Title of Invention	"RECOMBINANT CHIMERIC FUSION PROTEIN AND PROCESS OF PREPARATION THEREOF"
Abstract	The present invention relates to A recombinant chimeric fusion protein comprising conserved portions of hbl A gene as the binding component; hbl D and hbl C genes as the lytic components and process for preparing the same.

Full Text

TECHNICAL FIELD The present invention relates to the construction of a new and specific fusion gene encoding 56 kDa chimeric protein composed of L1, L2 and B moieties of HBL toxin of Bacillus cereus. BACKGROUND Bacillus cereus, a soil-borne bacterium which causes diarrheal and emetic food poisoning and a variety of typically necrotic nongastro-intestinal infections. Among the many potential virulence factors of B. cereus, Haemolysin BL (HBL) is a unique and potent three-component pore-forming toxin consisting of three distinct proteins namely, Binding component (B), Lytic component 1 (L1) and Lytic component 2 (L2) coded by hbl A, hbl D and hbl C genes, respectively. HBL besides being hemolytic also exhibits dermonecrotic and cytotoxic activities and has a significant role in causing severe eye infections like endophthalamitis. The existence of HBL toxin has been determined in all the species of the B. cereus group with the exception of Bacillus anthracis. Earlier attempts to clone individual L1 and L2 components of HBL of B. cereus described in the art were not successful mainly because of high toxicity of individual proteins to E. coli. Detection systems based on the Polymerase Chain Reaction (PCR) are described in the art are specific and accurate. The main disadvantage of these PCR systems is their ability to identify only potential HBL producing bacteria that may not always correlate to the expression of toxin components by the organism. Also for each of the individual toxin gene, separate PCR is required. So far, immunoassays that are available in the art identify only the L2 component of the Hemolysin BL complex that too for a qualitative estimation of this toxin component. There is a high degree of molecular heterogeneity observed among the toxin components of HBL that often results in problems for their specific identification. Further, there is no single system available to detect all the three toxins in one assay. Since all the three (B, L1 and L2) components of HBL are required for full enterotoxic activity, detection/identification of all the three toxins, therefore, is needed to determine the virulence of a B. cereus strain. OBJECTIVE The principal object of the present invention is to provide a recombinant chimeric protein comprising conserved portions of hbl A, hbl D and hbl C genes and their amplification by PCR. Another object of the present invention is to provide an immunoassay for the detection of Haemolysin BL toxin producing bacillus cereus group strains comprising polyclonal antibodies generated against recombinant chimeric protein comprising conserved portions of hbl A, hbl D and hbl C genes. Still another object of the present invention is to provide an immunoassay which detects all the three toxins in one assay. SUMMARY The present invention relates to a recombinant chimeric fusion protein comprising conserved portions of - hbl A gene as the binding component; - hbl D and hbl C genes as the lytic components. The present invention further relates to a process for the preparation of the recombinant chimeric fusion protein comprising the steps of - designing three pairs of primer sequences to amplify conserved portions of hbl D, hbl C, hbl A genes; - introducing restriction sites into the 5' and 3' flanking sites of said primer sequences to facilitate ligase dependent directional cloning; - amplifying the conserved portions of hbl D, hbl C, hbl A genes by polymerase chain reaction (PCR) to obtain amplified PCR products; - digesting the amplified PCR products with restriction enzymes to facilitate directional dependent cloning; - ligating the digested PCR products on the restriction enzyme digested pRSET A vector to obtain ligated PCR products; - cloning the ligated PCR products on the pRSET vector; - screening the clones using forward and reverse primers to obtain the fusion gene. BRIEF DESCRIPTION OF DRAWINGS Figure 1: Construction of plasmid used for the expression of HBL fusion protein: Figure 2: Electrophoretic analysis of E. coli expressed chimeric protein: Figure 3: Purification of E. coli expressed HBL fusion protein: Figure 4: Immunogenicity of the HBL fusion protein DETAILED DESCRIPTION Haemolysin BL is a unique and potent three component pore forming toxin composed of a binding component, B, and two lytic components, L1 and L2 Conserved regions of hbl A (B), hbl D (L1) and hbl C (L2) of HBL were targeted and cloned together using ligase dependant directional cloning in to pRSET vector and expressed in E. coli. The resultant 56 kDa fusion protein was purified using Ni-NTA chromatography. Polyclonal antibodies were raised against this purified fusion protein and the antigenicity was confirmed by Western blot/ELISA using the purified protein as well as Bacillus cereus culture supernatants. The genetic material can be used to produce sufficient quantities of protein to be used in diagnostic methods for HBL toxin producing Bacillus cereus strains and also for vaccine development. Figure 1 depicts Left panel and Right panel. The left panel comprises plasmid pRSET A, an expression vector containing P, T7 promoter; R, synthetic ribosome binding site; H, 6X Histidine affinity tag sequence; EX, express epitope; MCS, multiple cloning site; T, transcriptional terminator; O, origin of replication and ampr, ampicillin resistance gene. BXSBPPKNEBH in MCS are sites for restriction endonucleases BamH I, Xho I, Sac I, Bgl II, Pst I, Pvu II, Kpn I, Nco I, EcoR I, BstB I and Hind III respectively. Right panel: The entire HBL operon of B. cereus ATCC 14579. hbl D (codes for L1 component of HBL), hbl C (codes forL2 component of HBL), hbl A (codes for B component of HBL) were amplified by PCR with new restriction sites added at the ends by primers and cloned into the BamH I and Hind III sites of pRSET A to generate a chimeric protein. The size of the clone is 1501 bp. Figure 2 provides electrophoretic analysis of E. coli expressed chimeric protein. All samples were separated by electrophoresis through SDS-12% PAGE. The gel was stained with Coomassie blue in order to visualize protein components. Lane 1, Uninduced E. coli BL21 (DE3) pLysS cells with the vector containing fusion gene; lane 2, cells expressing HBL fusion protein after 5 h; Lane 3, cells expressing HBL fusion protein after 3 h; lane 4, cytosolic proteins of cells expressing HBL fusion protein; lane 5, inclusion bodies of cells expressing HBL fusion protein; lane M, Molecular weight standards; Figure 3 depicts the purification of E. coli expressed HBL fusion protein. The proteins were analyzed on 12% SDS-PAGE and stained with Coomassie blue. Lane M, Molecular weight standards; Lane 1, HBL fusion protein during First elution of Ni-NTA affinity chromatography; Lane 2, Second Elution; Lane 3, Third elution; Lane 4, Uninduced E. coli BL21 (DE3) pLysS cell with the vector containing fusion gene. Figure 4 relates to the immunogenicity of the HBL fusion protein. Protein samples were fractionated by SDS-12% PAGE and then electrophoretically transferred to nitrocellulose. Lanes M is for Molecular weight standards; lane 1 is for Recombinant HBL fusion protein; Lane 2 is for Bacillus cereus ATCC 14579 hemolysin BL toxin obtained from culture supernatant; and Lane 3 is for HBL toxin negative Bacillus cereus NCIM 2185 culture supernatant. The blot is probed with total antiserum to the purified recombinant fusion protein. The present invention has targeted conserved portions of genes of the L1, L2 and B components of tripartite protein HBL using NCBI database. These sequences were amplified by PCR and restriction sites were introduced into the 5' and 3' flanking sites of these three sequences to facilitate ligase dependant directional cloning and to obtain fusion gene by encoding for the chimeric protein composed of L1, L2 and B moieties of HBL toxin. Since the 56 kDa chimeric protein is central to the detection of all the three components of tripartite HBL toxin, availability of the protein in significant quantities in pure form will allow the design of comprehensive and specific diagnostics for HBL toxin of Bacillus cereus. It also provides a source for candidate vaccine molecule against B. cereus group enterotoxin producing strains. Following primers are used for the amplification of conserved portions of hbl D, hbl C and hbl A genes encoding for Li, L2 and B components of tripartite protein HBL: Primer Sequence (5'- 3') Product Target Accession size gene no L1Bam ACTACCGGATCCACTATTCATG 590 hblD AJ237785.1 L1 Kpn TGAAGTTGTGGTACCGTTGC L2Kpn CACCAATGGTACCAGCAGAA 471 hbl C AJ237785.1 L2 Sal TACTTAGTCGACCTTGCGCA BSal AAAAGGGTCGACTATTTGCA 493 hbl A AJ237785.1 B Hind GATCCTAAAGCTTCTTCTAGACG Table 1 Following is the nucleotide sequence of the recombinant fusion gene of HBL toxin. The open reading frame (ORF) starts at 1bp nucleotide position with start codon "GGA" and stops with codon "CTT" at 1499bp nucleotide position. 1 ggatccacta ttcatgcatt tgcacaagaa acgaccgctc aagaacaaaa agtaggcaat 61 tatgcattag gccccgaagg actgaagaaa gcattagctg aaacagggtc tcatattcta 121 gtaatggatt tatacgcaaa aacaatgatt aagcaaccaa atgtaaattt atctaatatc 181 gatttaggct cagagggggg agagttgctc aaaaatattc accttaatca agagctgtca 241 cgaatcaatg cgaattactg gttagataca gcgaagccac agattcaaaa aactgctcgt 301 aatattgtaa attacgatga acaatttcaa aattattacg acacattagt agaaactgta 361 caaaagaaag ataaggcagg tctaaaagag ggtataaatg atttaattac tacaatcaat 421 acaaattcaa aagaagttac agatgtgatt aagatgctac aagacttcaa agggaaacta 481 tatcaaaatt ctacagattt taaaaataat gttggtggtc cagatgggaa aggtggatta 541 actgcaatat tagcaggtca acaggcaacg gtaccagcag aaactcaaca ggaaggcatg 601 gatatttcct cttcattacg aaaattaggt gcgcaatcta aattaatcca aacgtatatt 661 gatcaatctt taatgagtcc taatgtacag ttagaggaag tcacagcttt aaatacaaat 721 caattcctaa tcaaacaaga tatgaaggaa tggtcatcgg aactctatcc acagttaatt 781 ctattaaatt caaaaagcaa aggatttgta acaaaattta atagctatta cccgacatta 841 aaatcgtttg tagacaataa agaagataga gaagggtttt cggatagact tgaagtactt 901 caagaaatgg ctatgacgaa tcaagaaaat acgcaacggc aaatcaatga attaacagat 961 cttaaattac agcttgataa aaaattaaaa gattttgata ccaatgtggc aactgcgcaa 1021 ggtcgactat ttgcaaaatc tatgaatgcc tattcttata tgttaattaa gaatcctgat 1081 gtgaattttg agggaattac cattaatgga tatgtagatt tacctggtag aatcgtacaa 1141 gatcaaaaga atgcaagggc acatgctgtt acttgggata cgaaagtaaa aaaacagctt 1201 ttagatacat tgaatggtat tgttgaatac gatacaacat ttgacaatta ttatgaaaca 1261 atggtagaag cgattaatac aggggatgga gaaactttaa aagaagggat tacagatttg 1321 cgaggtgaaa ttcaacaaaa tcaaaagtat gcacaacaac taatagaaga attaactaaa 1381 ttaagagact ctattggaca tgatgttaga gcttttggaa gtaataaaga gctcttgcag 1441 tcaattttaa aaaatcaagg tgcagatgtt gatgccgatc aaaagcgtct agaagaagct 15011 Following is the amino acid sequence coded by the fusion gene for the recombinant protein : SEQUENCE ID NO. 1 Gly Ser Thr He His Ala Phe Ala Gin Glu Thr Thr Ala Gin Glu Gin Lys Val Gly Asn Tyr Ala Leu Gly Pro Glu Gly Leu Lys Lys Ala Leu Ala Glu Thr Gly Ser His He Leu Val Met Asp Leu Tyr Ala Lys Thr Met He Lys Gin Pro Asn Val Asn Leu Ser Asn He Asp Leu Gly Ser Glu Gly Gly Glu Leu Leu Lys Asn He His Leu Asn Gin Glu Leu Ser Arg He Asn Ala Asn Tyr Trp Leu Asp Thr Ala Lys Pro Gin He Gin Lys Thr Ala Arg Asn He Val Asn Tyr Asp Glu Gin Phe Gin Asn Tyr Tyr Asp Thr Leu Val Glu Thr Val Gin Lys Lys Asp Lys Ala Gly Leu Lys Glu Gly He Asn Asp Leu He Thr Thr He Asn Thr Asn Ser Lys Glu Val Thr Asp Val He Lys Met Leu Gin Asp Phe Lys Gly Lys Leu Tyr Gin Asn Ser Thr Asp Phe Lys Asn Asn Val Gly Gly Pro Asp Gly Lys Gly Gly Leu Thr Ala He Leu Ala Gly Gin Gin Ala Thr Val Pro Ala Glu Thr Gin Gin Glu Gly Met Asp He Ser Ser Ser Leu Arg Lys Leu Gly Ala Gin Ser Lys Leu He Gin Thr Tyr He Asp Gin Ser Leu Met Ser Pro Asn Val Gin Leu Glu Glu Val Thr Ala Leu Asn Thr Asn Gin Phe Leu He Lys Gin Asp Met Lys Glu Tip Ser Ser Glu Leu Tyr Pro Gin Leu He Leu Leu Asn Ser Lys Ser Lys Gly Phe Val Thr Lys Phe Asn Ser Tyr Tyr Pro Thr Leu Lys Ser Phe Val Asp Asn Lys Glu Asp Arg Glu Gly Phe Ser Asp Arg Leu Glu Val Leu Gin Glu Met Ala Met Thr Asn Gin Glu Asn Thr Gin Arg Gin He Asn Glu Leu Thr Asp Leu Lys Leu Gin Leu Asp Lys Lys Leu Lys Asp Phe Asp Thr Asn Val Ala Thr Ala Gin Gly Arg Leu Phe Ala Lys Ser Met Asn Ala Tyr Ser Tyr Met Leu lie Lys Asn Pro Asp Val Asn Phe Glu Gly He Thr He Asn Gly Tyr Val Asp Leu Pro Gly Arg He Val Gin Asp Gin Lys Asn Ala Arg Ala His Ala Val Thr Trp Asp Thr Lys Val Lys Lys Gin Leu Leu Asp Thr Leu Asn Gly He Val Glu Tyr Asp Thr Thr Phe Asp Asn Tyr Tyr Glu Thr Met Val Glu Ala He Asn Thr Gly Asp Gly Glu Thr Leu Lys Glu Gly He Thr Asp Leu Arg Gly Glu He Gin Gin Asn Gin Lys Tyr Ala Gin Gin Leu He Glu Glu Leu Thr Lys Leu Arg Asp Ser He Gly His Asp Val Arg Ala Phe Gly Ser Asn Lys Glu Leu Leu Gin Ser He Leu Lys Asn Gin Gly Ala Asp Val Asp Ala Asp Gin Lys Arg Leu Glu Glu Ala Asp lie Ser Cys Leu Ala He Met Glu Arg Trp Arg He Thr Glu Chimeric protein based on this fusion gene sequence representing no variations thereof will have majority of the epitopes of Li, L2 and B moieties of HBL and will therefore be useful in vaccine or diagnostic development or other studies. This fusion protein can also be used (and are indeed more likely to be used) as immunogen for the preparation of antibodies or as standards in assays that use antibodies to the HBL toxin as a method of identifying the presence of HBL producing Bacillus cereus group strains. Following is the Western blot analysis of culture free supernatants of Bacillus cereus strains and non Bacillus strains (Table Removed) Table 2 Bacterial strains, culture media, growth conditions and DNA sample preparations The bacterial strains used in this study are listed in Table 2. Reference strains of Bacillus cereus obtained from ATCC and National Center for Industrial Microorganisms (NCIM, Pune) were used to evaluate the immunogenicity of recombinant fusion protein after raising of polyclonal antisera in mice followed by Western blotting. Four Bacillus cereus strains could be recovered from different soil samples of Karnataka region by using mannitol-egg yolk - polymyxin agar (Himedia, India) as selective culture medium. Recombinant HBL fusion protein: The conserved regions of the L1, L2, and B components of HBL were PCR amplified and cloned in pRSET A vector. Restriction enzyme digestion of cloned vector revealed a 2.9-kb fragment and 1.5 kb fragment as predicted. E. coli BL 21 DE3 (plys) cells were transformed with the recombinant plasmid. To establish the expression of the recombinant protein, cells were grown and induced by ImM IPTG for 5 h. The presence of HBL fusion protein was determined by SDS-PAGE analyses of cytosol and inclusion bodies. The recombinant fusion protein appeared to be aggregating to form inclusion bodies. Procedure Bacterial strains and Media Reference strain B. cereus ATCC 14579 (obtained from American Type Cultural Collection. Brain Heart Infusion) is used to propagate the B. cereus ATCC 14579 strain. For molecular biology experiments, the B. cereus ATCC 14579 is cultured on Luria broth. Cloning of fusion gene Primer designing Conserved portions of genes of the L1, L2 and B components of tripartite protein HBL have been selected using NCBI database. Three pairs of PCR primers are designed to amplify conserved portions of hbl D, hbl C and hbl A genes by PCR. Restriction sites are introduced into the 5' and 3' flanking sites of these three primer sequences to facilitate ligase dependant directional cloning. Polymerase Chain Reaction Bacillus cereus ATCC 14579 genomic DNA is extracted by standard protocol and 375 pg of the DNA was used as template for the PCR amplification using L1 (hbl D), L2 {hbl C) and B {hbl A) primers individually. PCR amplification is performed under the following conditions : The PCR reaction mixture for generation of amplified products contains 300 nM of each primer, 200 mM each dNTP, 0.5 units of Taq polymerase, 2.0 mmol l-1 MgCl2 in IXPCR buffer. The reaction procedure consisted of 30 cycles of denaturation at 94°C for 1 min followed by primer annealing at 54°C for 1 min and extension at 72°C for 1 min. The DNA is denatured for 4 min in the beginning and finally the duration is extended for 5 min at 72°C. The PCR products are analyzed by agarose gel electrophoresis and the size of the PCR products is 575 bp, 457 bp, 459 bp of hbl A, hbl D and hbl C genes, respectively. Cloning of hbl A, hbl D and hbl C genes together in expression vector The amplified PCR products of the hbl A, hbl D and hbl C genes were cloned together on to pRSET A vector (Invitrogen). The advantage of pRSET A vector is that it contains T7 promoter, which is highly specific for T7 RNA polymerase thus leading to higher expression of genes cloned under T7 promoter. This vector also contains a nucleotide sequence that encodes a metal binding domain, a series of six consecutive Histidine amino acids expressed as N-terminal fusion to the protein of interest. This metal binding domain (Six-tagged Histidine moieties) on the fusion peptide has high affinity for the divalent ions (like nickel, copper and cobalt) and facilities one step purification of the protein using (IMAC) immobilized metal affinity columns. The amplified PCR products of the hbl A are digested with Bam H I and Kpn I, of hbl D with Kpn I and Sal I and of hbl C with Sal I and Hind III restriction enzymes to facilitate directional dependant cloning. The restriction digested PCR products of hbl A, hbl D and hbl C are ligated on to Bam H I and Hind III digested pRSET A vector. The clones are screened using L i forward primer: ACTACCGGATCCACTATTCATG and B reverse primer: GATCCTAAAGCTTCTTCTAGACG. The presence of fusion gene in pRSET A vector is confirmed by restriction analysis using Bam HI and Hind III enzymes. Sequence of fusion gene The DNA sequencing of the fusion gene is carried out using L1 forward and B reverse primers. The sequence of the entire fusion gene is 1501 bp with GC and AT composition of 33.71 % and 66.29%. The fusion gene codes for 500 amino acids and predicted size of the protein is 56250 Daltons. Protein Expression: The protein expression of fusion gene is carried out in BL21 (DE3) E.coli host. The E.coli BL21 (DE3) contains chromosomal copy of T7 RNA polymerase gene under control of lac UV5 promoter and hence expression of genes cloned under T7 promoter can be induced with gratuitous inducer such as IPTG. Further BL21 (DE3) being a Ion protease deficient strain which protects the expressed heterologous proteins from proteolytic cleavage. The chimeric protein composed of L1 (hbl D), L2 (hbl C) and B (hbl A) moieties was expressed in E.coli BL21 (DE3) after inducing with IPTG. The following protocol was conducted for expression of the recombinant proteins (Luria broth was supplemented with 100 ug/ml of ampicillin for the following experiment) The E. coli cells carrying the recombinant plasmid are grown at 37 °C in Luria Bertani broth with 100 ug of ampicillin per milliliter at 200 rpm in 500 ml flask. When A600 reaches 0.6, IPTG is added to a final concentration of ImM. After 5 h of induction, cells are harvested by centrifugation at 4000g for 20 min. To check for cytosolic localization of the recombinant protein, the pellet from 100 ml culture is resuspended in 5 ml sonication buffer (50mM Na-phosphate, pH 7.8, 300 mM NaCl). Cells are sonicated at 4°C for 9 cycles (1- min bursts/ 1-min cooling/300W). The lysate is centrifuged at 10,000g for 30 min. Cytosolic extract is collected in the form of supernatant while the pellet (insoluble matter) is solubilized in 5 ml of 8 M Guanidine hydrochloride, 0.1 M Na- phosphate, 0.1M Tris-Cl, pH 8.0 by stirring for 1 h at room temperature. Tubes are centrifuged at 10,000g for 30 min at 4 °C and the supernatant (inclusion bodies) is collected. All the samples are examined on 12% Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE). Purification of the Recombinant chimeric protein: As HBL fusion protein was mainly localized as the inclusion bodies, the protein was purified under denaturing conditions. The pellet from 200 ml of culture is resuspended in 5 ml of buffer containing 6 M GuHCl, 0.1 M Na phosphate, and pH 7.8. Cells are stirred at room temperature for lh. Lysate is centrifuged at 10,000g for 30 min at 4 °C. The supernatant (inclusion bodies) is collected and added to Qiagen NI-NTA 50% resin and mixed gently by shaking at 200 rpm for 60 min at room temperature and then the resin was loaded carefully into an empty column with the bottom cap still attached. The column is washed with 4 column volumes of buffer containing 8 M urea, 0.1 M Na-phosphate, 0.01 mM Tris-Cl (pH 8.0) to facilitate the removal of GuHCl. The column is then washed with a buffer containing 8 M urea, 0.1 M Na-phosphate, 0.01 mM Tris-Cl and pH 6.3 to facilitate the removal of contaminating proteins. [046] The recombinant protein is eluted with a buffer containing 8 M urea, 0.1 M Na-phosphate, 0.01 mM Tris-Cl (pH 4.5). The fractions are analyzed on SDS-PAGE and those containing the protein are pooled and dialyzed against T10E5 (Tris 10mM and EDTA 5 mM, pH 8.0) buffer. The protein content is estimated by the method of Lowry and coworkers (1956). Mouse immunization: BALB/c mice were immunized with HBL fusion protein (50µg/mouse) intramuscularly. First injection was administered with FCA (Freund's Complete Adjuvant, Sigma, USA) and the following doses were given at the intervals of one week with FIA (Freund's Incomplete Adjuvant). The antibody reactivity of immunized mice sera was measured by plate-ELISA. The recombinant protein was observed to be highly immunogenic in mice. Polyclonal antibodies could be made use of in Western blot/ELISA. HBL crude toxin preparation from Bacillus cereus cultures: [034] The culture medium used for the production of crude hemolysin BL toxin, consisted of 2% casaminoacids, 0.4% glucose, 0.6% KH2PO4, 0.6% K2HPO4, 0.1% sodium citrate, and 0.2% MgSO4 (CGY medium). Overnight culture (2ml) of Bacillus cereus strains were inoculated to 200ml medium and kept for incubation for 5-6 hours at 32 °C, 200 rpm on a rotary shaker. Prior to centrifugation, EDTA was added to a final concentration of 1 mM to minimize proteolytic degradation of hemolysin BL. The supernatant was concentrated by lyophilization to one tenth of the starting volume and checked for the presence of hemolysin BL by well diffusion assay on sheep blood agar plate. Western Blot analysis: Hemolysin BL crude toxin preparation of Bacillus cereus strains was resolved on 12% SDS-PAGE (Laemilae 1951) and Western blotting carried out as per the procedure of Towbin et al., using the hyper immune sera raised in mice. Visualisation of bands was achieved by incubation with anti mouse horse radish peroxidase (HRP) conjugate followed by colour development using diamino benzidine hydrogen peroxide (DAB)-H202 substrate solution. Reaction was stopped by distilled water. The culture supematants of other Bacillus cereus strains as well as non Bacillus cereus strains were also tested by Western blotting In Western blot a single band was obtained with the purified recombinant protein whereas with Bacillus cereus (ATCC 14579) culture supernatant two bands obtained at -38 kDa and -44 kDa regions, respectively (Figs.2). Polyclonal antisera of recombinant fusion protein was found to be reacting with all the Bacillus cereus strains in Western blotting but did not exhibit any reaction with other non Bacillus cereus strains tested. Indirect Plate Enzyme Linked Immunosorbent Assay: Prior to native HBL toxin producing Bacillus cereus strains detection, the assay was standardized by incubating purified recombinant chimeric protein at different dilutions (1-500 ng/ml). The indirect plate ELISA was performed as per the method described by Engwell and Perlman (1971) with suitable modifications. Crude toxin preparation of Bacillus cereus strains in 100ul volumes were added to the microtiter wells and blocked with 0.5% bovine serum albumin (BSA) in phosphate buffered saline (PBS). After washing with PBS, polyclonal antisera produced from mice against recombinant chimeric protein was added and the plates were incubated at 37°C for 60 min. The wells were washed, and then secondary antibody (goat anti-mice IgG-HRP, 1:1000) was added and incubated for 60 min at 37°C. After another wash with PBS, 100 µl of TMB/H2O2 substrate was added to the wells and incubated at room temperature for about 10 min. The reaction was then stopped with 100 ul of 2.5 N H2SO4. The absorbance of each well was read at 450 nm. Samples with absorbance > 0.18 were considered positive. Each sample was tested in triplicate. Neutralizing properties of the antibodies Polyclonal antibodies against recombinant protein were tested for neutralizing properties by using the sheep blood agar plates. For this purpose the mouse polyclonal antibodies against recombinant fusion protein were added to two-fold serially diluted supernatant of strain ATCC 14579 (producing HBL) and assayed in the hemolysis test on sheep blood agar plates. The addition of polyclonal antisera raised against recombinant fusion protein to the crude preparation of HBL toxin of Bacillus cereus ATCC 14579 resulted in a significant reduction in the hemolytic activity on sheep erythrocytes. Adjuvanticiry of Recombinant chimeric protein: Protective antigen of Bacillus anthracis is the vaccine molecule for anthrax. A dose of 50 ug of recombinant protective antigen was given alone or in combination with different concentrations of recombinant chimeric protein of HBL toxin of Bacillus cereus by subcutaneous or intra muscular route in experimental mice and was tested for antibody response against protective antigen. Different concentrations of recombinant chimeric protein of HBL toxin at microgram level (5 ug-100 ug) alongwith protective antigen provided enhanced antibody response thereby suggesting adjuvant activity of recombinant chimeric HBL protein. We Claim, 1. A recombinant chimeric fusion protein comprising conserved portions of: i. hbl A gene as the binding component; ii. hbl D and hbl C genes as the lytic components. 2. The recombinant chimeric fusion protein as claimed in claim 1, wherein said fusion protein has sequence ID no. 1. 3. The recombinant chimeric fusion protein as claimed in claim 1, wherein the molecular weight of said recombinant chimeric fusion protein is 56 kDa. 4. A process for the preparation of the recombinant chimeric fusion protein comprising the steps of: i. designing three pairs of primer sequences to amplify conserved portions of hbl D, hbl C, hbl A genes; ii. introducing restriction sites into the 5' and 3' flanking sites of said primer sequences to facilitate ligase dependent directional cloning; iii. amplifying the conserved portions of hbl D, hbl C, hbl A genes by polymerase chain reaction (PCR) to obtain amplified PCR products; iv. digesting the amplified PCR products with restriction enzymes to facilitate directional dependent cloning; v. ligating the digested PCR products on the restriction enzyme digested pRSET A vector to obtain ligated PCR products; vi. cloning the ligated PCR products on the pRSET vector; vii. screening the clones using forward and reverse primers to obtain the fusion gene. 5. The process for the preparation of the recombinant chimeric fusion protein as claimed in claim 4, wherein the restriction enzymes used in step (iv) are Bam H 1, Kpn 1, Sal 1, Hind III or combination thereof. 6. The process for the preparation of the recombinant chimeric fusion protein as claimed in claim 4, wherein the forward primer is ACTACCGGATCCACTATTCATG. 7. The process for the preparation of the recombinant chimeric fusion protein as claimed in claim 4, wherein the reverse primer is GATCCTAAAGCTTCTTCTAGACG. 8. An immunoassay for the detection of Haemolysin BL toxin producing bacillus cereus group strains comprising polyclonal antibodies generated against recombinant chimeric protein comprising conserved portions of hbl A, hbl D and hbl C genes. 9. A recombinant chimeric fusion protein as herein described with reference to foregoing examples. 10. A process for the preparation of recombinant chimeric fusion protein as herein described with reference to foregoing examples.

Documents:

03-03-2014_12943-29_REFILING.pdf

03-03-2014_Form 2.pdf

03-03-2014_Revised claims (along with Marked up copy).pdf

12943-29_REFILING.pdf

246-del-2009-abstract.pdf

246-del-2009-Claims-(14-10-2014).pdf

246-del-2009-claims.pdf

246-DEL-2009-Correspondence-Others (20-01-2010).pdf

246-del-2009-Correspondence-Others-(04-03-2014).pdf

246-del-2009-Correspondence-others-(14-10-2014).pdf

246-del-2009-correspondence-others.pdf

246-del-2009-description (complete).pdf

246-del-2009-drawings.pdf

246-del-2009-form-1.pdf

246-del-2009-form-18.pdf

246-del-2009-form-2.pdf

246-del-2009-form-3.pdf

246-DEL-2009-GPA (20-01-2010).pdf

Form 2.pdf

Revised claims (along with Marked up copy).pdf