.
The animals are euthanised five days after they are wounded. A small area of skin -
1 to 1.5 millimetres - is excised from the edges of the treated and untreated wounds.
Wound closure and time to wound closure is determined. Additionally, the levels of
tenascin, a protein that helps build connective tissue, in the granulation tissue of the wounds
is determined. The quality of the granulation tissue (i.e. rough., pinkish tissue that normally
forms as a wound heals, new capillaries and connective tissue) is also determined.
Materials and Methods
Chronic granulating wounds are prepared by methods well known in the art. Male
Sprague Dawley rats weighing 300 to 350 grams are acclimatized for a week in our facility
prior to use. Under intraperitoneal Nembutal anesthesia (SSmg/kg), the rat dorsum is shaved
and depilated. Animals are individually caged and given food and water ad libitum. All
experiments were conducted in accordance with the Animal Care and Use Committee
guidelines of the Department of Veterans Affairs Medical Center, Albany, NY.
Histological characterization of this wound with comparison to a human chronic
granulating wound had previously been performed. Sixty four rats are then divided into
eight treatment groups (n=8 / group). Animals are treated with topical application of vehicle
(vehicle controls) on days 5, 9, 12,15, and 18. The vehicle control can be either agarose
(Group 1) or the polymeric form (Group 2) that will be used in conjugation of L-thyroxine.
Wounds treated with T4-agarose (Groups 3-5) or T4-polymer (Groups 6-8) at 1, 10,100
ug/cm2 in the presence of 10 ug globular hexasaccharide, 10 ug collagen, and 10 mM
calcium chloride to be applied topically on days 5, 9,12,15, and 18. All wounds are left
exposed. Every 48 hours the outlines of the wounds can be traced onto acetate sheets, and
area calculations can be performed using computerized digital planimetry.
Three full-thickness, transverse strips of granulation tissue are then harvested from
the cephalad, middle, and caudal ends of the wounds on day 19 and fixed in 10-percent
buffered formalin. Transverse sections (Sum) are taken from each specimen and stained
with hematoxylin and eosin. The thickness of the granulation tissue can be estimated with
an ocular micrometer at low power. High-powered fields are examined immediately below
the superficial inflammatory layer of the granulation tissue. From each strip of granulation
tissue five adjacent high-powered fields can be photographed and coded. Enlarged prints of
these exposures are then used for histometric analysis in a blinded fashion. Fibroblasts,
"round" cells (macrophages, lymphocytes, and neutrophils), and capillaries are counted. In
addition the cellularity of each section is graded for cellularity on a scale of 1 (reduced cell
counts) to 5 (highly cellular).
Statistical analysis:
Serial area measurements were plotted against time. For each animal's data a
Gompertz equation will be fitted (typical r 2=0.85). Using this curve the wound half-life
can be estimated. Comparison between groups is performed using life table analysis and the
Wilcoxon rank test. These statistical analyses are performed using the SAS (SAS/STAT
Guide for Personal Computers, Version 6 Edition, Gary, North Carolina, 1987, p 1028) and
BMDP (BMDP Statistical Software Manual, Los Angeles, BMDP Statistical Software, Inc.
1988) packages on a personal computer.
Cell counts for the different treatment groups are pooled and analyzed using a oneway
analysis of variance. Post-hoc analyses of differences between groups can be carried
out using Tukey's test (all pairwise multiple-comparison test) with/? significant. Sigma Stat statistical software (Jandel Scientific, Corte Madera, California) will
be used for data analysis.
Example 10. Rodent Model of Myocardial Infarction: The coronary artery
ligation model of myocardial infarction is used to investigate cardiac function in rats. The
rat is initially anesthetized with xylazine and ketamine, and after appropriate anesthesia is
obtained, the trachea is intubated and positive pressure ventilation is initiated. The animal
is placed supine with its extremities loosely taped and a median sternotomy is performed.
The heart is gently exteriorized and a 6-O suture is firmly tied around the left anterior
descending coronary artery. The heart is rapidly replaced in the chest and the thoracotomy
incision is closed with a 3-O purse string suture followed by skin closure with interrupted
sutures or surgical clips. Animals are placed on a temperature regulated heating pad and
closely observed during recovery. Supplemental oxygen and cardiopulmonary resuscitation
are administered if necessary. After recovery, the rat is returned to the animal care facility.
Such coronary artery ligation in the rat produces large anterior wall myocardial infarctions.
The 48 hr. mortality for this procedure can be as high as 50%, and there is variability in the
size of the infarct produced by this procedure. Based on these considerations, and prior
experience, to obtain 16-20 rats with large infarcts so that the two models of thyroid
hormone delivery discussed below can be compared, approximately 400 rats are required.
These experiments are designed to show that systemic administration of thyroid
hormone either before or after coronary artery ligation leads to beneficial effects in intact
animals, including the extent of hemodynamic abnormalities assessed by echocardiography
and hemodynamic measurements, and reduction of infarct size. Outcome measurements are
proposed at three weeks post-infarction. Although some rats may have no infarction, or
only a small infarction is produced, these rats can be identified by normal echocardiograms
and normal hemodynamics (LV end-diastolic pressure Thyroid Hormone Delivery
There are two delivery approaches. In the first, thyroid hormone is directly injected
into the peri-infarct myocardium. As the demarcation between normal and ischemic
myocardium is easily identified during the acute open chest occlusion, this approach
provides sufficient delivery of hormone to detect angiogenic effects.
Although the first model is useful in patients undergoing coronary artery bypass
surgery, and constitutes proof of principle that one local injection induces angiogenesis, a
broader approach using a second model can also be used. In the second model, a catheter
retrograde is placed into the left ventricle via a carotid artery in the anesthetized rat prior to
inducing niyocardial infarction. Alternatively, a direct needle puncture of the aorta, just
above the aortic valve, is performed. The intracoronary injection of the thyroid hormone is
then simulated by abruptly occluding the aorta above the origin of the coronary vessels for
several seconds, thereby producing isovolumic contractions. Thyroid hormone is then
injected into the left ventricle or aorta immediately after aortic constriction. The resulting
isovolumic contractions propel blood down the coronary vessels perfusing the entire
myocardium with thyroid hormone. This procedure can be done as many times as necessary
to achieve effectiveness. The number of injections depends on the doses used and the
formation of new blood vessels.
Echocardiographv:
A method for obtaining 2-D and M-mode echocardiograms in unanesthetized rats
has been developed. Left ventricular dimensions, function, wall thickness and wall motion
can be reproducibly and reliably measured. The measurement are carried out in a blinded
fashion to eliminate bias with respect to thyroid hormone administration.
Hemodvnainics:
Hemodynamic measurements are used to determine the degree of left ventricular
impairment. Rats are anesthetized with isoflurane. Through an incision along the right
anterior neck, the right carotid artery and the right jugular vein are isolated and cannulated
with a pressure transducing catheter (Millar, SPR-612, 1.2 Fr). The following
measurements are then made: heart rate, systolic and diastolic BP, mean arterial pressure,
left ventricular systolic and end-diastolic pressure, and + and -dP/dt. Of particular utility
are measurements of left ventricular end-diastolic pressure, progressive elevation of which
correlates with the degree of myocardial damage.
Infarct Size:
Rats are sacrificed for measurement of infarct size using TTC methodology.
Morphometry
Microvessel density [microvessels/mm2] will be measured in the infarct area, periinfarct
area, and in the spared myocardium opposing the infarction, usually the posterior
wall. From each rat, 7-10 microscopic high power fields [x400] with transversely sectioned
myocytes will be digitally recorded using Image Analysis software. Micro vessels will be
counted by a blinded investigator. The microcirculation will be defined as vessels beyond
third order arterioles with a diameter of 150 micrometers or less, supplying tissue between
arterioles and venules. To correct for differences in left ventricular hypertrophy,
microvessel density will be divided by LV weight corrected for body weight. Myocardium
from sham operated rats will serves as controls.
Example 11: Effects of the aVp3 antagonists on the pro-angiogenesis effect of
T4 or FGF2: The aV(33 inhibitor LM609 totally inhibited both FGF2 or T4-induced proangiogenic
effects in the CAM model at 10 micrograms (Figure 16).
Example 12: Inhibition of Cancer-Related New Blood Vessel Growth.
A protocol disclosed in J. Bennett, Proc Natl Acad Sci USA 99:2211-2215, 2002, is
used for the administration of tetraiodothyroacetic (Tetrac) to SCID mice that have received
implants of human breast cancer cells (MCF-7). Tetrac is provided in drinking water to
raise the circulating level of the hormone analog in the mouse model to 10" M. The
endpoint is the inhibitory action of tetrac on angiogenesis about the implanted tumors.
Example 13: Pro-angiogenesis Promoting Effect of Thyroid Hormone and
Analogs Thereof at Subthreshold Levels of VEGF and FGF2 in an in vitro
Three-dimensional Micro-vascular Endothelial Sprouting Model
Either T3, T,t, T4-agarose, or fibroblast growth factor 2 (FGF2) plus vascular endothelial
growth factor (VEGF) produced a comparable pro-angiogenesis effect in the in vitro threedimensional
micro-vascular endothelial sprouting model. The pro-angiogenesis effect of the
thyroid hormone analogs were blocked by PD 98059, an inhibitor of the mitogen-activated
protein kinase (MAPK; ERK1/2) signal transduction cascade. Additionally, a specific avps
integrin antagonist (XT199) inhibited the pro-angiogenesis effect of either thyroid hormone
analogs or T4-agarose. Data also demonstrated that the thyroid hormone antagonist Tetrac
inhibits the thyroid analog's pro-angiogenesis response. Thus, those thyroid hormone analogs
tested are pro-angiogenic, an action that is initiated at the plasma membrane and involves avp3
integrin receptors, and is MAPK-dependent.
The present invention describes a pro-angiogenesis promoting effect of T3, T4, or T4-
agarose at sub-threshold levels of VEGF and FGF2 in an in vitro three-dimensional microvascular
endothelial sprouting model. The invention also provides evidence that the hormone
effect is initiated at the endothelial cell plasma membrane and is mediated by activation of the
ocvpS integrin and ERK1/2 signal transduction pathway.
Enhancement by T3, T4, or Tt-agarose of the angiogenesis activity of low
concentrations of VEGF and FGF2 in the three-dimensional sprouting assay was
demonstrated. Either T3 T4 at 10~7-10~8 M, or T4-agarose at 10~7 M total hormone
concentration was comparable in pro- angiogenesis activity to the maximal concentrations
of VEGF and FGF2 effect in this in vitro model. Although new blood vessel growth in the
rat heart has been reported to occur concomitantly with induction of myocardial
hypertrophy by a high dose of T4, thyroid hormone has not been regarded as an angiogenic
factor. The present example establishes that the hormone in physiologic concentrations is
pro-angiogenic in a setting other than the heart.
T4-agarose reproduced the effects of T4, and this derivative of thyroid hormone is
thought not to gain entry to the cell interior, it has been used in our laboratory to examine
models of hormone action for possible cell surface-initiated actions of iodothyronines.
Further, experiments carried out with T4 and tetrac also supported the conclusion that the
action of T4 in this model was initiated at the plasma membrane. Tetrac blocks membraneinitiated
effects of T4.
Since thyroid hormone non-genomically activates the MAPK (ERK1/2) signal
transduction pathway, the action of the hormone on angiogenesis can be MAPK-mediated.
When added to the CAM model, an inhibitor of the MAPK cascade, PD 98059, inhibited
the pro-angiogenic action of T4. While this result was consistent with an action on
transduction of the thyroid hormone signal upstream of an effect of T4 on FGF2 elaboration,
it is known that FGF2 also acts via an MAPK-dependent mechanism. T4 and FGF2
individually cause phosphorylation and nuclear translocation of ERK1/2 in endothelial cells
and, when used in sub-maximal doses, combine to enhance ERK1/2 activation further. To
examine the possibility that the only MAPK-dependent component of hormonal stimulation
of angiogenesis related exclusively to the action of FGF2 on vessel growth, cellular release
of FGF2 in response to T4 in the presence of PD 98059 was measured. The latter agent
blocked the hormone-induced increase in growth factor concentration and indicated that
MAPK activation was involved in the action of T4 on FGF2 release from endothelial cells,
as well as the consequent effect of FGF2 on angiogenesis.
Effect of Thyroid Hormone on Angiogenesis
Either T4, T3, or T4-agarose at 0.01-0.1 joM resulted in significant (P stimulation of angiogenesis (Table 4). This is shown to be comparable to the proangiogenesis
efficacy of FGF2 (50 ng/ml) plus VEGF (25 ng/ml).
Table 4. In Vitro Pro-angiogenesis Effect of Growth Factors, Thyroid Hormone,
and Analogs in the Three-Dimensional Human Micro-vascular Endothelial Sprouting Assay
(Table Removed)
Data (means +SD) were obtained from 3 experiments. Cells were pre-treated with Subthreshold
level ofFGF2 (1.25 ng/ml) + VEGF(2.5 ng/ml).
Data represent mean ± SD, n = 3, *P Effects of Tetrac on thyroid pro-angiogenesis action:
Ta stimulates cellular signal transduction pathways initiated at the plasma
membrane. These pro-angiogenesis actions are blocked by a deaminated iodothyronine
analogue, tetrac, which is known to inhibit binding of T4 to plasma membranes. The
addition of tetrac (0.1μ.M) inhibited the pro-angiogenesis action of either T3, T4, or T4-
agarose (Tables 5-7). This is shown by the inhibition of number of micr-vascular
endothelial cell migration and vessel length (Table 5-7).
Role of the ERK1/2 Signal Transduction Pathway in Stimulation of
Angiogenesis by Thyroid Hormone:
Parallel studies of ERK1/2 inhibition were carried out in the three-dimensional
micro-vascular sprouting assays. Thyroid hormone and analog at 0.01-0.1 uM caused
significant increase in tube length and number of migrating cells, an effect that was
significantly ( P of number micro-vascular endothelial cell migration and vessel length (Table 5-7).
Role of the Integrin avp3 in Stimulation of Angiogenesis by Thyroid Hormone:
Either Ta, T4, or T4-agarose at 0.01-0.1 pM-mediated pro-angiogenesis in the
presence of sub-threshold levels of VEGF and FGF2 was significantly (P by the avp3 integrin antagonist XT199 (Tables 5-7) . This is shown by the inhibition of
number of micro-vascular endothelial cell migration and vessel length (Table 5-7).
Thus, the pro-angiogenesis effect of thyroid hormone and its analogs begins at the
plasma membrane av|33 integrin and involves activation of the ERK1/2.
(Table Removed)
Human dermal micro-vascular endothelial cells (HDMVC) were used. Cells were
pretreated with FGF2 (1.25 ng/ml) + VEGF (2.5 ng/ml). Images were taken at 4 and 10X,
day 3. Data represent mean ± SD, n — 3, *P Table 6: Pro-angiogenesis Mechanisms of the Thyroid Hormone T4 in the
Three-Dimeusional Human Micro-vascular Endothelial Sprouting Assay
Human dermal micro-vascular endothelial cells (HDMVC) were used. Cells were
preti-eated with FGF2 (1.25 ng/ml) + VEGF (2.5 ng/ml). Images were taken at 4 and 10X,
day 3. Data represent mean ±SD, n = 3, *P (Table Removed)
Human dermal micro-vascular endothelial cells (HDMI'C) were used. Cells were
pretreated with FGF2 (1.25 ng/ml) + VEGF (2.5 ng/ml). Images were taken at 4 and I OX,
day 3. Data represent mean ±_SD, n = 3, * P Example 14: In vitro Model for Evaluating Polymeric Thyroid Analogs
Transport Across the Blood-Brain Barrier
Described below is an in vitro method for evaluating the facility with which selected
polymeric thyroid analog alone or in combination with nerve growth factor or other
neurogenesis factors likely will pass across the blood-brain barrier. A detailed description of
the model and protocol are provided by Audus, et al., Ann. N.Y. Acad. Sci 507: 9-18
(1987), the disclosure of which is incorporated herein by reference.
Briefly, microvessel endothelial cells are isolated from the cerebral gray matter of
fresh bovine brains. Brains are obtained from a local slaughter house and transported to the
laboratory in ice cold minimum essential medium ("MEM") with antibiotics. Under sterile
conditions the large surface blood vessels and meninges are removed using standard
dissection procedures. The cortical gray matter is removed by aspiration, then minced into
cubes of about 1 mm. The minced gray matter then is incubated with 0.5% dispase (BMB,
Indianapolis, Ind.) for 3 hours at 37°C. in a shaking water bath. Following the 3 hour
digestion, the mixture is concentrated by centrifugation (lOOOx g for 10 min.), then
resuspended in 13% dextran and centrifuged for 10 min. at 5800x g. Supernatant fat, cell
debris and myelin are discarded and the crude microvessel pellet resuspended in 1 mg/ml
collagenase/dispase and incubated in a shaking water bath for 5 hours at 37°C. After the 5-
hour digestion, the microvessel suspension is applied to a pre-established 50% Percoll
gradient and centriruged for 10 rain at lOOOx g. The band containing purified endothelial
cells (second band from the top of the gradient) is removed and washed two times with
culture medium (e.g., 50% MEM750% F-12 nutrient mix). The cells are frozen (-80° C.) in
medium containing 20% DMSO and 10% horse serum for later use.
After isolation, approximately 5xl05 cells/cm2 are plated on culture dishes or 5-12
mm pore size polycarbonate filters that are coated with rat collagen and fibronectin. 10-12
days after seeding the cells, cell monolayers are inspected for confluency by microscopy.
Characterization of the morphological, histochemical and biochemical properties of
these cells has shown that these cells possess many of the salient features of the blood-brain
barrier. These features include: tight intercellular junctions, lack of membrane fenestrations,
low levels of pinocytotic activity, and the presence of gamma-glutamyl transpeptidase,
alkaline phosphatase, and Factor VIII antigen activities.
The cultured cells can be used in a wide variety of experiments where a model for
polarized binding or transport is required. By plating the cells in multi-well plates, receptor
and non-receptor binding of both large and small molecules can be conducted. In order to
conduct transendothelial cell flux measurements, the cells are grown on porous
polycarbonate membrane filters (e.g., from Nucleopore, Pleasanton, Calif.). Large pore size
filters (5-12 mm) are used to avoid the possibility of the filter becoming the rate-limiting
barrier to molecular flux. The use of these large-pore filters does not permit cell growth
under the filter and allows visual inspection of the cell monolayer.
Once the cells reach confluency, they are placed in a side-by-side diffusion cell
apparatus (e.g., from Crown Glass, Sommerville, N.J.). For flux measurements, the donor
chamber of the diffusion cell is pulsed with a test substance, then at various times following
the pulse, an aliquot is removed from the receiver chamber for analysis. Radioactive or
fluorescently-labelled substances permit reliable quantitation of molecular flux. Monolayer
integrity is simultaneously measured by the addition of a non-transportable test substance
such as sucrose or inulin and replicates of at least 4 determinations are measured in order to
ensure statistical significance.
Example 15: Traumatic Injury Model
The fluid percussion brain injury model was used to assess the ability of polymeric
thyroid hormone analogs alone or in combination with nerve growth factors or other
neurogenesis factors to restore central nervous system functions following significant
traumatic brain nrj ury.
/. Fluid Percussion Brain Injury Procedure
The animals used in this study were male Sprague-Dawley rats weighing 250-300
grams (Charles River). The basic surgical preparation for the fluid-percussion brain injury
has been previously described. Dietrich, etal., ActaNeuropathol. 87: 250-258 (1994)
incorporated by reference herein. Briefly, rats were anesthetized with 3% halothane, 30%
oxygen, and a balance of nitrous oxide. Tracheal intubation was performed and rats were
placed in a stereotaxic frame. A 4,8-rnm craniotomy was then made overlying the right
parietal cortex, 3.8 mm posterior to bregma and 2.5 mm lateral to the midline. An injury
tube was placed over the exposed dura and bonded by adhesive. Dental acrylic was then
poured around the injury tube and the injury tube was then plugged with a gelfoam sponge.
The scalp was sutured closed and the animal returned to its home case and allowed to
recover overnight.
On the next day, fluid-percussion brain injury was produced essentially as described
by Dixon, et al,5 J. Neurosurg. 67: 110-119 (1987) and Clifton, et al., J. Cereb. Blood Flow
Metab. 11: 114-121 (1991). The fluid percussion device consisted of a saline-filled
Plexiglas cylinder that is fitted with a transducer housing and injury screw adapted for the
rat's skull. The metal screw was firmly connected to the plastic injury rube of the intubated
anesthetized rat (70% nitrous oxide, 1.5% halothane, and 30% oxygen), and the injury was
induced by the descent of a pendulum that strikes the piston. Rats underwent mild-tomoderate
head injury, ranging from 1.6 to 1.9 arm. Brain temperature was indirectly
monitored with a thermistor probe inserted into the right temporalis muscle and maintained
at 37-37.5°C. Rectal temperature was also measured and maintained at 37°C. prior to and
throughout the monitoring period.
Behavioral Testing.
Three standard functiona/ehavioral tests were used to assess sensorimotor and
reflex function after brain injury. The tests have been fully described in the literature,
including Bederson, et al., (1986) Stroke 17: 472-476; DeRyck, et al., (1992) Brain Res.
573: 44-60; Markgraf, et al., (1992) Brain Res. 575: 238-246; and Alexis, et al., (1995)
Stroke 26: 2338-2346.
A. The Forelimb Placing Test
Forelimb placing to three separate stimuli (visual, tactile, and proprioceptive) was
measured to assess sensorimotor integration. DeRyck, et al., Brain Res. 573:44-60 (1992).
For the visual placing subtest, the animal is held upright by the researcher and brought close
to a table top. Normal placing of the limb on the table is scored as "0," delayed placing ( sec) is scored as "1," and no or very delayed placing (>2 sec) is scored as "2." Separate
scores are obtained first as the animal is brought forward and then again as the animal is
brought sideways to the table (maximum score per limb=4; in each case higher numbers
denote greater deficits). For the tactile placing subtest, the animal is held so that it cannot
see or touch the table top with its whiskers. The dorsal forepaw is touched lightly to the
table top as the animal is first brought forward and then brought sideways to the table.
Placing each time is scored as above (maximum score per limb=4). For the proprioceptive
placing subtest, the animal is brought forward only and greater pressure is applied to the
dorsal forepaw; placing is scored as above (maximum score per limb=2). Finally, the ability
of animals to place the forelimb in response to whisker stimulation by the tabletop was
tested (maximum score per limb=2). Then subscores were added to give the total forelimb
placing score per limb (range=0-12).
B. The Beam Balance Test
Beam balance is sensitive to motor cortical insults. This task was used to assess
gross vestibulomotor function by requiring a rat to balance steadily on a narrow beam.
Feeney, etal., Science, 217: 855-857 (1982); Goldstein, etal., Behav. Neurosci. 104: 318-
325 (1990). The test involved three 60-second training trials 24 hours before surgery to
acquire baseline data. The apparatus consisted of a 3/4-inch-wide beam, 10 inches in length,
suspended 1 ft. above a table top. The rat was positioned on the beam and had to maintain
steady posture with all limbs on top of the beam for 60 seconds. The animals' performance
was rated with the scale of Clifton, et al., J. Cereb Blood Flow Metab. 11:1114-121 (1991),
which ranges from 1 to 6, with a score of 1 being normal and a score of 6 indicating that the
animal was unable to support itself on the beam.
C. The Beam Walking Test
This was a test of sensorimotor integration specifically examining hindlimb
function. The testing apparatus and rating procedures were adapted from Feeney, et al.,
Science, 217: 855-857 (1982). A 1-inch-wide beam, 4 ft. in length, was suspended 3 ft.
above the floor in a dimly lit room. At the far end of the beam was a darkened goal box with
a narrow entryway. At equal distances along the beam, four 3-inch metal screws were
positioned, angling away from the beam's center. A white noise generator and bright light
source at the start of the beam motivated the animal to traverse the beam and enter the goal
box. Once inside the goal box, the stimuli were terminated. The rat's latency to reach the
goal box (in seconds) and hindlimb performance as it traversed the beam (based on a 1 to 7
rating scale) were recorded. A score of 7 indicates normal beam walking with less than 2
foot slips, and a score of 1 indicates that the rat was unable to traverse the beam in less than
80 seconds. Each rat was trained for three days before surgery to acquire the task and to
achieve normal performance (a score of 7) on three consecutive trials. Three baseline trials
were collected 24 hours before surgery, and three testing trials were recorded daily
thereafter. Mean values of latency and score for each day were computed.
Example 16: Thyroid Hormone Analogs
(Table Removed)
TETRAC-Retinoic Acid
Example 19: Halogenated Stilbestrol Analogs
Diethylstilbestrol
Example 20: Compositions of T4 Analogs, Halogenated Stilbesterols, and
Retinoic Acid
Retinoic Acid-Diethylstilbestrol-Retinoic Acid
Example 21: Preparations of Compounds for PET-imaging
In general, the radioactive imaging agents of the present invention (Examples 16-20)
ire prepared by reacting radioactive 4-halobenzyl derivatives with piperazine derivatives,
-"referred are F-l 8 labeled 4-fluorobenzyl derivatives for PET-imaging. A general method
for the preparation ot 4-rluoro-.sup. 18 F-benzyl halides is described in Iwata et al., Applied
Radiation and Isotopes (2000), Vol. 52, pp. 87-92.
Example 22: Preparation of Compounds for SPECT-imaging
For Single Photon Emission Computed Tomography ("SPECT"), 99mTc-labeled
compounds are preferred. A general synthetic pathway for these compounds starts with
non-radioactive analogues of compounds according to Examples 16-20 that are reacted with
99mTc -binding chelators, e.g. Nj 82 -Chelators. The synthesis of the chelators follows
standard procedures, for example, the procedures described in A. Mahmood et al., A N2 82 -
Tetradentate Chelate for Solid-Phase Synthesis: Tecnnetium, Rhenium in Chemistry and
Nuclear Medicine (1999), Vol. 5, p. 71, or in Z. P. Zhuang et al., Bioconjugate Chemistry
(1999), Vol. 10, p. 159.
One of the chelators is either bound directly to the nitrogen in the ~N(R4)R5 group
of the non-radioactive compounds according to Examples 16-20, or via a linker moiety
comprising an alkyl radical having one to ten carbon atoms, wherein the alkyl radical
optionally contains one to ten --C(O)— groups, one to ten — C(O)N(R)~ groups, one to ten —
N(R)C(O)— groups, one to ten —N(R)~ groups, one to ten ~N(R)o groups, one to ten
hydroxy groups, one to ten —C(O)OR~ groups, one to ten oxygen atoms, one to ten sulfur
atoms, one to ten nitrogen atoms, one to ten halogen atoms, one to ten aiyl groups, and one
to ten saturated or unsaturated heterocyclic rings wherein R is hydrogen or alkyl. A
preferred linker moiety is -C(0)-CH2 --N(H)-.
Example 23: T4 is a ligand of aVp3 integrin
To determine if T4 is a ligand of the aVp3 integrin, 2 u.g of commercially available
purified protein was incubated with [125I]T4, and the mixture was run out on a nondenaturing
polyacrylamide gel. aVp3 binds radiolabeled T4 and this interaction was
competitively disrupted by unlabeled T4, which was added to aVp3 prior to the [I25I]T4
incubation, in a concentration-dependent manner (Fig. 24). Addition of unlabeled T4
reduced binding of integrin to the radiolabeled ligand by 13% at a total T4 concentration of
10"7 M total (3x10"10 M free T4), 58% at 10'6 M total (1.6xlO~9 M free), and inhibition of
binding was maximal with 10"5 M unlabeled T4. Using non-linear regression, the interaction
of aVp3 with free T4 was determined to have a Kd of 333 pM and an ECso of 371 pM.
Unlabeled '13 was less etlective in displacing [I25I]T4-binding to aVp3, reducing the signal
by28%atlO-4MtolalT3.
Example 24: T4 binding to ocVpS is blocked by tetrac, RGD peptide and
integrin antibody
We have shown previously that T4-stimulated signaling pathways activated at the
cell surface can be inhibited by the iodothyronine analog tetrac, which is hown to prevent
binding of T4 to the plasma membrane. In our radioligand-binding assay, while 10~8 M
tetrac had no effect on [I25I]T4-binding to purified aVp3, the association of T4 and ocVp3
was reduced by 38% in the presence of 1CT7 M tetrac and by 90% with 10~5 M tetrac (Fig.
25). To determine specificity of the interaction, an RGD peptide, which binds to the
extracellular matrix-biding site on ccV(33, and an RGB peptide, which has a glutamic acid
residue instead of an aspartic acid residue and thus does not bind aV|33, were added in an
attempt to displace T4 from binding with the integrin. Application of an RGD peptide, but
not an RGB peptide, reduced the interaction of [12SI]T4 with ocVp3 in a dose-dependent
manner (Fig. 25).
To further characterize the interaction of T4 with aVp3, antibodies to ctVp3 or
ctVpS were added to purified aVp3 prior to addition of [125I]T4. Addition of 1 p.g/ml of
aVp3 monoclonal antibody LM609 reduced complex formation between the integrin and
T4 by 52%, compared to untreated control samples. Increasing the amount of LM609 to 2
Hg, 4 p.g, and 8 |J,g/ml diminished band intensity by 64%, 63% and 81%, respectively (Fig.
26). Similar results were observed when a different aVp3 monoclonal antibody, SC7312,
was incubated with the integrin. SC7312 reduced the ability of T4 to bind ocVp3 by 20%
with 1 p.g/ml of antibody present, 46% with 2 u.g, 47% with 4 p,g, and by 59% when 8
p.g/ml of antibody were present. Incubation with monoclonal antibodies to aV and P3,
separately, did not affect [125I]T4-binding to aVp3, suggesting that the association requires
the binding pocket generated from the heterodimeric complex of aVp3 and not necessarily
a specific region on either monomer. To verify that the reduction in band intensity was due
to specific recognition of aVp3 by antibodies, purified aVp3 was incubated with a
monoclonal antibody to aVp5 (PIF6) or mouse IgG prior to addition of [125I]T4, neither of
which influenced complex formation between the integrin and radioligand (Fig. 26).
Example 25: T4-stimulated MAPK activation is blocked by inhibitors of
hormone binding and of integrin aVp3
Nuclear translocation of phosphorylated MAPK (pERKl/2) was studied in CV-1
cells treated with physiological levels of T4 10"7 M total hormone concentration, 10"10 M
free hormone) for 30 min. Consistent with results we have previously reported, T4 induced
nuclear accumulation of phosphorylated MAPK in CV-1 cells within 30 min (Fig. 27). Preincubation
of CV-1 cells with the indicated concentrations of ctVp3 antagonists for 16 h
reduced the ability of T4 to induce MAPK activation and translocation. Application of an
RGD peptide at 10 8 and 10"7 M had a minimal effect on MAPK activation. However, 10"6
M RGD peptide inhibited MAPK phosphorylation by 62% compared to control cultures and
activation was reduced maximally when 10~5 M RGD (85% reduction) and KT4 M RGD
(87% reduction) were present in the culture media. Addition of the nonspecific RGB peptide
to the culture media had no effect on MAPK phosphorylation and nuclear translocation
following T4 treatment in CV-1 cells.
Tetrac, which prevents the binding of T4 to the plasma membrane, is an effective
inhibitor of T4-induced MAPK activation. When present at a concentration of 10"6 M with
T4, tetrac reduced MAPK phosphorylation and translocation by 86% when compared to
cultures treated with T4 alone (Fig. 27), The inhibition increased to 97% when 10"4 M
tetrac was added to the culture media for 16 h before the application of T4. Addition of
aVp3 monoclonal antibody LM609 to the culture media 16 h prior to stimulation with T4
also reduced T4-induced MAPK activation. LM609 at 0.01 and 0.001 u.g/ml of culture
media did not affect MAPK activation following T4 treatment Increasing the concentration
of antibody in the culture media to 0.1,1, and 10 p,g/ml reduced levels of phosphorylated
MAPK found in the nuclear fractions of the cells by 29%, 80%, and 88%, respectively,
when compared to cells treated with T4 alone.
CV-1 cells were transiently transfected with siRNA to aV, 03 or both aV and P3
and allowed to recover for 16 h before being placed in serum-free media. Following T4
treatment for 30 min, the cells were harvested and either nuclear protein or RNA was
extracted. Figure 28A demonstrates the specificity of each siRNA for the target integrin
subunit. CV-1 cells transfected with either the aV siRNA or both aV and P3 siRNAs
showed decreased aV subunit RT-PCR products, but there was no difference in aV mRNA
expression when cells were transfected with the siRNA specific for P3, or when exposed to
the transfection reagent in the absence of exogenous siRNA. Similarly, cells transfected
with p3 siRNA had reduced levels of 03 mRNA, but relatively unchanged levels of ccV
siRNA. The addition of T4 for 30 min did not alter mRNA levels for either aV or (33,
regardless of the siRNA transfected into the cells.
Activated MAPK levels were measured by western blot in CV-I cells transfected
with siRNAs to aV and fi3, either individually or in combination (Fig. 28B). CV-I cells
treated with scrambled negative control siRNA had slightly elevated levels of T4-induced
activated MAPK when compared to the parental cell line. Cells exposed to the transfection
reagent alone display similar levels and patterns of MAPK phosphorylation as the nontransfected
CV-1 cells. When either aV siRNA or p3 siRNA, alone or in combination, was
transfected into CV-1 cells, the level of phosphorylated MAPK in vehicle-treated cultures
was elevated, but the ability of T4 to induce a further elevation in activated MAPK levels
was inhibited.
Example 26: Hormone-induced angiogenesis is blocked by antibody to aVp3
Angiogenesis is stimulated in the CAM assay by application of physiological
concentrations of T4 (Fig. 29A and summarized in Fig. 29B). 10~7 M T4 placed on the
CAM filter disk induced blood vessel branch formation by 2.3-fold (P compared to PBS-treated membranes. Propylthiouracil, which prevents the conversion of
T4 to T3, has no effect on angiogenesis caused by T4. The addition of a monoclonal
antibody, LM609 (10¸μg/filter disk), directed against ctVfM, inhibited the pro-angiogenic
response to T4.
Example 27: Biocompatible Polymer Conjugates of Thyroid Hormone Analogs
for Short and Long-term Delivery
Sketch 2: Molecular Models Showing the 3 D view for Topography & Molecular Geometry
in stick, ball & stick, disc and space filling models for comparative evaluation.
Stick Model: Molecules in two sets- showing molecular density in lower set.
Set 1: Triac and Tetrac (Iodines in Yellow, Oxygens in Red)
Set 2
Ball & Stick Model: Triac and Tetrac
topographical alignment.
Setl
- lower set showing molecular density and
Set 2
Disc Model: Triac and Tetrac
iK A »r
Space Filling Model: Triac and Tetrac
Thyroid Hormone analog and Anti-Cancer Activity:
The thyroid honnone metabolites Triac and Tetrac are used in treatment of thyroid
cancer to enrich and as substitute therapy for its needs.
Commercially Available Thyroid Hormones & its Analogs:
There are several brand names synthetic thyroid hormones available in the market
including Unithroid®, Levothroid®, Synthroid® and Levoxyl®. There are generic
formulations like Levo-T®, Levothyroxine Sodium® and Novothyrox®.
Natural Thyroid hormones are sold as food supplement in a dried and powdered form
obtained from slaughtered animal's thyroid glands. This desiccated product pill may
contain unwanted animal protein, improper balance of the T3 and T4 compounds and
synthetic binders which is least recommended for human consumption. The ratio of T3
to T4 may vary for each batch depending on the animal's gland and has not been found
to be constant for any proper delivery in human subjects. The complication in dose,
delivery and availability in the system argues for a standardized, constant, limited dose
and temporal release regimen for safe human consumption and other topical uses.
Thyroid Hormone Regulated Release System:
As of today, no specific and standardized regimen of treatment for thyroid hormone
replacement therapy is available to patients in United States. We are proposing a long
term, permanent slow release system of individual thyroid constituents based on
personalized needs presorted for the dose, desired activity and response profile in test
systems. "We will be achieving it through the polymer bound thyroid constituents
delivery to the site of these products for dose defining and in a limited distribution. The
proposed conjugates (Fig 3 - a sketch) will have both short and longer term release
capacity achieved through hydrolysable and non-hydrolysable characteristics. This will
achieve the minimum dose level delivery for the specific cardio vascular and wound
healing properties.
Sketch 3: Ordered & Random Polymer Conjugates -
O = Drug/Organic Compound/ Entity being conjugated
Typical Polymeric Templates for Drug/API Conjugate's
Conjugated Delivery Systems:
Among the developing delivery systems, synthetic polymers conjugated chemical
entities are gaining ground. A variety of synthetic, natural and biopolymeric origin side
groups with efficient biodegradable backbone polymers are available and are in use in
the trade. Poly alkyl glycols, polyesters, poly anhydride, poly saccharide, and poly
amino acids are available for conjugation depending on the final characteristic of the
conjugated product in terms of their hydrophilicity, hydrophobic nature, hydrolyses by
enzymes, co-factors and biologically available acids in vivo as well as in vitro systems
for the purpose.
Polymer Conjugation-Synthesis & Purification:
We are proposing a library of conjugated products (see Fig 6 and Table-1) for the
controlled, hydrolysable as well as non-hydrolysable polymer conjugate products
including the biopolymers. A test case will evolve from each category of polymer
products for their detailed study in terms of its pharmacokinetics covering delivery,
transport, half-life and degradation arid or erosion data. The series will also be tried to
prepare as a concurrent or library design of combinatorial synthesis fitting into the
similar chemical class of reaction for the substrate and varying polymers utilizing DCC,
DCC/HOBt based and other water soluble reagents including placement of linker and
commonly used NHS ester based synthetic strategies with a view for future
developments in the polymeric conjugation combinatorial or parallel synthesis. The
available facilities of the synthesizer at PRJ will be utilized towards this effect and each
product will be individually purified for suitability of the biological test systems.
Sketch 4: Representative Polymer Conjugate Structures from Natural, Synthetic and
Polypeptide Polymer Chain.
Polymer Conjugates- Physical & Chemical Characterization:
A through spectro-analytical and cliromatographic analysis of the polymer bound
compounds will be performed using NMR (High & Low Field- Proton & Carbon,
DEPT, HOMOCOSY & HETEROCOSY/HETCOR wherever applicable), IR, MS,
HPLC, thermal and environmental degradation analysis for stability suitability and
degradation rate profile.
Release & Stability Studies:
A detailed HPLC analyses for quantitative release analyses will be undertaken based on
our established protocol for the individual thyroid products i.e., GC-1, T3, T4 and
DITPA as well as Triac and Tetrae along with individual polymer and polymer
conjugated product's chromatographic and spectro-analytical profile.
Polymers Compatibility Criteria for Conjugation:
Biodegradable and biocompatible polymers have been designated as probable carriers
for long term and short time delivery vehicles including non hydrolysable polymeric
conjugates (table 1). PEGs and PEOs are the most common hydroxyl end polymers with
a wide range of molecular weights to choose for the purpose of solubility (easy carrier
mode), degradation times and ease of conjugation. One end protected Methoxy-PEGs
will also be employed as a straight chain carrier capable of swelling and thereby
reducing the chances of getting protein attached or stuck during the subcellular
transportation. Certain copolymers of ethylene and vinyl acetate, i.e. EVAc which have
exceptionally good biocompatibility, low crystallinity and hydrophobic in nature are
ideal candidate for encapsulation mediated drug delivery carrier.
Polymers with demonstrated high half-life and in-system retention properties will be
undertaken for conjugation purpose. Among the most common and recommended
biodegradable polymers from lactic and glycolic acids will be used. The copolymers of
L-lactide, and L-lysine is useful because of its availability of amine functional groups
for amide bond formation and this serves as a longer lasting covalent bonding site of the
carrier and transportable thyroid compound linked together through the carboxyl moiety
in all the thyroid constituents.
The naturally occurring polysaccharides from cellulose, chitin, dextran, ficoll, pectin,
carrageenan (all subtypes), and alginate and some of their semi-synthetic derivatives are
ideal carriers due to its high biocompatibility, bio systems familiar degradation products
(mono saccharide from glucose and fructose), hydrophilic nature, solubility, protein
immobilization/interaction for longer term stability of the polymer matrix. This provides
a shell for extra protection for polymer matrix from degradation over time and adding to
the effective half life of the conjugate.
Protein & Polypeptide from serum albumin, collagen, gelatin and poly-L-lysine, poly-Lalanine,
poly-L-serine are natural amino acids based drug carrier with advantage of
biodegradation, biocompatibility and moderate release times of the carrier molecule.
Poly-L-serine is of further interest due to its different chain derivatives, e.g., poly serine
ester, poly serine imine and conventional poly serine polymeric backbone with available
sites for specific covalent conjugation.
Synthetic hydrogels from methacrylate derived polymers have been frequently used in
biomedical applications because of their similarity to the living tissues. The most widely
used synthetic hydrogels are polymers of acrylic acid, acrylamide and 2-hydroxyethyl
methacrylate (HEMA). The poly HEMA are inexpensive, biocompatible, available
primary alcohol side chain elongation functionality for conjugation and fit for ocular,
intraocular and other ophthalmic applications which makes them perfect drug delivery
materials. The pHEMA are immune to cell attachment and provides zero cell motility
which makes them an ideal candidate for internal delivery system.
Synthetic thyroid analog DITPA conjugation library design program has been achieved
with the development of crude DITPA conjugated products. PVA and PEG hydrophilic
polymer coupling mediated through Dicycolhexyl Carbodiimide and by other coupling
reagents of hydrophilic and hydrophobic nature is under progress.
The design for the evolution of library synthesis on solid phase synthesizer is in its final
stages and a model for its high throughput screening (HTS) will be put in place based on
commonality of testing system and parametric criteria. The statistical analyses for the
delivery time, half-life and conceived stability of the conjugates will be accumulated for
the puipose of structure delivery analyses (SDA). Following is a list of intended
polymer conjugates for preparation (Table 8).
(Table Removed)
Other Embodiments
While the invention has been described in conjunction with the detailed description
thereof, the foregoing description is intended to illustrate and not limit the scope of the
invention, which is defined by the scope of the appended claims. Other aspects, advantages,
and modifications are within the scope of the following claims.



WE CLAIM:
1. An angiogenic agent comprising at least one of a thyroid hormone and analog thereof
conjugated to a polymer forming a conjugated thyroid compound wherein the
conjugated thyroid compound binds to the cell surface at the cell membrane level and
does not activate signal transduction.
2. The angiogenic agent as claimed in claim 1, wherein said analog is selected from
those compounds recited in Figure 20, Tables A-D.
3. The angiogenic agent as claimed in claim 1, wherein said thyroid hormone analog is
levothyroxine (T4), triiodothyronine (T3), 3,5-dimethyl-4-(4'-hydroy-3'-
isopropylbenzyl)-phenoxy acetic acid (GC-1), and 3,5-diiodothyropropionic acid
(DITPA).
.
?
•
4. The angiogenic agent as claimed in claim 1, wherein said polymer is selected from the
group consisting of polyvinyl alcohol,acrylic acid ethylene co-polymer,
polyethyleneglycol (PEG), polylactic acid, , polyglycolide, agarose and copolymers
thereof
;
; •
5. The angiogenic agent as claimed in claim 1, wherein said conjugation is via a
covalent or non-covalent bond. 1
6. The angiogenic agent as claimed in claim 5, wherein said covalent bond is at least one
ofan ester linkage and an anhydride linkage. 7. The angiogenic agent as claimed in claim 1, wherein said agent is encapsulated or
incorporated in at least one of a microparticle, and liposome.
8. The angiogenic agent as claimed in claim 7, wherein the at least one liposome and
microparticle has a size less than 200 nm.
r
9. The angiogenic agent as claimed in claim 1, wherein the angiogenic agent further
comprising at least one of a growth factor, a vasodilator, an anti-coagulant, and
combinations thereof
10. The angiogenic agent as claimed in claim 1, wherein said thyroid hormone analog is
conjugated to nanoparticles.
11. The angiogenic agent as claimed in claim 1, wherein said composition further
•
comprises pro-angiogenesis factors, nerve growth factors, neurogenesis factors, antiinflammatory
agents, antioxidants, or combinations thereof
12. The angiogenic agent as claimed in claim 11, wherein said pro-angioegnesis factor is
FGForVEGF.
13. The angiogenic agent as claimed in claim 11, wherein said antioxidant is vitamin C, ;
vitamin E, resveratrol-like compounds, or combinations thereof
14. The angiogenic agent as claimed in claim 11, wherein said anti-inflammatory agent is
a compound selected from the group consisting of non-steroidal compounds, insulin
sensitizers, and protesome inhibitors.
15. The angiogenic agent as claimed in claim 1 wherein the thyroid hormone analog is a
labeled thyroid hormone analog that binds to transthyretin.
16. The angiogenic agent as claimed in claim 15, wherein said angiogenic agent passes
the blood brain barrier.
17. The angiogenic agent as claimed in claim 15, wherein said labeled thyroid hormone
analog is selected from the group consisting of: T3, T4 DITPA, GC-1.
18. The angiogenic agent as claimed in claim 15, wherein said labeled thyroid hormone
f
analog is conjugated to a dendrimer.
•
19. The angiogenic agent as claimed in claim 15, wherein said angiogenic agent is
imageable by at least one of a positron emission tomography, a single photon
emission computed tomography, and a magnetic resonance imaging.
20. The angiogenic agent as claimed in claim 15, wherein said labeled thyroid hormone
analog is conjugated to a compound selected from the group consisting of retinoic
acid, halogenated stilbestrols, or analogs thereof
21. The angiogenic agent as claimed in claim 9, wherein said growth factor is selected
from the group consisting of: transforming growth factor alpha (TGFa), transforming
growth factor beta (TGFP), basic fibroblast growth factor, vascular endothelial growth
factor, epithelial growth factor, nerve growth factor, platelet-derived growth factor, ;
and vascular permeability factor.
22. The angiogenic agent as claimed in claim 9 wherein said vasodilator is adenosine,
adenosine derivatives, or combinations thereof
23. The angiogenic agent as claimed in claim 9 wherein said anticoagulant is heparin,
heparin derivatives, anti-factor Xa, anti-thrombin, aspirin, clopidgrel, or combinations
thereof
24. The angiogenic agent as claimed in claim 1 wherein said thyroid hormone analog^is
at least one of tetraiodothyroacetic acid (TETRAC), triiodothyroacetic acid (TRIAC), I
monoclonal antibody LM609, and XT 199.
25. The angiogenic agent as claimed in claim 1 wherein the angiogenic agent includes
fiirther includes at least one chemotherapeutic agent.
Dated this 2/4/2007 /^~?fe^^»
[SWAROTK6MAR]
OF REMFRY & SAGAR
ATTORNEYS FOR THE APPLICANTS

Documents:

2461-delnp-2007-Abstract-(23-08-2013).pdf

2461-delnp-2007-abstract.pdf

2461-delnp-2007-Claims-(23-08-2013).pdf

2461-delnp-2007-claims.pdf

2461-delnp-2007-Correspondence-others-(15-09-2008).pdf

2461-delnp-2007-Correspondence-Others-(23-08-2013).pdf

2461-delnp-2007-correspondence-others.pdf

2461-delnp-2007-description (complete).pdf

2461-delnp-2007-Drawigns-(23-08-2013).pdf

2461-delnp-2007-drawings.pdf

2461-delnp-2007-form-1.pdf

2461-delnp-2007-Form-18-(15-09-2008).pdf

2461-delnp-2007-Form-2-(23-08-2013).pdf

2461-delnp-2007-form-2.pdf

2461-delnp-2007-Form-3-(23-08-2013).pdf

2461-delnp-2007-form-3.pdf

2461-delnp-2007-form-5.pdf

2461-delnp-2007-GPA-(23-08-2013).pdf

2461-delnp-2007-pct-210.pdf

2461-delnp-2007-pct-220.pdf

2461-delnp-2007-pct-237.pdf

2461-delnp-2007-pct-301.pdf

2461-delnp-2007-pct-304.pdf

2461-delnp-2007-Petition-137-(23-08-2013).pdf


Patent Number 260602
Indian Patent Application Number 2461/DELNP/2007
PG Journal Number 20/2014
Publication Date 16-May-2014
Grant Date 12-May-2014
Date of Filing 02-Apr-2007
Name of Patentee ALBANY COLLEGE OF PHARMACY
Applicant Address 106 NEW SCOTLAND AVENUE, ALBANY, NEW YORK 12208, USA
Inventors:
# Inventor's Name Inventor's Address
1 SHAKER A.MOUSA 5 FOX GLOVE COUNT, WYNANTSKILL, NY 12198, USA
2 FAITH B.DAVIS OLD S.ROAD, WEST SAND LANE,NY 12196,USA
3 PAUL J.DAVIS OLS S.ROAD, WEST SAND LAKE, NY 12196, USA
PCT International Classification Number A61K 31/198
PCT International Application Number PCT/US2005/032813
PCT International Filing date 2005-09-15
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 60/670,534 2005-04-13 U.S.A.
2 10/943,072 2004-09-15 U.S.A.