Title of Invention

A FUSION PROTEIN

Abstract

The present invention relates to fusion proteins comprising an antigen derived from the so-called tumour rejection antigen PRAME (also known as DAGE) linked to an immunological fusion partner which provides T helper epitopes, such as, for example protein D from Haemophilus influenzae B, fusion partner proteins comprising fragments of protein D, methods for preparing the same and for formulating vaccines and use of the same for treating a range of cancers.

Full Text

VACCINE The present invention relates to fusion proteins comprising an antigen derived from the so-called tumour rejection antigen PRAME (also known as DAGE) linked to an immunological fusion partner which provides T helper epitopes, such as, for example protein D from Haemophilus influenzae B, methods for preparing the same and for formulating vaccines and use of the same for treating a range of cancers, including, but not limited to melanoma, breast, bladder, lung cancer such as NSCLC, sarcoma, ovarian cancer, head and neck cancer, renal cancer, colorectal carcinoma, multiple myeloma, leukemia including acute leukemia and oesophageal carcinoma. In a further embodiment, the present invention relates to fusion partner proteins comprising protein D derivatives and methods for preparing same. Among different groups of tumour-associated antigens, cancer testis antigens are of interest for immunotherapy because of their broad tumour-specific expression and the fact that generally these antigens are not expressed in healthy cells. More than 50 cancer/testis antigens have been described so far and, for many of them, epitopes recognized by T lymphocytes have been identified. PRAME is a cancer testis antigen and is in under investigation as a potential immunotherapy. In immunotherapy the cancer antigen is introduced to the patient usually as a vaccine, for example containing an antigen as a protein or an immunogenic fragment thereof, or as DNA encoding for the protein or as a vector containing said DNA, which stimulates the patient's immune system to attack tumours expressing the same antigen. If the appropriate response is stimulated, T lymphocytes (T cells) attack antigens directly, and provide control of the immune response. B cells and T cells develop that are specific for one antigen type. When the immune system is exposed to a different antigen, different B cells and T cells are formed. As lymphocytes develop, they normally learn to recognize the body's own tissues (self) as different from tissues and particles not normally found in the body (non-self). Once B cells and T cells are formed, a few of those cells will multiply and provide "memory" for the immune system. This allows the immune system to respond faster and more efficiently the next time it is exposed to the same antigen. Certain experiments seem to indicate that cancer testis antigens can stimulate the memory mechanisms in the immune system. It is hypothesized by some that PR..AME is involved in cell death or cell cycles. It has been shown by some groups to be expressed in melanoma and a wide variety of tumours including lung, kidney and head and neck. Interestingly it also seems to be expressed in 40-60% leukemia such as acute lymphoid leukemia and acute myeloid leukemia, see for example Exp Hematol. 2000 Dec;28(l2):1413-22. In patients it has been observed that over expression of PRAMH seems to be associated with higher survival and lower rates of relapse in comparison to those who do not over express the protein. The antigen and its preparation are cescribed in US patent No. 5, 830, 753. PRAME is found in the Annotated Human Gene Database H-Inv DB under the accession numbers: U65011.1, BC022008.1, AK129783.1, BC014974.2, CR608334.1, AF025440.1, CR591755.1, BC039731.1, CR623010.1, CR611321.1, CR618501.1, CR604772.1, CR456549.1, and CR620272.1. Protein D is a surface protein of the gram-negative bacterium, Haemophilus influenza B. Information on immunological fusion partners derived from protein D can be obtained from WO 91/18926. Fusion proteins of a. portion of an antigen and a heterologous fusion partner are sometimes prepared to increase the immunogenicity of the antigen and/or aid production of the protein in appropriate quantities and/or purity see for example WO 99/40188 which describes a fusion protein of MAGE and, for example protein D a surface protein of the gram-negative bacterium, Haemophilus influenza B. The fusion protein is prepared recombinantly and the protein D secretion sequence can be incorporated into the fusion protein to potentially assist secretion and solubilisation of the final product. Summary of the invention The present invention provides a fusion protein comprising: a) FRAME or an immurtogenic fragment thereof, and b) a heterologous fusion partner derived from protein D, wherein the said fusion protein does not include the secretion sequence (signal sequence) of protein D. The present invention further provides a fusion partner protein as described herein derived from protein D, in which the fusion partner protein does not include the secretion sequence or signal sequence of protein D. The present invention further provices a fusion protein as described herein and an antigen or fragment thereof. The present invention further provides a fusion partner protein derived from protein D, in which the fusion partner protein comprises or consists of amino acids 20 to 127 of protein D. In one embodiment of the present invention, one or more amino acids from the protein D fusion partner protein as described herein may be deleted or may be replaced by substitution. The amino acids may be substituted with conservative substitutions as defined herein, or other amino acids may be used. In one embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acids may be substituted. The protein D fusion partner protein as described herein may additionally or alternatively contain deletions or insertions within the amino acid sequence when compared to the wild-type protein D sequence. In one embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acids may be inserted or deleted. The term "secretion sequence" or "signal sequence" or "secretion signal" of protein D, in the context of this application, is intended to refer to approximately amino acids 1 to 16, 17, 18 or 19 of the naturally occurring protein. In one embodiment, the secretion or signal sequence or secretion signal of protein D refers to the N-terminal 19 amino acids of protein D. The terms "secretion sequence" or '"signal sequence" or "secretion signal" are used interchangeably in the present specification. The fusion partner protein of the present invention may comprise the remaining full length protein D protein, or may comprise approximately the remaining N-terminal third of protein D. For example, the remaining N-terminal third of protein D may comprise approximately or about amino acids 20 to 127 of protein D. In one embodiment, the protein D sequence for use in the present invention comprises amino acids 20 to 127 of protein D. In a further embodiment, the present invention comprises or consists of any of the sequences starting from any of the following amino acids of the protein D sequence: 17, 18, 19, 20, 21, or 22; and terminating at any on the following amino acids of the protein D sequence: 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or 140. By "remaining" in this context is neant the sequence of the protein D protein without the secretion or signal sequence as described herein. In one embodiment of the present invention in which the fusion protein comprises PRAME or an immunogenic fragment thereof, the protein D derivative of the present invention comprises approximately the first 1/3 of the protein, more specifically the amino acids 20 to 127. In an alternative embodiment of the present invention in which the fusion protein comprises PRAME or an immunogenic fragment thereof, the protein D comprises approximately the first 1/3 of the protein in which the N-terminal 109 amino acids of protein D are used. In one embodiment of the present invention the protein D portion does not include the secretion sequence of the protein. In one embodiment of the present invention the protein D derivative is not lip) dated. In one embodiment, the present invention provides a protein D construct, as described herein, as a fusion partner protein. The protein D construct may be a fusion partner protein for a construct additionally comprising a PRAME or MAGE-A3 construct as described herein or may be a fusion partner protein for a construct additionally comprising another cancer antigen or any other antigen. It seems that for fusion proteins comprising PRAME or an immunogenic fragment thereof and protein D, or for fusion proteins comprising protein D, or for a fusion partner protein comprising protein D, that the presence of the secretion sequence (or signal sequence) may detrimentally affect the amount of fusion protein produced. PRAME In one aspect the fusion protein of the present invention comprises a fusion partner protein as described herein and a PRAME antigen or immunogenic fragment thereof. Generally the PRAME protein has 509 amino acids and in one embodiment all 509 amino acids of PRAME may be used. Several cytotoxic T lymphocytle (CTL) epitopes have been identified on PRAME, for example: VLDGLDVLL (PRA10(M08; SEQ ID NO: 1.3); SLYSFPEPEA (PRA142"15i; SEQ ID NO:! 4); ALYVDSLFFL (PRA3O LYVDSLFFL (PRA301309; SEQ ID NO: 16) and SLLQHLIGL (PRA425^33; SEQ ID NO: 17) Generally it is desirable to include as many of these epitopes as possible into the antigen to generate a strong immune response and ensure the antigen is as immunogenic as possible. Although, it may be possible to compensate for a lower immunogenicity of a given construct by employing a formulation with a potent immunological adjuvant. Strong adjuvants are discussed below in more detail. In one aspect the invention provides the PRAME portion of the fusion protein comprising, consisting of or consisting essentially of full length protein. However, the invention also extends to PRAME constructs with conservative substitutions. In one embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acids may be substituted. The PRAME construct as described herein may additionally or alternatively contain deletions or insertions within the amino acid sequence when compared to the wild- type PRAME sequence. In one embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acids may be inserted or deleted. Conservative substitutions are well known and are generally set up as the default scoring matrices in sequence alignment computer programs. These programs include PAM250 (Dayhoft M.O. et al, (1978), "A model of evolutionary changes in proteins1', In "Atlas of Protein sequence and structure" 5(3) M.O. Dayhoft (ed.), 345-352), National Biomedical Research Foundation, Washington, and Blosum 62 (Steven Henikoft and Jorja G. Henikoft (1992), "Amino acid substitution matricies from protein blocks"), Proc. Natl. Acad. Sci. USA 89 (Biochemistry): 10915-10919. In general terms, substitution within the following groups are conservative substitutions, but substitutions between groups are considered non-conserved. The groups are: i) Aspartate/asparagine/glutamate/gluta mine ii) Serine/threonine iii) Lysine/arginine iv) Phenylalanine/tyrosine/tryptophane v) Leucine/isoleucine/valine/methionine vi) Glycine/alanine Generally the PRAME sequence/amino acids used in the fusion proteins of the invention will be greater than 80%, such as 85, 90, 95 and more specifically 99% identical to naturally occurring PRAME. However, those skilled in the art are aware that amino acid residues generated as a result of the cloning process may be retained in the recombinantly synthesized proteins. If thes;e do not detrimentally affect the characteristics of the product, it is optional whether or not they are removed. In one aspect the invention provides a fusion protein as described herein comprising, consisting of or consisting essentially of full length PRAME protein. In a further aspect the PRAME portion of the fusion protein of the present invention comprises, consists of or consists essentially of one or more of the following epitopes: VLDGLDVLL (PRAl0(M08; SEQ ID NO: 12); SLYSFPEPEA (PRAM2~151; SEQ ID NO:14); ALYVDSLFFL (PRA3OO~309; SEQ ID NO:1 5); LYVDSLFFL (PRA301"309; SEQ ID NO: 161 and SLLQHLIGL (PRA425"433; SEQ ED NO: 17). Fusion proteins In a further embodiment of the present invention, a tumour antigen other than PRAME or in addition to PRAME may be used in a fusion protein as described herein. In one embodiment, a fusion protein is provided comprising a fusion partner protein as described herein and one or more of the following tumour antigens or tumour antigen derivatives or an immunogenic portion thereof which is able to direct an immune response to the antigen: a MAGE antigen, for example a MAGE-A antigen such as MAGE 1, MAGE 2, MAGE 3, MAGE 4, MAGE 5, MAGE 6, MAGE 7, MAGE 8, MAGE 9, MAGE 10, MAGE 11, MAGE 12. These antigens are sometimes known as MAGE Al, MAGE A2, MAGE A3, MAGE A4, MAGE A5, MAGE A6, MAGE A7, MAGE A8, MAGE A9, MAGE A 10, MAGE Al 1 and/or MAGE A12 (The MAGE A family). In one embodiment, an antigen from one of two further MAGE families may be used: the MAGE B and MAGE C group. The MAGE B family includes MAGE Bl (also known as MAGE Xpl, and DAM 10), MAGE B2 (also known as MAGE Xp2 and DAM 6) MAGE B3 and MAGE B4 - the Mage C family currently includes MAGE Cl and MAGE C2. The MAGE antigen for use in the present invention may comprise the full length MAGE antigen. Alternatively, the MAGE antigen "nay comprise an immunogenic portion of MAGE in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids maybe deleted from or substituted in the amino acid sequence. In one embodiment of the present invention, 2 amino acids may be deleted from the N-terrninus of the MAGE sequence. In one embodiment of the present invention in which the antigen is MAGE-A3 or an immunogenic portion thereof, the sequence of MAGE-A3 maybe from amino acid 3 to 314 of MAGE-A3. In another embodiment, the tumour antigen or derivative for use in the present invention may be PRAME, BAGE, LAGE 1, LAGE 2 (also known as NY-ESO-1), SAGE, HAGE, XAGE, PSA, PAP, PSCA, P501S (also known as prostein), HASH1, HASH2, Cripto, B726, NY-BR1.1, P510, MUC-1, Prostase, STEAP, tyrosinase, telomerase, survivin, CASB616, P53, and/or Her-2/neu or an immunogenic portion thereof which is able to direct an immune response to the antigen In a further embodiment of the invention, the tumour antigen may comprise or consist of one of the following antigens, or an immunogenic portion thereof which is able to direct an immune response to the antigen: SSX-2; SSX-4; SSX-5; NA17; MELAN-A; P790; P835; B3O5D; B854; CASB618 (as described in WO00/53748); CASB7439 (as described in WOO 1/62778); C1491; C1584; and C158 5. In one embodiment, the antigen for use in the present invention may comprise or consist of P501S. P501S, also named prostein (Xu ei al., Cancer Res. 61,2001, 1563-1568), is known as SEQ ID NO. 113 of WO98/37814 and is a 553 amino acid protein. Immunogenic fragments and portions thereof comprising at least 20, preferably 50, more preferably 100 contiguous amino acids as disclosed in the above referenced patent application maybe used in fusion proteins of the present invention. Preferred fragments are disclosed in WO 98/50567 (PS 108 antigen) and as prostate cancer-associated protein (SEQ ID NO: 9 of WO 99/67384). Other preferred fragments are amino acids 51-553, 34- 553 or 55-553 of the full-length P501S protein. In one embodiment, the antigen may comprise or consist of WT-1 expressed by the Wilm's tumor gene; or an immunogenic portion thereof which is able to direct an immune response to the antigen; or the N-terminal fragment WT-1F comprising about or approximately amino acids 1-249 of WT-1 In a further embodiment, the antigen may comprise or consist of the antigen expressed by the Her-2/neu gene, or a fragment thereof or an immunogenic portion thereof which is able to direct an immune response to the antigen. Li one embodiment, the Her-2/neu antigen may be one of the following fusion proteins which are described in WO00/44899. The antigen for use in the present invention may comprise or consist of "HER-2/neu ECD- ICD fusion protein," also referred to as "ECD-ICD" or "ECD-ICD fusion protein," which refers to a fusion protein (or fragments thereof) comprising the extracellular domain (or fragments thereof) and the intracellular domain (or fragments thereof) of the HER-2/neu protein. In one embodiment, this ECD-ICD fusion protein does not include a substantial portion of the HER-2/neu transmembrane domain, or does not include any of the HER- 2/neu transmembrane domain. In a further embodiment, the antigen may comprise or consist of "HER-2/neu ECD-PD fusion protein," also referred to as "ECD-PD" or "ECD-PD fusion protein," or the "HER- 2/neu ECD-APD fusion protein," also referred to as "ECD-APD" or "ECD-APD fusion protein," which refers to fusion proteins (or fragments thereof) comprising the extracellular domain (or fragments thereof) and phosphorylation domain (or fragments thereof, e.g., APD) of the HER-2/neu protein. In one embodiment, the ECD-PD and ECD-APD fusion proteins do not include a substantial portion of the HER-2/neu transmembrane domain, or does not include any of the HER-2/neu trarsmembrane domain. The fusion proteins of the PRAME antigen and protein D fusion partner protein as described herein may be chemically conjugated, but are preferably expressed as recombinant fusion proteins, which may allow increased levels of PRAME protein to be produced in an expression system as compared to PRAME alone without fusion partner, such as protein D or modified protein D proteins. Additionally or alternatively, the tumour antigens described herein and the fusion partner protein of the present invention may be chemically conjugated or may be expressed as recombinant fusion proteins, which may allow increased levels of PRAME protein or another tumour antigen to be produced in an expression system as compared to PRAME or another tumour antigen alone without fusion partner, such as protein D or modified protein D proteins. Fusion proteins of the present invention, as described herein, may additionally comprise one or more linker sequences between the fusion partner protein and the tumour antigen or immunogenic portion thereof; or between the fusion partner protein and a His tail or other affinity tag (if present); or between the tumour antigen or immunogenic portion thereof and a His tail or other affinity tag(if present). The amino acids in the linker sequences may be unrelated to the sequences of the antigen and/or fusion partner. Fusion proteins of the present invention, as described herein, may additionally comprise amino acids Met-Asp-Pro at the N-termina! end of the fusion protein sequence. The Met amino acid may be from the original protein D sequence or may be from an unrelated sequence. The fusion partner may assist in expressing the protein (expression enhancer) at higher yields than the native recombinant protein. The fusion partner protein D, due to its foreign nature, maybe particularly immune genie in vivo and assist the fusion protein comprising PRAME or another tumour antigen by providing T helper epitopes, preferably T helper epitopes recognised by CD4 T-cells. Such CD4-T cells may be believed to contribute to generating a favourable immune response, in particular, a CD8 cytolytic T- cell response. In one embodiment, the fusion partner may act as both an expression enhancing partner and an immunological fusion partner. In one aspect the invention provides a fusion protein wherein the N-terminal portion of protein D (as described above or herein) is fused to the N-terminus of PRAME or an immunogenic fragment thereof. More specifically the fusion with the protein D fragment and the N-terminus of PRAME is effected such that the PRAME replaces the C-terminal- fragment of protein D that has been excised. Thus the N-terminus of protein D becomes the N-terminus of the fusion protein. In a further aspect the invention provides a fusion protein wherein the N-terminal portion of protein D (as described above or herein) is fused to the N-terminus or another portion of a tumour antigen or an immunogenic fragment thereof. More specifically the fusion with the protein D fragment and the N-terminus or other portion of a tumour antigen may be effected such that the PRAME or other tumour antigen or derivative thereof as described herein replaces the C-terminal-fragment of protein D that has been excised. Thus the N- terminus of protein D becomes the N-terminus of the fusion protein. Other fusion partners or fragments thereof may be included in fusion proteins of the invention or may replace the protein D element of the present invention, for example in embodiments comprising the PRAME antigen or a fragment or portion thereof as described herein. Examples of other fusion partners include: • the non-structural protein from influenzae virus, NS1 (hemagglutinin) - typically the N terminal 81 amino acids are utilised, although different fragments may be used provided they include T-helper epitopes, • LYTA derived from Streptococcus pneumoniae, which synthesize an N-acetyl-L- alanine amidase, amidase LYTA, (coded by the lytA gene {Gene, 43 (1986) page 265- 272} such as the repeat portion of the Lyta molecule found in the C terminal end for example starting at residue 178 such as residues 188 - 305. Purification of hybrid proteins containing the C-LYTA fragment at its amino terminus has been described {Biotechnology: 10, (1992) page 795-798. Fusion proteins of the invention may include an affinity tag, such as for example, a histidine tail comprising between 5 to 9 such as 6 histidine residues. These residues may, for example be on the terminal portion of protein D (such as the N-terminal of protein D) and/or the may be fused to the terminal portion of the PRAME antigen or derivative thereof, or the tumour antigen or derivative thereof as described herein. Generally however the histidine tail with be located on terminal portion of the PRAME antigen or derivative thereof, or the tumour antigen or derivative thereof as described herein such as the C-terminal end of the PRAME antigen or derivative thereof, or the tumour antigen or derivative thereof as described herein. Histidine tails may be advantageous in aiding purification. The present invention also provides a nucleic acid encoding the proteins of the present invention. Such sequences can be inserted into a suitable expression vector and used for DNA/RNA vaccination or expressed in a suitable host. Microbial vectors expressing the nucleic acid may be used as vaccines. Such vectors include for example, poxvirus, adenovirus, alphavirus, listeria and monophage. A DNA sequence encoding the proteins of the present invention can be synthesized using standard DNA synthesis techniques, such as by enzymatic ligation as described by D.M. Roberts et al. in Biochemistry 1985, 24, 5090-5098, by chemical synthesis, by in vitro enzymatic polymerization, or by PCR technology utilising for example a heat stable polymerase, or by a combination of these techniques. Enzymatic polymerisation of DNA may be carried out in vitro using a DNA polymerase such as DNA polymerase I (Klenow fragment) in an appropriate buffer containing the nucleoside triphosphates dATP, dCTP, dGTP and dTTP as required at a temperature of 10°-37oC, generally in a volume of 50ul or less. Enzymatic ligation of DNA fragments may be carried out using a DNA ligase such as T4 DNA ligase in an appropriate buffer, such as 0.05M Tris (pH 7.4), 0.01M MgCl2, 0.01M dithiothreitol lmM spermidine, lmM ATP and O.lmg/ml bovine serum albumin, at a temperature of 4°C to ambient, generally in a volume of 50ml or less. The chemical synthesis of the DNA polymer or fragments may be carried out by conventional phosphotriester, phosphite or phosphoramidite chemistry, using solid phase techniques such as those described in 'Chemical and Enzymatic Synthesis of Gene Fragments - A Laboratory Manual' (ed. H.G. Gassen and A. Lang), Verlag Chemie, Weinheim (1982), or in other scientific publications, for example M.J. Gait, H.W.D. Matthes, M. Singh, B.S. Sproat, and R.C. Titmas, Nucleic Acids Research, 1982, 10, 6243; B.S. Sproat, and W. Bannwarth, Tetrahedron Letters, 1983, 24, 5771; M.D. Matteucci and M.H. Caruthers, Tetrahedron Letters, 1980, 21, 719; M.D. Matteucci and M.H. Caruthers, Journal of the American Chemical Society, 1981, 103, 3185; S.P. Adams et al, Journal of the American Chemical Society, 1983,105, 661; N.D. Sinha, J. Biernat, J. McMannus, and H. Koester, Nucleic Acids Research, 1984, 12, 4539; and H.W.D. Matthes etal, EMBO Journal, 1984, 3, 801. The process of the invention may be performed by conventional recombinant techniques such as described in Maniatis et al, Molecular Cloning - A Laboratory Manual; Cold Spring Harbor, 1982-1989. In particular, the process may comprise the steps of: i) preparing a replicable or integrating expression vector capable, in a host cell, of expressing a DNA polymer comprising a nucleotide sequence that encodes the protein or an immunogenic derivative thereof; ii) transforming a host cell with said vector; iii) culturing said transformed host cell under conditions permitting expression of said DNA polymer to produce said protein; and iv) recovering said protein. The term 'transforming' is used herein to mean the introduction of foreign DNA into a host cell. This can be achieved for example by transformation, transfection or infection with an appropriate plasmid or viral vector using e.g. conventional techniques as described in Genetic Engineering; Eds. S.M. Kingsiran and A.J. Kingsman; Blackwell Scientific Publications; Oxford, England, 1988. The term 'transformed' or 'transformant' will hereafter apply to the resulting host cell containing and expressing the foreign gene of interest. The expression vectors are novel and also form part of the invention. The replicable expression vectors may be prepared in accordance with the invention, by cleaving a vector compatible with the host cell to provide a linear DNA segment having an intact replicon, and combining said linear segment with one or more DNA molecules which, together with said linear segment encode the desired product, such as the DNA polymer encoding the protein of the invention, or derivative thereof, under ligating conditions. Thus, the DNA polymer may be preformed or formed during the construction of the vector, as desired. The choice of vector will be determined in part by the host cell, which may be prokaryotic or eukaryotic bvit are generally E. coli or CHO cells. Suitable vectors may include plasmids for example TMCP14 or pET21 or pET26, pcDNA3, bacteriophages, cosmids and recombinant viruses. The preparation of the replicable expression vector may be carried out conventionally with appropriate enzymes for restriction, polymerisation and ligation of the DNA, by procedures described in, for example, Maniatis et al. cited above. The recombinant host cell is prepared, in accordance with the invention, by transforming a host cell with a replicable expression vector of the invention under transforming conditions. Suitable transforming conditions are conventional and are described in, for example, Maniatis et al. cited above, or "DNA Cloning" Vol. II, D.M. Glover ed., IRL Press Ltd, 1985. The choice of transforming conditiors is determined by the host cell. Thus, a bacterial host such as E. coli may be treated with a solution of CaCh (Cohen et al, Proc. Nat. Acad. Sci., 1973, 69, 2110) or with a solution comprising a mixture of RbCl, MnCh, potassium acetate and glycerol, and then \v th 3-[N-morpholino]-propane-sulphonic acid, RbCl and glycerol. Mammalian cells in culture may be transformed by calcium co- precipitation of the vector DNA onto the cells. The invention also extends to a host cell transformed with a replicable expression vector of the invention. The DNA may be codon optimized by standard techniques to further facilitate expression of the relevant host. In one embodiment of the present invention there is provided DNA encoding a fusion protein comprising a PRAME antigen or portion or fragment thereof as described herein, in which the nucleotide sequence of the PRAME antigen or portion or fragment thereof is codon-optimised. In one embodiment, the protein D nucleotide sequence is not codon-optimised. Culturing the transformed host cell under conditions permitting expression of the DNA polymer is carried out conventionally, as described in, for example, Maniatis et al. and "DNA Cloning" cited above. Thus, pre ferably the cell is supplied with nutrient and cultured at a temperature below 50°C. The proteins of the present invention may be expressed in prokaryotes or eukaryotes such as yeast but are often expressed in E. coli. Particular strains of E. coli such as AR58 and BLR DE3 may be employed. Generally a selection marker of, for example kanamycine resistance or ampicillin resistance is incorporated to facilitate identification of the successful incorporation of the recombinant gene/construct into the expression system. The product is recovered by conventional methods according to the host cell and according to the localisation of the expression product (intracellular or secreted into the culture medium or into the cell periplasm) In one embodiment of the present invention the expression product is intracellular. In one embodiment of the present invention the expression product is an insoluble protein Thus, where the host cell is bacterial, such as E. coli it may, for example, be lysed physically, chemically or enzymatically and the protein product isolated from the resulting lysate. Where the host cell is mammalian, the product may generally be isolated from the nutrient medium or from cell free extracts. Conventional protein isolation techniques nclude selective precipitation, adsorption chromatography, and affinity chromatography including a monoclonal antibody affinity column. In one embodiment of the invention there is provided a process for producing a fusion protein as described herein comprising the step of expressing in a cell a fusion protein comprising a fusion partner protein as described herein. The cell may be a bacterium. In one embodiment in which the cell is a bacterium, the bacterium may be E. coli. The process of the present invention may comprise the step of expressing a fusion protein as described herein in a cell as an insoluble protein. The process may further comprise the step of lysing the cell and purifying the expressed fusion protein from the lysed cells. In one embodiment of the invention there is provided a fusion protein obtained by or obtainable bv a method or nrocess described herein. The proteins of the present invention are provided either soluble in a liquid form or in a lyophilised form. It is generally expected that each human dose will comprise 1 to 1000 ug of protein, and preferably 30 - 300 ug. The present invention also provides pharmaceutical composition such as vaccine comprising a fusion protein of the present invention in a pharmaceutically acceptable excipient. The vaccine may optionally contain one or more other tumour-associated antigens or polypeptides, or preferably be combined with other cancer vaccines based on a tumour- associated antigen. For example, these tumour-associated antigens could be antigens as described herein and/or may be members belonging to the MAGE, LAGE and GAGE families or WT-1. In one embodiment the tumour-associated antigen may comprise or consist of the MAGE-A3 antigen. Vaccine preparation is generally described in Vaccine Design ("The subunit and adjuvant approach" (eds. Powell M.F. & Newman MJ). (1995) Plenum Press New York). Encapsulation within liposomes is described by Fullerton, US Patent 4,235,877. The proteins of the present invention may be preferably adjuvanted in the vaccine formulation of the invention. Suitable adjuvants may include an aluminium salt such as aluminium hydroxide gel (alum) or aluminium phosphate, but may also be a salt of calcium, iron or zinc, or may be an insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivatised polysaccharides, or polyphosphazenes. Other known adjuvants include CpG containing oligonucleotides. The oligonucleotides are characterised in that the CpG dinucleotide is unmethylated. Such oligonucleotides are well known and are described in, for example WO 96/02555. In the formulation of the inventions it may be desirable that the adjuvant composition induces an immune response preferentially of the TH1 type. In one embodiment there is provided an adjuvant system including, for example a combination of monophosphoryl lipid A, preferably 3-de-C)-acylated monophosphoryl lipid A (3D-MPL) together with an aluminium salt. The adjuvant may optionally also include CpG oligonucleotides to preferentially induce a TH1 response. An enhanced system that may be used in the present invention comprises the combination of a monophosphoryl lipid A and a saponin derivative particularly the combination of QS21 and 3D-MPL as disclosed in WO 94/00153, or, for example a less reactogenic composition where the QS21 is quenched with cholesterol as disclosed in WO 96/33739. A formulation that may be used in formulations of the present invention, comprising QS21 3D-MPL & tocopherol, for example in an oil in water emulsion, is described in WO 95/17210. Another adjuvant formulation that may be used in formulations of the present invention is QS21, 3D-MPL & CpG or equivalent thereof, for example in an oil in water emulsion or as a liposomal formulation. Accordingly in one embodiment of the present invention there is provided a vaccine comprising a fusion protein or fusion partner protein as described herein and an adjuvant, for example as described above. Combination of FRAME and MAGE In one embodiment of the present invention there is provided a composition comprising (a) an antigen component comprising a PRAME antigen or fusion protein as described herein and (b) an antigen component comprising ,i MAGE antigen or fusion protein as described herein. In one embodiment, the composition may further comprise an adjuvant as described herein. The MAGE antigen for use in the combination may comprise the full length MAGE antigen. Alternatively, the MAGE antigen may comprise an immunogenic portion of MAGE in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids may be deleted from or substituted in the amino acid sequence. In one embodiment of the present invention, 2 amino acids may be deleted from the N-terminus of the MAGE sequence. In one embodiment of the present invention in which the antigen is MAGE-A3 or an immunogenic portion thereof, the sequence of MAGE-A3 may be from amino acid 3 to 314ofMAGE-A3. For the combination described above, either or both of the PRAME and/or MAGE antigens may be part of a fusion protein or proteins as described herein, or the antigens may be present in other fusion proteins or may be presented as antigen alone. In one embodiment of the present invention there is provided a composition comprising a fusion protein comprising a PRAME antigen and fusion partner protein as described herein and a fusion protein comprising a MAGE A3 antigen and fusion partner protein as described herein. In an alternative embodiment, the fusion protein comprising the MAGE-A3 antigen comprises or consists of the MAGE-A3 antigen and a fusion partner protein comprising approximately the first 109 amino acids of protein D, in which one or two or more amino acids from protein D are optionally substituted, and in which the signal sequence of protein D is optionally present, in addition to the first 109 amino acids of protein D. The fusion proteins of the present invention may additionally optionally comprise one or more amino acids as "linkers" between the sequences of the antigen and the fusion partner protein or between the antigen and a His tail, if present. The amino acids may be unrelated to the sequences of the antigen and/or fusion partner. Fusion proteins of the present invention, as described herein, may additionally comprise amino acids Met-Asp-Pro at the N-terminal end of the fusion protein sequence. The Met amino acid may be from the original protein D sequence or may be from an unrelated sequence. In one embodiment, the sequence of a fusion protein comprising MAGE-A3 and protein D for use in the present invention is shown in Figure 12 and SEQ ID NO:43. The present invention also extends to methods of preparing said vaccines/ compositions. EXAMPLES Four fusion constructs were prepared and will be referred to herein as Examples/construct! 1, 2, 3 and 4. A codon optimized construct was prepared from example 3 and is designated as example 3a herein. A codon optimized construct was prepared from example 4 and is designated as example 4a herein. In Examples 3a and 4a the sequence in respect of the protein D portion of the molecule is the same. However, certain codons in the FRAME region were modified, to further improve expression and, in Example 3a, the linker between PRAME and the his tail has been removed. The fusion proteins of the above examples comprise the amino acids 20-127 of protein D. The amino acids Met, Asp and Pro were included at the N-terminal of the protein D fragment (ie amino acids MDP-20-127 Protein D). It is thought that these three additional amino acids may aid the stability of the protein and/or increase the level of the protein expression thereof. Amino acid 127 of protein D is fused to the N-terminal of full length PRAME (ie amino acid 127 of protein D is fused to N-terminal of PRAME). A histidine tag tail, to aid purification, was included in three of the six proteins. The exact sequence of the tail is dependent the plasmid used. Three different types of plasmids, TCMP14 and pET21 or pET26 were constructed: for each plasmid, DNA encoding for fusion protein was included with and without a histidine tail. Unless stated otherwise the general strategy below was used in the preparation of each of the examples. Cloning strategy for the generation of PD1/3-PRAME (with or without His-tag) recombinant protein using TCMP14 vector: Amplification of the sequences presented in the plasmid TCMP14 were done using a three steps PCR strategy. The vector pH!C348 containing the DNA sequence encoding the entire protein D gene has been obtained from DT. A. Forsgren, Department of Medical Microbiology, University of Lund, Malmo General Hospital, Malmo, Sweden. The DNA sequence of protein D has been published by Janson et al. (1991) { Janson H, LO Heden, A Grubb, M Ruan, & A Forsgren. 1991. Infect Immun 59:119-125}. The expression vector pMG81 is a derivative of pBR322, in which bacteriophage X derived control elements for transcription and translation of foreign inserted genes were introduced (Shatzman et al., 1983) { Shatzman A, YS Ho, & M Rosenberg. 1983. Experimental Manipulation of Gene Expression. Inouya (ed) pp 1-14. Academic: NY). In addition, the Ampicillin resistance gene was exchanged with the Kanamycin resistance gene. The coding sequence for the portion of NS1 protein (amino acid 4 to 81) was substituted for a multiple cloning sites to get pMG81 MCS. The coding sequence for the 1/3 protein D (amino acid 20 to 127) was cloned into pMG81 MCS using BamHI and Ncol restriction sites to get pMG81- 1/3PD. First, PCR amplification of the section corresponding to amino acid 20-127 of protein D was done using pMG81-l/3PD vector as template and oligonucleotide sense: 5'ATA TAA CAT ATG GAT CCA AGC AGC ;AT TCA TCA AAT 3' (CAN008; SEQ ID NO: 18) and antisense: 5' CCA CAA ACG CCT TCG TTC CAT GGT ITC AAA GTT TTC TGT C 3' (CAN037; SEQ ID NO: 19). PRAME cDNA obtained from the Ludwig Institute, Brussels, Belgium was inserted in the Bstxl-Notl sites of the pCDNAl vector (Invitrogen) to generate pCDNA-1-PRAME recombinant vector. PCR amplification of .he section corresponding to amino acid of PRAME protein was done using pcDNA-1 -PRAME vector (GSKBio) as template and oligonucleotide sense: 5' GAC AGA AAA CTT TGA AAC CAT GGA ACG AAG GCG TTT GTG G 3' (CAN036; SEQ ID NO: 20) and antisense: 5' AGA GAG ACT AGT CTA GTT AGG CAT 3AA ACA GGG GCA CAG3' (CAN029; SEQ ID NO: 21) or 5' GGA GGA ACT AGT GTT AGG CAT GAA 2.CA GGG GCA CAG 3' (CAN002; SEQ ED NO: 22) depending if a his-tail (CAN002) or not (CAN029) was added. The final PRAME sequence inserted in the TCMP14 plasmid was obtained following a PCR amplifications using the 1/3PD and PRAME gene templates that were generated in the preliminary steps for template and oligonucleotide sense: C AN008. and antisense: CAN029 or CAN002 depending if an his-tail was present (CAN002) or not (CAN029). Ndel at 5' end and Spel at 3' end sites were also added for cloning of the fragment into TCMP14 vector. Construction of the vector design to express the recombinant protein 1/3PD-PRAME with or without His-tag recombinant protein using pET21 vector : A recombinant cDNA plasmid called pcDNAl-PRAME (as described in the previous strategy) containing the coding sequence for PRAME gene and the vector PMG81-1/3PD (as described in the previous strategy) containing the N-terminal portion of the protein D coding sequence were used. The cloning strategy included the following steps. a) First, the 1/3PD sequence without secretion signal (secretion or signal sequence)was PCR amplified from plasmid PMG81-1/3PD using the oligonucleotide sense: 5' AGAGAGCATATGAGCAGCCATTCATCAAATATGGCG (C AN040; SEQ ID NO: 22), and the antisense: 5' ACGTGGGCGGCCGCGGTTTCAAAGTTTTCTGT2ATTTCTAA(CAN032; SEQ ID NO: 23); Ndel at the 5' end and Notl at the 3' end sites were also added for cloning of the fragment into pET21b(+) vector. b) The PRAME sequence was PCR amplified from plasmid pcDNAl-PRAME using the oligonucleotide sense: 5' TTGTTGGCGGCCGCAATGGAACGAAGGCGTTT3TGGGGT (CANO33; SEQ ID NO: 25), and the antisense: 5' GGAGGACTCGAGGTTAGGCATGAAACAGGGGC&CAG (CAN034; SEQ ID NO: 26); Notl at the 5' end and Xhol at the 3' end sites were also added for cloning of the fragment into pET21b vector. This amplification resulted in the addition at the C-terminal of the protein of two amino acids, Leu and Glu, followed by 6 His in pET21b(+) plasmid. For the generation of the protein without His-tag, a stop codon (TAG) was added at the 3' end of the PRAME gene by using CAN033 and CAN035 (antisense: 5' GGAGGACTCGAGCTAGTTAGGCATGAAACAGGGGCACAG (CAN035; SEQ ID NO: XX) instead ofCAN033andCAN034. c) Cloning into pET21b(+) plasmid (Invitrogen) of the above amplified fragments. d) Removal of Not 1 site between 1/3PD and PRAME by using QuikChange II Site- Directed Mutagenesis Kit (Stratagene) and the oligonucleotide sense: 5' CAGAAAACTTTGAAACCATGGAACGAAGGCG 5' cgccttcgttccatggtttcaaagttttctg e) Addition of two amino acids Asp and Pro following the Met at position 1 at the N- terminal of the protein D 1/3 by mutagenesis and using the oligonucleotide sense: 5' GGAGATATACATATGGATCCAAGCAGCCATTCATCAAATATGG (CAN104; SEQ ID NO: XX) and the antisense: 5' CCATATTTGATGAATGGCTGCTTGGATCCATATGTATATCTCC (CAN105; SEQ ID NO: XX). Construction of the vector design to express the recombinant protein 1/3PD-PRAME codon optimized (without or with His tag) in pET26 vector: The PRAME gene was codon optimized and cloned in pGA4 backbone with the addition of Not 1 and Xhol sites in the 5' end and the 3' end of the optimized gene respectively. This plasmid, named 0606420pGA4, was used to clone the gene in fusion with the PD1/3 in the pET26 vector using the following seeps. a) Removal of the Notl / Xhol fragment corresponding to the optimized PRAME sequence with a stop codon at the 3'end of the gene from 0606420pGA4 plasmid. b) Cloning of the optimized PRAME fragment into a pET26b(+) plasmid which contain the 1/3PD previously cloned Ndel/Notl with CAN040 and CAN032 oligonucleotides as described above and where Asp and Pro amino acids were added in N-terminal by mutagenesis method with CAN104 and CAN105 oligonucleotides. c) Removal of the Notl site by mutagenesis with oligonucleotides: sense 5' GACAGAAAACTTTGAAACCATGGAACGTCGTO3TCTGTGG (CAN 123", SEQ ID NO". XX) and antisense 5' CCACAGACGACGACGTTCCATGGTTTCAAAGTTTTCTGTC (CAN124; SEQ ED NO: XX). This resulted in 1/3PD-PRAME codon optimized fusion protein without His-tail. d) The plasmid was then used as a template; for the generation of 1/3PD-PRAME codon optimized with 6 His plasmid. PCR amplification of the fusion protein was done with oligonucleotides sense 51 GGAATTCCATATGGATCCAAGCAGCCATTC (CAN199; SEQ ED NO: XX) and a antisense 5' GGAGCTCTCGAGTCAGTGGTGGTGGTGGTGGTGGTTCGGCATAAAGCACGGGC (CAN198; SEQ ID NO: XX); Ndel at the 5' end, Xhol at the .5' end sites followed by 6 His and a stop codon were also added for cloning of the fragment into pET26b(+) vector. e) Cloning of the amplified fragment in pET26b For the production of the fusion protein, the DNA construct has been cloned into the expression vector TCMP14. This plasmid utilizes signals from lambda phage DNA to drive the transcription and translation of inserted foreign genes. The vector contains the lambda PL promoter PL, operator OL and two utilization sites (NutL and NutR) to relieve transcriptional polarity effects when N protein is provided (Gross et al., 1985. Mol. & Cell. Biol. 5:1015). The plasmid expressing the pD-PRAME fusion protein was designed so the PRAME amino acids were added to the C-terminal of a 108 amino acids derivative of pD without its signal sequence (secretion or signal sequence) (i.e. residues 20-127). To this construction, three unrelated amino acids (Met and Asp and a Proline) were added at the N-terminal of the derivative of pD, and for certain constructions a his tail at the C- terminal of the PRAME amino acids was included (see table A above). This construct could alternatively be described as containing 109 amino acids derivative of pD, if the N- terminal Met is considered to come from trie pD sequence. Host Strain and Transformation Hosts from E. Coli strain AR58 (Mott et al, Proc. Natl. Acad. Sci. USA, vol 82, pp 88-92, January 1985, Biochemistry) were transformed with plasmid DNA for Examples/ constructs 1 and 2. The AR58 lysogenic E. coli strain used for the production of Examples/constructs 1 and 2 is a derivative of the standard NIH E coli K12 strain N99 (F- su- galK2, lacZ- thr-). It contains a defective lysogenic lambda phage (galE::TN10,1 Kil- cI857 DH1). The Kil- phenotype prevents the shut off of host macromolecular synthesis. The cI857 mutation confers a temperature sensitive lesion to the cl repressor. The DH1 deletion removes the lambda phage right operon and the hosts bio, uvr3, and chlA loci. The AR58 strain was generated by transduction of N99 with a P lambda phage stock previously grown on an SA500 derivative (galE::TN10,1 Kil- cI85'? DHI). The introduction of the defective lysogen into N99 was selected with tetracyoline by virtue of the presence of a TN10 transposon coding for tetracyclin resistance in the adjacent galE gene. N99 and SA500 are E.coli K12 strains derived from Dr. Martin Rosenberg's laboratory at the National Institutes of Health. Vectors containing the PL promoter, are introduced into an E. coli lysogenic host to stabilize the plasmid DNA. Lysogenic host strains contain replication-defective lambda phage DNA integrated into the genome (Shatzman et al., 1983; In Experimental Manipulation of Gene Expression. Inouya (ed) pp 1-14. Academic Press NY). The lambda phage DNA directs the synthesis of the cl repressor protein which binds to the OL repressor of the vector and prevents binding of RNA polymerase to the PL promoter and thereby transcription of the inserted gene. The cl gene of the expression strain AR58 contains a temperature sensitive mutation so thai PL directed transcription can be regulated by temperature shift, i.e. an increase in culture temperature inactivates the repressor and synthesis of the foreign protein is initiated This expression system allows controlled synthesis of foreign proteins especially of those that may be toxic to the cell (Shimataka & Rosenberg, 1981. Nature 292:128). Hosts from E. Coli strain BLR (DE3) Novagen, WI, USA (catalogue number: 69053-4) BLR (DE3) Novagen, WI, USA (catalogue number: 69053-4) BLR is a recA~ derivative of BL21 that improves plasmid monomer yields and may help stabilize target plasmids containing repetitive sequences or whose products may cause the loss of the DE3 prophage (1,2) were transformed with plasmid DNA from examples/constructs 3 and 4. Each of transformation was carried out by standard methods with CaCh-treated cells (Hanahan D. « Plasmid transformation by Simanis. » In Glover, D. M. (Ed), DNA cloning. IRL Press London. (1985): p. 109-135.). Growth and induction of bacterial host strain Culture Bacteria were grown-on 20 ml of Luria-Bertani (LB) broth (BD) + 1% (w/v) glucose (Laboratoire MAT, catalogue number: GR-0101) + antibiotic(Carbenicillin 100 ug/ml for pET21b, kanamycin 40 |ag/ml for TCMPI -). Cultures were incubated at 33°C, for AR58 cells and at 37°C, for BLR (DE3) cells until an O.D.60onm around 0.8. • Induction At O.D.6oonm around 0.8, the cultures BLR (DE3) were induced at 1 mM isopropyl p-D-1- thiogalactopyranoside (IPTG; EMD Chemicals Inc., catalogue number: 5815) and incubated for 2 hours or 3 hours at 37°C alihough solubility may be increased if a lower temperature is used. At O.D.6oonm around 0.8, the cultures AR5S were induced by heat activation at 37°C and incubated for 7 hours. The bacterial growth was adequate for the Iwo expression systems. • Extraction and Purification of the Protein Upon expression of the polypeptide in culture, cells are typically harvested by centrifugation then disrupted by physical or chemical means (if the expressed polypeptide is not secreted into the media) and the resulting crude extract retained to isolate the polypeptide of interest. BugBuster™ Protein Extraction Reagent is used under conditions recommended by the suppliers (Novagen). PDl/3-Prame-his protein purification E. coli cell paste was resuspended in 20 mM Tns buffer pH 8.5 then passed through homogenizer system (Panda from Niro Soavi S.p.A. - 2 passes - 750 bars). After addition of 2 mM MgCl2 and Benzonase (50 U/mlh homogenate was incubated 1 hour at room temperature (RT) under gentle agitation then centrifuged 30 minutes at 15900 g and RT. Resulting pellet was resuspended in 20 m VI Tris buffer pH 8.5 containing 1% Sodium Dodecyl Sulphate (SDS) and 60 mM Glutathione and incubated 30 minutes at RT under gentle agitation. After centrifugation 30 minutes at 15900 g and RT, pellet was discarded. Centrifugation supernatant was 10-fold diluted in 20 mM Tris buffer containing 6.66 M Urea, 0.333 M sodium chloride (NaCl) and 11.11 mM Imidazole and then subjected to chromatographic separation on a Nickel ion metal affinity column (IMAC Sepharose 6 FF - GE Healthcare) equilibrated in a 20 mM Iris buffer pH 8.5 containing 0.1% SDS, 6.0 M Urea, 0.3 M NaCl and 10 mM Imidazole. After washing of the column with 20 mM Tris buffer pH 8.5 containing 0.5% Sarcosyl, 6.0 M Urea, 0.3 M NaCl and 10 mM Imidazole, antigen was eluted from the column by increasing the concentration of Imidazole up to 40 mM in the same washing buffer. After addition of phosphate up to 50 mM, antigen positive eluate was passed through a Macro-Prep Ceramic Hydroxyapatite type II column (Bio-Rad) equilibrated in a 20 mM Tris buffer pH 8.5 containing 50 mM phosphate, 0.5% Sarcosyl, 6.0 M Urea and 0.3 M NaCl. Hydroxyapatite flow-through containing the antigen was then diafiltered against 5 mM Borate buffer pH 9.8 containing 3.15% Sucrose on an Omega 30 kDa membrane (Pall). UltrafiHration retentate was sterilized by filtration through a 0.45/0.22 um Cellulose acetate membrane (Sartorius). Purified material was stored at -70°C. An alternative purification process has alsc been used, which differs from the above process in the following steps: - No benzonase treatment - No shift from SDS to sarcosyl on IMAC column (SDS from extraction up to HA step) - The buffer used for the diafiltration was 5 mM Tris buffer pH 8.5 - 0.5 M Argimne. This alternative purification process resulted in incomplete SDS removal with residual value around 0.05 and 0.085%. • Purification The expressed recombinant proteins were purified from supernatant fractions obtained after centrifugation of induced E. coli using a His-Bind metal chelation resin (QIAgen, Chatsworth, CA) according to the instructions from the resin manufacturer. Characterisation of the Protein SDS-Page: Gel: NuPAGE 4-12 % Bis-Tris Gel 1.0mm 15 or 26 wells (Invitrogen catalog number: NP0323BOX) See Figure 1 and 2 below, which show SDS page analysis of Example 3 and 4 and 3a and 4a respectively, wherein the different recombinant l/3pD-PRAME proteins with or Replacement page 30 without his-tag migrate on gel at an apparent molecular weight of ~70kDa. The recombinant proteins are found as an inclusion bodies in the E coli cell lysate, after induction. Preparation of samples, buffers and migration conditions were done under conditions recommended by the suppliers (Invitrogen). 1 Of.il of all preparations were loaded (before induction (BI) and after induction (AI)) in wells corresponding to 100 JJ.1 of culture equivalent. Fig 1 legend: SDS page analysis after Coomass le-blue staining of recombinant 1/3PD- PRAME after IPTG induction of E. coli BLR E)E3 strain transformed with recombinant pET2l. An equivalent of lOOuL of culture after 2 hours of induction in BLR DE3 strain with lmM IPTG at 25, 30 or 37°C has been loaded on gel. Clone #3 (1/3PD-PRAME / pET21) and Clone #4 (1/3PD-PRAME-His / pE.T21) are presented on gel before (BI) and after (AI) inductions in soluble (supernatant) and non-soluble (pellet) fractions. Lane 1 and 10: Standard Broad Range prestain (BioRad Cat#161 -0318), lane 2 (clone #3, BI, supernatant), lane 3 (clone #3, BI, pellet), lane 4 (clone #3, AI, 25°C, supernatant), lane 5 (clone #3, AI, 25°C, pellet), lane 6 (clone #3, AI. 30°C, supernatant), lane 7 (clone #3, AI, 30°C, pellet), lane 8 (clone #3, AI, 37°C, supernatant), lane 9 (clone #3, AI, 37°C, pellet), lane 11 (clone #4, BI, supernatant), lane 12 (clone #4, BI, pellet), lane 13 (clone #4, AI, 25°C, supernatant), lane 14 (clone #4, AI, 25°C, pellet), lane 15 (clone #4, AI, 30°C, supernatant), lane 16 (clone #4, AI, 30°C, pellet), lane 17 (clone #4, AI, 37°C, supernatant), lane 18 (clone #4, AI, 37°C, pellet). Fig 2 legend: SDS page analysis after Coomassie-blue staining of recombinant 1/3PD- PRAME after IPTG induction of E. coli BLR DE3 strain transformed with recombinant pET26. An equivalent of lOOuL of culture after 2 hours of induction in BLR DE3 strain with lmM IPTG at 25, 30 or 37°C has been loaded on gel. Clone #3a (I/3PD-PRAME codon optimized / pET26) and Clone #4a (1/3PD-PRAME-His codon optimized / pET26) are presented on gel before (BI) and after (AI) inductions in soluble (supernatant) and non- soluble (pellet) fractions. Lane 2 and 10: Standard Broad Range prestain (BioRad Cat#161- 0318), lane 1 (clone #3a, BI, supernatant), lane 3 (clone #3a, BI, pellet), lane 4 (clone #3a, AI, 25°C, supernatant), lane 5 (clone #3a, AI, 25°C, pellet), lane 6 (clone #3a, AI, 30°C, supernatant), lane 7 (clone #3a, AI, 30°C, pellet), lane 8 (clone #3a, AI, 37°C, Replacement page 30a supernatant), lane 9 (clone #3a, AI, 37°C, pellet), lane 11 (clone #4a, BI, supernatant), lane 12 (clone #4a, BI, pellet), lane 13 (clone #4a, Al, 25°C, supernatant), lane 14 (clone #4a, AI, 25°C, pellet), lane 15 (clone #4a, AI, 30°C, supernatant), lane 16 (clone #4a, AI, 30°C, pellet), lane 17 (clone #4a, AI, 37°C, supernatant), lane 18 (clone #4a, AI, 37°C, pellet). Western Blot Membranes were blocked for 30 minutes at 3'7°C, 60RPM using 3% milk/PBS IX fresh solution. After the blocking incubation, primary antibodies were added (rabbit anti- PRAME; GSK Biologicals SA) at dilution 1 5000 or a-6X His tag (AbCam) at dilution 1:3000 in 3% milk/PBS IX fresh solution for 1 hour at 37°C, 60RPM. After that, membranes were washed three times 5 minutes at room temperature using 0.02% Tween20/PBS IX. Secondary antibodies were added (perox donkey anti-IgG (H+L) rabbit (Jackson laboratory) at dilution 1:20 000 using 3% milk/PBS IX fresh solution. Membranes were incubated for 1 hour at 37°C, 60RPM. After that, membranes were washed three times 5 minutes at room temperature using 0.02% Tween20/PBS IX before the membrane expositions to peroxydase substrate (KH2PO4, l0mM; (NH^SCj, lOmM; O-dianisidine, 0.01% & hydrogen peroxide 0.045%) or alkaline phosphatase substrate (Sigma Fast) following the supplier's recommendations. Fig 11: SDS page analysis after Coomassie-blue staining of recombinant 1/3PD-PRAME with or without secretion signal after IPTG induction of E. coli BL21 DE3 strain transformed with recombinant pET21. An equivalent of lOOuL of culture after 3 hours of induction in BL21 DE3 strain with lmM IPTG at 37°C has been loaded on gel. Those constructs are presented on gel before (BI) and after (AI) inductions in soluble (supernatant) and non-soluble (pellet) fraci ons. Lane 1: Standard Broad Range prestain (BioRad Cat#161-0318), lane 2 (pDl/3-PRAME + SS, BI, supernatant), lane 3 (pDl/3- PRAME + SS, BI, pellet), lane 4 (pDl/3-PRAME + SS, AI, supernatant), lane 5 (pDl/3- PRAME + SS, AI, pellet), lane 6 (pDl/3-PRAME + SS + His, BI, supernatant), lane 7 (pDl/3-PRAME + SS + His, BI, pellet), lane 8 (pDl/3-PRAME + SS + His, AI, supernatant), lane 9 (pDl/3-PRAME + SS +• His, AI, pellet), lane 10 (pDl/3-PRAME w/o SS, BI, supernatant), lane 11 (pDl/3-PRAME w/o SS, BI, pellet), lane 12 (pDl/3-PRAME w/o SS, AI, supernatant), lane 13 (pDl/3-PRAME w/o SS, AI, pellet), lane 14 (pDl/3- PRAME w/o SS + His, BI, supernatant), lane 15 (pDl/3-PRAME w/o SS + His, BI, pellet), lane 16 (pDl/3-PRAME w/o SS + His, AI, supernatant), lane 17 (pDl/3-PRAME w/o SS + His, AI, pellet). Example 6: Immunofienicity of PD-PRAME-His formulated in ASQ1B or AS1S: dose range of antigen in a constant dose of adjuvant. Aim: dose-range of antigen to select the best dose to use in preclinical experiments Protocol: 6 groups of 12 CB6F1 mice received intra-muscular (IM) injections at day 0 and 14 of: l.PBS 2. PRAME (50* ug) in AS01B or AS 15 3. PRAME (lOug) in AS01B or AS15 4. PRAME (2ug) in AS01B or AS 15 5. PRAME (0.4ug) in AS01B or AS15 6. PRAME (0.08ug) in AS01B or AS 15 * 44.7ug actually administered instead of the 50|ig intended dose AS01B is a liposomal adjuvant formulation comprising QS21 and 3D-MPL; AS15 is a liposomal adjuvant formulation comprising QS21, 3D-MPL and CpG. The construct used in this example was Example/Construct 3a (pET26 with a His tail), provided in 5 mM Tris buffer pH 8.5 - 0.5 M Arginine. Protein provided in a borate buffer with sucrose may also be used. Read-outs: • Intracellular Cytokine Staining (ICS) 14 days post 2 injections after in vitro restimulation of spleen cells (4 pools of 3 mice per group) with the pool of peptides PRAME at lug/ml/peptide (15-mer) CD4 response (AS01B adjuvant) Results of ICS for CD4 cytokines for the AS01B adjuvant are shown in Figure 3. In this experiment it may be concluded that the best dose of PRAME antigen to induce a CD4 response in AS01B under these conditions seems to be 2\ig. CD8 response (AS01B adjuvant) Results of ICS for CD8 cytokines for the AS01B adjuvant are shown in Figure 4. The data appear to show a very low CD8 response and heterogeneity of the response intra-group. CD4 response (AS15 adjuvant) Results of ICS for CD4 cytokines for the AS 15 adjuvant are shown in Figure 5. These data appear to show that a similar CD4 response was induced with 44ug, 10(ig, 2ug and 0.4ug of PRAME formulated in AS 15; with a decreased response induced with 0.08|ig PRAME CDS response (AS 15 adjuvant) Results of ICS for CD8 cytokines for the AS 15 adjuvant are shown in Figure 6. These data appear to show no CD8 response (background in the PBS group) Example 7 In summary, for the inventions described herein, the following summary may be used to described specific constructs of PD1/3-PRAME that have so far been generated: Constructs used for PD1/3-PRAME - No signal sequence of Protein D are included (amino acids 2 to 19 of protein D) - The Methionine of Protein D is included IAA 1 of the protein D) - Two unrelated AA (Asp and Pro) are substituted for amino acids 2-Lys and 3-Leu of Protein D - The first 109 AA of protein D after the signal sequence of protein D are included (109 amino acids including the first Met in N-term + AA20 to 127 of the protein D) - AA 1 - 509 of PRAME are included (full length original sequence of PRAME) - With or without a His tail composed of one of the following: • Three unrelated amino acid (Thr, Ser and Gly) + 6 His residues for cloning in TCMP14 plasmid; or • Two unrelated amino acid (Leu and Glu) +- 6 His residues for cloning in pET21 plasmid; or • 6 His residues for cloning in pET26 plasnid. A marked up amino acid sequence of examples of constructs of the present invention is shown in Figure 7 Alignments of the following constructs are shown in Figures 8, 9 and 10: Alignment between LipoD-MAGE3-His and Dl/3-PRAME-His (Figure 8) Alignment between the shared sequence of the original protein D from Haemophilus influenzae and the LipoD-MAGE3-His (Figure 9) Alignment between the shared sequence of the original protein D from Haemophilus influenzae, the LipoD-MAGE3-His and the pDl/3-PRAME-His (Figure 10) Formulation of Vaccine preparation using fusion proteins: The fusion proteins of the invention can be formulated into vaccines which are either adjuvanted or not. In one embodiment, as an adjuvant, the formulation may comprise a mixture of 3 de -O-acylated monophosphoiyl lipid A (3D-MPL) and QS21 in an oil/water emulsion. The adjuvant system SBAS2 has been previously described WO 95/17210. The adjuvant for use in the present invention may alternatively comprise 3 de -O-acylated monophosphoryl lipid A (3D-MPL), QS21 and CpG in an oil-in water formulation or in a liposomal formulation. 3D-MPL: is an immunostimulant derived from the lipopolysaccharide (LPS) of the Gram-negative bacterium Salmonella minnesota. MPL has been deacylated and is lacking a phosphate group on the lipid A moiety. This chemical treatment dramatically reduces toxicity while preserving the immunostimulant properties (Ribi, 1986). It is believed that 3D-MPL combined with various vehicles may strongly enhance both the humoral and a TH1 type of cellular immunity. QS21: is a natural saponin molecule extracted from the bark of the South American tree Quillaja saponaria Molina. A purification technique developed to separate the individual saponines from the crude extracts of the bark, permitted the isolation of the particular saponin, QS21, which is a triteipene glycoside demonstrating stronger adjuvant activity and lower toxicity as compared with the parent component. QS21 has been shown to activate MHC class I restricted CTLs to several subunit Ags, as well as to stimulate Ag specific lymphocytic proliferation (Kensil, 1992). It is thought that there may be a synergistic effect of combinations of MPL and QS21 in the induction of both humoral and TH1 type cellular immune responses. The oil/water emulsion comprises an organic phase made of 2 oils (a tocopherol and squalene), and an aqueous phase of PBS containing Tween 80 as emulsifier. The emulsion comprised 5% squalene 5% tocopherol 0.4% Tween 80 and had an average particle size of 180 nm and is known as SB62 (see WO 95/17210). The resulting oil droplets should have a size of approximately 180 nm. The adjuvant for use in the present invention may be formulated as a combination of MPL and QS21, in an oil/water emulsion or in a liposomal formulation. This preparation should be delivered in vials of 0.7 ml to be admixed with lyophilised antigen or fusion protein (vials containing from 30 to 300 ng, antigen). Immunostimulatory oligonucleotides may also be used. Examples oligonucleotides for use in adjuvants or vaccines of the present invention include CpG containing oligonucleotides, generally containing two or more dinucleotide CpG motifs separated by at least three, more often at least six or more nucleotides. A CpG motif is a cytosine nucleotide followed by a guanine nucleotide. The CpG oligonucleotides are typically deoxynucleotides. In one embodiment the internucleotide in the otigonucleotide is phosphorodithioate, or more preferably a phosphorothioate bond, although phosphodiester and other internucleotide bonds are within the scope of the invention. Also included within the scope of the invention are oligonucleotides with mixed internucleotide linkages. Methods for producing phosphorothioate oligonucleotides or phosphorodithioate are described in US5,666,153, US 5,278,302 and WO 95/26204. Examples of oligonucleotides are as follows: TCC ATG ACG TTC CTG ACG TT (CpG 1826; SEQ ED NO: 36) TCT ccc AGC GTG CGC CAT (CpG 1758; SEQ ID NO: 37) ACC GAT GAC GTC GCC GGT GAC GGC ACC ACG TCG TCG TTT TGT CGT TTT GTC GTT (CpG 2006; SEQ ID NO: 38) TCC ATG ACG TTC CTG ATG CT (CpG 1668; SEQ ID NO: 39) TCG ACG TTT TCG GCG CGC GCC G (CpG 5456; SEQ ID NO: 40), the sequences may contain phosphorothioaie modified intemucleotide linkages. Alternative CpG oligonucleotides may comprise one or more sequences above in that they have inconsequential deletions or additions thereto. The CpG oligonucleotides may be synthesized by any method known in the art (for example see EP 468520). Conveniently, such oligonucleotides may be synthesized utilising an automated synthesizer. In one embodiment of the present invention an adjuvant combination for use in the invention includes one or more of the following components: 3D-MPL and QS21 (EP 0 671 948 Bl); oil in water emulsions comprising 3D-MPL and QS21 (WO 95/17210, WO 98/56414); or 3D-MPL formulated with other carriers (EP 0 689 454 Bl). Other adjuvant systems that may be used in the present invention comprise a combination of 3D-MPL, QS21 and a CpG oligonucleotide as described in US6558670 and US6544518. The final vaccine maybe obtained after reconstitution of the lyophilized formulation. References: 1. A. Roca (U. of Wisconsin), personal communication. 2. Studier, F.W. (1991) J. Mol. Biol. 219, 37-44. 3. Jan H. Kessler" et al The Journal of Experimental Medicine, Volume 193, Number 1, January 1,2001 73-88, 4. Ikeda H et al Immunity, Feb; 6(2): 1997, 199-208 CLAIMS: 1. A fusion protein comprising: (a) PRAME or an immunogenic fragment thereof, and (b) a heterologous fusion partner protein derived from protein D, wherein the said fusion partner protein does not include the secretion sequence or signal sequence from protein D. 2. A fusion partner protein derived from protein D, in which the fusion partner protein comprises amino acids Met-Asp-Pro at or within the N-terminus of the fusion protein sequence and in which the fusion partner protein does not include the secretion sequence or signal sequence of protein D. 3. A fusion partner protein according to claim 2, in which the protein D sequence comprises or consists of approximately or evactly amino acids 17 to 127, 18 to 127, 19 to 127 or 20 to 127 of protein D. 4. A fusion partner protein of any preceding claim in which one or more amino acids from the protein D fusion partner protein are deleted or replaced by substitution. 5. A fusion partner protein according to claim 4 in which the amino acids are substituted with conservative substitutions. 6. A fusion partner protein according to cluim 4 or 5 in which 1, 2, 3, 4, 5, 6, 7, 8, 9 or more amino acids are substituted. 7. A fusion partner protein according to any preceding claim in which the secretion sequence or signal sequence of protein D refers to approximately amino acids 1 to 16, 17, 18 or 19 of the naturally occurring prolein. 8. A fusion partner protein according to any preceding claim in which the secretion or signal sequence of protein D is the N-terminal 19 amino acids of protein D. 9. A fusion protein comprising the fusion partner protein of any of claims 2 to 8. 10. A fusion protein comprising the fusion partner protein of any of claims 2 to 8 and one or more tumour antigens or immunogenic portions thereof. 11. A fusion protein according to claim 9 or 10 comprising the tumour antigen PRAME or an immunogenic portion thereof. 12. A fusion protein according to claim 1 or 11 in which the immunogenic fragment or portion of PRAME comprises or consists of one or more of the following epitopes: .. „ .,. _ . inn_ms 13. A fusion protein according to claim 9 or 10 comprising one or more of the following tumour antigens or tumour antigen derivatives or an immunogenic portion thereof: MAGE 1, MAGE 2, MAGE 3, MAGE 4, MAGE 5, MAGE 6, MAGE 7, MAGE 8, MAGE 9, MAGE 10, MAGE 11, MAGE 12, MAGE Bl, MAGE B2, MAGE B3, MAGE B4, MAGE Cl, MAGE C2. 14. A fusion protein according to claim 13 in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids may be deleted from or substituted in the amino acid sequence of the MAGE antigen. 15. A fusion protein according to claim 14 in which 2 amino acids are deleted from the N-terminus of the MAGE sequence. 16. A fusion protein according to claim 13, 14 or 15 wherein the antigen is MAGE-A3 or an immunogenic portion thereof, in which the MAGE-A3 antigen comprises or consists of amino acid 3 to 314 of MAGE-A3. 17. A fusion protein according to claim 10 in which the tumour antigen or derivative thereof is selected from one of the following antigens or an immunogenic portion thereof which is able to direct an immune response to the antigen: WT-1. WT-1F, BAGE, LAGE 1, LAGE 2 (also known as NT-ESO-l), SAGE, HAGE, XAGE, PSA, PAP, PSCA, P501S (also known as prostem), HASH1, HASH2, Cripto, B726, NY- BR1.1, P510, MUC-1, Prostase, STEAP, tyrosinase, telomerase, survivin, CASB616, P53, and/or Her-2/neu, SSX-2; SSX-4; SSX-5; NA17; MELAN-A; P790; P835; B305D; B854; CASB618 (as described in WO00/53748); CASB7439 (as described in WO01/62778); C1491; C1584; and C1585. 18. A fusion protein according to any of clams 1 or 9 to 17, further comprising an affinity tag. 19. A fusion protein according to any of cla1ms 1 or 10 to 18 additionally comprising one or more linker sequences between the fusion partner protein and the tumour antigen or immunogenic portion thereof; and/or between the fusion partner protein and a His tail or other affinity tag; and/or between the tumour antigen or immunogenic portion thereof and a His tail or other affinity tag. 20. A nucleic acid sequence encoding a fusion protein or fusion partner protein as claimed in any of claims 1 to 19. 21. A vector comprising the nucleic acid sequence of claim 20. 22. A host cell transformed with the vector of claim 21. 23. A vaccine containing a fusion protein or fusion partner protein as claimed in any of claims 1 to 19 or a nucleic acid as claimed in claim 20 or a vector as claimed in claim 21. 24. A vaccine as claimed in claim 23 additionally comprising an adjuvant, and/or immunostimulatory cytokine or chemokine. 25. A vaccine as claimed in claim 24 wherein the adjuvant comprises 3D-MPL, QS21 and/or a CpG oligonucleotide. 26. A vaccine as claimed in any of claims 23 to 25 for use in medicine. 27. Use of a protein or nucleic acid or vector as claimed herein for the manufacture of a vaccine for immunotherapeutically treating a patient suffering cancer. 28. A process for producing a fusion protein comprising the step of expressing in a cell a fusion protein comprising a fusion partner protein according to any of claims 1 to 8. 29. A process according to claim 28 in which the cell is a bacterium. 30. A process according to claim 29 in which the bacterium is E. coli. 31. A process according to any of claims 28 to 30 in which the fusion protein is expressed in a cell as an insoluble protein. 32. A process according to claim 31 further comprising the step of lysing the cell and purifying the expressed fusion protein from the lysed cells. 33. A fusion protein obtained by or obtainable by the process of any of claims 28 to 32. 34. A method of treating a patient suffering from cancer comprising the step of administering a protein, nucleic acid, vector or vaccine as claimed herein. 35. The use of claim 27 or the method of claim 34 in which the cancer is selected from melanoma, breast, bladder, lung cancer such as NSCLC, sarcoma, ovarian cancer, head and neck cancer, renal cancer colorectal carcinoma, multiple myeloma, leukemia including acute leukemia and oesophageal carcinoma. The present invention relates to fusion proteins comprising an antigen derived from the so-called tumour rejection antigen PRAME (also known as DAGE) linked to an immunological fusion partner which provides T helper epitopes, such as, for example protein D from Haemophilus influenzae B, fusion partner proteins comprising fragments of protein D, methods for preparing the same and for formulating vaccines and use of the same for treating a range of cancers.

Documents:

2495-KOLNP-2009-(13-03-2014)-ANNEXURE TO FORM 3.pdf

2495-KOLNP-2009-(13-03-2014)-CORRESPONDENCE.pdf

2495-KOLNP-2009-(19-02-2014)-ABSTRACT.pdf

2495-KOLNP-2009-(19-02-2014)-ANNEXURE TO FORM 3.pdf

2495-KOLNP-2009-(19-02-2014)-CLAIMS.pdf

2495-KOLNP-2009-(19-02-2014)-CORRESPONDENCE.pdf

2495-KOLNP-2009-(19-02-2014)-DESCRIPTION (COMPLETE).pdf

2495-KOLNP-2009-(19-02-2014)-FORM-1.pdf

2495-KOLNP-2009-(19-02-2014)-FORM-13.pdf

2495-KOLNP-2009-(19-02-2014)-OTHERS.pdf

2495-KOLNP-2009-(19-02-2014)-PETITION UNDER RULE 137.pdf

2495-KOLNP-2009-(29-07-2013)-ABSTRACT.pdf

2495-KOLNP-2009-(29-07-2013)-CLAIMS.pdf

2495-KOLNP-2009-(29-07-2013)-CORRESPONDENCE.pdf

2495-KOLNP-2009-(29-07-2013)-DESCRIPTION (COMPLETE).pdf

2495-KOLNP-2009-(29-07-2013)-DRAWINGS.pdf

2495-KOLNP-2009-(29-07-2013)-FORM-1.pdf

2495-KOLNP-2009-(29-07-2013)-FORM-13.pdf

2495-KOLNP-2009-(29-07-2013)-FORM-2.pdf

2495-KOLNP-2009-(29-07-2013)-OTHERS.pdf

2495-kolnp-2009-abstract.pdf

2495-KOLNP-2009-ASSIGNMENT.pdf

2495-kolnp-2009-claims.pdf

2495-KOLNP-2009-CORRESPONDENCE 1.1.pdf

2495-kolnp-2009-correspondence.pdf

2495-kolnp-2009-description (complete).pdf

2495-kolnp-2009-drawings.pdf

2495-kolnp-2009-form 1.pdf

2495-kolnp-2009-form 18.pdf

2495-kolnp-2009-form 3.pdf

2495-kolnp-2009-form 5.pdf

2495-kolnp-2009-gpa.pdf

2495-kolnp-2009-international publication.pdf

2495-kolnp-2009-pct priority document notification.pdf

2495-kolnp-2009-pct request form.pdf

2495-kolnp-2009-sequence listing.pdf

2495-kolnp-2009-specification.pdf

abstract-2495-kolnp-2009.jpg