Title of Invention	"RECOMBINANTLY PREPARED POLYPEPTIDE FROM H. INFLUENZAE AND COMPOSITION THEREOF"
Abstract	Polypeptides comprising non-typeable Haemophilus influenzae (NTHi) amino acid sequences.Over 2500 specific NTHi proteins are disclosed.The invention also provides related polypeptides nucleic acids,antibodies and methods.These can all be used in medicine for treating or preventing disease and/or infection caused by H.influenzae such as otitis media.

Full Text

WO 2005/111066 PCT/IB2005/001775 POLYPEPTEDES FROM NON-TYPEABLE HAEMOPHILUS INFLUENZAE All documents cited herein are incorporated by reference in their entirety TECHNICAL FIELD This invention is in the field of Haemophilus influenzae immunology and vaccinology BACKGROUND ART Haemophilus influenzae is a small, non-motile, Gram-negative coccobacillus It is a respiratory pathogen that causes a wide spectruin of human infections, including asymptomatic colonization of the upper respiratory tract (i e carnage), infections that extend from colonized mucosal surfaces to cause otitis media (inflammation of the middle ear), bronchitis, conjunctivitis sinusitis, urinary tract infections and pneumonia, and invasive infections, such as bacterernia, septic arthritis, epiglottitis, pneumonia, empyema, pericarditis cellulitis, osteomyelitis and meningitis H. influenzae was the first bacterium for which a complete genome sequence was published [1] H.influenzae strains are either capsulated (typeable) or non-capsulated (non-typeabJe) and there are six major serological types of capsulated strains (a to f) 95% of H influenzae-caused invasive diseases are caused by H influenzae type b ('Hib ) strains The most serious manifestation of Hib disease is meningitis but the introduction in the 1980s of vaccines based on conjugated Hib capsular saccharides has hugely reduced incidence of this disease Although Hib infections can now be controlled by vaccination, other pathogenic H.influenzae strains remain a risk For instance, non-typeabJe H influenzae (NTHi) is responsible for otitis media (OM), particularly chronic OM While OM is rarely associated with mortality, it is associated with significant morbidity Hearing loss is the most common complication of OM, with behavioral educational and language development delays being additional consequences of early onset OM with effusion Acute OM is the most common bacterial infection in children in the USA The non-typeable H influenzae biogroup aegyptius causes epidemic conjunctivitis and Brazilian purpunc fever (BPP) [2], with BPF having a mortality of up to 70% To date, antibiotics are the mam tool against the spectrum of clinical entities known collectively as OM but widespread use of antibiotics for OM has met with controversy due to the emergence of multiple-antibiotic resistant microorganisms Progress towards a vaccine is slow due to an incomplete understanding of both the pathogenesis of OM and the immune response to it The genome sequence of the serotype d strain KW20 [1,3] has been useful for understanding basic H.influenzae biology, but it has not been so useful in countering pathogenic H.influenzae strains as serotype d strains are generally not pathogens It is an object of the invention to provide polypeptides for use in the development of vaccines for preventing and/or treating infections caused by non-typcable H.influenzae strains In particular, it is an object to provide polypeptides for use in improved vaccines for preventing and/or treating otitis media The polypeptides may also be useful for diagnostic purposes, and as targets for antibiotics -I- WO 2005/111066 PCT/IB2005/001775 DISCLOSURE OF THE INVENTION Polypeptides The invention provides polypeptides comprising the H influenzae amino acid sequences disclosed in the examples These amino acid sequences are the even SEQ ID NOs between 2 and 5080 There are thus 2540 amino acid sequences, and these are referred to as NTHnnnn, where nnnn is a number between 0001 and 2832 (there are 292 NTHnnnn numbers that have no sequence, see Table I) Further NTHi sequences of the invention are given as SEQ ID NOS 5088 onwards The invention also provides polypeptides comprising amino acid sequences thathave sequence identity to the H influenzae amino acid sequences disclosed in the examples Depending on the particular sequence, the degree of sequence identity is preferably greater than 50% (eg 60%, 70%, 75% 80% 85% 90% 91% 92% 93% 94% 95%, 96% 97% 98%, 99% or more) These polypeptides include homologs, orthologs allelic variants and functional mutants Typically 50% identity or more between two polypeptide sequences is considered to be an indication of functional equivalence Identity between polypeptides is preferably determined by the Smith-Waterman homology search algorithm as implemented in the MPSRCH program (Oxford Molecular), using an affine gap search with parameters gap open penalty~12 and gap extension penalty=1 These polypeptide may, compared to the NTHi sequences of the examples, include one or more (e g 1,2,3,4,5,6,7 8,9 10 etc) conservative amino acid replacements i e replacements of one amino acid with another which has a related side chain Genetically-encoded amino acids are generally divided into four families (1) acidic ie aspartate glutamate, (2) basic i. e lysine, arginine, histidine, (3) non polar i. e. alanine valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and (4) uncharged polar i e glycine, asparagine, glutamme, cystine, serine, threonine, tyrosme Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids In general, substitution of single amino acids within these families does not have a major effect on the biological activity The polypeptides may also include one or more (eg 1 2 3 4, 5, 6, 7 8, 9 10, etc ) single amino acid deletions relative to the NTHi sequences of the examples The polypeptides may also include one or more (e g 1,2, 3 4, 5, 6,7 8 9, 10 etc ) insertions (e g each of 1,2, 3,4 or 5 amino acids) relative to the NTHi sequences of the examples Preferred poljpeptides of the invention are listed in Table II, including polypeptides that are lipidated, that are located in the outer membrane, that are located in the innei membrane, that ate located in the penplasm, or that are not found in non-pathogenic H. influenzae strains Particularly preferred polypeptides ate those that fall into more than one of these categories e g polypeptides that aic located in the outer membrane and are also not found in non-pathogenic H.influenzae strains A particularly preferred polypeptide is NTH0867 NTH0S61 NTH0863 and NTH0865 are also preferred As described below, these four proteins are embodied by SEQ ID NOS 1566, 5095, 1570 5094, 1574,5903, 1578 and 5092 Within these eight SEQ ID NOS, 1566-1578 are preferred -2- WO 2005/111066 PCT/IB205/00I775 The invention further provides polypeptides comprising fragments of the H.influenzae amino acid sequences disclosed in the examples The fragments should comprise at least n consecutive amino acids from the sequences and, depending on the particular sequence, n is 7 or more (eg 8 10, 12 14, 16, 18, 20 22,24 26,28 30,35 40,45 50 60,70, 80, 90,100 ormore) The fragment may comprise at least one T cell or preferably, a B-cell epitope of the sequence T-and B-cell eprtopes can be identified empirically (e g using PEPSCAN [4,5] or similar methods), or they can be predicted (e g using the Jameson-Wolf antigenic index [6], matrix-based approaches [7], TEPITOPE [8], neural networks [9] OptiMer & EpiMer [10, 11] ADEPT [12], Tsites [13], hydrophilicity [14], antigemc index [15] or the methods disclosed in reference 16 etc) Other preferred fragments are (a) the N-termtnal signal peptides of the NTHi polypeptides of the invention, (b) the NTHi polypeptides, but without their N-terminal signal peptides, (c) the NTHi polypepbdes but without their N-termmal amino acid residue Polypeptides of the invention can be prepared in many ways e g by chemical synthesis (in whole or in part), by digesting longer polypeptides using proteases, by translation from RNA by purification from cell culture (eg from recombwant expression), from the organism itself (eg after bacterial culture, or direct from patients), etc A preferred method for production of peptides Polypeptides of the invention can take various forms (eg native, fusions, glycosylated, non-glycos>lated hpidated, non-hpidated, phosphorylated, non-phosphorylated, myristoylated, non-mynstoylated, monomeric, multimeric, particulate, denatured, etc) Polypeptides of the invention are preferably provided in purified or substantially purified form i e substantially free from other polypeptides {eg free from naturally-occurring polypept.des), particularly from other Haemophilvs or host cell polypeptides, and are generally at least about 50% pure (by weight) and usually at least about 90% pure i e less than about 50%, and more preferably less than about 10% (eg 5%) of a composition is made up of other expressed polypept.des Polypeptides of the invention are preferably H influenzas polypeptides Polypeptides of the invention preferably have the function indicated in Table III for the relevant sequence -3 WO 2005/111066 PCT7IB2005/001775 Polypeptides of the invention may be attached to a solid support Polypeptides of the invention may comprise a detectable label (eg a. ladioactive or fluorescent label, or a biotin label) The term "polypeptide" refers to amino acid polymers of any length The polymer may be linear or branched, it may comprise modified amino acids and it may be interrupted by non-amino acids The terms also encompass an amino acid polymer that has been modified naturally or by intervention, for example, disulfide bond formation glycosylation, lipidation acetylation, phosphorylation, or any other manipulation or modification such as conjugation with a labeling component Also included within the definition are for example polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc ), as well as other modifications known in the art. Polypeptides can occui as single chains or associated chains Polypeptides of the invention can be naturally or non-naturally glycosylated (i e the polypeptide has a glycosylation pattern that differs from the glycosylation pattern found in the corresponding naturally occurring polypeptide) The invention provides polypeptides comprising a sequence -X-Y- or -Y-X-, wherein -X- is an amino acid sequence as defined above and -Y- is not a sequence as defined above i e the invention provides fusion proteins Where the N-terminus codon of a polypeptide-coding sequence is not ATG then that codon will be translated as the standard amino acid for that rodon rather than as a Met, which occurs when the codon is a start codon The invention provides a process for producing polypeptides of the invention, comprising the step of culturing a host cell of to the invention under conditions which induce polypeptide expression The invention provides a process for producing a polypeptide of the invention, wherein the polypeptide is synthesised in part or in whole using chemical means The invention provides a composition comprising two or more polypeptides of the invention The invention also provides a hybrid polypeptide represented by the formula NH2-A-[ X-L-]n-B-COOH, wherein X is a polypeptide of the invention as defined above L is an optional linker amino acid sequence, A is an optional N-terminal amino acid sequence B is an optional C-terminal amino acid sequence, and n is in integer greater than 1 The value of n is between 2 and x, and the value of x is typically 3, 4, 5 6,1 8 9 or 10 Preferably n is 2, 3 or 4, it is more preferably 2 or 3, most preferably, n = 2 For each n instances, -X- may be the same or different For each n instances of [-X-L-], linker amino acid sequence L- may be present or absent Foi instance when n=2 the hybrid may be NH2-X1-L1-X2-L2-COOH, NH2 X,-X2-COOH, NH2-X, L1-X2-COOH, NH2Xi-X2-L2-COOH, etc Linker amino acid sequence(s) -L- wil! typically be short (e g 20 or fewer amino acids i.e 19, 18, 17, 16 15, 14, 13, 12, 11, 10, 9, 8, 7 6 5 4, 3 2 1) Examples include short pcptide sequences which facilitate cloning, poly-glycine linkers (i. e Glyrt where n = 2 3, 4 5 6, 7, 8, 9, 10 01 more) and histidine tags (i. e His,, where in = 3 4, 5 6,7 8, 9, 10 or more) Other suitable linker amino acid sequences will be apparent to those skilled in the art -A- and -B are optional sequences which will typically be short (e g 40 or fewer amino acids i. e 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, WO 2005/111066 PCT/IB2005/001775 29 28, 27 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8 7 6, 5 4 3, 2 1) Examples include leader sequences to direct polypeptide trafficking, or short peptide sequences which facilitate cloning or purification (e g histidine tags / e Hisn where n = 3, 4, 5, 6, 7, 8 9 10 or more) Other suitable N-terminal and C-terminal amino acid sequences will be apparent to those skilled in the art Various tests can be used to assess the in vivo immunogenicity of polypeptides of the invention For example, polypeptides can be expressed recombinantly and used to screen patient sera by immunoblot A positive reaction between the polypeptide and patient serum indicates that the patient has previously mounted an immune response to the protein in question i e the protein is an immunogen This method can also be used to identify immunodominant proteins Antibodies The invention provides antibodies that bind to polypeptides of the invention These may be polyclonal or monoclonal and may be produced by any suitable means {eg by recombinant expression) To increase compatibility with the human immune system, the antibodies may be chimenc or humanised [e g refs 22 & 23], or fully human antibodies may be used The antibodies may include a detectable label (eg for diagnostic assays) Antibodies of the invention may be attached to a solid support Antibodies of the invention are preferably neutralising antibodies Monoclonal antibodies are particularly useful in identification and purification of the individual polypeptides against which they are directed Monoclonal antibodies of the invention may also be employed as reagents in immunoassays radioimmunoassays (RIA) or enzyme linked immunosorbent assays (ELISA) etc In these applications the antibodies can be labelled with an analytically-deteclable reagent such as a radioisotope a fluorescent molecule or an enzyme The monoclonal antibodies produced by the above method may also be used for the molecular identification and characterization (epitope mapping) oi polypeptides of the invention Antibodies of the invention arc preferably provided in purified or substantially purified form Typically, the antibody will be present in a composition that is substantially free of other polypeptides e g where less than 90% (by weight), usually less than 60% and more usually less than 50% of the composition is made up of other polypeptides Antibodies of the invention can be of any isotype (e g IgA, IgG, IgM i e an a, y or u heavy chain) but will generally be IgG Within the IgG isotype antibodies may be IgGl IgG2 IgG3 or IgG4 subclass Antibodies of the invention may have a K or a ? light chain Antibodies of the invention can take various forms, including whole antibodies, antibody fragments such as F(ab')2 and F(ab) fragments, Tv fragments (non-covalent heterodimers), single-chain antibodies such as single chain F\ molecules (scFv), mimbodies oligobodies etc The term "antibody' does not imply any particular origin and includes antibodies obtained through non-conventional processes such as phage display -5- WO 2005/111066 PCT/IB2005/001775 The invention provides a process for detecting polypeptides of the invention, comprising the steps of (a) contacting an antibody of the invention with a biological sample under conditions suitable for the formation of an antibody antigen complexes and (b) detecting said complexes The invention provides a process for detecting antibodies of the invention comprising the steps of (a) contacting a polypeptide of the invention with a biological sample (e g a blood or serum sample) under conditions suitable for the formation of an antibody-antigen complexes, and (b) detecting said complexes Nucleic acids The invention provides nucleic acid comprising the H.influenzae nucleotide sequences disclosed in the examples These nucleic acid sequences are the odd SEQ ID NOs between 1 and 50S0 The invention also provides nucleic acid comprising nucleotide sequences having sequence identity to the H influenzae nucleotide sequences disclosed in the examples Identity between sequences is preferably determined by the Smith-Waterman homology search algorithm as described above The invention also provides nucleic acid which can hybridize to the H.influenzae nucleic acid disclosed in the examples Hybridization reactions can be performed under conditions of different " stringency" Conditions that increase stringency of a hybridization leaction of widely known and published in the art [e g page 7 52 of reference 24] Examples of relevant conditions include (in oidet of increasing stringency) incubation temperatures of 25°C, 37°C, 50°C, 55°C and 68°C buffer concentrations of 10 x SSC, 6 x SSC, 1 x SSC, 0 1 x SSC (where SSC is 0 15 M NaCl and 15 mM citrate buffer) and their equivalents using other buffer systems formamide concentrations of 0%, 25%, 50%, and 75%, incubation times from 5 minutes to 24 hours, 1, 2, or more washing steps wash incubation times of 1 2, or 15 minutes, and wash solutions of 6 x SSC, 1 x SSC, 0 1 x SSC or de-ionized water Hybridization techniques and their optimization are well known in the art [e g see references 24-27, etc ] In some embodiments nucleic acid of the invention hybridizes to a target of the invention under low stringency conditions, in other embodiments it hybridizes under intermediate stringency conditions in preferred embodiments, it hybridizes under high stringency conditions An exemplary set of low stringency hybridization conditions is 50°C and 10 x SSC An exemplary set of intermediate stringency hybridization conditions is 55°C and 1 xSSC An exemplary set of high stringency hybridization conditions is 68°C and 0 1 x SSC Nucleic acid comprising fragments of these sequences are also provided These should comprise at least n consecutive nucleotides from the H influenzae sequences and depending on the particular sequence,n is 10 or more (eg 12,14,15 18 20,25 30,35,40 50 60 70,80,90,100 150,200or more) The invention provides nucleic acid of formula 5-X-Y Z-3' wherein -X- is a nucleotide sequence consisting of x nucleotides -Z- is a nucleotide sequence consisting of z nucleotides, -Y- is a -6- WO2005/111066 PCT/IB2003/001775 nucleotide sequence consisting of either (a) a fragment of one of the odd-numbered SEQ ID NOS 1 to 5079 or (b) the complement of (a), and said nucleic acid 5' X-Y-Z-31 is neither (i) a fragment of one of the odd-numbered SEQ ID NOS 1 to 5079 nor (u) the complement of (l) The -X- and/or -Z-moieties may comprise a promoter sequence (or its complement) The invention also provides nucleic acid encoding the polypeptides and polypeptide fragments of the invention The invention includes nucleic acid comprising sequences complementary to the sequences disclosed in the sequence listing (e g for antisense or probing, or for use as primers), as well as the sequences in the orientation actually shown Nucleic acids of the invention can be used in hybridisation reactions (e g Northern or Southern blots, or in nucleic acid microarrays or gene chips ) and amplification reactions (eg PCR, SDA, SSSR, LCR, TMA, NASBA etc ) and other nucleic acid techniques Nucleic acid according to the invention can take various forms (e g single-stranded, double-stranded, vectois, primers, probes, labelled etc) Nucleic acids of the invention may be circular or branched, but will generally be linear Unless otherwise specified or required, any embodiment of the invention that utilizes a nucleic acid may utilize both the double-stranded form and each of two complementary single-stranded forms which make up the double-stranded form Primers and probes are generally single stranded, as are antisense nucleic acids Nucleic acids of the invention are preferably provided in purified or substantially purified form i. e substantially free from other nucleic acids (eg free from naturally-occurrmg nucleic acids) particularly from other Haemophilus or host cell nucleic acids, generally being at least about 50% pure (by weight), and usually at least about 90% pure Nucleic acids of the invention are preferably H influenzae nucleic acids Nucleic acids of the invention may be prepared in many ways eg by chemical synthesis (eg phosphoramidite synthesis of DNA) in whole or in part by digesting longer nucleic acids using nucleasesfeg restriction enzymes) by joining shorter nucleic acids or nucleotides (eg using hgases orpolytnerases), from genomic or cDNA hbranes, etc Nucleic acid of the invention may be attached to a solid support (e g a bead, plate, filter, film, slide, microarray support, resin etc ) Nucleic acid of the invention may be labelled e g with a radioactive or fluorescent label, or a biotin label This is particularly useful where the nucleic acid is to be used in detection techniques e g wheie the nucleic acid is a primer or as a probe The term 'nucleic acid" includes in general means a polymeric form of nucleotides of any length which contain deoxyribonucleotides, nbonucleotides, and/or their analogs It includes DNA RNA DNA/RNA hybrids It also includes DNA or RNA analogs, such as those containing modified backbones (e g pepttde nucleic acids (PNAs) or phosphorothioates) or modified bases Thus Ihe invention includes mRNA, tRNA, rRNA, ribozymes, DNA, cDNA recombinant nucleic acids -7- WO 2005/111066 PCT/IB2005/001775 branched nucleic acids, plasmids, vectors, probes, primers, etc Where nucleic acid of the invention takes the form of RNA, it may or may not have a 5' cap Nucleic acids of the invention comprise NTHi sequences, but they may also comprise non-NTHi sequences (e g in nucleic acids of formula 5-X-Y-Z-3', as defined above) This is particularly useful for primers, which may thus comprise a first sequence complementary to a PCAV nucleic acid target and a second sequence which is not complementary to the nucleic acid target Any such non-complementary sequences in the primer are preferably 51 to the complementary sequences Typical non-complementary sequences comprise restriction sites or promoter sequences Nucleic acids of the invention can be prepared in many ways e g by chemical synthesis (at least in part)3 by digesting longer nucleic acids using nucleases (e g restriction enzymes), by joining shorter nucleic acids (e g using hgases or polymerases), from genomic or cDNA libraiies, etc Nucleic acids of the invention may be part of a vector ; e part of a nucleic acid construct designed for transduction/transfection of one or more cell types Vectors may be, for example, 'cloning vectors" which are designed for isolation propagation and replication of inserted nucleotides, "expression vectors" which are designed for expression of a nucleotide sequence in a host cell, "viral vectors" which is designed to result in the production of a recombmant virus or virus-like particle, or "shuttle vectors , which comprise the attributes of more than one type of vector Preferred vectors are plasmids A host cell" includes an individual cell or cell culture which can be or has been a recipient of exogenous nucleic acid Host cells include progeny of a single host cell and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural accidental, or deliberate mutation and/or change Host cells include cells tiansfected or infected in vivo or in vitro with nucleic acid of the invention Where a nucleic acid is DNA, it will be appreciated that "U" in a RNA sequence will be replaced by T" in the DNA Similarly where a nucleic acid is RNA, it will be appreciated that T in a DNA sequence will be replaced by "U" in the RNA The term "complement" or "complementary" when used in relation to nucleic acids refers to Watson-Crick base pairing Thus the complement of C is G, the complement of G is C, the complement of A is T (or U), and the complement of T (or U) is A. It is also possible to use bases such as I (the punne inosine) e g to complement pyrimidines (C or T) The terms also imply a direction -the complement of 5'-ACAGT-3' is 5'-ACTGT-3 rather than 5' TGTCA-3' Nucleic acids of the invention can be used, for example to produce polypeptides, as hybridization probes for the detection of nucleic acid in biological samples, to generate additional copies of the nucleic acids, to generate ribozymes or antisense oligonucleotides, as single-stranded DNA primers or probes, or as triple-strand forming ohgonucleotides The invention provides a process for producing nucleic acid of the invention, wherein the nucleic acid is synthesised in part or in whole using chemical means -8- WO 2005/111066 PCT/IB2005/001775 The invention provides vectors comprising nucleotide sequences of the invention (e g cloning or expression vectors) and host cells transformed with such vectors The invention also provides a kit comprising primers (e g PCR primers) for amplifying a template sequence contained within a Haemophilus bacterium (eg E.injluenzae) nucleic acid sequence, the kit comprising a first primer and a second primer, wherein the first primer is substantially complementary to said template sequence and the second primer is substantially complementary to a complement of said template sequence, wherein the parts of said primers which have substantial complementarity define the termini of the template sequence to be amplified The first primer and/or the second primer may include a detectable label (e g a fluorescent label) The invention also provides a kit comprising first and second single-stranded oligoaucleotidea which allow amplification of a Haemophilus template nucleic acid sequence contained in a single- or double-stranded nucleic acid (or mixture thereof), wherein (a) the first oligonucleotide comprises a primer sequence which is substantially complementary to said template nucleic acid sequence, (b) the second oligonucleotide comprises a primer sequence which is substantially complementary to the complement of said template nucleic acid sequence, (c) the first oligonucleotide and/or the second oligonucleotide comprise(s) sequence which is not compementary to said template nucleic acid, and (d) said primer sequences define the termmi of the template sequence to be amplified The non-complementary sequence(s) of feature (c) are preferably upstream of (; e 5' to) the primer sequences One or both of these (c) sequences may comprise a testnction site [eg ief 28] or a piomoter sequence [e g 29] The first oligonucleotide and/or the second oligonucleotide may include a detectable label (e g a fluorescent label) The template sequence may be any part of a genome sequence The invention provides a process for detecting nucleic acid of the invention, comprising the steps of (a) contacting a nucleic probe according to the invention with a biological sample under hybridising conditions to form duplexes, and (b) detecting said duplexes The invention provides a process for detecting H.influenzae in a biological sample {eg blood), comprising the step of contacting nucleic acid according to the invention with the biological sample under hybridising conditions The process may involve nucleic acid amplification (e g PCR, SDA, SSSR, LCR, TMA, NASBA, etc ) or hybridisation (e g microarrays, blots, hybridisation with a probe in solution etc) PCR detection of H.influenzae in clinical samples has been reported [e g see refs 30 & 31] Clinical assays based on nucleic acid are described in general in ref 32 The invention provides a process for preparing a fragment of a target sequence, wherein the fragment is prepared by extension of a nucleic acid primer The target sequence and/or the primer are nucleic acids of the invention The primer extension reaction may involve nucleic acid amplification (eg PCR, SDA SSSR, LCR, TMA, NASBA etc ) Nucleic acid amplification according to the invention may be quantitative and/or real-time -9- WO 2005/111066 PCT/IB2005/001775 For certain embodiments of the invention, nucleic acids are preferably at least 7 nucleotides in length (eg 8 9 10 11 12 13,14,15,16,17,18,19,20,21,22 23,24 25,26,27,28,29 30,31,32,33 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60, 65, 70, 75 80, 90, 100 110, 120., 130, 140, 150, 160 170, 180, 190,200,225,250,275, 300 nucleotides or longer) For certain embodiments of the invention, nucleic acids are preferably at most 500 nucleotides in length (e g 450,400, 350,300,250,200, 150, 140, 130, 120, 110, 100, 90, 80, 75 70, 65, 60, 55, 50, 45, 40, 39,38,37, 36, 35, 34, 33, 32, 31, 30,29,28,27, 26, 25, 24, 23,22, 21,20,19,18,17, 16, 15 nucleotides or shorter) Primers and probes of the invention, and other nucleic acids used for hybridization are preferably between 10 and 30 nucleotides in length (eg- 10,11,12,13,14,15 16,17 18 19 20 21,22,23,24, 25,26 27,28 29, or 30 nucleotides) Pharmaceutical compositions The invention provides compositions comprising (a) polypeptide, antibody and/or nucleic acid of the invention and (b) a pharmaceutically acceptable carrier These compositions may be suitable as immunogenic compositions, for instance, or as diagnostic reagents, or as vaccines Vaccines according to the invention may either be prophylactic (i e to prevent infection) or therapeutic (i e to treat infection) but will typically be prophylactic A 'pharmaceutically acceptable earners includes any carreir that does not itself induce the production of antibodies harmful to the individual receiving the composition Suitable carriers are typically large slowly metabolised macromolecules such as proteins., polysacchandes, polyiactic acids polyglycolic acids, polymeric amino acids, amino acid copolymers sucrose trehalose lactose, and lipid aggregates (such as oil droplets or hposomes) Such carriers are well known to those of ordinary skill in the art The vaccines may also contain diluents, such as water saline glycerol etc Additionally auxiliary substant.es, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present Sterile pyrogen-free, phosphate-buffered physiologic saline is a typical carrier A thorough discussion of phaimaceutically acceptable excipients is available in ref 138 Compositions of the invention may include an antimicrobial, particularly if packaged in a multiple dose format Compositions of the invention may compuse detergent e g a Tween (polysoibate), such as Tween 80 Detergents are generally present at low levels e g Compositions of the invention may include sodium salts (e g sodium chloride) to give tonicity A concentration of 10±2mg/ml NaCI is typical Compositions of the invention will generally include a buffer A phosphate buffer is typical Compositions of the invention may comprise a sugar alcohol (eg mannitol) or a disacchande (eg sucrose or trehalose) eg at around l5-30mg/mI (eg 25 mg/ml) particularly if they are to be -10- WO2005/111066 PCT/IB2005/001775 Iyophilised or if they include matenal which has been reconstituted from Iyophihsed material The pH of a composition for Iyophilisation may be adjusted to around 6 1 prior to lyophilisation Polypcptides of the invention may be administered in conjunction with other immunoregulatory agents In particular, compositions will usually include a vaccine adjuvant Adjuvants which may be used in compositions of the invention include, but are not limited to A Mineral-containing compositions Mineral containing compositions suitable for use as adjuvants in the invention include mineral salts, such as aluminium salts and calcium salts The invention includes mineral salts such as hydroxides (e g oxyhydroxides) phosphates (e g hydroxyphosphates orthophosphates), sulphates, etc [e g see chapters 8 & 9 of ref 33], or mixtures of different mineral compounds with the compounds taking any suitable form (e g gel, crystalline, amorphous, etc), and with adsorption being preferred The mineral containing compositions may also be formulated as a particle of metal salt [34] Aluminium phosphates are particularly pieferred, particularly in compositions which include a Hinfiuenzae sacchande antigen and a typical adjuvant is amorphous aluminium hydroxyphosphate with PCVA1 molar ratio between 0 84 and 0 92, included at 0 6mg Al37ml Adsorption with a low dose of aluminium phosphate may be used e g between 50 and lOOug A1J+ per conjugate per dose Where there is more than one conjugate in a composition not all conjugates need to be adsorbed B Oil Emulsions Oil emulsion compositions suitable for use as adjuvants in the invention include squalenc-water emulsions, such as MF59 [Chapter 10 of ref 33, see also ref 35] (5% Squalene, 0 5% Tween 80, and 0 5% Span 85, fonnulated into submicron particles using a microfluidizer) Complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA) may also be used C Saponin formulations [chapter 22 of ref 33] Saponin formulations may also be used as adjuvants in the invention Saponins are a heterologous group of sterol glycosides and tuterperioid glycosides that are found in the bark, leaves, stems roots and even flowers of a wide lange of plant species Saponin from the bark of the Quillaia saponana Molina tree have been widely studied as adjuvants Saponin can also be commercially obtained from Smilax ornata (sarsaprilla) Gypsophilla pamculata (brides veil), and Saponana officianals (soap root) Saponin adjuvant formulations include purified formulations, such as QS1, as well as hpid formulations, such as ISCOMs QS21 is maiketed as Stimulon(tm) Saponin compositions have been purified using HPLC and RP-HPLC Specific purified fiactions using these techniques have been identified including QS7 QS17 QS18 QS21, QH-A, QH B and QH-C Preferably the saponin is QS21 A method of production of QS21 is disclosed in ref 36 Saponin formulations may also comprise a sterol such as cholesterol [37] -11- WO 2005/111066 PCT/IB2005/001775 Combinations of saponins and cholesterols can be used to form unique particles called immunostimulating complexs (ISCOMs) [chapter 23 of ref 33] ISCOMs typically also include a phospholipid such as phosphatidylethanolamine or phosphatidylcholine Any known saponin can be used in ISCOMs Preferably the ISCOM includes one or more of QuilA, QHA & QHC ISCOMs are further described in refs 37-39 Optionally, the ISCOMS may be devoid of additional detergent [40] A review of the development of saponin based adjuvants can be found in refs 41 & 42 D Virosomes and virus-like particles Virosomes and virus-like particles (VLPs) can also be used as adjuvants in the invention These structures generally contain one or more proteins from a virus optionally combined or formulated with a phosphohpid They are generally non-pathogenic, non replicating and generally do not contain any of the native viral genome The viral proteins may be recombinantly produced or isolated from whole viruses These viral proteins suitable for use in virosomes or VLPs include proteins derived from influenza virus (such as HA or NA), Hepatitis B virus (such as core or capsid proteins), Hepatitis E virus, measles virus, Smdbis virus Rotavirus, Foot-and-Mouth Disease virus, Retrovirus, Norwalk virus, human Papilloma virus HIV, RNA-phages, QB-phage (such as coat proteins), GA-phage, fi-phage AP205 phage, and Ty (such as retrotiansposon Ty protein p1) VLPs are discussed further in Lefs 43-48 Virosomes are discussed further in, for example, ref 49 E Bacterial or microbial derivatives Adjuvants suitable for use in the invention include bacterial or microbial derivatives such as non-toxic derivatives of enterobactenal lipopolysacchande (LPS), Lipid A derivatives immunostimulatory oligonucleotides and ADP nbosylating toxins and detoxified derivatives thereof Non-toxic derivatives of LPS include monophosphoryl hpid A (MPL) and 3-O-deacylated MPL (3dMPL) 3dMPL is a mixture of 3 de O-acylated monophosphoryl hpid A with 4 5 or 6 acylated chains A preferred small particle" form of 3 De-O-acylated monophosphoryl hpid A is disclosed in ref 50 Such " small particles" of 3dMPL are small enough to be sterile filtered through a 0 22um membrane [50] Other non-toxic LPS derivatives include monophosphoryl lipid A mimics, such as aminoalkyl glucosamimde phosphate derivatives e g RC-529 [51,52] Lipid A derivatives include derivatives of lipid A from Escherichia coll such as OM-174 OM-174 is described for example in refs 53 & 54 Immunostimulatory ohgonucleotides suitable for use as adjuvants in the invention include nucleotide sequences containing a CpG motif (a dinucleotide sequence containing an unmethylated cytosine linked by a phosphate bond to a guanosine) Double-stranded "RNAs and ohgonucleotides containing palindiomic or poly(dG) sequences have also been shown to be immunostimulatory The CpG s can include nucleotide modifications/analogs such as phosphorothioate modifications and can be double stranded or single-stranded References 55, 56 and 57 disclose possible analog -12- WO 2005/111066 PCT/IB2005/001775 substitutions e g replacement of guanosine with 2'-deoxy 7-deazaguanosine The adjuvant effect of CpG oligonucleotides is further discussed in refs 58-63 The CpG sequence may be directed to TLR9, such as the motif GTCGTT or TTCGTT [64] The CpG sequence may be specific for inducing a Th1 immune response, such as a CpG-A ODN, or it may be more specific for inducing a B cell response, such a CpG-B ODN CpG-A and CpG-B ODNs are discussed in refs 65-67 Preferably, the CpG is a CpG-A ODN Preferably, the CpG oligonucleotide is constructed so that the 5' end is accessible for receptor recognition Optionally, two CpG oligonucleotide sequences may be attached at their 3' ends to form immunomers" See, for example, refs 64 & 68 70 Bacterial ADP-nbosylating toxins and detoxified derivatives thereof may be used as adjuvants in the invention Preferably, the protein is derived from E coh (E coli heat labile enterotoxin "LT"), cholera ("CT"), or pertussis (*TT") The use of detoxified ADP-nbosylating toxins as mucosal adjuvants is described in ref 71 and as parenteral adjuvants in ref 72 The toxin or toxoid is preferably in the form of a holotoxin comprising both A and B subunits Preferably, the A subunit contains a detoxifying mutation preferably the B subunit is not mutated Preferably, the adjuvant is a detoxified LT mutant such as LT-K63, LT-R72, and LT-G192 The use of ADP-nbosylating toxins and detoxified derivaties thereof particularly LT-IC63 and LT-R72, as adjuvants can be found in refs 73-80 Numerical reference for amino acid substitutions is preferably based on the alignments of the A and B subumts of ADP-nbosylating toxins set forth in ref 81 specifically incorporated heiein by reference in its entirety F Human immunomodulators Human immunomodulators suitable for use as adjuvants in the invention include cytokines, such as interleukins {eg IL-1 IL-2, IL-4, IL 5 IL-6, DL-7, IL-12 [82], etc) [83], inteiferons {eg interferon-y), macrophage colony stimulating factor and tumor necrosis factor G Bwadhesives and Mucoadhesives Bioadhesives and mucoadhesives may also be used as adjuvants in the invention Suitable bioadhesives, include estenfied hyaluronic acid microspheres [84] or mucoadhesives such as cross-linked derivatives of poly(acrylic acid), polyvinyl alcohol polyvmyl pyrolhdone, polysaccharides and carboxymethylcellulose Chitosan and derivatives thereof may also be used as adjuvants in the invention [85] H Microparticles Microparticles may also be used as adjuvants in the invention Microparticles (; e a particle of ~100nm to ~150µm in diameter, more preferably ~200nm to ~30µm in diameter, and most preferably ~500nm to -~10µm in diameter) formed from materials that are biodegradable and non-toxic {e g a poly(aFhydroxy acid) a polyhydroxybutyric acid, a polyorthoester, a polyanhydnde a polycaprolactone etc ) with poly(lactide-co-glycohde) are preferred, optionally treated to have a -13- WO 2005/111066 PCT/lB2005/001775 negatively-charged surface (eg with SDS) or a positively-charged surface (eg with a cationic detergent, such as CTAB) I Liposomes (Chapters 13 & 14 of ref 33) Examples of liposome formulations suitable for use as adjuvants are described in refs 86-88 J Polyoxyethylene ether and polyoxyethylene ester formulations Adjuvants suitable for use in the invention include polyoxyethylene ethers and polyoxyethylene esters [89] Such formulations further include polyoxyethylene sorbitan ester surfactants in combination with an octoxynol [90] as well as polyoxyethylene alkyl ethers or ester surfactants in combination with at least one additional non-ionic surfactant such as an octoxynol [91] Preferred polyoxyethylene ethers are selected from the following group polyoxyethylene-9-lauryl ether (laureth 9), polyoxyethyiene-9-steoryl ether, polyoxytheylene 8 steoryl ether, polyoxyethylene 4-lauryl ether polyoxyethylene-35-lauryl ether, and polyoxyethyIene-23-lauryl ether K Polyphosphazene (PCPP) PCPP formulations are described, for example, in refs 92 and 93 L Muramyl peptides Examples of muramyl peptides suitable for use as adjuvants in the invention include N acetyl-muramyl-L-threonyl-D isoglutamine (tar MDP) N acetyl-normuramyl-L-alanyl D isoglutaminc (nor-MDP) and N acetylmuramyl-L-alanyl D lsoglutarninyl-L-alanine 2-(l -2-dipalmitoyl-s;i glycero-3-hydroxyphosphoryloxy) ethylaimne MTP-PE) M Imdazoquinolone Compounds Examples of lmidazoquinolone compounds suitable for use adjuvants in the invention include Imiquamod and its homologues (e g "Resiquimod 3M"), described further in refs 94 and 95 The invention may also compuse combinations of aspects of one or more ofthe adjuvants identified above Foi example the following adjuvant compositions may be used in the invention (1) a saponm and an oil-in watei emulsion [96] (2) a sapomn (eg QS21) + a non-toxic LPS derivative (eg 3dMPL) [97] (3) a saponm (e g QS21) + a non-toxic LPS derivative (e g 3dMPL) + a cholesterol, (4) a sapomn (e g QS21) + 3dMPL + IL-12 (optionally + a sterol) [98], (5) combinations of 3dMPL with, for example, QS21 and/oi oil-in-water emulsions [99], (6) SAF, containing 10% squalane, 0 4% Tween 80(tm) 5% pluronic-block polymer L121, and thr MDP either microflurdized into a submicron emulsion or vortexed to generate a larger particle size emulsion (7) Ribi adjuvant system (RAS), (Ribi Immunochem) containing 2% squalene, 0 2% Tween 80, and one or more bacterial ceLl wall components from the group consisting of monophosphoryhpid A (MPL), nehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (Detox(tm)) and (8) one or more mineral salts (such as an aluminum salt) + a non-toxic derivative of LPS (such as 3dMPL) Other substances that act as lmmunostimulating agents are disclosed in chapter 7 of ref 33 -14- WO 2005/111066 PCT/IB2005/001775 The use of an aluminium hydroxide or aluminium phosphate adjuvant is particularly preferred, and antigens are generally adsorbed to these salts Calcium phosphate is another preferred adjuvant The pH of compositions of the invention is preferably between 6 and 8, preferably about 7 Stable pH may be maintained by the use of a buffer Where a composition comprises an aluminium hydroxide salt it is preferred to use a histidine buffer [100] The composition may be sterile and/or pyrogen-free Compositions of the invention may be isotonic with respect to humans Compositions may "be presented in vials, or they may be presented in ready-filled syringes The syringes may be supplied with or without needles A syringe will include a single dose of the composition, whereas a vial may include a single dose or multiple doses Injectable compositions will usually be liquid solutions or suspensions Alternatively, they may be presented in solid form (e g freeze-dried) for solution or suspension in liquid vehicles prior to injection Compositions of the invention may be packaged in unit dose form or in multiple dose form For multiple dose forms, vials are preferred to pre-filled syringes Effective dosage volumes can be routinely established, but a typical human dose of the composition for injection has a volume of 0 5ml Where a composition of the invention is to be prepared extemporaneously prior to use (e g where a component is presented in lyophihsed form) and is presented as a kit, the kit may comprise two vials, or it may comprise one ready-filled syringe and one vial, with the contents of the syringe being used to reactivate the contents of the vial prior to injection Immunogemc compositions used as vaccines comprise an immunologically effective amount of antigen(s), as well as any other components as needed By'immunologically effective amount' it is meant that the administration of that amount to an individual either in a single dose or as part of a series is effective for treatment or prevention This amount vanes depending upon the health and physical condition of the individual to be treated age, the taxonomic group of individual to be treated (e g non-human primate primate, etc ), the capacity of the individual's immune system to synthesise antibodies the degree of protection desired, the formulation of the vaccine, the treating doctor's assessment of the medical situation, and other relevant factors It is expected that the amount will fall in a relatively broad lange that can be determined through routine trials, and a typical quantity of each meningococcal sacchaude antigen per dose is between 1 µg and 10mg per antigen Phar maceuttcat uses The invention also provides a method of treating a patient, comprising administering to the patient a therapeutically effective amount of a composition of the invention The patient may either be at risk from the disease themselves or may be a pregnant woman ( maternal immunisation') The invention provides nucleic acid, polypeptide of antibody of the invention for use as medicaments (e g as immunogenic compositions or as vaccines) or as diagnostic reagents It also provides the use of nucleic acid, polypeptide, or antibody of the invention in the manufactuie of (l) a -15- WO 2005/111066 PCT/IB2005/001775 medicament for treating or preventing disease and/or infection caused by H influenzas, (II)a diagnostic reagent for detecting the presence of H.influenzae or of antibodies raised against H influenze, and/or (III) a reagent which can raise antibodies against H influenzae Said H.influenzae serotype or strain, but is preferably a non-typeable H influenzae Said disease may be for instance otitis media (including acute otttis media), bronchitis, conjunctivitis, sinusitis, a urinary tract infection, pneumonia, bacteremia, septic arthritis epiglottitis pneumonia, empyema, pericarditis, cellulitis, osteomyelitis, lower respiratory tract infection or meningitis The invention is particularly useful for preventing inflammation of the middle ear, by eliciting an immune response that prevents bacteria from moving from the throat to the middle ear via the eustachian tube, where the middle ear is then colonised The patient is preferably a human Where the vaccine is for prophylactic use, the human is preferably a child (eg a. toddler or infant), where the vaccine is for therapeutic use, the human is preferably an adult A vaccine intended for children may also be administered to adults e g to assess safety dosage, immunogemcity, etc One way of checking efficacy of therapeutic treatment involves monitoring NTHi infection after administration of the composition of the invention One way of checking efficacy of prophylactic treatment involves monitoring immune lesponses against an administered polypeptide after administration Immunogenicity of compositions of the invention can be determined by administering them to test subjects (eg children 12-16 months age, or animal models [eg a chinchilla model [146]) and then determining standard parameters including ELISA titres (GMT) of IgG These immune lesponses will generally be determined atound 4 weeks after administration of the composition, and compared to values determined before administration of the composition Where more than one dose of the composition is administered, more than one post-administration determination may be made Administration of polypeptide antigens is a preferred method of treatment for inducing immunity Administration of antibodies of the invention is another preferred method of treatment This method of passive immunisation is particularly useful for newborn children or for pregnant women This method will typically use monoclonal antibodies, which will be humanised or fully human Compositions of the invention will generally be administered directly to a patient Direct delivery may be accomplished by parenteral injection (eg subcutaneously intrapentoneally intravenously, intramuscularly, of to the interstitial space of a tissue), or by rectal, oral, vaginal, topical, transdermal, intianasai, ocular, aural, pulmonary or other mucosal administration Intramuscular administration to the thigh or the upper arm is preferred Injection may be via a needle (e g a hypodermic needle), but needle-free injection may alternatively be used A typical intramuscular dose is 0 5 ml The invention may be used to elicit systemic and/or mucosal immunity -16- WO 2005/111066 PCT/IB2005/001775 Dosage treatment can be a single dose schedule or a multiple dose schedule Multiple doses may be used in a primary immunisation schedule and/or in a booster immunisation schedule A primary dose schedule may be followed by a booster dose schedule Suitable timing between pruning doses (e g between 4 16 weeks), and between priming and boosting, can be routinely determined Bacterial infections affect various areas of the body and so compositions may be prepared in various forms For example, the compositions may be prepared as injectables, either as liquid solutions or suspensions Solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared (e g a lyophilised composition) The composition may be prepared for topical administration eg as an ointment, cream or powder The composition be prepared for oral administration e g as a tablet or capsule, or as a syrup (optionally flavoured) The composition may be prepared for pulmonary administration eg as an inhaler, using a fine powder or a spray The composition may be prepared as a suppository or pessary The composition may be prepared for nasal, aural or ocular administration eg as spray, drops, gel or powder [e g refs 101 & 102] Combinations Within the >2500 proteins described in the examples, NTH0861, NTH0863, NTH0865 and NTH0867 are particularly preferred for use with the invention (particularly in vaccines), and these four proteins can be used in combinations Thus the invention provides a composition composing (a) a NTH0861 protein and (b) at least one further NTHi protein The invention also provides a composition comprising (a) a NTH0863 protein, and (b) at least one further NTHi protein The invention also provides a composition comprising (a) a NTH0865 protein and (b) at least one further NTHi protein The invention also provides a composition comprising (a) a NTH0867 protein, and (b) at least one further NTHi protein The further NTHi protein can be selected from proteins of the invention as described above The combinations are picferably selected within these four proteins, and so the invention provides a composition comprising two or more (i e 2, 3 or 4) of NTH086I, NTH0863 NTH0865 and/or NTH0S67 Preferred compositions comprise (1) NTH0861 and NTH0863 (2) NTH0861 and NTH0865, (3)NTII0861 and NTH0867, (4)NTH0863 and NTH0865, (5)NTH0863 and NTH0867 (6)NTH0865 andNTH0867, (7)NTH0861 NTH0863 andNTH0865 (8)NTH0861,NTH0863 and NTH0867, (9) NTH0863, NTH0865 and NTH0867 (10) NTH0861, NTH0865 and NTH08671 (II) NTH0861.NTH0863 NTH0865 and NTH0867 The NTH0861 protein pieferably comprises SEQ ID NO 1566, SEQ ID NO 5095, or an amino acid sequence having sequence identity (as described above) to SEQ ID NO 1566 and/or to SEQ ID NO 5095 The NTH0863 protein preferably comprises SEQ ID NO 1570 SEQ ID NO 5094, or an amino acid sequence having sequence identity (as described above) to SEQ ID NO 1570 and/or to SEQ ID NO 5094 The NTH0865 protein preferably comprises SEQ ID NO 1574 SEQ ID NO 5093, or an amino acid sequence having sequence identity (as described above) to SEQ ID NO 1574 and/or to SEQ ID NO 5093 The NTH0867 protein pieferably comprises SEQ ID NO 1578 SEQ -17- WO 2005/111066 PCT/IB2005/001775 ID NO 5092, or an amino acid sequence having sequence identity (as described above) to SEQ ID NO 1578 and/or to SEQ ID NO 5092 Further antigemc components of compositions of the invention The invention also provides a composition comprising a polypeptide or the invention and one or more of the following further antigens — a sacchande antigen from N memngitidis serogroup A, C, W135 and/or Y (preferably all four), such as the oligosaccharide disclosed in ref. 103 from serogroup C [see also ref 104] or the oligosaccharides of ref 105 — a sacchande antigen from Streptococcus pneunomae [eg 106 107 108] — an antigen from hepatitis A virus, such as inactivated virus [e g 109 110] — an antigen from hepatitis B virus, such as the surface and/or core antigens {eg 110, 111] — a diphtheria antigen such as a diphtheria toxoid [e g chapter 3 of ref 112] e g the CRM197 mutant [eg 113] — a tetanus antigen, such as a tetanus toxoid [e g chapter 4 of ref 112] — an antigen from Boidetella pertussis such as pertussis holotoxm (PT) and filamentous haemagglutinin (FHA) from B pertussis, optionally also in combination with pertactm and/or agglutinogens 2 and 3 [e g refs 114 & 115] — a sacchande antigen from Haemophilus influenzae B [e g 104] — polio antigen(s) [e g 116,117] such as IPV — measles, mumps and/01 rubella antigens [e g chapters 9,10 & 11 of ref 112] — influenza antigen(s) [eg chapter 19 of ref 112], such as the haemagglutinin and/or neuramimdase surface proteins — an antigen from M01 axella catarralis [eg 118] — an protein antigen from Streptococcus agalactiae (group B streptococcus) [eg 119 120] — a sacchande antigen from Streptococcus agalactiae (group B streptococcus) — an antigen from Streptococcus pyogenes (group A streptococcus) [e g 120,121 122J — an antigen from Staphylococcus aureus [e g 123] The composition may comprise one 01 more of these further antigens Toxic protein antigens may be detoxified where necessary (eg detoxification of pertussis toxin by chemical and/or genetic means [115]) Where a diphtheria antigen is included in the composition it is preferred also to include tetanus antigen and pertussis antigens Similarly where a tetanus antigen is included it is preferred also to include diphtheria and pertussis antigens Similarly, where a pertussis antigen is included it is preferred also to include diphthet 1a and tetanus antigens DTP combinations are thus preferred Sacchande antigens are preferably in the form of conjugates Carrier proteins for the conjugates include diphtheria toxm tetanus toxin, the N meningitidis outer membrane protein [124], synthetic peptides [125,126], heat shock proteins [127,128] pertussis proteins [129 130] protein D from -18- WO 2005/111066 PCT/IB2005/001775 H.influenzae [131], cytokines [132], lymphokines [132], streptococcal proteins, hormones [132] growth factors [132], toxin A or B from C difficile [133] iron-uptake proteins [134], etc A preferred carrier protein is the CRM197 diphtheria toxoid [135] Antigens in the composition will typically be present at a concentration of at least lµg/ml each In general, the concentration of any given antigen will be sufficient to elicit an immune response against that antigen As an alternative to using proteins antigens in the immunogemc compositions of the invention, nucleic acid (preferably DNA eg in the form of a plasmid) encoding the antigen may be used Antigens are preferably adsorbed to an aluminium salt Screening methods The invention provides a process for determining whether a test compound binds to a polypeptide of the invention If a test compound binds to a polypeptide of the invention and this binding inhibits the life cycle of the H.influenzae bacterium then the test compound can be used as an antibiotic or as a lead compound for the design of antibiotics The process will typically comprise the steps of contacting a test compound with a polypeptide of the invention, and determining whether the test compound binds to said polypeptide Preferred polypeptides of the invention for use in these processes are enzymes (e g tKNA synthetases), membrane transporters and ribosomal polypeptides Suitable test compounds include polypeptides, polypeptides, carbohydrates, lipids, nucleic acids (e g DNA, RNA and modified forms thereof), as well as small organic compounds (e g MW between 200 and 2000 Da) The test compounds may be provided individually, but will typically be part of a library (e g a combinatorial library) Methods for detecting a binding interaction include NMR, filter binding assays, gel-retardation assays, displacement assays, surface plasmon resonance, reverse two-hybrid etc A compound which binds to a polypeptide of the invention can be tested for antibiotic activity by contacting the compound with GBS bacteria and then monitoring for inhibition of growth The invention also provides a compound identified using these methods Preferably the process comprises the steps of (a) contacting a polypeptide of the invention with one oi more candidate compounds to give a mixture, (b) incubating the mixture to allow polypeptide and the candidate compound(s) to interact, and (c) assessing whether the candidate compound binds to the polypeptide or modulates its activity Once a candidate compound has been identified in vitro as a compound that binds to a polypeptide of the invention then it may be desirable to perform further experiments to confirm the in vivo function of the compound in inhibiting bacterial growth and/or survival Thus the method comprise the further step of contacting the compound with a NTHi bacterium and assessing its effect The polypeptide used in the screening process may be free in solution affixed to a solid support located on a cell surface or located intracellularly Preferably, the binding of a candidate compound -19- WO 2005/111066 PCT/IB2005/001775 to the polypeptide is detected by means of a label directly or indirectly associated with the candidate compound The label may be a fluorophore, radioisotope, or other detectable label General The invention provides a computer readable medium {e g a floppy disk, a hard disk, a CD-ROM, a DVD etc) and/oi a computer memory and/or a computer database containing one or more of the sequences in the sequence listing The term "comprising" encompasses ' including" as well as "consisting", e g a composition "comprising" X may consist exclusively of X or may include something additional eg X + Y The term "about" in relation to a numerical value x means, for example, x±10% The word 'substantially" does not exclude "completely" e g a composition which is substantially free" from Y may be completely free from Y Where necessary, the word "substantially" may be omitted from the definition of the invention The N-terminus residues in the amino acid sequences in the sequence listing are given as the amino acid encoded by the first codon in the corresponding nucleotide sequence Where the first codon is not ATG it will be understood that it will be translated as methionine when the codon is a start codon, but will be translated as the indicated non-Met amino acid when the sequence is at the C-terminus of a fusion partner The invention specifically discloses and encompasses each of the amino acid sequences of the sequence listing having a K-terminus methionine residue (eg a formyl-methionine residue) in place of any indicated non-Met residue Alternative start codons can be used in biology The amino acid sequences in the sequence listing are based on particular start codons, but downstream start codons may alternatively be used Thus the invention specifically discloses and encompasses each of the amino acid sequences of the sequence listing, starting at any methionine residue from the sequence that is downstream of the N-terminal residue shown in the sequence listing (e g SEQ ID NOS 5088, 5089 & 5090) As indicated in the above text, nucleic acids and polypeptides of the invention may include sequences that (a) are identical (i e 100% identical) to the sequences disclosed in the sequence listing, (b) share sequence identity with the sequences disclosed in the sequence listing (c) have 1 2 3 4, 5 6,1 8, 9 of 10 single nucleotide or amino acid alterations (deletions insertions, substitutions), which may be at separate locations or may be contiguous as compared to the sequences of (a) or (b), and (d) when aligned with a particular sequence from the sequence listing using a pairwise alignment algorithm a moving window of x monomers (amino acids or nucleotides) moving from start (N-terminus ot 51) to end (C-terminus of 3r), such that for an alignment that extends to p monomers (where p>x) there are p-x+1 such windows, each window has at least xy identical -20- WO 2005/111066 PCT/IB2005/001775 aligned monomers, where x is selected from 20, 25, 30,35,40,45, 50, 60, 70, 80, 90,100,150, 200 y is selected irom 0 50,0 60,0 70 0 75 0 80, 0 85, 0 90, 0 91 0 92 0 93, 0 94, 0 95, 0 96 0 97, 0 98, 0 99, and if xy 18 is not an integer then it is rounded up to the nearest integer The preferred pairwise alignment algorithm is the Needleman-Wunsch global alignment algorithm [136], using default parameters (e g with Gap opening penalty =10 0, and with Gap extension penalty = 0 5, using the EBLOSUM62 scoring matrix) This algorithm is conveniently implemented in the needle tool in the EMBOSS package [137] L The nucleic acids and polypeptides of the invention may additionally have further sequences to the N-terminus/5' and/or C-terminus/3' of these sequences (a) to (d) The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, molecular biology, immunology and pharmacology, within the skill of the art Such techniques are explained fully in the literature See, e g, references 138-145, etc MODES FOR CARRYING OUT THE INVENTION Genome sequencing has been carried out on a low-passage clinical NTHi isolate (strain 86-028NP [146]) A total of 2540 coding sequences were identified in the genome, and these are given in the sequence listing together with then inferred translation products Annotation of 1489 of the polypeptide sequences is given in Table III From the sequenced material, polypeptide-coding sequences of particular interest were selected for further work with particular attention to immunogemc proteins for vaccine development Lipoproteins Of the 2540 coding sequences the following 39 were identified as hpoproteins NTH0094, NTH0I63, NTH0I67, NTH0255, NTH0289, NTH0838, NTH0909, NTH0997, NTH1000, NTHI016, NTHI 174, NTH1298, NTHI313, NTHI413, NTHI416, NTH 1552, NTH1623, NTH1675, NTH1680, NTH1739, NTH1873, NTH1922, NTH1942, NTH1974, NTH2142 NTH2169 NTH2251, NTH2349, NTH2356, NTH2358, NTH2524, NTH2588, MTH2595, NTH2641, NTH2673, NTH2715, NTH2754, NTH2758, and NTH2769 Lipoprotems are surface-exposed and as such they represent accessible immunological targets eg for diagnostic and for immunisation purposes Moreover, it has been found in B burgdorferr [147] that OspA protein is immunogenic in a lipidated form but is non-immunogenic in a non-1 lpidated form, and the authors concluded that post-translational lipid attachment is a critical determinant of OspA immunogenicity Outer membrane As H.influenzae is a Gram-negative bacterium its cell wall includes an outer membrane Of the 2540 coding sequences, the following 48 were identified as being located in this outer membrane NTH0017, NTH0193 NTH0227, NTH0241, NTH0252, NTH0270, NTH0283, NTH0432, NTH0498, NTH0502, NTH0504 NTH05I2 NTH0539,NTH0638,NTH0647 KTH0648, NTH0788 NTH0839,NTH0867, NTH0914, NTH1054 NTH1075, NTH1082, NTH1200,NTH1203,NTH1214 NTH1290,NTH1390,NTH1582,NTH1652 NTH1666 NTH1744, NTH1819 NTH1845 NTH1900,NTHI953,NTH1956 NTHI958 NTH1962 NTH2039 NTH2232, NTH2234, NTH2235, NTH2269, NTH2448 -21- WO 2005/111066 PCT/IB2005/0O1775 NTH2484, NTH2493, and NTH2727 Outer membrane proteins (OMPs) are surface exposed and, as such they represent accessible immunological targets e g for diagnostic and for immunisation purposes OMPs are often invasins, adhesins, etc which, if blocked, offers a means of preventing bacterial infection NTH1845 is an Aida-like autotransporter ( Lav') and is a preferred protein of the invention It is conserved between NTHi strains, including one known to cause meningitis, but there is no corresponding gene in the Rd sequence or in strain R2846 It lies between the tmk and holb genes A preferred form of NTH1845 starts at Met-22(;e SEQIDNO 5090) Periplasm As H.influenzae is a Gram-negative bacterium, it has a penplasm between its cell cytoplasmic membrane and its outer membrane Of the 2540 coding sequences, the following 105 were identified as being located in the penplasm NTH0014, NTH0049, NTH0057, NTH0059, NTH0106, NTH0U9, NTH0120 NTH0I32, NTH0174, NTHOI90 NTH0206, NTH0244, NTH0346, NTH0405, NTH0421, MTH0468 NTH0485, NTH0513 NTH0547 NTH0619, NTH0643, NTH0661, NTH0691, NTH0738, NTH0820, NTH0835, NTH0848, NTH0849, NTH0856 NTH086! NTH0863, NTH0865, NTH0910, NTH0926, NTH0961, NTH1015 NTH1018, NTH1121, NTH1164, NTHI185, NTH1190, NTH126I, NTH12G8, NTH1301, NTH1311, NTH1388, NTH1394, NTH1406, NTH1407, NTH14J4 NTH1435, NTH1468, NTH1541, NTH1570, NTH1600, NTH1601, NTH1619, NTH1622, NTH1724, KTH1745, NTH1773, NTH1781, NTH1798, NTHI8O7, NTH1829, NTH1865, NTH1871, NTH1892, NTHI897, "NTH1916, KTH1917, NTH1965, NTH1999, NTH2116, NTH2119, NTH2133, NTH2135, "NTH2149 NTH2150, NTH2187, NTH2217, NTH2227, NTH2256, NTH2258, NTH2277, NTH2291, NTH2316, NTH2342, NTH2344, NTH2369, NTH2394, NTH2432, NTH2434 NTH2451, NTH2496, NTH2508, NTH2537, NTH2541, NTH2572, NTH2575, NTH2610, NTH2705, KTH2726, NTH2738 and NTH2778 Periplasmic proteins represent useful immunological targets e g for diagnostic and for immunisation purposes Inner membrane As H.influemae is a Gram-negative bacterium, it has an inner membrane Of the 2540 coding sequences, the following 740 were identified as being located in the inner membrane NTH0002, NTHO0I5, NTH0Q19, NTHOQ20, NTH0021, NTH0025, NTH0032, NTH0034, NTH0035, NTH0041, NTH0043, NTH0045, NTH0048, NTH0050, "NTH0052, NTH0060, NTH0061 NTH0067, -NTH0073, NTH0076, NTH0085, NTH0089, NTH0091, NTH0097, NTHOI07, NTH0110, NTH0116, NTH0118, NTH0121, NTH0I28, NTH0134, NTH0135, WTH0151, NTHO155, NTH0157, NTH0158, NTH0180, NTH0184, WTH0185 NTH0186 NTH0189, NTH0199, NTH0203, NTH0208, NTH0209, WTH0223, NTH0224 NTH0228, NTH0232, MTH0237, NTH0238, NTH0242, NTH0247, NTH0248, KTH0251, NTH0253, NTH0254, KTH02S6, NTH0263, NTH0269, KTH0278, NTH0279, NTH0280, KTH0290, KTH0295, NTH0297, NTH0302, NTHO307, NTH0311 , NTH0317, NTH0320 NTH032I, NTH0325, NTH0326, NTH0333, NTH0334, NTH0341, NTH0347, NTH0351, NTH0352, NTH0353, NTH0356, KrH0358, NTH0366, NTH0371, NTH0372, NTH0388, NTH0397 NTH0400, NTH040I, NTH0402 NTH0407, NTH0411, NTH0412, NTH0417.NTH0418 NTH0420 NTH0426, NTH0427, KTH0434, NTH0435 NTH0437,MTH04441NTH0453,NTH0455!NTH0457,NTH0459,NTH0460J'NTH0461 NTH0462 NTH0463, NTH0465, NTH0469, MTH0473, NTH0475, NTH0478, NTH0484 NTH0489 NTH0490 NTH0493, NTH0496, NTH0507, -22- WO 2005/111066 PCT/IB2005/001775 NTH0509 NTH05I8, NTH0524, NTH0S26, NTH0528, NTH0529, NTH0544, NTH0545, NTH0549, NTH0565, NTH0566, NTH0574, NTH05S0 NTH058I, NTH0584, NTH0585, NTH0586 NTH0587, NTH0590, NTH0617 NTH0618, NTH0622, NTH0624, NTH0626, NTH0630, NTH0636, NTH0637, NTH0642 NTH0644, NTC0646, NTH0654, NTH0656, NTH0658, NTH0673, NTH0675 NTH0676, NTH0677, NTH0678, NTH0680, NTH0694, NTH0696, NTH0702, NTH0703, NTH0706, NTH0709, NTH0710, NTH0712, NTH0715, NTII0718, NTH0728, NTH0730, NTH0740, NTH0744, NTH0745, NTH0749, NTH0750, NTH0755, NTH0762 NTH0764, NTH0765, NTH0771, NTH0774, NTH0794, NTH0795, KTH0796, NTH0797, NTH0798, NTH0802, NTH0803, NTH0804, NTH0813, NTH0814, NTH0815, NTH0821, NTH0S22, NTH0827 NTH0829, NTH0834, NTH0836, NTHO85O, NTH0851, NTH0852, NTH0858, NTH0872, NTH0874, NTH0875, NTH088O, NTH0887 KTH0888, NTH0894, NTB0904, NTH0913, NTH0927, NTH0928, NTH0941, NTH0948 NTH0949, NTH0950, NTH0952 NTHO953, NTH0955, NTH0964, NTH09S8, NTH0973, NTH0986, NTH09S7 NTH09S9, NTH0994, NTH0996, NTHJ002, KTHI003,KIH1004,NTH1005 NTH1009, NTHI010 NTHI012, NTBI020 NTFI1021, NTH1026 NTHi02S,NTHIO3I, NTH1032, NTHI037, NTH1039, NTH1042, NTH1043, NTH1048 NTH1052, NTH1058, NTH1063, NTH1064, NTH1069, NTH1073, NTH1080, NTH1083 NTHIG8i NTHI085, NTH1086 NTHI087, NTHI089, NTH1090, NTH1091, NTHI092, NTHIO98 NTHII02, NTH 1103 NTHII04 NTHI106, NTH1123, NTH112-1, NTHJ125, NTHH30 NTHI138, NTH114I, NTHI150, NTHU51, NTHI178, NTHI181, NTHIJ84, NTHI188, NTH1I89, NTH119I, NTH1192, NTH1193, NTH120I, NTII1205 NTH1216 NTH1220, NTH1221,NTHI224,NTH1225)NTH1226,NTH12291NTH1230, NTH1231 NTH1233, NTH1234, NTHI236, NTH1238, NTH1240, NTHJ241, NTH125O NTH1252, NTH3254, NTH1255, NTH1256, NTH1262, NTH1273, NTH1275, NTH1279, NTH1280, NTH128I, NTHI282, NTH1283, NTH1286, NTH1287, NTH1293, NTH1295, NTH1297, NTHI300, NTH1302, NTH13O5, NTH1306 NTHI307 NTH13O8, NTH1309, NTH13I5, NTHI319, NTHI32I, NTH1327, NTH1332, NTH1334, NTH1336 NTH1337, NTH1341, NTH1346, NTH1348, KTH1354, KTH1357, NTH1359, NTHI361, NTH1365, NIH1368, NTH 1374, NTH1376, NTH1379, NTH1380, NTH1383, NTH1391, NTHI393, NTH1398, NTHI400 NTH14H, MTH14I2, NTH1420, NTHI421, NTH1425, NTH1427, NTHI428, NTH1429, NTH1430, NTH1431, NTH1434, NTH1437, NTH1438, NTHL439, NTH1447, NTH1448, NTHI450, NTH1454, NTH1455, NTH1464, MTH1467, NTHJ470, NTH1471, NTHI472, NTHI473, NTH1474, NTH1479, NTH1491, NTHI492, NTHI493, NTH1495 NTH1500 NTHl503)NTHIS06;NTHl5!0,NTHl5l5,NTHI525JNTHl526 NTHI527 NTH1528 NTHI531, NTH1532 NTH1537, NTHI538, NTH1540, NTHI548 NTHI559 NTH1562, NTH1567, NTHI569, NTIII573, NTH1575, NTHIJSI, NTHJ584, NTH15S6, NTHL587, NTHI588 NTHI590, NTH1594, NTH1597, NTH1599, NTHI602, NTH1605, NTH1606, NTHI608, NTHI609, NTH1617, NTHJ618 NTHJ620, NTH1621, NTH1625, NTH1629, NTH163I, NTHI634, NTH1637, NTH1638, NTHI653,NTHI654,NTHI6^7,NTH1662)NTH1664 NTHI668,NTH1671 NTHI686, NTH1687, NTH16S8 NTH1689 NTH1690,NTlI1692,NTH1693 NTH169S NTH1701]NTH1707,NTH17I2 NTH1718 NTH1719 NTH1722 NTHI725, NTIU729, NTH1732, NTHI735, NTH1760, NTHI767, NTH1770, NTHI778, NTHI779, NTH17S2 NTH1783, NTH1788 NTH1793, NTHI795, NTH1796, NTH1799, NTHI803, NTHI80, NTH1806 NTHI8I3, NTH1815, NTHI820 NTH1824, MTH1828, NTH1835, NTHI836, NTH1842, NTH1849, NTHI850 NTHI859 NTHI861, NTHI870, NTH1872, NTH1881 NTH1882 NTH1885, NTH1888, NTH1889, NTH1891, NTH1896, NTH1898 NTH1899, NTHI906, NTH1908, NTHI919, NTHI923, NTH1925, NTH1927, NTH1935, HTH1919, NTH1941, NTH1951, NTH1960, NTOI963, NTH1966, -NTH1967, NTH1968, NTHI978 NTH1981 NTH1986, NTH1992, NTH1993 NTH1995 NTH1996 NTH1997 NTH1998, NTH200I, NTH2005 NTH2008,NTH2009,NTH2010,NTH2024 NTH2025 NTH2038 NTH2040, NTH204I, NTH2043, NTH2050, NTH2052 NTH2055,NTH2060;NTH2062 NTH2064 NTH2065, NTH2070, NTH207I.NTH2073, NTH2078, NTH2079, -23- WO 2005/111066 PCT/IB2005/001775 NTH2081, NTH2083, NTH2089, NTH2091, NTH2092, NTH2093, NTH2094, NTH2095, NTH2096, NTH2097 NTH2099, NTH2101, NTH2112, NTH2115, NTH2118, NTH2120, NTH2122, NTH2126, NTH212S NTH2I29 NTH2130, NTH2131, NTH2136,NTH2138 NTH2145 NTH2146 NTH2162 NTH2163 NTH2166, NTH2169, NTH2170 NTH2173 NTH2181 NTH7183, NTH2191, NTH2193 NTH2195, NTH2196, NTH2200, NTH2204, NTH2205, NTH2209, NTTO13, OTH2226, NTH2228, NTH2231, NTH2242, NTH2243 NTII2247, NTH2250 NTH2253, NTH2257, NTH2259, NTH2262, NTH2263, NTH2266, NTH2273, NTH2274, NTH2282, NTH2284, NTH2285, NTH2288, NTH2292, NTH2296, NTH2299, NTH2318, NTH2323, NTH2324, NTH2326, NTH2327, NTH2333, NTH2343, NTH2346, NTH2347, NTHJ352, NTH2361, NTH2364, NTH2365, NTH236S, NTH2370, NTH237I, NTH2376, NTH2377, NTH2381, NTH2382, NTH2388, NTH2398, NTH2402, NTH2405, NTH2406, NTH2407, NTH2408, NTH2414, NTH2422, NTH2430, NTH2433, NTH2438, NTH2447, NTH2455) NTH2457, NTH2458, NTH2472, NTH2478, NTH2481, NTH2486, NTH2495 NTH2497, NTH2498 NTH2499, NTH2501 NTH2505 NTH2525, NTH2531, NTH2532, N1H2533, NTH2534, NTH2542, NTH2543, NTH2545, NTH2546, NTH2548 NTH2549 NTH2550 NtH2552, NTH2554, NTH2556 NTH2557 NTH2558, NTH2562, NTH2566, NTH2567, NTH2568, NTH2569, NTH2570, NTH2573 NTH2S77, NTH2578 NTH2587,NTH259I,NTH2593 NTH2597, NTH2600, NTH2602, NTIJ2603, NTH2604 NTH2605, NTH2612, NTH2613, NTH26I5, NTH2616, NTH2618, NTH2626, NTH2633, NTH2640) NTH2647, NTH2648, NTH2649, NTH2650, NTH266I, NTH2663, NTH2664, NTH2667, NTH2668, NTH2674, NTH2675, N1H2680, NTH2690 NTH270I, NTH2702, NTH2703, NTH2708, NTH27U, NTH2724, NTH2725, NTH2732, NTH2735, NTH2740, NTH2743 NTH2749, NTH2750, NTH2755, NTH2756 NTH2757, NTH2764, NTH2765 NTH2774, NTH2777, NTH2779, NTH278I, NTH2793, NTH2794, NTH2796, NTH2797, NTH2798, NTH2806, NTH2807, NTH2813, NTH2814, NTH2823 and NTH2824 Inner membrane proteins represent useful immunological targets eg for diagnostic and for immunisation purposes Of these proteins, NTH1069 in particular has been identified as a virulence-associated protein A preferred form of this protein starts at Met-27 0 s SEQ ID NO 5088) Another preferred form starts atMet-19(SEQIDNO 5089) Adhesin An adhesin having amino acid sequence SEQ ID NO 5091 has been identified in a NTHi strain isolated from a patient with meningitis It is homologous to the Hia adhesin from Nmeningitidis H. influenzae Rd The genome sequence of the serotype d strain KW20 [1,3] was published in 1995 As serotype d strains are generally not pathogens, but the sequenced NTHi strain is from a clinical infection, expressed NTHi sequences that are not seen in serotype d are likely to be the proteins that are involved in pathogenic mechanisms Blocking these proteins, either by antibiotic treatment or by antibody binding, thus has therapeutic potential Of the 2540 coding sequences the following 613 are not seen in the Rd genome NTH0001, NTH0002 NTH0004 NTH0005 NTH00I2 NTH0OI6, NTH0021, NTH0022, NTH0024, NTH0032, NTHOO33 NTH0034, NTH0035 NTH0036, NTH0037 NTH0038 NTH0040 NTH0045 NTH0050, NTH005l,NTH0052,NTH0053,NTH0064,NTH0089 NTH0092, NTH0097 NTH0101 NTH0104 NTH0110, NTH0114, NTH0122, NTH0123 NTH0124 NTH0125, NTH0129 NTH0135,NTH0136, NTH0138, NTH0I40, NTH0146 NTH0I48, NTH0151, NTH0I53 NTH0I54, NTH0I59, NTH0161, NTH0164, WTH0I69, NTH0173, NTH0176, NTH0177, -NTH0187, -24- WO 2005/111066 PCT/IB2005/001775 NTH0191, NTH0192, NTH0193, NTH0194, NTH0195, NTHQ197, NTH0198, NTH0199 NTH0226, NTH0235, NTH0236, NTH0238,NTH0250,NTH0251,NTH0254,NTH0255,NTH0256 NTH0264, NTH0265, NTII0278 NTH0279 NTH0280, NTH02S2, NTH0283, NTH0284, NTH0285, NTH0289, NTH0297 NTH0298, NTH0299 NTH0300, NTH0302, NTH0307 NTH0308JNTH0310,NTH03I2JNTH03i3 NTH0319 NTH0327, NTH0328, NTH033! NTH0334, NTHO335' MH0339, NTH0341,NTH0348,NTH0363 NTH0371 NTH0375, NTH0378 NTH0379, NTH0384, NTH0385, NTH0396, NTH0407, NTH0408, NTH041I, NTH0417, NTH0419, NTH0420, NTH0424, NTH0429, NTH0430, NTH0431, NTH0432 NTH0433, NTH0434, NTH0435, NTH0438, NTH0455 NTH0478, N1H0484, NTH0485, NTH0486, NTH0487, NTH0488, NTH0489 NTH0498, NTH0500, NTH0501, NTH0506, NTH0509, WTH0510, NTH05I1, NTH0520, KTH0523, NTH0526, NTH0527, NTH0531, WTH0534, NTH0536, NTH0539 NTH0539, NTH0561, NTH0573, NTH0577 NTH0579, NTH0580, NTH0581 NTH0582, NTH0583, NTH0584, NTH0585, NTH0586, NTH0588 NTH0599, NTH0603, NTH0604, NTH0606, NTH0615 NTH0617, NTH063I NTH0637, NTH0644, NTH0645, NTH06:i3, NTH0662, NTH0663, NTH0664, NTH0667, NTH0668, NTH0673, NTH0677, NTH0680, NTH0681 NTH0683, NTH0687 NTH0690 NTH0691 NTH0692, NTH0694, NTH0695, NTH0696 NTH0706,NTH0707,NTH0711,NTH0715 NTH0716, NTH0717, NTH0721 NTH0724, NTH0725, NTH0726, NTH0728, NTH0729, NTH0730, NTH0749 NTH0752, NTH0756, NTH0768, NTH0776, NTH0792, NTH0797, NTH0818, NTH0827, NTH0832 NTH0839, NTH0841, NTH0843, NTH0844, NTH0862, NTH0864, NTH0866, NTH0867, NTH0877, NTH0879, NTH0885 NTH0886 NTH0892, NTH0895, NTH0896, NTH0900, NTH0901, NTH0904, NTH0906 NTH0921 NTH0924, NTH0928, WTH0929, NTH0930, NTH0931, NTH0932, NTH0933 NTH0937, NTH0938, NTH0942, NTH0949, NTH0953, NTH0955, NTH0961, NTH0964, NTH0970, NTH0971 NTH0972 KTH0973, NTH0985, NTH0987, NTH0991, NTH0992, NTH0993, NTH0994, NTH0995, NTH0996, NTH1007 NTH1016 NTH1017, NTH1020, NTHI025, NTHI026, NTH1027, NTH1028, NTH1029, NTHJ037, WTH1040, "NTH1049, KTH1067, NTH1069, NTH1070, NTH1073, NTHI082, NTH1086,NTH1089 NTHI090, NTHII08, NTH11I1, NTHI112, NTH1114, NTH(115, NTH1I16, "NTH1122, NTHI129, NTH1131, NTH1142, NTH! 149, NTH1150, NTH1I53, NTH1I57, NTHI159, NTH1161, NTH1162, NTHI176, NTHU78, NTHlI79,Nn-il!93 NTH1195 NTHU96,NTHI204,NTH1205,NTHl207,NTHI208>NTH1209,NTH12I0 NTH12I1 NTH1214, NTH1216, NTHI220, NTHI225, NTHI234, NTH1235, NTH1237 NTH1241, NTH1244, NTH1245, NTH1246, NTH1247(NlH1248,NTH1249)NTH1250,NTH1251JNTH1252,NTH1253,NTH1270 MTH127I NTH1294 NTHI299, NTHI313,-NTH13I5t NTH1316, NTH1325 NTHI330, NTHI333, NTH1337, NTH1339, NTH1342, NTHI353, NTH1361, NTH1367, NTH1374, NTH1375, NTH1381, NTHI3S2, NTH1390 NTH139I, NTH1395 NTH1396, NTH1399, NTH1414, NTH14I5, NTHI418 NTH1419, NTH1437, KTH1441, NTH1454, NTH1456, NIH1471, KTH1474, NTH1487, MTH1489, NTH1490, NTH149I, NTH1492, NTH1493, KTHH94 NTH1495, NTH1496, NTH1497, KTH1504, NTH15I6, NTH1540, NTH1543 NTH1555,NTHl563 NTH1564 KTH1567)NTHi5713NTH1573,NTH1574, KTH1580,-NTHi587 NTH1598, NTH1599, NTH1600, NTHI601 NTH1602.NTH1603, NTH1605 NTHI606, NTH1607, "NTH161 1, NTH16I2,NTH16I5, NTH1616 NTH1626, NTH1627, NTH1628, NTHI647, NTH1656 NTH1657, NTHI658, KTHI676, NTH1677, NTH1687, NTH1697,NTH17O2, NTH1703, NTHI713, MTH1734, NTH1740, NTH1742, NTH1744 NTH1745, NTHI748, NTH1749 N1HI751, NTH1752, NTH1753, NTH1754, NTH1755, NTHI756, NTHI757, NTHI758, MTH1759, NTHI760, NTH1765, NTH1769,NTH1770 NTH1778, NTH1798, NTH1804, NTH1811, NTH18I2. NTHI815, NTHI816 NTH1817, NTH1818, NTH1820, NTHI82lf NTH1822, NTH1829, NTH1832 NTH1833, NTH1837, NTH1842 NTH1845, NTH1854, NTH1857, NTH1904, NTH1910 NTH1914, NTHI916, NTH1920, NTH1921, NTH1922, NTH1943, NTH1946 NTHI947, NTH1948, NTH1956 NTHI962, NTH1964, NTH1968, NTH1989, NTH1994, NTH2019, NTH203!, NTH2035, NTH2043, NTH2056 -25 WO 2005/111066 PCT/IB2005/001775 NTH2060 NTH2069, NTH2075, NTH2093, NTH2096, NTH2109, NTH2110, NTH21I2, NTH2113, NTH2114, NTH2117, NTH2156, NTH2159, NTH2170, NTH2197, NTH2198, NTH2199, NTH2206, NTH2207, NTH2216 NTH2217, NTH2219, NTH2220, NTH2221, NTH2222, NTH2223, NTH2226, NTH2229, NTH2245, NTH2273, NTH22S4 NTH2287, NTH2305, NTH2309, NTH2315, NTH2316, NTH2323, NTH2326 NTH2330, NTH2332) NTH2343, NTH2349, NTH2353, NTH2362, NTH2363, NTH2364, NTH2386, NTH2414, NTH2442 NTH2451, NTH2455 NTH2456, NTH2457, NTH2458, KTH2460 NTH2461, NTH2463, NTH2464, NTH2466, NTH2467, NTH2468 NTH2471, NTH2480, NTH248I, NTH2482, NTH2483, NTH2484, NTH2485, NTH2486, NTH2487, NTH2488, NTH2500, NTH2510, NTH2524, NTH2525, NTH2527, NTH2528, NTH2536 NTH2537 NTH2549, NTH2562, NTH2563, NTH2572, NTH2573, NTH2575, NTH2584, NTH2585, NTH2590, NTH2604, NTH2607, NTH2608, NTH2609, NTH2635, NTH2647, NTH2648, NTH2650, NTH2655, NTH2664, NTH2668 NTH2679, NTH2684, NTH2693, NTH2694, NTH2696, NTH2697, NTH2703, NTH2704, NTH2706, NTH2707 NTH2708, NTH2709, NTH2710, NTH2711, NTH2712, NTH2713, NTH2715, NTH2716, NTH2718, NTH2719, NTH2720, NTH2721, NTH2723, NTH2724, NTH2725, NTH2726, NTH2727, NTH2729, NTH2730, NTH2731, NTH2737, NTH2744, NTH2753, NTH2778, NTH2781, NTH2783, NTH2784, NTH2785, NTH2791, NTH2804, NTH2806 NTH2809, NTH2810, and NTH2S16 NTH0861 to NTH0867 Protein NMB0419 from Neisseria meningitidis has been found to participate in the meningococcal invasion mechanism [2] The protein was shown to modulate bactcnal interaction with monolayers of human repiratory epithelial cells, promoting invasion A homologous protein BPF001 is seen in H.influenzae biogroup aegyptius, but study of tins protein was not possible The NTHi genome includes a region (SEQ ID NO 5081) encoding a string of four polypeptides (NTH0861, NTH0863, NTII0865 and NTH0867) with strong similarity to NMB0419 This legion and the four polypeptides are shown below -26- WO 2005/111066 PCT/IB2005/001775 TAGAGGGGAGCTCTAATGCCA&CTTTACAATGCGAATTTTGGAATGTAGGGCAAGGGTTA R G E L * TTTTCAAGTGGGCGTATTCAAATGGGACGCCCCCATTCXTTSGGTTTATGGTTtG CAflGTTCCTCATCATGGTTCAAAGCCAATTTTAGTGAATAAAMTARAAGRTTATCC?T'r CfiTTCAaTTTARTaGGaAAACaflATGRMCTCACAAAftaCACTTCTTACCACCGCACrTT (SEQ ID NO 1574) HTSO865 M K L T K T L h T T A I. F TCGGtGCTTCTATTTTTTCTTTTCAATCCiVCCGCTTGGGCGGATACGCCGGAACAGCAAT GASIFSFOSTAWA D T P E Q Q F TCCAACMGGTTl'AACCGCTTAirGliGCAaAGCAACTaTCAAaCCGCCTT'rJ51SACTXTGGT QQGLTAYEQSNYQTArKLWL TACCTCTGGCGGAGCAGGGAGATGCACAGGCTCAAGGTGGTTTGGGCATGATGI'ATGAaA PLAEQGDAQAQGGLGMMYER GAGGACTTCGCGTARAACAAGATGArrTCAAPGCAGTGAACTGGTATCGCAAAGCGGCGG GLGVKQDDFK-a^Wffyfi iC . A A JS RGCAGGGGGATGCAGATGCTCAATTAaATTTGGGTGCGATGTATGCAATCGGACGTGGCG Q G DADAQLNLGAMY&IGRGV TAAAACAAGATGG'TGTg^aagaSGTC^GTGGTTTCGCAAfiGCGGCAGAGCAGSGAAATG JCflDffVEAVKW?fl K A A E Q G S A CAAAGGCTCAAAATGGTTrGGGCAJ-GATGTATGACGGAGGACrTGGCATAAAACAAGATT KAQUGX.GMMYDGGLGIKODX ATTTCAAAGCGGTGAAATGGCATCGCAAftGCGGCGGAGCAGGGWATGGAGGTGCTCAAG FKAVKVJHRKAREQGYGGAQV TTATQTTGGGATTCTCATATCTI'a'CGGGAAAAGGTGTTCAAGTAAATAAAICTTTAGCCA MLGFSYLSGKGVQVNKSIJAK AAGAATGGXTTGGTAAGGCTTGTGATAATGGTGAACAAGTGGGrTGTGAATA'FTA'rGGrP B W P 6 K A DHGEO^G EtYGK AGCTAAATAGAGGGGAACGCTAATGCCAACTTTACAATGCGAATTTTGGAATGTAGGGCA LARGER* AGGGTTATTTTCAAGTGGGCGTATTCAAATGGGAGACGCCCAAGCCTTTCATTGGGTTTA TGGTtTGCAAGTTCCTCATCATGGTITCAAAGCCAATTTAGTGAATAAAAAfSAAAGAT'I' ATCCATTCAI'TCAATTTAATMGAAAACAAAATGAAACTCACAAAAACPCTTCTIIACCAC CSBQ ID KO 1570} MTO0863 MKI.TKTLI.TT CGCACTTTTCGGTGCTTCTGTAMTTCTTTTCAATCCACCGCTTGGGCGGATACGCTGGA A_^^ F_G_ A5VF5FQSTAWA D X L B ACAGCAAT7CCAACAAGGTTTAACCGCTTATGACCAAAGCAACTATCAAACCGCCTTTAA QQFQQGLTAYEQSNYQTAFK ACTTrGGTTACCTATGGCAGAGCAGGGATATGCPAAGGCTCAAT'ETAATTI'GGGCGTGAT LWLPMAEQGYAKAQFNLGVM GTATGCTAAGGGGCAAGGCGTCAAACAAGATGATrTTGAAGCGGTGAAGTGGTTTCGCAA ySKGQGVKQDDFEAVKWFSK -27- -28- WO 2005/111066 PCT/IB2005/001775 -29- WO 2005/111066 PCT/IB2005/001775 WO 2005/111066 PCT/IB2005/001775 The serial repeats of four closely-related genes that axe also related to genes involved in bacterial invasion is noteworthy, and NTH0861, NTH0863 NTH0865 and NTH0867 are of particular interest for immunisation purposes NTH0867 in particular is an outer-membrane protein that is not seen in the Rd genome, and is of special interest Moreover as well as being caused by NTHi, acute otitis media is often caused by Moraxella catarrihalis and Streptococcus pneumoniae Four proteins have been identified that in the NTHi -30- WO 2005/111066 PCT/IB2005/001775 genome that have homologs in the Mcatarrhalis genome, namely NTH0861 (SEQ ID NO 1566), NTH0863(SEQIDNO 1570),NTH0865 (SEQIDNO 1574) and NTH0867 (SEQIDNO 1578) These proteins can thus be used as antigens for a general AOM vaccine The corresponding Mcatarrhalis antigens can also be used, either on their own or in combination with the NTHi antigens -31- A variant of SEQ ID NO 1566 is given as SEQ ID NO 5095 WO 2005/111066 PCT/IB2005/001775 Preferred NTH0861 proteins have identity to both of SEQ ID NOS 1566 and 5095 Preferred NTH0863 proteins have identity to both of SEQ ID NOS 1570 and 5094 Preferred NTH0865 proteins have identity to both of SEQ ID NOS 1574 and 5093 Preferred NTH0867 proteins have identity to both of SEQ ID NOS 1578 and 5092 It will be understood that the invention has been described by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention -32 WO 2005/111066 PC1/IB2005/001775 TABLE I - MISSING NTHnnnn VALUES between NTH0001 and NTH2832 0008 0031 0042 0054 0056 0066 0074 0077 0093 0111 0160 0162 0166 0171 0179 0210 0213 0214 0219 0229 0231 0276 0281 0288 0293 0322 0332 0357 0362 0381 0395 0398 0404 0406 0409 0410 0415 0439 0445 0446 0452 0466 0471 0491 0497 0516 0533 0538 0541 0546 0551 0553 0556 0569 0578 0598 0600 0610 0623 0639 0649 0666 0693 0713 0722 0727 0742 0746 0757 0763 0780 0789 0791 0793 0800 0809 0816 0855 0883 0891 0902 0911 0915 0916 0922 0943 0944 0957 0975 0978 0980 0998 0999 1013 1034 1044 1047 1055 1056 1065 1072 1076 1079 1099 1113 1118 1119 1128 1133 1134 1136 1146 1147 1158 1160 1170 1194 1199 1213 1219 1223 1232 1243 1257 1260 1288 1289 1296 1312 1317 1329 1335 1347 1350 1356 1358 1362 1364 1372 1377 1385 1452 1458 1469 1478 1481 1486 1488 1502 1517 1518 1529 1536 1547 1553 1557 1560 1566 1592 1595 1596 1604 1642 1649 1667 1669 1674 1691 1699 1711 1715 1721 1723 1727 1728 1731 1737 1741 1743 1746 1750 1761 1772 1784 1797 1810 1814 1823 1843 1844 1856 1864 1866 1878 1902 1909 1918 1957 1961 1979 1985 1987 1990 2004 2006 2015 2017 2023 2033 2037 2042 2054 2077 2080 2098 2104 2107 2125 2154 2167 2171 2174 2179 2194 2203 2210 2218 2237 2239 2240 2244 2254 2255 2267 2268 2270 2275 2278 2286 2290 2295 2300 2302 2312 2320 2334 2340 2355 2357 2366 2367 2374 2380 2400 2409 2431 2444 2459 2523 2540 2547 2551 2574 2580 2589 2601 2611 2614 2624 2628 2637 2639 2645 2652 2658 2662 2677 2692 2699 2700 2728 2734 2746 2760 2767 2773 2787 2799 2805 2808 2819 2822 NTH0001 NTH0002 NTH0004 NTH0005 NTH0012 NTH0014 NTII0015 NTH0016 NTH0017 NTH00I9 NTH0020 NTH0021 NTH0022 NTH0024 NTH0025 NTH0032 NTH0033 NTH0034 NTH0035 NTH0036 NTH0037 NTH0038 NTH0040 "NTH0041 NTH0043 NTH0045 NTH0048 NTH0049 NTH005O NTH0051 "NTH0052 NTH0053 "NTH0057 NTH0059 NTH006O NTH0061 NTH0064 NTH0067 NTH0073 NTH0076 MTH0085 NTH0089 NTH0091 NTH0092 NTH0094 "NTH0097 NTHO101 NTH0104 NTH0106 NTH0107 NTH0110 NTH0I14 NTH0116 NTHOllS NTH0119 NTH0120 NTH0121 NTH0122 NTH0123 NTH0124 NTH0125 NTH0128 NTH0129 NTH0132 NTH0134 NTH0135 NTH0136 NTH0138 NTH0140 NTH0146 NTH0148 "NTH0151 NTH0153 NTH0154 NTH0I55 NTH0157 NTH0158 NTH0159 NTH0161 NTH0163 NTH0164 NTH0167 NTH0169 NTH0173 NTH0174 NTH0176 NTH0I77 NTH0180 NTH0184 NTH0185 NTH0186 NTH0187 NTH0L89 NTH0190 NTH0191 NTH0192 -33- WO 2005/111066 PCT/IB2005/001775 NTH0193 NTH0I94 NTH0195 NTH0197 NTH0198 NTH0199 NTH0203 NTH0206 NTH0208 NTH0209 NTH0223 NTH0224 NTH0226 NTII0227 NTH0228 NTH0232 NTH0235 NIH0236 NTH0237 NTH0238 NTH0241 NTH0242 NTH0244 NTH0247 NTH0248 NTH0250 NTH025I NTH0252 NTH0253 NTH0254 NTH0255 NIH0256 NTH0263 NTH0264 NTH0265 NTH0269 NTH0270 NTH0278 NTH0279 NTH0280 NTH0282 NTH0283 NTH0284 NTH0285 NTH0289 NTH0290 NTPI0295 NTH0297 NTH0298 NTH0299 NTH0300 NTH0302 NTH0307 NTH0308 NTH03I0 NTH0311 NTII0312 NTH0313 NTH0317 NTHO319 NTH0320 NTH0321 NTH0325 NTH0326 NTH0327 NTH0328 NTH0331 NTH0333 NTH0334 NTH0335 NTH0339 NTH0341 NTH0346 NTH0347 NTH0348 NTH0351 NTH0352 NTH0353 NTH0356 NTH0358 NTH0363 NTH0366 NTH0371 NTH0372 KTH0375 NTH0378 NTO0379 NTH0384 NTH0385 NTH0388 NTH0396 NTH0397 NTH0400 NTH0401 NTH0402 NTH0405 NTH0407 NTH0408 NTN0411 NTH0412 NTH0417 NTII0418 NTH0419 NTH0420 NTH0421 NTH0424 NTH0426 NTH0427 NTH0429 NTH0430 NTH0431 NTH0432 NTH0433 NTII0434 NTH0435 NTH0437 NTH0438 NTH0444 NTH0453 NTH0455 NTII0457 NTH0459 NTH0460 NTH0461 NTH0462 NTH0463 NTH0465 NTH0468 NTH0469 NTH0473 NTH0475 NTH0478 NTH0484 NTH0485 NTH0486 NTH0487 NTH0488 NTH0489 NTH0490 NTH0493 NTH0496 NTH0498 NTH0500 NTH0501 NTH0502 NTH0504 NTH0506 NTH0507 NTH0509 NTH0510 NTH0511 NTH0512 NTH0513 NTH0518 NTH0520 NTH0523 NTH0524 NTH0526 NTH0527 NTHO528 NTH0529 NTH0531 NTH0534 NTH0536 NTH0539 NTH0544 NTH0545 N1H0547 NTH0549 NTH0559 NTII0561 NTH0565 NTH0566 NTH0573 NTH0574 NTH0577 NTII0579 NTH0580 NTH0581 NTH0582 NTH0583 NTH0584 NTH0585 NTH0586 NTH0587 NTH0588 NTH0590 NTH0599 NTH0603 NTH0604 NTII0606 KTH0615 N1H0617 NTH0618 NTH0619 NTH0622 NTH0624 NTO0626 "NTH0630 NTH0631 NTH0636 NTH0637 NTH0638 NTH0642 NTH0643 NTH0644 NTH0645 NTH0646 NTH0647 NTH0648 NTH0653 NTH06S4 NTH0656 NTH0658 NTH0661 NTH0662 NTH0663 NTH0664 NTH0667 NTH0668 NTH0673 NTH0675 NTH0676 NTH0677 NTH0678 NTH0680 NTH0681 NTH0683 NTH0687 NTH0690 NTH0691 NTH0692 NTH0694 NTH0695 NTH0696 NTH0702 NTH0703 NTH0706 NTH0707 NTH0709 NTII0710 NTH0711 NTH0712 NTH0715 NTH0716 NTH0717 NTH0718 NTH0721 NTH0724 NTH0725 NTH0726 NTH0728 NTH0729 NTO0730 NTH0738 NTH0740 NTH0744 NTH0745 NTH0749 NTH0750 NTH0752 NTH0755 NTH0756 NTH0762 NTH0764 NTH0765 NTH0768 NTH0771 NTH0774 NTH0776 NTH0788 NTH0792 TSTTH0794 NTH0795 NTH0796 NTH0797 NTH0798 NTH0802 "NTH0803 NTH0804 NTH0813 NTH0814 NTH0815 NTH0818 NTH0820 NTH0821 NTH0822 NTH0827 NTH0829 NTH0832 NTH0834 NTH0835 NTH0836 NTH0838 NTII0839 NTH0841 NTH0843 NTH0844 NTH0848 NTH0849 NTII0850 NTH0851 NTH0852 NTH0856 -34- WO 2005/111066 PCT/IB2005/001775 NTH0858 NTH0861 NTH0862 NTH0863 NTH0864 NTH0865 NTH0866 NTH0867 NTH0872 NTH0874 NTH0875 NTH0877 NTH0879 NTHOS80 NTH0885 NTH0886 NTH0887 NTH0888 NTH0892 NTH0894 NTH0895 NTH0896 NTH0900 NTH0901 NTH0904 NTH0906 NTH0909 NTH0910 NTH0913 NTH0914 NTH0921 NTH0924 NTH0926 NTH0927 NTH0928 NTH0929 NTH0930 NTH0931 NTH0932 NTH0933 NTH0937 NTH0938 NTH0941 NTH0942 NTH0948 NTH0949 NTH0950 NTH0952 NTH0953 NTH0955 NTH0961 NTH0964 NTH0968 NTH0970 NTH0971 NTH0972 NTH0973 NTH0985 NTH0986 NTH0987 NTH0989 NTH0991 NTH0992 NTH0993 NTH0994 NTH0995 NTH0996 NTH0997 NTH1000 NTH1002 NTH1003 NTH1004 NTH1005 NTH1007 NTH1009 NTH1010 NTH1012 NTH1015 NTH1016 NTH1017 NTH1018 NTH1020 NTH1021 NTH1025 NTH1026 NTH1027 NTH1028 NTH1029 NTH1031 NTH1032 NTH1037 NTH1O39 NTH1040 NTHI042 NTH1043 NTH1048 NTH1049 NTH1052 NTH1054 NTH1058 NTH1063 NTH1064 NTH1067 NTH1069 NTH1070 NTH1073 NTH1075 NTH1080 NTH1082 NTH1083 NTH1084 NTH1085 NTH1086 NTH1087 NTH1089 NTH1090 NTH1091 NTHI092 NTH1098 NTHH02 NTH1103 NTH1104 NTH1106 NTH1108 NTH1111 NTH1112 NTH1114 NTH1115 NTH1116 NTHH21 NTH1122 NTH1123 NTH1124 NTH1125 NTH1129 NTH1130 NTHl31 NTH1138 NTH1141 NTH1142 NTH1149 NTH1150 NTHU51 NTH1153 NTH1157 NTH1159 NTH1161 NTH1162 NTH1164 NTH1174 NTH1176 NTH1178 NTH1179 NTH1181 NTH1184 NTH1185 NTH1188 NTH1189 NTHil90 NTH1191 NTH1I92 NTHU93 NTH1195 NTH1196 NTH1200 NTH120I NTH1203 NTH1204 NTH1205 NTH1207 NTH1208 NTH1209 NTH1210 NTH1211 NTH1214 NTH1216 NTH1220 NTH1221 NTH1224 NTH1225 NTH1226 NTH1229 NTH1230 NTH1231 NTH1233 NTH1234 NTH1235 NTHI236 NTH1237 NTH1238 NTH1240 NTH1241 "NTH1244 N1H1245 NTH1246 NTH1247 NTH1248 NTH1249 NTH1250 NTH1251 NTH1252 NTH1253 NTH1254 NTH1255 NTH1256 NTH1261 NTH1262 NTH1268 NTH1270 NTH1271 NTH1273 NTH1275 NTH1279 NTH1280 NTH1281 NTH1282 NTH1283 NTH1286 NTH1287 NTH1290 NTH1293 NTH1294 NTH1295 NTH1297 NTH1298 NTH1299 NTH1300 NTH1301 NTH1302 NTH1305 NTH1306 NTH1307 NTH1308 NTH1309 NTH13U KTH1313 NTH1315 NTH1316 NTH1319 NTH1321 NTH1325 NTH1327 NTH1330 NTH1332 NTH1333 NTH1334 NTH1336 NTH1337 NTH1339 NTH1341 NTH1342 NTH1346 NTH1348 NTH1353 NTH1354 NTH1357 NTH1359 NTH1361 KIH1363 NTH1365 NTH1367 NTH1368 NTH1374 NTH1375 N1H1376 NTH1379 -NTH1380 NTH1381 NTH1382 NTH1383 NTH1388 NTH1390 NTH1391 NTH1393 NTH1394 NTH1395 NTHI396 NTH1398 NTH1399 NTH1400 NTH1406 NTHI407 NTH1411 NTH1412 NTHI413 NTH1414 NTHH15 NTH1416 NTH1418 NTH1419 NTH1420 NTH1421 NTH1425 NTH1427 NTHI428 NTH1429 NTH1430 NTH143I NTH1434 NTH1435 NTHI437 NTH1438 NTH1439 NTH1441 -35- WO 2005/111066 PCT/IB2005/001775 NTH1447 NTH1448 NTH1450 NTHI454 NTH1455 NTH1456 NTH1464 NTH1467 NTH2468 NTH1470 NTH1471 NTH1472 NTH1473 NTH1474 NTH1479 NTH1487 NTH1489 NTH1490 NTH1491 NTH1492 NTH1493 NTH1494 NTH1495 NTH1496 NTH1497 NTH1500 NTH1503 NTH1504 NTH1506 NTH1510 NTH1515 NTH1516 NTH1525 NTH1526 NTH1527 NTH1528 NTH1531 NTH1532 NIH1537 NTH1538 NTH1540 NTII1541 NTH1543 NTH1548 NTH1552 NTH1555 NTH1559 NTH1562 NTH1563 NTH1564 NTH1567 NTH1569 NTH1570 NTH1571 NIH1573 NIH1574 NTH1575 NTH1580 NTH1581 NTH1582 NTH1584 NTHI586 NTH1587 NTH1588 NTH1590 NTH1594 NTH1597 NTH1598 NTH1599 NTH1600 NTH1601 NTH1602 NTH1603 NTH1605 NTH1606 NTH1607 NTH1608 NTH16O9 NTH1611 NTH1612 NTH1615 NTH1616 NTH1617 NTH1618 NTH1619 NTH1620 NTH1621 NTH1622 NTH1623 NTH1625 NTH1626 NTFil627 NTH1628 NTH1629 NTH1631 NTH1634 NTH1637 NTH1638 NTH1647 NTH1652 NTH1653 NTH1654 NTH1656 NTH1657 NTH1658 NTH1662 NTH1664 NTH1666 NTH1668 NTH1671 NTHI675 NTH1676 NTH1677 NTH1680 NTH1686 NTH1687 NTH1688 NTH1689 NTH1690 NTH1692 NTH1693 NTH1697 N7H1698 NTH1701 NTH1702 NTH1703 NTH1707 NTH1712 NTH1713 NTH1718 NTH1719 NTH1722 NTFI1724 NTH1725 NTHI729 NTH1732 NTH1734 NTH1735 NTH1739 NTH1740 NTH1742 NTHI1744 NTH1745 NTH1748 NTH1749 NTH1751 NTH1752 NTH1753 NTH1754 NTH1755 NTH1756 NTH1757 N1H1758 NTH1759 NTH1760 NTH1765 NTH1767 NTH1769 NTH1770 NTH1773 NTH1778 NTH1779 NTH1781 NTH1782 NTH1783 NTH1788 NTH1793 NTH1795 NTH1796 NTH1798 NTH1799 NTH1803 NTH1804 NTH1805 NTH1806 N1H1807 NTH1811 NTH1812 NTH1813 NTH1815 NTH1816 NTH1817 NTH1818 NTH1819 NTH1820 NTH1821 NTH1822 NTH1824 NTH1828 NTHI829 NTH1832 NTH1833 NTH1835 NTH1836 NTH1837 NTHI842 NTH1845 NTH1849 NTH1850 NTH1854 NTH1857 NTH1859 NTH1861 NTH1865 NTH1870 NTHIS71 NTH1872 NTH1873 NTH1881 NTH1882 NTH1885 NTH1888 NTH1889 NTH1891 NTH1892 NTH1896 NTH1897 NTH1898 NTH1899 NTH1900 NTH1904 NTH1906 NTH1908 NTH1910 NTH1914 NTH1916 NTH1917 NTH1919 NTH1920 NTH1921 NTH1922 NTH1923 NTH1925 NTII1927 NTH1935 NTH1939 NTH1941 NTH1942 K1H1945 NTH1946 NTH1947 NTH1948 NTH1951 NTH1953 NTH1956 NTH1958 NTHI960 NTH1962 NTH1963 NTH1964 NTH1965 NTH1966 N1H1967 NTH1968 NTH1974 NTH1978 NTH1981 NTH1986 NTH1989 NTH1992 NTH1993 NTH1994 NTH1995 NTH1996 NTH1997 NTH1998 NTH1999 NTH2001 NTH2005 NTH2008 NTH2009 NTH2010 NTH2019 NTH2024 NTH2025 NTH2031 NTH2035 NTH2038 NTH2039 NTH2040 NTH2041 NTH2043 NTH2050 NTH2052 NTH2055 NTH2056 NTH2060 NTH2062 NTH2064 NTH2065 NTH2069 NTH2070 NTH2071 NTH2073 NTH2075 NTH2078 NTH2079 NTH2081 NTH2083 NTH2089 NTH2091 NTH2092 "NTH2093 NTH2094 -36- WO 2005/111066 PCT/IB2005/001775 NTH2095 NTH2096 NTH2097 NTH2099 NTH2101 NTH2109 NTH2110 NTH2112 NTH2113 NTH2114 NTH2115 NTH2116 NTH2117 NTH2118 NTH2I19 NTH2120 NTH2122 NTH2126 NTH2128 NTH2129 NTH2130 NTH2131 NTH2I33 NTH2135 NTH2136 NTH213S NTH2142 NTH2145 NTH2146 NTH2149 NTH2150 NTH2156 NTH2159 NTH2162 NTH2163 NTH2166 NTH2169 NTH2170 NTH2173 NTH2181 NTH2183 NTH2187 NTH2191 NTH2193 NTH2195 NTH2196 NTH2197 NTH2198 NTH2199 NTH2200 NTH2204 NTH2205 NTH2206 NTH2207 NTH2209 NTH2213 NTH2216 NTH2217 NTH2219 NTH2220 NTH2221 NTH2222 NTH2223 NTH2226 NTH2227 NTH2228 NTH2229 NTH2231 NTH2232 NTH2234 NTH2235 NTH2242 NTH2243 NTH2245 NTH2247 NTH2250 NTH2251 NTH2253 NTH2256 NTH2257 NTH2258 NTH2259 NTH2262 NTH2263 NTH2266 NTH2269 NTH2273 NTH2274 NTH2277 NTH2282 NTH2284 NTH2285 NTH2287 NTH2288 NTH2291 NTH2292 NTH2296 NTH2299 NTH2305 NTH2309 NTH2315 NTH2316 NTH2318 NTH2323 NTH2324 NTH2326 NTH2327 NTH2330 NTH2332 NTH2333 NTH2342 NTH2343 NTIT2344 NTH2346 NTH2347 NTH2349 NTH2352 NTH2353 NTH2356 NTH2358 NTH2361 NTH2362 NTH2363 NTH2364 NTH2365 NTH2368 NTH2369 NTH2370 NTH2371 NTH2376 NTH2377 NTH2381 NTH2382 NTH2386 NTPI2388 KTH2394 NTH2398 NTH2402 NTH2405 NTH2406 NTH2407 NTH2408 NTH2414 NTH2414 NTH2422 NTH2430 NTH2432 NTH2433 NTH2434 NTH2438 NTH2442 MTH2447 NTH2448 NTH2451 NTH2455 NTH2456 NTH2457 NTH2458 NTH->460 NTH2461 NTH2463 NTH2464 NTH2466 NTH2467 NTH2468 NTH247i NTH2472 NTH2478 NTH2480 NTH2481 NTH2482 NTH2483 NTH2484 NTH2485 NTH2486 NTH2487 NTH2488 NTH2493 NTH2495 NTH2496 NTH2497 NTH2498 NTH2499 NTH2500 NTH2501 NTH2505 NTH2508 NTH2510 NTH2524 NTH2525 NTH2527 NTH2528 NTH2531 NTII2532 NTH2533 NTH2534 NTH2536 NTH2537 NTH254I NTH2542 NTH2543 NTH2545 NTH2546 NTH2548 NTH2549 NTH2550 NTH2552 NTH2554 NTH2556 NTH2557 NTH2558 NTH2562 NTH2563 NTH2566 NTH2567 NTH2568 NTH2569 NTH2570 NTH2572 NTH2573 NTH2575 NTH2577 NTH2578 NTH2584 NTH2585 NTH2587 NTH2588 NTH2590 NTH2591 NTH2593 NTEi2595 NTH2597 NTH2600 NTH2602 NTH2603 NTH2604 NTH2605 NTH2607 NTH2608 NTH2609 NTH2610 NTH2612 NTH2613 NTH2615 NTH2616 NTH26I8 NTH2626 NTH2633 NTH2635 NTH2640 NTH2641 NTH2647 NTH2648 NTH2649 NTH2650 NTH2655 NTH2661 NTH2663 NTH2664 NTH2667 NTH2668 NTH2673 NTH2674 NTH2675 NTH2679 NTH2680 NTH2684 NTH2690 NTH2693 NTH2694 NTH2696 NTH2697 NTH2701 NTH2702 NTH2703 NTH2704 NTH2705 NTH2706 NTH2707 NTH2708 NTH2709 NTH2710 NTH2711 NTH2712 NTH2713 NTH2715 NTH2716 NTH2718 NTH2719 NTH2720 NTH2721 NTH2723 NTH2724 NTH2725 NTH2/26 NTH2727 NTH2729 NTH2730 NTH2731 "NTH2732 NTH2735 NTH2737 NTH2'38 NTH2740 -37 WO 2005/111066 PCT/IB2005/001775 NTH2743 NTH2744 NTH2749 NTH2750 NTH2753 NTH2754 N1H2755 NTH2756 NTH2757 NTH2758 NTH2764 NTH2765 NTH2769 NTH2774 NTH2777 NTH2778 NTH2779 NTH2781 NTH2783 NTH2784 NTH2785 NTH2791 NTH2793 NTH2794 NTH2796 NTH2797 NTH2798 NTH2804 NTH2806 NTH2807 NTH2809 NTH2810 NTH2813 NTH2814 NTH28I6 NTH2823 TABLE III - Annotations aa = length of polypeptide PSORT - cellular location of polypeptide, according to PSORT algorithm aa PSORT Annotation 0003 274 cytoplasm Diammopimefate epimerase (dapF) -00'07 61 cytoplasm tldD protein tldD 0010 158 cytoplasm transcriptiona! regulator 93 cytoplasm usg 1 protein (usg1) 274 cytoplasm excinuclease ABC subunit C (uvrC) 0014 64 periplasmic excinuclease ABC, subunit C (uvrC) 0017 161 outer 2',3' cyclic nucleotide 2' phosphodiesterase (cpdB) 0018 130 cytoplasm 16s pseudoundylate 516 synthase (rsuA) 0019 98 inner 1 bicyclomycln resistance protein (bcr) 0020 181 inner 4 Na{+) translocating NADH qumone reductase, subunit 0023 110 cytoplasm sigma E factor regulatory protein (rseB) 0025 195 inner 1 slgma E factor negative regulatory protein (mclA) 0026 157 cytoplasm RNA polymerase sigma E factor (rpoE) 0027 100 cytoplasm cell division protein (ftsQ) 0028' 37 cytoplasm cell division protein (ftsA) 0029 34 cytoplasm cell division protein (fteA) 0030 268 cytoplasm aspartate ammonia ligase (asnA) 0039 311 cytoplasm ADP heptose -LPS heptosyltransferase II (rfaF) 0043 194 inner 3 sodium dicarboxylate symporter protein 0044 79 cytoplasm :erntin (rsgA) 0047 219 cytoplasm heat shock protein (hslU) / ATP dependent Clp protease ATP binding subunit .0048 55 inner 2 L lactate permease (IctP) 0049 90 pen plasm ic transfemn binding protein orTonB dependent receptor 0055 92 cytoplasm leat shock protein (hsiV) 0057 235 periplasmic acid phosphatase 0058 206 cytoplasm rod shape determining protein (mreB) or cell division protein FtsA ftsA 0059 54 periplasmic rod shape-determining protein (mreC) 0060 104 inner 0 ribosomal protein S8 (rpS8) 0061' 313 inner 2 ribosomal protein L6 {rpL6) i 0063' 257 cytoplasm fumarate (and nitrate) reduction regulatory protein (fnr) 38- WO 2005/111066 PCT/IB2005/001775 0065 266 cytoplasm thiamin ABC transporter, periplasmic-bindmg protein (tbpA) 0067 86 inner 1 thiamm ABC transporter, permease protein '0068 52 cytoplasm UDP-N acetylenolpyruvoylglucosamme reductase (murB) 0066 149 cytoplasm RNA polymerase sigma-32 factor {rpoH) 0070 127 cytoplasm RNA polymerase sigma-32 factor (rpoH) 0071 64 cytoplasm NifR3/SMM1 family protein 0072 201 cytoplasm acetolactate synthase 111 large subunit (ilvl) 0073, 142 inner 1 acetolactate synthase III large subunit (ilvl) 0075 166 cytoplasm acetolactate synthase III small subunit (ilvH) 0,078 119 cytoplasm orotate phosphonbosyltransferase (pyrE) 00V9 36 cytoplasm orotate phosphonbosyltransferase (pyrE) 0082 144 cytoplasm DNA polymerase III, chi subunit (ho!C) 0083 85 cytoplasm methylglyoxal synthase (mgsA) 0085 340 inner 7 cytochrome C type biogenesis protein (ccmF) 0086 45 cytoplasm cytochrome C type biogenesis protein (ccmE) ,0087 312 cytoplasm histidyl-tRNA synthetase (hisS) _0088 214 cytoplasm opoisomerase IV, subunit A (parC) ,0091, 212 inner 1 4-hydroxy 2 oxoglutarate 0094 338 lipo zinc protease 0098 358 cytoplasm lomoserme 0 acetyltransferase (met2) 0O99 60 cytoplasm DNA gyrase, subunit A (gyrA) 0100 56 cytoplasm DNA gyrase, subunit A {gyrA) 0102 102 cytoplasm universal stress protein A (uspA) 0103 290 cytoplasm alanyl tRNA synthetase (alaS) 0104 81 cytoplasm atanyl tRNA synthetase {alaS) '0105 557 cytoplasm protective surface antigen D15 (Omp85) ,0106' 110 periplasmic outer membrane protein 0167 257 inner 1 cell division protein (ftsZ) 0108 352 cytoplasm cell division protein (ftsA) 0109 496 cytoplasm DNA topoisomerase I (topA) 0112 259 cytoplasm penicillin binding protein 1B (ponB) 0113 35 cytoplasm penicillin binding protein 1B (ponB) 0115 279 cytoplasm penicillin binding protein 1A (ponA) 0116 310 inner 1 GTP-binding protein 0117 243 cytoplasm phosphomannomutase (yhxB) 0118 84 inner 0 phosphomannomutase (yhxB) 0119 89 periplasmic ton B protein 0120 147 periplasmic biopolymer transport protein (exbD) 0121 49 inner 1 biopolymer transport protein (exbB) 0126 77 cytoplasm ntegrase/recombinase 0128 111 inner 1 xanthine guanine phosphonbosyltransferase (gptB) 0130" 184 cytoplasm aminoacyl histidine dipeptidase (pepD) 0131 35 cytoplasm aminoacyl histidine dipeptidase {pepD) 01-34, 182 inner 1 phosphonbosylglycinamide formyltransferase (purN) -39- WO 2005/111066 PCT/IB2005/001775 58 cytoplasm GTP binding membrane protein (lepAJ 78 cytoplasm uracil DNA glycosylase (ung.) 014iff 76 cytoplasm atdose 1-epimerase (galM) 0,143' 129 cytoplasm gaiactokinase (galK) 0144 197 cytoplasm galactoKinase (galK) 0145 346 cytoplasm GTP-bindmg protein TypA 0147 179 cytoplasm queuinetRNA nbosyitransferase (tgt) 0150 239 | cytoplasm rlbosoma! large subunit pssudoundme synthase C 0152: 463 cytoplasm gaiactoside ABC transporter, ATP binding protein (mgiA) 0153 247 cytoplasm hemagglutmin/hemoiysin related protein 240 cytoplasm hemagglutlnln/hemolysln related protein , 0155 302 inner 7 phosphate perrnease 124 inner 2 cytochrome D ubiquinol oxidase, subunit \ (cydA) or ronflll) ABC ranaporter, permease protein IbpB 0158' 103 inner 2 cytochrome D ubiqumo! oxidase, subyntt tl (cydB) 0163 154 lipo 15 KDa pepbdoglycan associated Ilpoprotem (ipp) 0165 165 cytoplasm membrane-bound lytsc murem tmnsgiycosylass C (mltC) 0167 194 hpo membrane-bound lytic muresn transglycosylase C (mltC) 0170 51 cytoplasm hflK protein (hftK) 0174 40 periplasmic asl specific protease (prc) 0178 116 cytoplasm recombination protein (rec2) or competence protein ComA comA 0180 147 inner 2 ABC transporter, ATP-blndlng protein (msbA) 0185 220 inner 0 chonsmate synthase (aroC) 0186 156 inner 2 ATP binding transport protein (cydD) 0189 162 inner 2 oti shape-determining protein (mreD) 0190 188 periplasmic rod shape determining protein (mreC) 0196 68 cytoplasm Sigma factor 0200 68 cytoplasm mercuric ion scavenger protein (merP) '0201 68 cytoplasm mercuric ion scavenger protein (merP) 0202 68 cytoplasm mercuric ion scavenger protein (merP) 0203 63 inner 0 orfJ protein 0204 306 cytoplasm penicillin binding protein 1A (ponA) 0205 38 cytoplasm penicillin binding protein 1A (ponA) 0206 175 cytoplasm extragentc suppressor (suhB) 0208., 64 inner 1 cytochrome C type biogenesis 0209 117 inner 2 1,4 dihydroxy-2 naphthoate octaprenyltransferase (msnA) 0212 203 cytoplasm lysyi tRNA synthetase analog (genX) 0215 s, 204 cytoplasm fumarate reductase, flavoprotem subunit (frdA) or succmate dehvdroaenase flavoorotem subunrt sdhA 0216" 48 cytoplasm fumarate reductase, ftavoprotein subunit (frdA) ' 0217 40 cytoplasm fumarate reductass, fSavoprotein subunit (frdA) 0218 31D cytoplasm nitrogen fixation protein (ntfRS) 0220 99 cytoplasm Hin recombinatonal enhancer binding protein (fis) or factor for inversion stimulation protein Fis 0221 48 cytoplasm small protein B (smpB) -40- WO 2005/111066 PCT/IB2005/001775 0222 222 cytoplasm magnesium and cobalt transport protein (corA) 0223 91 inner 1 magnesium and cobalt transport protein (corA) 0225 426 cytoplasm exorlbonuclease II (rnb) or nbonuclease II family protein vacB 0233, 114 cytoplasm undylate kinase (pyrH) 0234 41 cytoplasm urldylate kinase (pyrH) 0236* 35 cytoplasm phospho 2-dehydro 3-deoxyheptonate aldolase (phenylalamne 0239 322 cytoplasm heat shock (chaperone) protein (hscA) . 0240 44 cytoplasm heat shock (chaperone) protein (hscA) 0241 193 outer usg-1 protein {usg1) 0243 268 inner 2 tryptophan synthase alpha subunit (trpA) -0244 58 cytoplasm tryptophan synthase beta subunit (trpB) 0244 245 periplasmic stationary phase survival protein SurA or peptidyl prolyl cis trans isomerase 0245 191 cytoplasm pynmidine operon regulatory protein (pyrR) or hypoxanthine guanine phosphonbosyltransferase, 0246 153 cytoplasm mazG protein (mazG) 0247 ¦ 159 inner 3 ATP synthase FO subunit a (atpB) 0249 203 cytoplasm glucose-inhibited division protein (gidB) 0157 289 cytoplasm selenocysteme specific elongation factor (selB) 0258 212 cytoplasm pyruvate dehydrogenase, E1 component (aceE) 0259 61 cytoplasm pyruvate dehydrogenase, E1 component (aceE) 0260 505 cytoplasm nbonuclease E (rne) 0262 303 cytoplasm ATP-dependent helicase (dmG) 0263 276 inner 7 thiamm ABC transporter, permease protein 0266 121 cytoplasm N utilization substance protein B (nusB) 0267 160 cytoplasm thiamm monophosphate kinass (thiL) 0268 144 cytoplasm thiamin monophosphate kinass (thiL) 0269 163 inner 3 phosphatidylglycerophosphatase A (pgpA) ,0272 44 cytoplasm ribosomal protein L34 (rpL34) 0273 119 cytoplasm ribonuclease P (mpA) ,0275 146 cytoplasm impA protein 0277 218 cytoplasm phospho 2-dehydro 3 deoxyheptonate aldolase (phenyfalanine 0286 288 cytoplasm GTP binding protein 0287 422 cytoplasm formate dehydrogenase, beta subunit (fdxH) or ferredoxm, 4Fe 4S bacterial type ,0291 109 cytoplasm mannonate dehydratase (uxuA) 0292 46 cytoplasm mannonate dehydratase (uxuA) 0294, 171 cytoplasm dihydroxyacid dehydratase (ilvD) 0295' 308 inner 1 threomne deammase (ilvA) 0296 239 cytoplasm galactose 1 phosphate undylyltransferase (galT) 0303 283 cytoplasm hemoglobin binding protein 0304 68 cytoplasm ribosomal protein L24 (rpL24) 0305 123 cytoplasm ribosomal protein L14 (rpL14) 0309 82 cytoplasm inorganic pyrophosphatase (ppa) 0311 185 inner 4 phosphatidylglycerophosphate synthase (pgsA) or CDP-diacylglycerol-glycerol 3 phosphate -41- WO 2005/111066 PCT/IB2005/001775 274 cytoplasm dihydrolipoamide dehydrogenase (IpdA) or pyruvate dehydrogenase, E3 component, lipoamide 0315 38 cytoplasm dihydrolipoamide dehydrogenase (IpdA) 0318 358 cytoplasm DNA topoisomerase III (topB) or DNAtopoisomerase I topA 0320 411 inner 1 Nqr6 subunit of Na translocating NADH quinone reductase 0321 i 191 inner 1 single stranded DNA binding protein (ssb) 0323 141 cytoplasm exclnuciease ABC, subunrt A (uvrA) 0324 319 cytoplasm type IV pilus assembly protein pilF , 0325 200 inner 1 pilus assembly protein PilG pilG 0326 386 Inner 8 branched chain amino acid transport system II carrier 0329 395 cytoplasm cystathiomne beta lyase (metC) or trans sulfuration enzyme family protein 0330 109 cytoplasm sanA protein (sanA) 0333 96 inner 1 folylpolyglutamate synthase/dihydrofolate synthase (folC) 0336 133 cytoplasm short chain dehydrogenase/reductase or oxidoreductase, short-chain dehydrogenase/reductase 391 cytoplasm tryptophan synthase beta subunit (trpB) 0340 ' 151 cytoplasm cell division protein (ftsH) 0342 147 cytoplasm peptide methionine sulfoxlde reductase pllB 0346 46 periplasmic small protein A 0347' 273 Inner 7 transport protein 0349 66 cytoplasm protease 0351 412 inner 1 penicillin binding protein 1B (ponB) 0352 291 inner 5 carbon starvation protein A cstA 0354 227 cytoplasm GTP pyrophosphokinase (relA) 0355 367 cytoplasm GTP pyrophosphokinase (relA) 0356 65 inner 1 diacylglycerol kinase (dgkA) 0358 56 inner 1 diacylglycerol kinase (dgkA) 0359 275 cytoplasm esterase 0360 216 cytoplasm UDP 3 0 (3 hydroxymynstoyl) glucosamine N acyltransferase 0361 141 cytoplasm translation elongation factor Ts (tsf) (EF-TS) 0365 91 cytoplasm exodeoxynbonuclease III (xthA) 0366 432 Inner 1 heme hemopexln utilization protein A (hxuA) 0367 184 cytoplasm carboxy terminal tail specific protease (prc) 0368 204 cytoplasm carboxy terminal tail specific protease (prc) 0369 163 cytoplasm dihydroxyacid dehydratase (ilvD) 0370 201 cytoplasm acetohydroxy acid synthase I! or acetolactate synthase III, large subunit llvl ,0372 306 inner 7 sodium dependent transporter or sodium and chloride dependent ransporter 0373 42 cytoplasm aminotransferase 0374 307 cytoplasm aminotransferase 0376 128 cytoplasm ribosomal protein L17 (rplQ) 0377 193 cytoplasm DNA-directed RNA polymerase, alpha chain (rpoA) 0380 33 cytoplasm acyineu ram mate cytidylyltransferase (neuA) 0382 359 cytoplasm peptidyl prolyl cis trans isomerse 0386 111 cytoplasm DNA gyrase, subunit A (gyrA) -42- WO 2005/111066 PCT/IB2005/001775 0387 52 cytoplasm DNA gyrase, subunit A (gyrA) 0388 242 inner 3 sodium/prohne symporter (proline permease) (putP) 039r 256 cytoplasm anaerobic ribonucleoside triphosphate reductase (nrdD) 0392 87 cytoplasm anaerobic ribonucleoside triphosphate reductase (nrdD} 0393 211 cytoplasm ammotransferase 0394 117 cytoplasm aerobic respiration control protein ARCA (arcA) or DNA binding response regulator 0397 444 inner 8 thiol disulfide interchange protein {dsbD} 0399 362 cytoplasm GTP binding membrane protein (lepA) 0400 437 inner 9 sodium dependent transporter 0401 206 inner 5 nitrite reductase, transmembrane protein (nrfD) 0402 138 inner 3 cytochrome C type biogenesis protein orthio! disulfide interchange protein DsbD dsbD 0403, 84 cytoplasm peptide methionine sulfoxide reductase (msrA) 0405 299 periplasmic peptide methionine sulfoxide reductase {msrA) 0418 297 inner 3 cytochrome D ubiqumol oxidase subunit I (cydA) 0421 287 periplasmic CTP synthetase (pyrG) 0423 385 cytoplasm exodeoxyribonuclease VII, large subunit (xseA) 0425 92 cytoplasm oligopeptide ABC transporter ATP binding protein (oppD) 0426 311 inner 6 ollgopeptlde ABC transporter, permease protein (oppC) 0427 232 inner 6 oligopeptide ABC transporter, permease protein (oppB) or Iron(lll) ABC ransporter, permease protein 0428 316 cytoplasm cysteme synthetase (cysK) 0431 116 cytoplasm C 5 cytosine specific DNA methylase 0436- 341 cytoplasm peptide chain release factor 3 (prfC) 0437 295 inner 1 enoy! (acyl carrier protein) reductase (fabl) 0441 66 cytoplasm . 2 4 diaminobutyrate decarboxylase 0442 222 cytoplasm ormamldopynmldlne-DNA glycosylase (fpg) 0443, 160 cytoplasm peptidase T (pepT) 0444 178 inner 0 uculokinase (fucK) 0447 323 cytoplasm L fucose isomerase (fuel) 0448 119 cytoplasm . fucose isomerase (fuel) 0449 193 cytoplasm dethiobiotm synthase (bioD 1) 0451 88 cytoplasm GTP cyclohydrolase I (folE) 0453 113 inner 1 GTP cyclohydrolase I (folE) 0454 78 cytoplasm GTP cyclohydrolase I (folE) 0456 212 cytoplasm protein Pll undylyl transferase (glnD) 04,57 288 inner 9 undecaprenyl phosphate alpha N acetylglucosaminyltransferase or phospho N acetylmuramoyl-pentapeptide transferase 0458 293 cytoplasm penicillin tolerance protein (lytB) 0459 57 inner 1 ipoprotein signal peptidase (IspA) 0460 122 inner 1 ipoprotein signal peptidase (IspA) ,0461 433 inner 2 YhbX/YhjW/YijP/YjdB family protein 0462 107 inner 2 ransporter protein 0463 159 inner 3 ransporter protein 43- WO 2005/111066 PCT/IB2005/001775 0454 349 cytoplasm 2' 3 cyclic-nucleotide 2' phosphodiesterase (cpdB) 0465; 73 inner 1 iron (chelated) ABC transporter, permease protein (yfeD) 04675 215 cytoplasm transcriptional activator 0468 314 periplasmic thiamine biosynthesis protein 0469 76 inner 1 ABC transporter permease protein 0470 328 cytoplasm alanyl tRNA synthetase (alaS) 0472 122 cytoplasm alany! tRNA synthetase (alaS) ,0473 89 Inner 0 phosphatidylsenne decarboxylase praenzyme (psd) 0,474 261 cytoplasm glutathione reductase (gor) or 2-oxoglutarate dehydrogenase, E3 component, 0475 241 inner 5 phosphatidylgtycerophosphatase B (pgpB) 0476 119 cytoplasm GTP cyclohydrolase II (nbA) 0477 153 cytoplasm DNA polymerase III, delta subunit (holA) 0479 369 cytoplasm glycyl tRNA synthetase beta chain (g!yS) 0480 305 cytoplasm UDP-3 0 (3 hydroxymynstoyl) N acetylglucosamine deacetyiase 0481 116 cytoplasm chorismate mutase / prephenate dehydratase (pheA) 0483 271 cytoplasm urease accessory protein (ureH) 0490 179 inner 4 glutamate permease (gltS) sodium/glutamate symporter 0492 95 cytoplasm nbosoma! protein S6 modification protein (rimK) or glutathione synthetase gshB 123 inner 2 Na+/H+ antiporter (nhaC) 0494 326 cytoplasm xylose operon regluatory protein (xyiR) 0495 144 cytoplasm ipopolysacchande biosynthesis protein or lacto N neotetraose biosynthesis glycosyl 0496 257 inner 1 ipopolysacchande biosynthesis protein 0502 46 outer penicillin binding protein 7 0503 138 cytoplasm ranscnption elongation factor (greA) 0504 115 outer D alanyl D alanine 0505- 370 cytoplasm D alanyl D alanine or penicillin binding protein 3 05063 38 cytoplasm S1016 family transposase 0507 158 inner 1 S1016V6 protein (1S1016-V6) 0508 111 cytoplasm S1016C2 transposase 05,14 296 cytoplasm aminopeptidase A/I (pepA) 0515 113 cytoplasm stringent starvation protein B (sspB) 0517 312 cytoplasm 1 deoxyxylulose 5-phosphate synthase fdxs) 0518 * 150 inner 0 short chain dehydrogenase/reductase 0519 348 cytoplasm phosphonbosylaminoimidazole synthetase (purM) 0521 40 cytoplasm phosphoglycerate mutase (gprnA) 0522 70 cytoplasm nbosoma! protein L31 (rpL31) 0524 158 inner 0 A/G specific adenine glycosylase (mutY) 0525 86 cytoplasm A/G specific adenine glycosylase {mutY} 6528 170 inner 2 ormate dehydrogenase gamma subunit (fdxl) 0529 319 inner 2 dhE protein (fdhE) 0530 137 cytoplasm DNA transformation protein (sxy) 44- WO 200S/111066 PCT/IB2005/001775 0535 b/1 cytoplasm immunoglobin A1 protease (iga1) or hemagglutimn/hemolysin related protein 0535 289 cytoplasm threonyl tRNA synthetase (thrS) 0540 184 cytoplasm competence protein E (comE) 0542 213 cytoplasm competence protein F (comF) 0543 220 cytoplasm hflK protein (hflK) orstomatin/lVlec-2 family protein 0544 295 Inner 1 hfIC protein (hflC) or stomatin/Mec 2 family protein 0547 /4 periplasmic sodium/proline symporter (prolme permease) (putP) 0548 3U4 cytoplasm cytoplasmic axial filament protein (cafA) 05497 108 Inner 1 cytoplasmic axial filament protein {cafA} 0550 cytoplasm cytoplasmic axial filament protein {cafA) 0552 217 cytoplasm cell division protein (mukB) 0554 248 cytoplasm killing protein suppressor (kicA) 0557 245 cytoplasm dhD protein (ftfhD) 0558 38 cytoplasm dhD protein (fdhD) 0560 30 cytoplasm phosphatidylsenne decarboxylase proenzyme (psd) 0563 56 cytoplasm ibosomal protein L32 (rpL32) 0564 225 cytoplasm beta ketoacyl ACP synthase III (fabH) or 3 oxoacyl (acykamer protein) synthase III fabH 0565, 368 inner 7 ryptophan specific transport protein (mtr) 0566 409 inner 1 L serins deaminase (sdaA) 0571 292 cytoplasm cytidmedeaminase(cdd) 0574 212 inner 2 poprotem 0575 65 cytoplasm ranscrlptlonal regulator (bolA) 0576 158 cytoplasm NADH ubiqulnone oxidoreducatase subunit A Na translocating or Na(+) translocating NADH quinone reductase, subunit 0580 160 inner 0 translation initiation factor 2 (infB) 0591 200 cytoplasm beta phosphoglucomutase pgmB 0592 467 cytoplasm cell division protein (mukB) 0594 393 cytoplasm raN-related protein 0595 3T cytoplasm GTP cyclohydrolase II (nbA) 0596 57 cytoplasm GTP cyclohydrolase II (nbA) 0597 345 cytoplasm oligopeptide transporter, periplasmic binding protein 0599 32 cytoplasm oligopeptide transporter periplasmic-bindmg protein 0601 240 cytoplasm aminopsptidase P (pepP) 0604 37 cytoplasm aldose 1 epimerase (galM) 0605 19R cytoplasm aldose 1 epimerase (galM) 0607 318 cytoplasm C 5 cytosme specific DNA methylase 0608 104 cytoplasm ailing protein (kicB) 0609 144 cytoplasm DNA polymerase III, delta subunit (holA) 0611 69 cytoplasm are lipoprotem B 0613 75 cytoplasm transcriptional regulator (nadR) 0614 310 cytoplasm transcriptional regulator (nadR) 0616 69 cytoplasm aerobic respiration control protein ARCA (arcA) 0618 368 inner 7 sodium/alanine symporter -45- WO 2005/111066 PCT/IB2005/001775 0619 303 periplasmic elongation factor Tu (tufB) 0622 218 inner 4 dedA protein 0626 164 inner 5 lic 1 operon protein (licB) 0627 321 cytoplasm lic 1 operon protein (licA) 06281 235 cytoplasm UDP N acetylenolpyruvoylglucosamine reductase (nwB) 0629 179 cytoplasm nitrate/nitrite sensor protein (narQ) 0630 151 inner 1 small major protein B (smpB) 0632 53 cytoplasm 6 phosphofmctokinase (pfkA) 0633 290 __ cytoplasm 6 phosphofructokmase (pfkA) 0635 355 cytoplasm type I modification enzyme (hsdM) 0636 158 inner 2 cystelne synthetase (cysZ) 0638 328 outer cell division protein ZipA 0640. 122 cytoplasm ribosomal protein S12 (rps12) 0641 346 cytoplasm glucose inhibited division protein (gidA) 0646 257 inner 5 Na+/H+ antiporter (nhaC) "0647 37 outer Na+/H+ antiporter (nhaC) 0648 362 outer colicm tolerance protein (tolB) 0650 497 cytoplasm cell division protein (mukB) 0651 391 cytoplasm heme binding lipoprotein (dppA) 0652 78 cytoplasm octaprenyl diphosphate synthase (ispB) 0654 103 inner 1 ribosomal protein L21 (rpL21) 0655- 85 cytoplasm ribosomal protein L27 (rpl_27) 0657 83 cytoplasm GTP binding protein (yhbZ) 0658 75 inner 1 ipopolysacchande biosynthesis protein 0659 55 cytoplasm ipopotysacchande biosynthesis protein 0660 255 cytoplasm molybdenum transport protein (modE) 06661 34 periplasmic molybdenum ABC transporter, periplasmic binding protein 06665 144 cytoplasm single stranded DNA binding protein (ssb) 0670 366 cytoplasm hlstidlnol phosphate amlnotransferase (hisH) 0671 31 cytoplasm phosphoserme ammotransferase (serC) 0672 31 cytoplasm phosphosenne ammotransferase (serC) 0674, 140 cytoplasm ribosomal protein L3 {rpL3) 0675 200 inner 1 ribosomal protein L4 (rpL4) 0676 139 inner 1 ribosomal protein L23 (rpL23) 0679 51 cytoplasm ampD signalling protein (ampD) 0682 96 cytoplasm hemolysin 0084 208 cytoplasm spermidine/putrescine ABC transporter, ATP-bindmg protein 0685 52 cytoplasm ysyWRNA synthetase analog (genX) 0686, 227 cytoplasm DNA binding response regulator (cpxR) 0688 258 cytoplasm aminoacyl histidine dipeptidase (pepD) 0689 185 cytoplasm ntegrase/recombtnase (xerC) 0698 399 cytoplasm nifS protein 0699 51 cytoplasm nuclease 0701 153 cytoplasm DnaA related protein -46- WO 2005/111066 PCT/IB2005/001775 0702 279 inner 7 uracil permease (uraA) 0703 129 inner 3 uracil permease (uraA) 0704 135 cytoplasm uracil phosphonbosyltransferase (upp) 0705 341 cytoplasm glutammyl tRNA synthetase (glnS) 0708 78 cytoplasm cytoplasmic axial filament protein (cafA) 0709 258 inner 5 anaerobic C4 dicarboxylate membrane transporter protein ,0710 43 inner 1 anaerobic C4 dicarboxyiate membrane transporter protein 0714 169 cytoplasm protein export protein (secB) 0718 175 inner 1 glucose inhibited division protein (gidA) 0719 224 cytoplasm threonyl tRNA synthetase (thrS) 0720 194 cytoplasm acyl carrier protein phosphodiesterase (acpD) 0723 146 cytoplasm DNA topoisomerase I (topA) 0732 200 cytoplasm recombination protein RecR (recR) 0733 202 cytoplasm DNA topoisomerase 111 (topB) 0734 322 cytoplasm S adenosylmethiomne synthetase (rnetX) 0735 193 cytoplasm anthranilate synthase component II (trpG) or para aminobenzoate synthase glutamine 0736 210 cytoplasm para aminobenzoate synthetase component , 0737 118 cytoplasm olylpolyglutamate synthase/dihydrofolate synthase (folC) 0738 184 periplasmic acetyl CoA carboxylase, carboxyl transferase subunit beta 0739 93 cytoplasm acetyl CoA carboxylase carboxyl transferase subunit beta 0740 177 Inner 1 periptasmic serine protease 0741 321 cytoplasm periplasmic serme protease 0743 269 cytoplasm RNA pseudoundylate synthase I (truA) 0745 235 inner 2 peptide ABC transporter ATP binding protein (sapF) 0747 37 cytoplasm peptide ABC transporter, ATP binding protein (sapF) 0748 44 cytoplasm peptide ABC transporter, ATP binding protein (sapD) 0751 86 cytoplasm pseudourldine synthase RluD (rluD) 0753 198 cytoplasm RNA (guanlne N1) methyltransferase (trmD) 0754 116 cytoplasm ribosomal protein L19 (rpL19) ,0758 235 cytoplasm ribosomal protein S3 (rpS3) 0759 110 cytoplasm ribosomal protein L22 (rpL22) ?0760 91 cytoplasm ribosomal protein S19 (rpS19) 0761 180 cytoplasm nbosomat protein L2 (rpL2) 0762 221 inner 5 protein export membrane protein (secD) ,0764 406 inner 1 protein export membrane protein (secD) ,0765 97 inner 1 preprotein translocase, YajC subunit (yajC) 0769 37 cytoplasm queume tRNA nbosyltransferase (tgt) ,0770 371 cytoplasm RNA 0772 55 cytoplasm thiamine biosynthesis lipoprotem ApbE lipoprotein 0773 35 cytoplasm ipoprotein 0774 299 inner 1 hiamine biosynthesis lipoprotem ApbE lipoprotein '0777 63 cytoplasm ribosomal protein L29 (rpL29) ,,0778 74 cytoplasm ribosomal protein L16 (rpL16) -47- WO 2005/111066 PCT/IB2005/001775 0779 335 cytoplasm dihydrolipoamide acetyltransferase (aceF) orpyruvate dehydrogenase, E2 component, 0781 35 cytoplasm dihydrolipoamide acetyltransferase (aceF) ,0782 549 cytoplasm pyruvate dehydrogenase E1 component (aceE) 0787 297 cytoplasm glycme cleavage system transcriptional activator (gcvA) or transcriptional regulator, LysR family 0788 159 outer hand penicillin-binding protein 1A (ponA) 0790 164 cytoplasm competence protein A (comA) 0794 168 inner 1 competence protein B (comB) 0795 134 inner 1 competence protein C (comC) 0796 172 inner 1 competence protein D (comD) 0798 166 Inner 1 competence protein E (comE) O801 583 cytoplasm argmyl tRNA synthetase (argS) 0802 100 inner 1 glutaredoxm (grx) ,0803 406 inner 0 beta ketoacyl ACP synthase I (fabB) 0804 137 inner 1 monofunctional biosynthetic peptidoglycan transglycosylase 0805 101 cytoplasm rp operon repressor (trpR) 0806 305 cytoplasm soluble lytic murem transglycosylase 0807 267 cytoplasm 2 hydroxyacid (glycerate) dehydrogenase 0808 30 cytoplasm 2 dehydro 3-deoxyphosphooctonate aldolase (kdsA) 0810 249 cytoplasm 2 dehydro 3-deoxyphosphooctonate aldolase (kdsA) 0712 84 cytoplasm hemK protein (hemK) ,0013 202 inner 1 hemK protein (hemK) 0817* 411 cytoplasm lydrolase 0821 240 inner 1 ranscnptional regulatory protein (ygiX) 0822 154 inner 1 sensor protein (ygiY) 0823 66 cytoplasm sensor protein (ygiY) 0824 316 cytoplasm glutamyl-tRNA synthetase (gltX) 0825 80 cytoplasm giutamyl-tRNA synthetase (gltX) 0826 79 cytoplasm glutamyl tRNA synthetase (gltX) 0828 45 cytoplasm nbonuclease PH (rph) 0829 278 inner 1 amidophosphonbosyltransferase(purF) 0830 484 cytoplasm DNA gyrase, subunit A (gyrA) 0831 54 cytoplasm DNA gyrase, subunit A (gyrA) 0833 583 cytoplasm hemin receptor (hemR) or iron-regulated outer membrane protein FrpB frpB '0834 143 Inner 2 colicm transport protein (tolQ) or biopolymer transport protein ExbB exbB 0835 139 periplasmic colicin transport protein (toIR) or biopolymer transport protein ExbD exbD 0836 337 inner 1 outer membrane integrity protein (tolA) or IgA specific sorine endopeptidase iga 0840 76 cytoplasm ABC transporter ATP-bindmg protein 0842 31 cytoplasm ype 1 restriction enzyme (hsdR) 0844 53 cytoplasm modification methylase 0845 184 cytoplasm ADP heptose synthase (rfaE) or aut protein aut 0847 389 cytoplasm argminosuccmate lyase (argH) 48 WO 2005/111066 PCT/IB200S/001775 0848 295 periplasmic glucosephosphate undylyltransferase (galU) or UTP-glucose-1 -phosphate undyiyltransferase galU 0849 63 periplasmic carbon storage regulator (csrA) 085O 461 inner 4 ATP binding protein protein (cydD) 0851 94 inner 2 ATP binding protein protein (cydD) 0852 160 inner 1 NAD(P)H oxidoreductase 0856 133 periplasmic protease IV (sppA) 0857 162 cytoplasm molybdenum ABC transporter, periplasmic-bmding protein 0858 . 242 Inner 5 molybdenum ABC transporter, permease protein (modB) or sulfate ABC transporter, permease protein cysT 0859 40 cytoplasm molybdenum ABC transporter ATP binding protein (modC) 0860 24b cytoplasm molybdenum ABC transporter, ATP binding protein (modC) or sulfate ABC ransporter, ATP binding protein cysA 0868 119 cytoplasm ype I restriction/modification specificity protein (hsdS) 0869 90 cytoplasm anthramlate synthase component I trpE 0873 145 cytoplasm phosphoserme aminotransferase (serC) 0874 234 inner 2 succinyl CoA synthetase, beta subunit (sucC) 0875 293 inner 1 succinyl CoA synthetase, alpha subunit (sucD) 0882 93 cytoplasm mazG protein (mazG) .0887 285 inner 1 3 oxoacyl (acyl-carner protein) reductase fabG 2 0696 153 cytoplasm DNA polymerase III delta' subunit (ho!B) 0892 41 cytoplasm hlol disulflde interchange protein (dsbD) 0893 60 cytoplasm hiol disulfide interchange protein (dsbD) 0897 234 cytoplasm phosphonbosylaminosmidazolecarboxarnideformyltransferase 0898 552 cytoplasm ATP dependent RNA helicase DeaD (deaD) 0900 64 cytoplasm type I restriction/modification specificity protein (hsdS) 0903 248 cytoplasm ype I restriction enzyme (hsdR) '0905 106 cytoplasm 2-Isopropylmalate synthase (leuA) 0907 373 cytoplasm DNA processing chain A (dprA) 0910 106 periplasmic mtnte reductase, Fe S protein (nrfC) 0912 fifl cytoplasm nitrite reductase, cytochrome C type protein (nrfB) 0913 ?77 inner 1 cell division protein FtsK related protein 0914 205 outer outer membrane lipoproteins earner protein (lolA) 0918 ?in cytoplasm glycogen phosphorylase (glgP) 0919 323 cytoplasm glycogen phosphorylase (glgP) 0920 117 cytoplasm glycogen phosphorylase (glgP) 0923 253 cytoplasm glycogen synthase (glgA) 6925 105 cytoplasm phosphoglycerate mutase (gpmA) 0934 242 cytoplasm 3-ketoacyl-acyl earner protein reductase (fabG) 0936 48 cytoplasm malonyl CoA acyl carrier protein transacvlase (fabD) 0936 222 cytoplasm malnnyl OnA anyl carrier protein transacvlase (fabD) 0939 111 cytoplasm 3-oxoacyI (acyl-camer protein) synthase III fabH 0945 125 cytoplasm molybdoptenn biosynthesis protein (moeB) orthiF protein thiF 0946 404 cytoplasm molybdoptenn biosynthesis protein (moeA) 0947 55 cytoplasm GTP cyclohydrolase I (folE) -49- WO 2005/111066 PCT/ffi2005/001775 '0950 353 inner 2 protease (sohB) 0954 274 cytoplasm recombination associated protein RdqC rdgC '0956 354 cytoplasm adenosylmethiomne 8 amino 7-oxononanoate ammolransferase '0958, 379 cytoplasm 8-amino 7-oxononanoate synthase (bioF) 096d 80 cytoplasm ABC transporter, ATP binding protein '0962 66 cytoplasm ABC transporter ATP binding protein ,0963, 317 cytoplasm ABC transporter ATP binding protein (msbA) 0965 313 cytoplasm tetraacyldisacchande 4 -kinase IpxK 0966 254 cytoplasm 3-deoxy D manno octulosonate cytidylyltransferase (kdsB) 0967 77 cytoplasm excinuclease ABC, subunit C (uvrC) 0969 204 cytoplasm ABC transporter ATP binding protein 0974 90 cytoplasm dethiobiotin synthase (bioD 2) -0976 223 cytoplasm biotin synthesis protein BioC 0977 549 cytoplasm long chain fatty acid coA ligase 0983 574 cytoplasm phosphoenolpyruvate carboxylase (ppc) ,0584. 303 cytoplasm gcpE protein (gcpE) 0988 226 cytoplasm rbs represser (rbsR) 0989 322 inner 1 nbokinase (rbsK) or ADP heptose synthase 0990 156 cytoplasm D-ribose ABC transporter, periplasmic binding protein (rbsB) 0992 223 cytoplasm saseplate assembly protein V 0994 52 inner 0 adhesin/invasm 0997 454 iipo multidrug efflux pump channel protein mtrE 1001 273 cytoplasm transcription termination factor (rho) 1002 230 inner 5 type 4 prepilln like protein specific leader peptidase 1003 143 inner 1 pilus assembly protein PilG pilG 1007 39 cytoplasm glycerol 3-phosphate regulon repressor (glpR) 1008 306 cytoplasm fructose 1,6 bisphosphatase (fbp) 1012 233 inner 8 hydroxyacylglutathione hydrolase 1014 182 cytoplasm tellunte resistance protein (tehB) 1015 541 periplasmic oligopeptide ABC transporter periplasmic binding protein 1018 45 periplasmic ohgopeptide ABC transporter, permease protein (oppB) 1019 256 cytoplasm methylenetetrahydrofolate 1021 428 inner 0 L fucose permease (fucP) or giucose/galactose transporter gluP 1022 216 cytoplasm L fuculose phosphate aldolase (fucA) 1023 144 cytoplasm fucose operon protein (fucU) 1024 30 cytoplasm fuculokmase (fucK) 1030 492 cytoplasm anaerobic glycerol 3-phosphate dehydrogenase, subunit A 1031 320 inner 1 anaerobic glycero! 3 phosphate dehydrogenase subunit B 1032 242 inner 5 transporter 1033 116 cytoplasm arsenate reductase 1041 70 cytoplasm hypoxanthine phosphonbosyltransferase (hpt) 1043 460 inner 9 proton glutamate symport protein or sodium/dicarboxylate symporter family protein 1045 155 cytoplasm anaerobic ribonucleoside triphosphate reductase activating -50- WO 200S/;lll066 PCT/TB2005/001775 1040 242 cytoplasm transport ATP binding protein (cydC) ABC transporter 1048 212 inner 4 transport ATP binding protein (cydC) 1050 359 cytoplasm fructose blsphosphate aldolase (fba) 1051 346 cytoplasm ADP heptose-LPS heptosyltransferase II rfaF 1053 56 cytoplasm peptidyi prolyl cis trans isomerse 1054 201 outer peptidyl-prolyl cis trans isomerse 1057 452 cytoplasm thiophene and furan oxidation protein (thdF) 10256 224 inner 2 nner membrane protein, 60 kDa (yidC) 1059, 58 cytoplasm ribosomal protein S18 (rpS18) 1060 149 cytoplasm nbosomai protein L9 (rpL9) 1061 577 cytoplasm heat shock protein (groEL) 1062 102 cytoplasm chaperonm (groES) 1063 190 inner 4 urease, gamma subunit (ureA) 1064 216 inner 5 rod shape determining protein (rodA) or cell division piotein FtsWftsW 1066 66 cytoplasm penicillin-binding protein 2 (pbp2) 1068 66 cytoplasm cell division protein FtsK related protein 1071 447 cytoplasm protease IV (sppA) 1074 286 cytoplasm ic 1 operon protein (licD) 1075 213 outer aminopeptidaseA/l (pepA) 1077 141 cytoplasm nucleoside dlphosphate kinase (ndk) 1078 227 cytoplasm GTP binding protein (yhbZ) 1080 317 inner 1 phosphonbosylamme-glycine ligase (purD) 1081 198 cytoplasm phosphoribosylaminoimidazolecarboxamideformyltransferase 1082 31 outer phosphonbosyiammoimidazolecarboxamideformyltransferase 1083 45 inner 0 phosphonbosylaminoimidazolecarboxamideformyltransferase 1084 199 inner 0 sufl protein (sufl) 1085 125 inner 1 1 acyl-glycerol 3 phosphate acyltransferase (pIsC) 1087 75 inner 1 1 acyl glycerol 3 phosphate acyltransferase (plsC) 1091 199 inner 4 sodium and chloride dependent transporter 1092 217 inner 2 potassium/copper transporting ATPase 1O93 68 cytoplasm mercuric ion scavenger protein (merP) 1094, 68 cytoplasm mercuric ion scavenger protein 1095 68 cytoplasm mercuric ion scavenger protein (merP) 1096 144 cytoplasm transcription al regulator, merR family 1097 105 cytoplasm met repressor (metJ) 1098 109 inner 1 ranscnption termination factor (rho) 1100 317 cytoplasm fumarate reductase fiavoprotein subunit (frdA) or succinate dehydrogenase fiavoprotein subunit sdhA 1101 276 cytoplasm umarate reductase iron sulfur protein (frdB) or succinate dehydrogenase ran sulfur protein sdhB 1102 132 inner 3 fumarate reductase, 15 kDa hydrophobic protein (frdC) 1103 114 inner 1 fumarate reductase 13 kDa hydrophobic protein (frdD) 1109 170 cytoplasm erminase small subumt 1116 51 cytoplasm heme-hemopexin utilization protein A (hxuA) 1117 165 cytoplasm leme-hemopexin utilization protein A (hxuA) -51- WO 2005/11:1066 PCT/IB2005/001775 1120 118 cytoplasm dihydroneoptenn aldolase (folB) 1124 338 inner 1 nrtrate/mtnte sensor protein (narQ) 1125 225 inner 1 topolsomsrase IV, subunit A (parC) 1127 139 cytoplasm glucose kinase 1132 202 cytoplasm type 1 modification enzyme (hsdM) 1135 260 cytoplasm type 1 modification enzyme (hsdM) 1137 362 cytoplasm type 1 restriction/modification specificity protein (hsdS) 1138 226 inner 0 thiamin phosphate pyrophosphorylase 1139 254 cytoplasm phosphomethylpynmidine kinase (thlD) 1140 32 cytoplasm phosphomethylpynmidme kinase (thiD) 1141 263 inner 1 hydroxyethylthiazole kinase 1143 70 cytoplasm outer membrane protein NsgA 1 144 , 51 cytoplasm nbonuclease E (rne) 1145 75 cytoplasm ribonuclease E (me) 1148 42 cytoplasm nbonuclease E (rne) 1151 180 inner 1 ademne phosphonbosyltransferase (apt) 1152 311 cytoplasm DIMA polymerase III, subunits gamma and tail (dnaX) 1154 221 cytoplasm DNA polymerase ill, subunits gamma and tau (dnaX) 1155 173 cytoplasm DNA polymerase III subunits gamma and tau (dnaX) 1156 60 cytoplasm uracil phosphonbosyitransferase (upp) 1165 406 cytoplasm mfS protein (mfS) 1166 151 cytoplasm scU protein (iscU) 1167 107 cytoplasm HesB/YadR/YfhF family protein 1168 174 cytoplasm co-chaperone Hsc20 (hscB) 1171 151 cytoplasm leat shock protein (hscA) 1172 53 cytoplasm 3 lactate dehydrogenase (did) 1173 36 cytoplasm ype 1 restriction enzyme EcoR124ll R protein, 1174 183 lipo poprotem (spr) 1175 194 cytoplasm Id D protein tldD 1177 44 cytoplasm lemoglobin binding protein 1180 234 cytoplasm peptidase E (pepE) 1182 386 cytoplasm ibosomal protein S1 (rpS1) '1183 94 cytoplasm ntearation host factor, beta subunit (himD) 1186, 194 cytoplasm orotidine 51 phosphate decarboxylase (pyrF) l188 181 inner 1 ipopolysacchande biosynthesis protein 1189 264 inner 1 alpha-1,2 N acetylglucosamme transferase rfaK 1190 57 periplasmic ipopolysacchande biosynthesis protein 1191 304 inner 2 alpha-23 sialyltransferase 1192 160 inner 4 ipopolysacchande biosynthesis protein 1197 124 cytoplasm undine kinase (udk) 1198 195 cytoplasm deoxycytidlne triphosphate deaminase (dcd) 1201 402 inner 10 drug resistance translocase family protein 1202 158 cytoplasm GTP-binding protein 1203 55 outer hemoglobin binding protein -52- WO 2005/111066 PCT/IB2005/001775 1206 736 cytoplasm TonB dependent receptor or hemoglobin receptor hmbR 1207 91 cytoplasm transcriptional regulator, HTH 3 family 1212 230 cytoplasm glycyl tRNA synthetase, beta chain (glyS) 1218 244 cytoplasm glycyMRNAsynthetase, alpha chain (glyQ) 1228 198 cytoplasm seryl tRNA synthetase (serS) 1229 282 inner 2 cytochrome C-type biogenesis protein (nrfF) 1230 176 inner 1 thiol disulfide interchange protein (dsbE) 1231 507 inner 9 cytochrome C type biogenesis 1233 380 inner 1 glutamate dehydrogenase (gdhA) 1242 135 cytoplasm transcriptional regulator 1253 266 cytoplasm transcriptional regulatory protein 1254 101 inner 3 galactoside ABC transporter permease protein (mgIC) 1256 185 Inner 6 ntracellularseptation protein A ispA 1258 154 cytoplasm acyl CoA thioesterhydrolase family protein 1261 158 periplasmic soluble lytic murein transglycosylase '1263 229 cytoplasm pyridoxamine phosphate oxidase (pdxH) 1264 162 cytoplasm GTP binding protein 1266 69 cytoplasm NAD(P)H flavin oxidoreductase 1267 386 cytoplasm ATP binding protein (mrp) 1268 460 periplasmic methionyl tRNA synthetase (metG) 1269 70 cytoplasm phosphoribosylaminoimidazole carboxylase, catalytic 1272 596 cytoplasm aminopeptidase N (pepN) 1273 175 inner 1 dihydrodipicolmate reductase (dapB) 1274 82 cytoplasm ferredoxin 1276 329 cytoplasm phenylalanyl tRNA synthetase, alpha subunit (pheS) 1277 373 cytoplasm phenylalanyl tRNA synthetase, beta subunit (pheT) 1278 286 cytoplasm DNA ademne methylase (dam) 1279 298 inner 1 3 dehydroquinate synthase (aroB) 1280 74 inner 2 NADH ubiquinono oxidoreductase, Na translocating 1281 208 inner 6 NADH ubiqumone oxidoreductase Na translocating 1282 269 inner 1 NADH ubiquinone oxidoreductase Na translocating 1283 411 inner 7 NADH ubiquinone oxidoreductase, subunit B (nqrB) 1284 48 cytoplasm NADH ubiquinone oxidoreducatase subunit A, Na translocating 1285 254 cytoplasm NADH ubiquinone oxidoreducatase subunit A, Na translocating 1286 85 inner 1 nitrogen fixation protein (rnfG) 1287 358 inner 9 Na(+) translocating NADH quinone reductase, subunit 1290 679 outer ferredoxm, 4Fe-4S bacterial type 1291 58 cytoplasm ferredoxin, 4Fe-4S bacteria! type 1295 406 inner 1 polynbonucleotide nucleotidyltransferase pnp 1297 296 inner 1 polynbonucleotlde nucleotidyltransferase pnp 1302 452 inner 1 O succinylbenzoate CoA ligase (menE) or long chain fatty acid-CoA igase fadD 2 1303 201 cytoplasm seqA protein (seqA) 1304 85 cytoplasm esterase/lipase -53- WO 2005/111066 PCT/IB2005/001775 1305' 65 inner 1 esterase/lipase 1306 144 inner 0 esterase/lipase 1307 41 inner 1 iron (chelated) ABC transporter, permease protein (yfeD) .1308 147 inner 2 iron (chelated) ABC transporter, permease protein (yfeD} 1309 282 inner 8 iron (chelated) ABC transporter permease protein (yfeC) 1310 306 cytoplasm iron (chelated) transporter, ATP binding protein (yfeB) 1311 293 periplasmic iron (chelated} ABC transporter, periplasmic binding protein 1313 154 lipo outer membrane integrity protein (toIA) or IgA specific serine endopeptidase iga 1314 253 cytoplasm penicillin binding protein 7 1318 41 cytoplasm transcriptional activator (iIvY) 1319 292 Inner 9 rarD protein 1320 105 cytoplasm glpE protein (glpE) '1321 263 inner 1 triosephosphate isomerase (tpiA) 1323 107 cytoplasm ntegrase/recombinase (xerC) 1324 100 cytoplasm dnaK suppressor protein (dksA) 1326 58 cytoplasm poly(A) polymerase (pcnB) 450 inner 10 C4 dicarboxylate transporter 1331 131 cytoplasm uracil DMA glycosylase (ung) 1332 124 inner 2 bicyclomycin resistance protein (bcr) 1338 50 cytoplasm gamma glutamyl phosphate reductase (proA) 1339 47 cytoplasm gamma glutamyl phosphate reductase (proA) 1340 39 cytoplasm gamma glutamyl phosphate reductase (proA) 1341 319 inner 1 gamma glutamyl phosphate reductase (proA) 1343 98 cytoplasm heat shock protein (dnaJ} 1344; 133 cytoplasm acetyl CoA carboxyiase biotin carboxyl carrier protein 1345 443 cytoplasm acetyi CoA carboxyiase biotin carboxyiase (accC) 1348 320 inner 7 sodium/pantothenate symporter (panF) 1349 493 cytoplasm cell division protein (ftsH) 1351 201 cytoplasm dihydropteroate synthase (folP-2) 1352 445 cytoplasm mrsA protein (mrsA) or phosphoglucomutase/phosphomannomutase family 1355, 438 cytoplasm DNA-directed RNA polymerase, beta1 chain (rpoC) 1357 172 inner 2 rod shape determining protein (rodA) 1359 621 inner 1 penicillin binding protein 2 (pbp2) 1361 193 cytoplasm modification methylase NIalV 1363 432 inner 1 3 phosphoshiklmate 1-carboxyvmyltransferase (aroA) or 3 1365 298 inner 1 formyltetrahydrofolate deformylase (purU) or phosphonbosylglycinamide formytfransferase purN 1366 138 cytoplasm DNA binding protein H NS (hns) 1369 66 cytoplasm DNA polymerase III, alpha subunit (dnaE) 1370 35 cytoplasm DNA polymerase III alpha subunit (dnaE) 1371 847 cytoplasm DNA polymerase III, alpha subunit (dnaE) 1373 118 cytoplasm hreonine deaminase (ilvA) 1378 ' 196 cytoplasm VfutT/nudix family protein 1379- 382 inner 1 glutamate 5 kinase (gamma giutamyl kinase) (proB) -54- WO 2005/111066 PCT/IB2005/001775 1380 128 inner 0 dihydrofolate reductase (folA) 1381 46 cytoplasm dihydrofolate reductase (folA) 1382 392 inner 2 multidrug resistance protein A (emrA) or fatty acid efflux system protein farA 1384 343 cytoplasm poly(A) polymerase (pcnB) 1386 106 cytoplasm 2 amino-4-hydroxy 6-hydroxymethyldihydroptendine 1388 432 periplasmic N acetylmuramoyl L alanlne amldase 1399 227 cytoplasm DNA mismatch repair protein (mutL) 1392 247 cytoplasm iemY protein (hemY) 1393' 175 inner 1 hemY protein (hemY) 1394 377 periplasmic uroporphyrm III C methyitransferase (hemX) 1398 194 Inner 0 transcnptonal activator (ilvY) 1400 492 inner 1 tetol acid reductoisomerase (ilvC) 1401 426 cytoplasm anaerobic glycerol 3 phosphate dehydrogenase, subunit C 1402 30 cytoplasm tRNA (guanine N1) methyitransferase (trmD) 1403 59 cytoplasm 16S rRNA processing protein RimM rimM 1404 81 cytoplasm 16S rRNA processing protein RimM nmM 1405 82 cytoplasm ribosomal protein S16 (rpS16) 1407 603 periplasmic 5r nucleotidase 1408 128 cytoplasm shikimic acid kinase I (aroK) 1410 249 cytoplasm stationary phase survival protein (surE) 1411 128 inner 2 ipoprotein B (ippB) 1412 74 inner 1 ipoprotein B (IppB) 1416 354 llpo ipoprotein NIpD 1417 56 cytoplasm ipoprotein NlpD 1420 62 inner 1 phosphate ABC transporter permease protein (pstC) 1421 282 inner 5 Phosphate ABC transporter, permease protein (pstA) or sulfate ABC ransporter, permease protein cysT 1422 255 cytoplasm amino acid ABC transporter ATP binding protein or sulfate ABC ransporter ATP binding protein cysA 1423 154 cytoplasm phosphate regulon transcriptional regulatory protein (phoB) or DNA binding response regulator NULL 1 424 72 cytoplasm phosphate regulon transcnptionat regulatory protein (phoB) 1425 425 inner 1 phosphate regulon sensor protein (phoR) or sensor histidine kinase NULL 1426 44 cytoplasm exodeoxynbonuclease I (sbcB) 1427 474 inner 1 exodeoxynbonuclease I (sbcB) 1428 158 inner 1 ammopepttdase A/i (pepA) 1429 480 inner 5 high affinity choline transport protein (betT) 1430 132 inner 2 high affinity choline transport protein (betT) 1431 57 inner 0 sensor protein (ygiY) 1432 139 cytoplasm high affinity ribose transport protein (rbsD) 1433 493 cytoplasm D ribose ABC transporter, ATP binding protein (rbsA) 1434 323 inner 9 D ribose ABC transporter, permease protein (rbsC) 1435 53 periplasmic D ribose ABC transporter, periplasmic binding protein 1436 88 cytoplasm D ribose ABC transporter, periplasmic binding protein (rbsB) -55- WO 2005/111066 PCT/IB2005/001775 1438 246 inner 6 heme exporter protein C (ccmC) or cytochrome c type biogenesis protein 1439- 221 inner 6 heme exporter protein B (ccmB) 1440 212 cytoplasm heme exporter ATP binding protein A (ccmA) or amino acid ABC transporter, ATP binding protein 1442 215 cytoplasm superoxide dismutase (sodA) 1443 231 cytoplasm ABC transporter, ATP binding protein 1445 105 cytoplasm anti sigma factor B antagonist ,1446,- 99 cytoplasm BolA/YrbA family protein 1447 424 inner 3 UDP N acetylglucosamine 1 carboxyvmyltransferase (murZ) 1448' 110 inner 1 amino acid ABC transporter, periplasmic binding protein 1449 135 cytoplasm amino acid ABC transporter, periplasmic binding protein 1450 234 inner 3 amino acid ABC transporter permease protein 1458 51 cytoplasm ATP-dependent Clp protease ATPase subunit (dpB) 1457 246 cytoplasm RNA methyltransferase, TrmH family 1459 782 cytoplasm virulence associated protein (vacB) or nbonuclease II family protein vacB 1460 83 cytoplasm peptidyl prolyl cis trans isomerase, FkbP type (slyD) or FKBP type peptidyl pralyl cis trans isomerase 1462 128 cytoplasm nbosome binding factor A (rbfA) 1463 306 cytoplasm tRNA pseudoundme 55 synthase (truB) 1464 379 inner 1 chonsmate mutase / prephenate dehydrogenase (tyrA) '1467 38 inner 1 chonsmate synthase (aroC) 1468 286 periplasmic penicillin insensitive murein endopeptidase (mepA) 1472 318 inner 2 hpid A biosynthesis (kdo)2 (lauroyl) lipid IVA or HtrB/MsbB farpily protein 1473 126 inner 1 oligopeptide transporter, periplasmic binding protein, 1475 696 cytoplasm oligopeptidase A (priC) 1476 292 cytoplasm type 1 modification enzyme (hsdM) 1477 196 cytoplasm type 1 modification enzyme (hsdM} 1480 204 cytoplasm nboflavin synthase, alpha chain (nbE) 1 482 212 cytoplasm aminopeptidase N (pepN) 1483 140 cytoplasm glutaminyl tRNA synthetase (glnS) 1485 699 cytoplasm 4 alpha glucanotransferase (malQ) 1499 273 cytoplasm glutamine synthetase (glnA) 1500 96 inner 1 glutamine synthetase (glnA) 1501 50 cytoplasm glutamine synthetase (glnA) 1503 347 inner 0 DTDP-glucose 4 6 dehydratase (rffG) 15O5 527 cytoplasm topoisomerase IV, subunit B (parE) 15O6 315 inner 1 ipid A biosynthesis lauroyl acyltransferase (htrB) 1507 308 cytoplasm ADP heptose synthase (rfaE) 1508 83 cytoplasm DNA directed RNA polymerase, beta chain (rpoC) 1509 829 cytoplasm DNA directed RNA poiymerase beta chain (rpoC) 1510 332 inner 8 ellunte resistance protein (tehA) 1511 81 cytoplasm ribosomal protein L13 (rpL13) 1512 153 cytoplasm ribosomal protein S9 (rpS9) 1513 101 cytoplasm urease, beta subunit (ureB) 1514 572 cytoplasm urease alpha subunit (ureC) -56- WO 2005/111066 PCT/IB2005/001775 '15.15 185 inner 1 urease accessory protein (ureE) 1519 183 cytoplasm urease accessory protein (ureF) 1520 107 cytoplasm urease accessory protein (ureG) 1523 334 cytoplasm ornithine carbamoyltransferase (arcB) ,1524, 310 cytoplasm carbamate kinase (arcC) 1526 193 inner 3 efflux pump component MtrF mtrF 1527 113 inner 2 anaerobic C4-dicarboxylate membrane transporter protein 1528 136 inner 1 NADH dehydrogenase (ndh) 1530 315 cytoplasm NADH dehydrogenase (ndh) 1531 410 inner 1 glyceroKS phosphate acyltransferase (plsB) 1532 367 inner 0 glycerol-3 phosphate acyltransferase (plsB) 1533 75 cytoplasm exArepressor(lexA) 1534 121 cytoplasm opacity protein or outer membrane protein NsgA nsgA 1537 227 Inner 4 argimne ABC transporter, permease protein (artM) 1538 221 inner 4 arginine ABC transporter, permease protein (artQ) 1539 72 cytoplasm arginme ABC transporter, periplasmic binding protein (artl) 1541 99 penplasmlc arginine ABC transporter, periplasmic binding protein 1542 243 cytoplasm arginme ABC transporter, ATP binding protein (artP) 1544 69 cytoplasm phosphoheptose isomerase (gmhA) 1545 73 cytoplasm shikirnate 5 dehydrogenase-related protein 1546 267 cytoplasm serine acetyltransferase (cysE) 1548 332 inner 1 glycerot 3-phosphate dehydrogenase (NAD+) (gpsA) 1549 567 cytoplasm adenylate cyciase (cyaA) 1550 42 cytoplasm adenylate cyciase {cyaA) 1551 228 cytoplasm adenylate cyciase (cyaA) 1552 110 !ipo ribosomal protein alanme acetyltransferase (nml) 1554 134 cytoplasm DNA polymerase III, psi subunit (holD) 1556 222 cytoplasm hemK protein hemK 1558 181 cytoplasm GTP binding protein (era) 1559; 125 inner 0 GTP binding protein (era) 1561 227 cytoplasm ribonuclease III (rnc) 1562 349 inner 3 signal peptidase I (iepB) 1565 345 cytoplasm tail fibre protein 1568 395 cytoplasm yrosyl tRNA synthetase (tyrS) 1569 315 inner 1 phosphonbosylpyrophosphate synthetase (prsA) 1575 72 inner 1 S1016V6 protein 1576 563 cytoplasm glucose 6 phosphate isomerase (pgi) -.1577 360 cytoplasm alanine racemase, biosynthetic (air) 1578 126 cytoplasm replicative DNA helicase (dnaB) 1579 303 cytoplasm replicative DNA helicase (dnaB) 1582 991 outer hand hemoglobin binding protein 1583 237 cytoplasm zinc protease 1584. 276 inner 1 adenylosuccmate synthetase (purA) 1585 41 cytoplasm adenylosuccinate synthetase (purA) -57- WO 2005/111066 PCT/IB2005/001775 1586 297 inner 1 2 3,4,5 tetrahydropyndine 2 carboxylate 1588 336 inner 1 punne nucleotide synthesis repressor (purR) 1589 78 cytoplasm phosphoenolpyruvate carboxylase (ppc) 1590 45 inner 1 ribosomal protein S1 (rpS1) 1'59r 244 cytoplasm cytidylate kinase 2 (cmkB) 1593 291 cytoplasm singlet oxygen resistance protein 1597 549 inner 1 D lactate dehydrogenase (did) 1609, 462 inner 1 oxidoreductase 16J0 199 cytoplasm spermidine/putrescme ABC transporter, perlplasmic-bmdlng 1633, 41 cytoplasm carbonic anhydrase 1614 647 cytoplasm ABC transporter, ATP binding protein 11318 289 inner 6 cytochrome C type biogenesis protein (ccmF) 1619 181 periplasmic thiol disuifide interchange protein (dsbE) 1624" 152 cytoplasm DNA ligase (lig) 1625 1027 inner 1 ype I restnction enzyme (hsdR) 1627 123 cytoplasm anticodon nuclease prrC 1629 177 inner 1 oligopeptide ABC transporter ATP binding protein (oppD) orsulfate ABC ransporter ATP-binding protein cysA 1630 356 cytoplasm oiigopeptide ABC transporter, ATP-binding protein (oppF) or sulfate ABC ransporter ATP-bmdmg protein cysA 1631 292 inner 1 membrane protein (lapB) 1635 683 cytoplasm 5 methyltetrahydropteroyltnglutamate homocysteine 1636 73 cytoplasm 5 methyltetrahydropteroyltnglutamate homocysteine 1639 363 cytoplasm GTP binding protein 1640 194 cytoplasm peptidyl tRNA hydrolase 1645 163 cytoplasm exodeoxynbonuclease VII large subunit (xseA) 1646 183 cytoplasm YhbX/YhjW/YijP/YjdB family protein 1648, 242 cytoplasm leat shock protein (dnaJ) 1650 320 cytoplasm heat shock protein 70 (dnaK) 1651 327 cytoplasm heat shock protein 70 (dnaK) 1653 411 inner 8 gluconate permease gntP 1659 ?69 cytoplasm molybdenum cofactor biosynthesis protein A (moaA) 1662 337 inner 2 sugar isomerase, KpsF/GutQ family 1664 531 inner 1 single stranded-DNA specific exonuclease (recJ) 1665 39 cytoplasm single stranded-DNA specific exonuclease (recJ) ,1666 235 outer hiol disuifide interchange protein (dsbA) 16681 230 inner 1 pfe protein (pfs) or 5 methylthioadenosine 1670 565 cytoplasm ransfernn binding protein orTonB dependent receptor ,1671 568 inner 1 on protease or ATP dependent protease La Ion 1672 139 cytoplasm 3 hydroxydecanoyl (acyl carrier-protein) dehydratase (fabA) 1678 1R5 cytoplasm bactenofemtin comigratory protein (bcp) 1679 286 cytoplasm dihydrodipicohnate synthetase (dapA) 1680 209 lipo ipoprotein 1681 107 cytoplasm sigma(54) modulation protein 1682 31? cytoplasm giycosyl transferase -58- WO 2005/111066 PCT/IB20 05/001775 1688 613 inner 2 sensor histidine kinase 1690 145 inner 1 UDP N-acetylglucosamme acetyltransferase (IpxA) 1692 403 inner 0 lipid A disacchande synthetase (IpxB) "1693 197 inner 1 nbonucleaseHII(rnhB) 1694 146 cytoplasm modification methyiase 1690 185 cytoplasm nbosome releasing factor (rrf) 1698 226 inner 1 1 deoxy D xylulose 5 phosphate reductoisomerase {d> r) 1700i 171 cytopfasm 1-deoxy D xylulose 5 phosphate reductoisomerase (d>r) ,1704 370 cytoplasm ribonucleoside dtphosphate reductase, alpha chain (nrcJA) *1705 39 cytoplasm ribonucleoside diphosphate reductase, beta chain {nrdB) l706 311 cytoplasm ribonucleoside diphosphate reductase, beta chain (nrdB) 1707, 409 inner 1 2 oxoglutarate dehydrogenase E2 component, dihydrolipoamtde 1708 , 222 cytoplasm 2 oxoglutarate dehydrogenase E1 component (sucA) 1709 184 cytoplasm ribosomal protein S4 (rpS4) 1712 314 inner 2 phosphosenne phosphatase (serB) 1714 680 cytoplasm transketolase 1 (tklA) 1716 333 cytoplasm biotin synthetase (bioB) 1717 217 cytoplasm hiamin ABC transporter, ATP binding protein or spermidine/putrescine ABC transporter ATP binding 1718: 84 inner 1 hiamin ABC transporter, permease protein 1719 77 inner 1 molybdopetenn biosynthesis protein (mog) 1720 112 cytoplasm nitrogen regulatory protein P II (glnB) 1722 348 inner 6 ransporter 1724 264 periplasmic primosomal protein N1 (pnA) 1725 487 inner 1 primosomal protein N' (pnA) 1726 102 cytoplasm PTS system glucose specific 1IA component (err) 1729 581 inner 1 phosphoenolpyruvate protein phosphotransferase (ptsl) 1730 92 cytoplasm phosphocamer protein HPr (ptsH) 1733 189 cytoplasm oligonbonuclease orn 1735 294 inner 2 phenylalanyl tRNA synthetase beta subunit (pheT) 1736 53 cytoplasm ntegration host factor, alpha subunit {himA) 1738, 47 cytoplasm ntegration host factor, alpha subunit (himA) 1739 161 lipo ipoprotein (nlpC) 1747 87 cytoplasm pyruvate kinase, type II (pykA) 1758 387 cytoplasm modification methyiase NlalV 1766 90 cytoplasm exodeoxynbonuclease, small subunit (xseB) 1767 , 296 inner 1 geranyltranstransferase (ispA) 1768 316 cytoplasm 1-deoxyxylulose-5 phosphate synthase (dxs) 1770 99 inner 1 glycosyltransferase 1771 464 cytoplasm fumarate hydratase class II (fumC) 1776 315 cytoplasm dihydroorotate dehydrogenase (pyrD) 1780 669 cytoplasm transferrin binding protein 2 precursor (tbp2) 1781 560 periplasmic ransfernn binding protein 1 precursor (tbp1) 1782 152 inner 1 deoxyu rid inetn phosphatase (dut) 59- WO 2005/111066 PCT/IB2005/001775 1783 400 inner 1 DNA/pantothenate metabolism flavoprotein (dfp) 1785 234 cytoplasm DNA repair protein (radC) 1786 82 cytoplasm ribosomal protein L28 (rpL28) 1787 56 cytoplasm ribosomal protein L33 (rpL33) 1788 454 inner 1 L 2,4-diammobutyrate 2 ketoglutarate 4 ammotransferase or acetylomithtne aminotransferase argD 1790 132 cytoplasm virulence associated protein C (vapC) 1791 443 cytoplasm L 2,4 diaminobutyrate decarboxylase 1792 434 cytoplasm ATP-dependent RNA helicase (hrpa) 1793 780 inner 1 ATP dependent RNA helicase (hrpa) 1794 122 cytoplasm ATP dependent helicase (hrpa) 1799 243 Inner 5 cytochrome D ubiquinol oxidase, subunit II (cydB) 1800 198 cytoplasm uxu operon regulator (uxuR) 1801 51 cytoplasm mannonate dehydratase (uxuA) , 18,02 33 cytoplasm acyl earner protein (acpP) 1803 220 inner 5 anaerobic C4-dicarboxylate membrane transporter protein 1805 486 inner 5 NAD(P) transhydrogenase, subunit alpha (pntA) 1806 474 inner 7 NAD(P) transhydrogenase subunit beta (pntB) 1807 305 periplasmic ranscnptional regulator 1808 70 cytoplasm DNA topoisomerase I (topA) 1809 50 cytoplasm signal recognrtion particle protein (ffh) 1812 88 cytoplasm ype I restnction enzyme (hsdR) 1813 646 inner 1 type I restriction enzyme (hsdR) 1815 418 inner 1 type I restriction/modification specificity protein (hsdS) 1819 545 outer heme hemopexm utilization protein B (hxuB) 1825 402 cytoplasm xylose isomerase (xylA) 1826' 493 cytoplasm xylulose kinase I827 308 cytoplasm ADP L glycero-D mannoheptose 6 epimerase (rfaD) 1828 167 inner 1 hioredoxin 1830 223 cytoplasm deoxynbose phosphate aldolase (deoC) 1831 509 cytoplasm competence protein (comM) 1834 7? cytoplasm glucose kinase 1835 288 inner 1 RpiR/YebK/YfhH family protein 1836 293 inner 0 N acetylneuraminate lyase (nanA) or dihydrodipicolinate synthase dapA ,1838 ?70 cytoplasm glucosamme 6-phosphate isomerase (nagB) 1839 381 cytoplasm N acetylgiucosamme 6 phosphate deacetylase (nagA) 1840' 107 cytoplasm outer membrane protein P2 (ompP2) 1841 38 cytoplasm DNA polymerase III, delta1 subunit (holB) 1845 716 outer hand LavA virulence protein 1846 237 cytoplasm thymidylate kinase 1848 265 cytoplasm arginmosuccmate synthetase (argG) 1855 97 cytoplasm exonbonuclease li (rnb) 1858 188 cytoplasm L lactate dehydrogenase (IctD) 1859 269 inner 1 glutamate racemase (murl) -60- WO 2005/111 066 PCT/IB2005/001775 1865" I 893 cytoplasm iATP-dependent DNA hetaase (recG) 1861 515 inner 1 guanosine 3' 5' bis(diphosphafe) 31 oyrophosphohydrofase 1867 69 cytoplasm molybdenum ptenn binding protein {mopl} 1888 lua cytoplasm desutfovmdn gamma subunit ; 1870 393 inner 1 kimg protein {kscB) 1871 343 penplasrmc enolase (eno) 1875 508 cytoplasm catalase (hktE) 1876- 50 cytoplasm glucosamine-fmctose 6 phosphate aminotransferase (glmS) 1877 232 cytoplasm glycogen synthase (glgA) 1879 174 cytoplasm glucose 1-phosphate adenylyltransferasg fglgC) 1880 283 cytoplasm glucose 1 phosphate adenylyltransferase (glgC) 1881 435 inner 1 glycogen operon protein (glgX) 1882 229 inner 1 glycogen operon protein (glgX) 1883 685 cytoplasm 1,4-alpha glucan branching enzyme (gigB) 1884 119 cytoplasm nbosoma! protein S10 (rpS10) 1885 315 inner 1 cys regulon transcriptional activator cysB 1886 217 cytoplasm acetate CoA transferase alpha subunit 1887 233 cytoplasm acetate CoA transfers beta subuntt (atoA) 1888 344 inner 5 short chain fatty acids transporter (atoE) 1889 84 inner 1 short chaiEi fatty acsds transporter (atoE) 1890 393 cytoplasm acetyl CoA acetyltransferase (atoB) 1891 310 inner 4 ceil division protein (ftsX) 1892 119 periplasmic cell division ATP binding protein (ftsE) 1893 129 cytoplasm cell division ATP-binchng protein (flsE) 1894 175 cytoplasm signal recognition particle docking protein FtsY (flsY) 1895 243 cytoplasm peptide ABC transporter ATP binding protein (sapD) 1896 105 inner 2 peptide ABC transporter, permease protem (sapC) 1897 50 penplasmic peptide ABC transporter, petmease protem (sapC) 1898 184 inner 4 peptide ABC transporter permease protein (sapC) 1899 321 inner 6 peptide ABC transporter, permease protein (sapB) 1900 584 outer peptide ABC transporter, psnpiasmsc-bmding protem (sapA) ; 1903 72 cytoplasm phosphoenolpymvate carboxylase (ppc) 1905 337 cytoplasm oxidoreductase 1906 624 inner 1 oxidoreductase 1908 323 inner 0 fsrrochelatase (hemH) 1913 321 cytoplasm thioredoxm reductase (trxS) 12? cytoplasm thtol peroxsdase (tpx) , I917 286 periplasmic Dhosphoribosvffbrmvtfllvcmamidme synthase (purl) 1919 980 mner 1 priosphonbosylform^glycinamfdme synthase (purl) 1923 247 inner 0 tpool^osacchatide biosynthesis protein 1925 172 inner 5 qip protem 1928 235 cytoplasm ribosomal large subunit pseudoundine gynthase D 1927 923 inner 1 ATP dependent helicase fhepA) 1928 249 cytoplasm L fucose operon activator (fucR) or transcriptional regulator DeoR family -61- WO 2005/113066 PCT/IB2005/001775 1929 568 cytoplasm ABC transporter ATP binding protein 1932 440 cytoplasm hemoglobin binding protein 158 cytoplasm hemoglobin binding protein 1934 140 cytoplasm 3,4 dihydroxy-2-butanone 4 phosphate synthase (nbB) or GTP cyclohydrolase 1935 282 inner 1 lipooligosacchande biosynthesis protein orlacto N neotetraose biosynthesis glycosyl 1936 160 cytoplasm rRNA methylase 1938 355 cytoplasm signal recognition particle docking protein FtsY (ftsY) ,1939 622 inner 9 O antigen acetylase 1940 380 cytoplasm ribonuclease D (md) 11941 562 inner 2 long chain fatty acid coenzyme A ligase (fadD) 1942 183 lipo outer membrane protein 11944 158 cytoplasm ATP dependent helicase (dinG) 19494 357 cytoplasm hemagglutmin/hemolysin related protein 1950 270 cytoplasm traN related protein 1953 232 outer outer membrane protein P2 (ompP2) 1954 366 cytoplasm queuosme biosynthesis protein (queA) or S adenosylmethionine tRNA 1958 1392 outer Adhesion and penetration protein 1959 504 cytoplasm excinudease ABC, subunit A (uvrA) 1960 220 inner 1 excinudease ABC, subunit A (uvrA) 1962 384 outer membrane bound lytic murein transglycosylase A 1963 261 inner 1 HesA/MoeB/ThiF family protein 1965 333 periplasmic adhesin 1967 467 inner 1 NMB1183 1969 156 cytoplasm ranscnptional regulator (ttk) 1971 224 cytoplasm catabolite gene activator (crp) 1972 392 cytoplasm RNA (uracil 5-) methyltransferase trmA 1973 351 cytoplasm beta hexosamimdase (exoll) or glycosyl hydrolase, family 3 1975 299 cytoplasm ong chain fatty acid transport protein (fadL) or outer membrane protein P1 1976 189 cytoplasm methylated DNA-protem cysteme methyltransferase (dat1) 1977 87 cytoplasm DNA mismatch repair protein (mutH) 1978 53 inner 0 DNA mismatch repair protein (mutH) 198O 71 cytoplasm DNA mismatch repair protein {mutH) 1981 430 inner 1 cell cycle protein (mesJ) 1982 34 cytoplasm pyndoxme kinase 1983 186 cytoplasm acetyl CoA carboxylase carboxyl transferase subunit alpha 1984 141 cytoplasm acetyl CoA carboxylase, carboxyl transferase subunit alpha 1986, 261 inner 9 membrane protein 1988 212 cytoplasm ABC transporter ATP binding protein (yebM) 1989 127 cytoplasm selenocysteine-specific elongation factor (selB) 1991 55 cytoplasm selenocysteine specific elongation factor (selB) or translation elongation actor Tu tufA 1992 461 inner 1 L seryl tRNA selenium transferase (selA) 1993 861 inner 1 DNA mismatch repair protein (mutS) -62- WO 2005/111066 PCT/IB2005/001775 I995 74 inner 2 tryptophan specific transport protein (mtr) 1996 339 inner 5 tryptophan specific transport protein (mtr) 1997 81 mner 2 ATP synthase F0F subunlt a (atpB) 1998 88 inner 1 ATP synthase FO, subunit c {atpE} 1999 156 periplasmic ATP synthase FO subunit b (atpF) '2000 144 cytoplasm ATP synthase F1, subunit delta (atpH) 2001 41 inner 0 ATP synthase F1, subunit delta 2002 513 cytoplasm ATP synthase F1, subunit alpha (atpA) 2003 289 cytoplasm ATP synthase F1, subunit gamma (atpG) 2005 76 inner 1 ATP synthase F1 subunit beta (atpD) 2007 372 cytoplasm ATP synthase F1 subunit beta (atpD) 2008 147 inner 1 ATP synthase F1, subunit epsilon (atpC) 2009 54 inner 1 tyrosme specific transport protein (tyrP) 2010 117 inner 1 rlbosomal protein L20 (rpL20) 2011 77 cytoplasm exodeoxynbonuclease V, beta chain (recB) 2012 1086 cytoplasm exodeoxynbonuciease V, beta chain (recB) 2013 288 cytoplasm exodeoxynbonuclease V, alpha chain (recD) 2014, 47 cytoplasm exodeoxynbonuclease V, alpha chain (recD) 2016 194 cytoplasm exodeoxynbonuclease V, alpha chain (recD) 202,1 107 cytoplasm virulence associated protein A (vapA) 2022 556 cytoplasm ABC transporter, ATP binding protein "2028 435 cytoplasm ranscnption repair coupling factor (mfd) 2029 228 cytoplasm ranscnption repair coupling factor (mfd) 2030 392 cytoplasm ranscnption repair coupling factor (mfd) 2031 36 cytoplasm ranscnption repair coupling factor (mfd) 2032 86 cytoplasm eucy! tRNA synthetase (leuS) 2034 688 cytoplasm eucy! tRNA synthetase (leuS) 2036 2038 281 cytoplasm undecaprenyl diphosphate synthase 288 inner 7 CDP diglycende synthetase (cdsA) 2041 283 inner 2 protective surface antigen D15 Omp85 2044- 256 cytoplasm RNA polymerase sigma 70 factor (rpoD) 2045 300 cytoplasm RNA polymerase sigma 70 factor (rpoD) 2046 347 cytoplasm DNA primase (dnaG) 2047 191 cytoplasm DNA primase (dnaG) 2048 52 cytoplasm DNA primase (dnaG) '2049 71 cytoplasm ibosomal protein S21 (rpS21) 2050 342 inner 1 0 sialoglycopratem endopeptidase (gcp) 2051 206 cytoplasm hymidinekmase(tdk) 2052 406 inner 10 tyrosine specific transport protein (tyrP) or Iryptophan transporter mtr 2053 86 cytoplasm erredoxin 4Fe4S bacterial type (fdx 2) 2058 263 cytoplasm phosphoglycerate kinase (pgk) 2059 81 cytoplasm phosphoglycerate kinase (pgk) 2061 207 cytoplasm amino acid ABC transporter ATP binding protein 2062 79 inner 0 amino acid ABC transporter, ATP binding protein 63- WO 2005/111066 PCT/IB2005/001775 2065 230 inner 4 nbonuclease BN (rbn) 2066 53 cytoplasm nbonuclease BN (rbn) 2070 273 Inner 1 undine phosphorylase (udp) .2071 438 inner 9 transport protein 2073 568 inner 1 2 succmyl-6-hydroxy 2,4-cyclohexadiene 1 carboxylate 2074 185 cytoplasm menaquinone specific isochonsmate synthase (menF) or anthramlate synthase component I trpE 2076 679 cytoplasm excinuclease ABC, subunit B (uvrB) .2079 756 inner 4 maiate oxidoreductase 2081 238 Inner 5 tyrosine specific transport protein (tyrP) ortryptophan transporter mtr 2083 228 inner 0 phosphonbosyl AMP cyclohydrolase / phosphonbosy! ATP 2084 258 cytoplasm hisF cyclase (hisF) 2085 249 cytoplasm phosphonbosylformimino 5 aminoimidazole carboxamide 2086 199 cytoplasm amidotransferase (hisH) 2087 381 cytoplasm imidazoleqlycerol phosphate dehydratase / 2088 367 cytoplasm llstidmol phosphate ammotransferase (hisC) 2089 427 inner 1 ustidmol dehydrogenase (hisD) 2090 35 cytoplasm ATP phosphonbosyltransferase (hisG) -2091 199 inner 1 biotin operon repressor/biotln acetyl coenzyme A or BirA protein/Bvg accessory factor 2092 488 inner 1 nosine 5'-monophosphate dehydrogenase (guaB) 2094 523 Inner 1 GMP synthase (guaA) 2095 296 inner 7 rarD protein 2097 168 inner 0 ranscnptional regulator 2099 321 inner 10 Na+/H+ antiporter (nhaA) 2100 32 cytoplasm lemolysin 2101 522 inner 7 apolipoprotein N-acyltransferase (cutE) 2106 193 cytoplasm recombination associated protein RdgC rdgC 2108 105 cytoplasm recombination associated protein RdgC rdgC 2110 290 cytoplasm ntegrase/recombinase 2115 158 mner4 colicm V production protein (cvpA) 2118 441 inner 2 acetate klnase (ackA) 2119 331 periplasmic phosphate acetyltransferase (pta) 2120 403 inner 1 phosphate acetyltransferase (pta) 2122 314 inner 1 adenine specific methylase 2123 323 cytoplasm cys regulon transcription al activator (cysB) 2124 71 cytoplasm phosphonbosylaminoimidazole carboxylase, catalytic subumt 2126 362 Inner 1 phosphoribosylammoimidazole carboxylase, ATPase subumt 2127 396 cytoplasm aspartate ammotransferase (aspC) 2128 220 inner 1 spermidine/putrescine ABC transporter, ATP binding 2134 152 cytoplasm mercuric resistance operon regulatory protein (merR2) 2138, 560 inner 10 PTS system fructose specific NBC component (fruA) 2139 313 cytoplasm 1-phosphofructokinase (fruK) or ADP heptose synthase 2140" 499 cytoplasm PTS system, fructose-specific HA/FPr component (fruB) 2143 92 cytoplasm virulence associated protein D (vapD) -64- WO 2005/311066 PCT/IB2005/001775 2146 101 inner 1 hypoxanthme phosphonbosyltransferase (hpt) 2147 451 cytoplasm pmbA protein (pmbA) 2151 241 cytoplasm ABC transporter, ATP binding protein 2152 164 cytoplasm nitrogen regulatory HA protein (ptsN) 2155 202 cytoplasm chonsmate mutase / prephenate dehydratase (pheA) 2157 148 cytoplasm ABC transporter, ATP binding protein 2158 192 cytoplasm histidmol phosphatase '2160 221 cytoplasm 5,10 methylenetetrahydrofolate reductase (metF) 2161 89 cytoplasm dethiobiotin synthase (bioD 1) 2162 313 inner 5 TRK system potassium uptake protein (trkH) or bis(5 -nucleosyl)-tetraphosphatase symmetncal/Trk 2163 191 inner 3 TRK system potassium uptake protein (trkH) or bls(5 nucleosyl)-tetraphosphatase symmetncal/Trk 2166 288 inner 4 heat shock protein (htpX) 2168 130 cytoplasm nbonuclease 2169 244 inner 0 lipoprolem (vacJ) 2172 185 cytoplasm transcription anbtermination protein (nusG) 2173 138 inner 3 preprotem translocase SecE subunit (secE) 2175 411 cytoplasm ATP dependent Clp protease, ATP binding subunit (dpX) 2176 211 cytoplasm ATP dependent Clp protease, proteolytic subunit (cIpP) 2177 394 cytoplasm trigger factor (tig) 2178 52 cytoplasm trigger factor (tig) 4180. 89 cytoplasm ribosomal protein S20 (rpS20) 2181 524 inner 11 virulence factor (mviN) 2182 312 cytoplasm riboflavin kinase / FMN adenylyltransferase (nbF) 2183 484 inner 1 isoleucyl tRNA synthetase ileS 2184 485 cytoplasm isoleucyl tRNA synthetase IleS 2185, 102 cytoplasm hit related protein 2186 184 cytoplasm ipoprotein 2187 393 periplasmic penicillin binding protein 5 (dacA) 2189 212 cytoplasm lipoate biosynthesis protein B (lipB) 2190 320 cytoplasm ipoate biosynthesis protein A (lipA) 2191 335 inner 1 citrate lyase ligase (cltC) 2192 95 cytoplasm citrate lyase, gamma chain (citD) 2193 291 inner 0 citrate lyase beta chain (citE) 2195 500 inner 1 citrate lyase, alpha chain (citF) 2196 416 inner 1 citG protein (citG) 2200 256 inner 1 heme hemopexm utilization protein A (hxuA) 2202 458 cytoplasm DNA repair protein (radA) 2204 166 inner 1 eucine responsive regulatory protein (!rp) 2205 554 inner 5 cell division protein FtsK ftsK-1 2208 169 cytoplasm polypeptide deformylase (def) 2209 318 inner 1 methionyl tRNAfomiyltransferase (fmt) 2211 450 cytoplasm sun protein (sun) or 16S RNA methyltransferase rsmB ,2212 458 cytoplasm TRK system potassium uptake protein (trkA) -65- WO 2005/111066 PCT/IB2O05/OO1775 2213 134 inner 2 large conductance mechanosensitive channel (mscL) 2Z15 40 cytoplasm RNA polymerase sigma E factor (rpoE) 2231 347 inner 1 lipopolysaccharide biosynthesis protein orADP heptose LPS heptosyltransferase II rfaF 2232 539 outer heme hemopexin utilization protein C or iron regulated outer membrane protein FrpB frpB 2233 170 cytoplasm heme hemopexin utilization protein C 2234 565 outer heme-hemopexin utilization protein B (hxuB) 2235 758 outer hand heme hemopexin utilization protein A (hxuA) 2236 231 cytoplasm DNA Iigase IigA 2 2238 327 cytoplasm dipeptide ABC transporter ATP binding protein (dppF) 2241 330 cytoplasm dipeptide ABC transporter, ATP binding protein (dppD) 2242 295 inner 6 dipeptide ABC transporter, permease protein (dppC) or thiol disulfide nterchange protein DsbD dsbD .2243 333 inner 5 dipeptide ABC transporter permease protein (dppB) 2246 727 cytoplasm DNA helicase II (uvrD) 2249 141 cytoplasm 6-pyruvoyl tetrahydrobioptenn synthase 2250 227 inner 0 aluminum resistance protein 2252, 184 cytoplasm sranched-cham amino acid transaminase (ilvE) 2259 898 inner 1 exodeoxynbonuclease V, gamma chain (recC) 2260 163 cytoplasm exodeoxynbonuclease V gamma chain (recC) 2262 372 inner 1 riboflavin biosynthesis protein (nbD) 2263 357 inner 1 protease (degS) 2274 192 inner 0 molybdopterin-guamne dmucleotide biosynthesis protein 2277 216 periplasmic periplasmic oxidoreductase (por) or fhio! disulfide interchange protein DsbA dsbA2 2280 363 cytoplasm RNA (uracil 5-) methyltransferase (trmA) 2282 125 inner 1 sigma E factor regulatory protein '2283 33 cytoplasm sigma-E factor regulatory protein 2285 178 inner 0 molybdoptenn guanine dmucleotide biosynthesis protein B 2289 652 cytoplasm ATP dependent Clp protease, ATPase subunit (clpB) 2293 156 cytoplasm DNA polymerase 1 (polA) 2294 785 cytoplasm DNA polymerase 1 (polA) 2299 507 inner 0 N utilization substance protein A (nusA) 2301 855 cytoplasm ranslation initiation factor 2 (infB) 2303 466 cytoplasm type 1 restriction enzyme (hsdR) 2304 285 cytoplasm ype 1 restriction enzyme (hsdR) '2307 518 cytoplasm anthranilate synthase component 1 (trpE) 2308 195 cytoplasm anthranilate synthase component li (trpG) or para aminobenzoate synthase glutamine '2311 84 cytoplasm anthamlate phosphonbosyltransferase (trpD) 2313 231 cytoplasm anthanilate phosphonbosyltransferase (trpD) 2314 477 cytoplasm ndole 3 glycerol phosphate synthase / 2317 239 cytoplasm valyl tRNA synthetase (valS) 2318 425 inner 1 valyHRNA synthetase -66- WO 2005/111066 PCT/IB2005/001775 2319, 35 cytoplasm valyl tRNA synthetase (valS) 2321 150 cytoplasm valyl tRNA synthetase (valS) 2322 102 cytoplasm valyl tRNA synthetase (valS) 2324 42 inner 1 transport protein 2325 238 cytoplasm purme-nucleoside phosphorylase (deoD) or 5-methylthioadenosine 2327 142 inner 0 ribosomal protein L11 (rpL11) 2328 229 cytoplasm ribosomal protein L1 (rpL1) .2329 1298 cytoplasm DNA directed RNA polymerase, beta chain (rpoB) 2331 158 cytoplasm iron(lll) ABC transporter, periplasmic binding protein 2333 506 inner 11 iron(lll) ABC transporter permease protein (hltB) 2335 356 cytoplasm iron(lll) ABC transporter, ATP binding protein (hitC) 2338 377 cytoplasm succinyl-diammopimelate desucclnylase (dapE) '2341 631 cytoplasm heat shock protein (htpG) 2344, 106 periplasmic organic solvent tolerance protein 2345 667 cytoplasm organic solvent tolerance protein 2346, 572 inner 1 prolyl tRNA synthetase (proS) 2347 630 inner 1 ATP dependent DNA helicase (recQ) 2348 113 cytoplasm cyaY protein (cyaY) 2350 415 cytoplasm diaminopimelate decarboxylase (lysA) 2351 208 cytoplasm nitrate/nitrite response regulator protein (narP) or tranacnptional regulator, LuxR family 2354 203 cytoplasm pseudourldine synthase RluD (rluD) or ribosomal large subunit )seudoundme synthase D 2356 272 lipo ipoprotein or competence Iipoprotefn ComL comL 2359 246 cytoplasm pyruvate formate lyase activating enzyme (act) 2360 772 cytoplasm ormate acetyltransferase (pfl) '2361 286 inner 6 formate transporter 2365 276 inner 2 sugar kinase 2368 377 inner 5 amino acid carrier protein 2371 158 inner 0 YgbBA'acN family protein 2373 146 cytoplasm mioC protein (mioC) orsulfite reductase (NADPH) flavoprotein, alpha 2376 333 inner 1 glpX protein (glpX) 2381 551 inner 6 ABC transporter, ATP binding protein 2382' 360 inner 2 ATP binding transport protein (cydD) 2383 228 cytoplasm heat shock protein (grpE) 2385 520 cytoplasm DNA repair protein (recN) 2387 38 cytoplasm DNA repair protein (recN) 2388 981 Inner 1 glutamate ammonia ligase adenylyltransferase (glnE) 2339 311 cytoplasm RNA delta(2) isopentenylpyrophosphate transferase (trpX) 2390 390 cytoplasm DNA mismatch repair protein (mutL) 2391 123 cytoplasm hymidylate synthetase (thyA) 2392 173 cytoplasm cytidine and deoxycybdylate deaminase family 2395 545 cytoplasm preprotem translocase SecA subunit (secA) 2396 363 cytoplasm preprotein translocase SecA subunit (secA) ,2397 163 cytoplasm mutator mutT protein {mutT) -67- WO 2005/111066 PCT/IB2005/001775 2398 618 inner 10 glutathione regulated potassium efflux system protein (kefC) 2399 254 cytoplasm 3-demethylubiqumone 9 3 methyltransferase ubiG 2401 245 cytoplasm ribosomal protein S2 (rpS2) 2402 71 inner 1 preprotem translocase SecY subunit (secY) 2403 144 cytoplasm ribosomal protein L15 (rpL15) 2404 59 cytoplasm ribosomal protein L30 (rpL30) 2405 267 inner 1 glucosamme- fructose-6-phosphate aminotransferase (glmS) 2406 177 inner 3 disulfide bond formation protein B (dsbB) 2407 238 Inner 5 Na+/H+ antiporter (nhaB) 2408 292 inner 5 Na+/H+antiporter(nhaB) 2410 241 cytoplasm fatty acid metabolism regulator protein (fadR) 2411 455 cytoplasm phosphatidylsenne synthase (pssA) or cardiolipin synthetase family protein '2412 201 cytoplasm rRNA methylase 2413, 232 cytoplasm adenme specific methylase 2415 122 cytoplasm ATP dependent RNA helicase SrmB (srmB) 2416 287 cytoplasm ATP dependent RNA heiicase SrmB (srmB) 2417 231 cytoplasm protease 2418 203 cytoplasm ATP ph os phonbosyltransferase (hisG) 2421 410 cytoplasm D 3 phosphoglycerate dehydrogenase (serA) ,2422 219 inner 1 ribose 5 phosphate isomerase A (rpiA) 2423 383 cytoplasm oxygen-independent coproporphyrmogen III oxidase 2424 658 cytoplasm ATP dependent protemase (Ion) 2428 298 cytoplasm ranscnptionai regulator, araC family 2429 38 cytoplasm ABC transporter, ATP-binding protein 2430 576 inner 4 ABC transporter, ATP-binding protein 2432 92 periplasmic mercuric ion scavenger protein (merP) 2433 120 inner 3 mercuric ion transport protein (merT) 2435 472 cytoplasm anaerobic dimethyl sulfoxide reductase, chain A (dmsA) 2436 352 cytoplasm anaerobic dimethyl sulfoxide reductase chain A (dmsA) 2437 205 cytoplasm anaerobic dimethyl sulfoxide reductase chain B (dmsB) 2438 279 inner 7 anaerobic dimethyl sulfoxide reductase chain C (dmsC) 2440 166 cytoplasm ferredoxin type protein (napF) or NADH dehydrogenase I, I subunit nuol 2443 133 cytoplasm 2 isopropylmalate synthase (leuA) 2445 358 cytoplasm 3 isopropylmalate dehydrogenase (beta IPM dehydrogenase) 2446 469 cytoplasm 3-isopropylmalate dehydratase, alpha subunit (leuC) 2447 200 inner 0 3 isopropylmalate dehydratase small subunit (leuD) 2448 1794 outer hand mmunoglobin A1 protease (iga1) or IgA specific serine endopeptidase iga 2449 378 cytoplasm DNA/ATP binding protein (recF) 2450 366 cytoplasm DNA polymerase III, beta subunit (dnaN) 2452 454 cytoplasm chromosomal replication initiator protein (dnaA) 2453 118 cytoplasm ransfernn binding protein 1 precursor (tbp1) 2454 231 cytoplasm transfernn binding protein 1 precursor (tbp1) '2457 199 inner 1 baseplate assembly protein V 2462 861 cytoplasm ail fibre protein -68- WO 200S/111066 PCT/BB2005/O01775 2476 89 cytoplasm aspartokinase I /homosenne dehydragenase! (thrA) 2477 307 cytoplasm aspartoklnase I /homosenne dehydrogenase I (thrA) 2478 314 inner 1 homosenne kinase (thrB) 2479 425 cytoplasm threonine synthase (thrC) 2480 238 cytoplasm mtegrase/recombinase (xerC) 2491 178 cytoplasm ferrsdoxin type 4Fe4S protein JnapF) 2492 93 cytoplasm napD protein (napD) 2493 832 outer hand Formate dehydrogenase major subumt 2494 279 cytoplasm ferredoxm type protein (napG) 2495 287 inner 4 feriBdoxin type 4Fe 4S protein (napH) 2496 150 periplasmic periplasmic nitrate reductase (napB) 2497 J2QQ inner 1 cytochrome C-type protein (napC) 2498 214 inner 0 ' adenylate Nmase (adk) 2499 412 inner 10 permease or AmpG related protein 2501 241 inner 0 UDP glucose 4-epimerase (galE) 2502 82 cytoplasm UDP giucose 4-epimerase (gaE) 2504 244 cytoplasm ron(lll) ABC transporter, ATP binding protein fbpc 2505 176 inner 4 ABC transporter, permease protein 2508 241 periplasmic FkbP type pepbdyl proly! cis trans isomerase (fkpA) or mao-ophage nfectiVity potentiator 2509 73 cytoplasm slyX protein (slyX) 2511 33 cytoplasm peroxiredoxin 2 family protein/glutaredoxin 2512 48 cytoplasm peroxtredoxtn 2 family proteln/glutaredoxsn ] 2513 117 cytoplasm peroxiredoxin 2 family protem/glutaredoxin 2514 301 cytoplasm hydrogen peroxide inducible genes activator (oxyR) or transcnptionai egulaior, LysR family 2517 158 cytoplasm ranscrsption elongation factor fgreB) ! 2518 770 cytoplasm ranscnption accessory protein (tex) l 2519 736 cytoplasm DNAqyrase subunit B (gyrB) 2520 59 cytoplasm DNAqvrase subunit B (gyrB) 2521 234 cytoplasm ibulose phosphate 3 epimerase (dod) I 2522 224 cytoplasm phosphoglycolate phosphatase (gph) 2530 132 cytoplasm ransposase 2531 369 inner 8 multidrug resistance protein B (emrB) or fatty acid eiflux system protein arB _ r2532 256 Inner 1 cell division protein (ftsN) 2533 1032 inner 12 acnftavine resistance protein (acrB) or multiple transfstdble resistance system protein MtrD 2534 419 inner 1 ipoprotein or membrane fusion protein mtrC 2535 196 cytoplasm ranscnptional represser (Bm3R1) or trancscnptional regulator MtrR mtrR 2538 418 cytoplasm ATP dependent RNA heiscase (rhlB) 2541 210 periplasmic kinase 2542 421 inner 1 serine hydroxymethyltransferase (serine methylase} (glyA) 2543 inner 3 YhbX/YhsW/YijP/Y]dB family protein 2544 85 cytoplasm phosphonbosylamme-giyctne ligase (purD) WO 2005/113066 PCT/1B2005/001775 2543 101 inner 1 jcelf division protein (ftsQ) 306 475 351 394 437 cytoplasm 380 45? ' cytoplasm 610 inner 1 107 208 cytoplasm 2548' 2548 2550 '2552 2553 2554 2555 2558' 2557 2558 2561 jnner 0 p afanme-P afansne ligase (ddlB) inner 2 UDP-N acetyimuramate-alanma ligase (murC) inner 1 UOP-N aceiyig!ucQsamine-N acetyimuramyi (pentapeptide) Inner 9 cell division protein fftsWj UDP N acetylmuramoylalanme-D glutamate ligase (murD) inner 10 phospho N acetylmuramoyi-penlapsptide transferass E (mraY) UDP MwWAc pentapepfade synihetase (murB inner 1 UDP N acetyimuramyi tnpepistie synthetase fmurE} pemciiim binding protein 3 (flsl) inner 1 cell division protein (ftsL) fticulokmase (fucK) 2584 25691 269 cytoplasm inner 0 transcnpiionaS regulatory protein (asnC) ulfite synthesis pathway protein (cysQ) or inos(to) monophosphatass famsiy protem 2570^ 2571 2577 2578 474 245 392 78 inner 0 cytoplasm Inner 1 mner 0 glucose-6 phosphate 1-dehydrogenase {zwf) oxidoreductase (devB) 6 phosphogluconate dehydrogenase decarboxylating (gnd) 8 phosphogluconats dehydrogenase, daearboxyiatsng (gnd) 2581 312 cytoplasm cytoplasm diadenosine tetraphosphatase (apaH) or bss{5 -nucleosyi; ietraphosphatase, symmetnca!/Trk iipooiigosacchande biosynthesis protein or lacto N neotetraose biosynthesis giycosyl 287 cytoplasm dimethyladenosme transferase (ksgA) 2584. 253 cytoplasm popolysacchande glycosyl iransferase 2585'- cytoplasm lipopoiysacchande gtycosyi transferase cytoplasm ranslation initiation factor 1 {infA) 2587 -25B8 364 Inner 8 lipo giycerol-3-phosphatase transporter (gipT}_ glycerophosphoryl diesterphosphodiesterase (glpQ) 2591 217 inner 4 glycerol uptake facilitator protein (gtpF) 2592 ! 503 cytoplasm glycerol klnase k 2593 2594 2595 ,2597 -2598 155 45 274 132 212 inner 1 cytoplasm lipo inner 1 cytoplasm xanlhine guamne phosphoribosyltransferase (gptE fllycerophosphoryi Chester phosphodiesterase (gipQj llpoproiein E (hel) exopolyphosphatase exopolyphosphatase 133 inner 1 ;ide chain release factor 3 (prfC) 2600 2610 cytoplasm pertplasmic transcnptlonal activator (metR) pyrrohne 5 carfaoxylate reductase (proC) 2612 mner 0 pyrrolme 5 carfaoxylate reductase (proC) 2617 297 cytoplasm mtegrase/recombmase (xerD) 2619 335 cytoplasm Hoiliday junction DNA helicase (ruvB) 2620 204 2621 190 cytoplasm Hoiliday junction DNA helK^se (ruvA) cytoplasm (crossover junction sndodeoxynbonuclease (ruvG) 2625 156 cytoplasm |datP pyrophosphohydroiase (ntpA) -70- WO 2005/11106(5 PCT/IB2005/001775 2525 588 cytoplasm aspartyl tRNA synthetase (aspS) 2629 78 cytoplasm virulence associated protein B (vapB) 2630 134 cytoplasm virulence associated protein C '2631 135 cytoplasm lactoylglutathione lyase (gloA) 2632 229 cytoplasm nbonuclease T (rnt) 2636 188 cytoplasm translation elongation factor P (efp) 2640 431 inner 1 opacity associated protein (oapA) 2641 134 lipo opacity associated protein (oapB) 2642 236 cytoplasm DNA repair protein (recO) 2643 438 cytoplasm tRNA (uracil 5) meihyltransferase frmA 2644 651 cytoplasm elongation factor G (fusA) 2646 394 cytoplasm elongation factor Tu (tufB) 2647 75 inner 2 chloride channel protein related protein 2649 245 inner 3 chloride channel protein related protein 2654 336 cytoplasm Iryptophany! tRNA synthetase (trpS) 2657 , 92 cytoplasm adenylosuccinate lyase (purB) 2659 364 cytoplasm adenylosuccinate lyase (purB) ' 2660 163 cytoplasm ribosomal protein L10 (rpL10) 2661 126 inner 0 ribosomal protein L7/L12 (rpL7/L12) 2663 456 inner 0 UDP N acetylglucosamine pyrophosphorylase (glmU) 2665 311 cytoplasm ysophospholipase L2 (pldB) 2666 371 cytoplasm aspartate semialdehyde dehydrogenase (asd) 2667 243 inner 4 ransport protein 2670 136 cytoplasm modulator of drug activity B (mdaB) 2671 42 cytoplasm modulator of drug activity B (mdaB) 2672 676 cytoplasm ATP dependent DNA helicase (rep) 2674 156 inner 1 ipopolysacchande core biosynthesis protein (kdtB) 2675 427 inner 2 3 deoxy d manno octulosomc acid transferase (kdtA) 2676 254 cytoplasm ipopolysacchande biosynthesis protein or beta 1 4 glucosyltransferase IgtF 26781 192 cytoplasm DNA 3 rnethyladenme glycosidase I (tagl) 2680 268 inner 1 shikimate 5 dehydrogenase (aroE) 2682 178 cytoplasm DNA topoisomerase I topA 2683 63 cytoplasm ABC transporter ATP binding protein 2685, 115 cytoplasm anaerobic ribonucleoside triphosphate reductase (nrdD) 2686 272 cytoplasm anaerobic ribonucleoside-triphosphate reductase (nrdD) 2687 286 cytoplasm acyl CoAthioesterase II (tesB) 2688 469 cytoplasm cysteinyl tRNA synthetase (cysS) 2689 169 cytoplasm peptidyl prolyl cis trans isomerase B (ppiB) "2698 107 cytoplasm hioredoxin (trxM) 2701 335 inner 1 D lactate dehydrogenase, fermentative (IdhA) 2702 393 inner 1 cystathionme gamma synthase (metB) 2703, 175 inner 1 ParA family protein 2705 451 periplasmic repiicative DNA helicase (dnaB) 2714 140 cytoplasm single stranded DNA binding protein (ssb) 71- WO 2005/111066 PCT/IB2005/001775 ,2717 686 cytoplasm DNA topoisomerase IIl (topB) 2722 156 cytoplasm DNA repair protein (radC) 2733 150 cytoplasm mutT protein mutT 2735 170 inner 3 transport protein 2736 280 cytoplasm aspartate ammonia lyase (aspA) 2736- 236 periplasmic aspartokinase I / homosenne dehydrogenase I (thrA) 2739, 317 cytoplasm transaldolase B (talB) 2740 217 inner 1 glyceraldehyde 3 phosphate dehydrogenase (gapdH) 2741 34 cytoplasm nner membrane protein, 60 kDa (yidC) 2742 204 cytoplasm nner membrane protein 60kDa(yidC) 2745 229 cytoplasm sufl protein (sufl) 2747 167 cytoplasm heat shock protein (hsIU) or ATP dependent Clp protease, ATP binding subunit 2748 94 cytoplasm spermidine/putrescme ABC transporter periplasmic binding .2749. 287 inner 8 drug resistance translocase family protein 2750 325 inner 2 potassium/copper transporting ATPase or cation transport ATPase, E1 E2 family 2751 349 cytoplasm 2 oxoglutarate dehydrogenase E1 component (sucA) '27512 34 cytoplasm 2 oxoglutarate dehydrogGnase E1 component (sucA) 2755 38 inner 1 serine transporter (sdaC) 2756 217 inner 4 serine transporter (sdaC) 2758; 75 lipo hermonuclease family protein 2761 144 cytoplasm orfG protein 2762 51 cytoplasm methionine ammopeptidase {map} 2763. 343 cytoplasm protein Pll undyiyltransferase glnD 2764 107 inner 4 ransporter 2765 282 inner 5 protein export membrane protein (secF) 2766 96 cytoplasm recA protein (recA) 2768 152 cytoplasm regulatory protein (recX) 2769 111 lipo crcB protein 2772 163 cytoplasm ranscnptional regulatory protein (tyrR) or nitrogen assimilation regulatory protein NtrX ntrX 2774 209 inner 1 glutathione transferase (bphH) or stringent starvation protein A sspA 2780 43 cytoplasm CTP synthetase (pyrG) 2782 138 cytoplasm CTP synthetase {pyrG) - 2785 167 cytoplasm ranscnptional regulator 2786 93 cytoplasm guanylate kinase (gmk) -2788 88 cytoplasm DNA directed RNA polymerase, omega chain (rpoZ) 2789 84 cytoplasm guanosine 3',5-bis{diphosphate) 3- pyrophosphohydrolase 2790 38 cytoplasm guanosine-3151 bis(diphosphate) 3' pyrophosphohydrolase 2792 90 cytoplasm S adenosylmethionme 2-demethylmenaqumone methyltransferase 2795 120 cytoplasm bs repressor (rbsR) 2801 113 cytoplasm ferredoxin {fdx 1) or ferredoxm 2Fe 2S type fdx 2 2807 266 inner 1 modification methylase (hind HIM) '2811 350 cytoplasm asparaginyl tRNA synthetase (asnS) or aspartyl tRNA synthetase asps -72- WO 2005/111066 PCT/IB2005/001775 2312 31 cytoplasm nbofiavm synthase beta chain (nbH) 228 Inner 3 PqlA family protein 2814 282 inner 1 pqiB protein pqiB 112 cytoplasm asparaginyl tRNA synthetase (asnS) or aspartyl-tRNA synthetase aspS 2817 128 cytoplasm carbonic anhydrase 2818 122 cytoplasm transcriptional regulatory protein (tyrR) 2825 215 cytoplasm pqiB protein pqiB 2827. 194 cytoplasm phosphoheptose isomerase gmhA 2831 233 cytoplasm 28 kDa outer membrane protein (hlpA) 2832 33 cytoplasm glycerol 3 phosphate regulon repressor (glpR) REFERENCES (the contents of which are hereby incorporated by reference) [I] Fleischmann etal (1995) Science 269 496-512 [2] L\et al (2003) Mol Microbiol 47 1101 1111 [3] GenBank accession NC_000907 [4] Geysen et al (1984) PNAS USA 81 3998 4002 [5] Carter (1994) Methods Mol Biol 36 207-23 [6] Jameson,BAetal L988, CABJOS4(1) 181-186 [7] Raddnzzam & Hammer (2000) Brief Bwmfoim 1(2) 179 89 [8] DeLallaefa/ (1999) J Immunol 163 1725 29 [9]Brusicera/ (1998) Bwmformatws 14(2) 121 30 [10] Meisteref al (1995) Vaccine 13(6) 581-91 [11] Roberts et al (1996) AIDS Res Hum Reti ovn uses 12(7) 593-610 [12] Maksyutov & Zagrebelnaya (1993) ComputAppl Biosa 9(3) 291-7 [13] Feller & de la Cruz (1991) Nature 349(6311) 720-1 [14] Hopp (1993) Peptide Research 6 183-190 [I5]Welling et al (1985)FEBS Lett 188215-218 [16] Davenport et al (1995) Immunogenetics 42 392-297 [17] Bodanszky (1993) Pi maples of Peptide Synthesis (ISBN 0387564314) [18] Fields et al (1997) MethEnzymol 289 Solid-Phase Peptide Synthesis ISBN 0121821900 [19] Chan & White (2000) Fmoc Solid Phase Peptide Synthesis ISBN 0199637245 [20] Kullmann (1987) Enzymatic Peptide Synthesis ISBN 0849368413 [21] Ibba (1996) Biotechnol Genet Eng Rev 13 197-216 [22] Breedveld (2000) Lancet 355(9205) 735 740 [23] Gorman &. Clark (1990) Semin Immunol 2 457-466 [24] Sambrooke et al (1989) Molecular Cloning A Labotatory Manual [25] Short protocols in molecular biology (4th ed, 1999) Ausubel etal eds ISBN0-471-32938-X [26] US patent 5 707,829 [27] Current Protocols in Molecular Biology (F M Ausubel et al eds 1987) Supplement 30 [28] EP-B 0509612 -73- WO 2005/111066 PCT/IB2005/001775 [29] EP-B-0505012 [30] Yadav et al (2003) LettAppl Microbiol37(3) 190-5 [31] Smghi etal (2002) Ann Trop Paediatr 22(4) 347-53 [32] Tang etal (1997) Clin Chem 43 2021-2038 [33] Vaccine Design (1995) eds Powell & Newman ISBN 030644867X Plenum [34]WO00/23105 [35] WO90/14837 [36] US patent 5,057,540 [37] WO96/33739 [38] EP-A-0109942 [39] WO96/11711 [40] WO00/07621 [41] Barr et al (1998) Advanced Drug Delivery Reviews 32 247-271 [42] Sjolandera/ (199$) Advanced Drug Delivery Reviews 32 321-338 [43] Nukura et al (2002) Vinology 293 273-280 [44] Lenz et al (2001) J'Immunol 166 5346 5355 [45] Pinto et al (2003) JInfectDis 188 327-338 [46] Gerber et al (2001) Vnol 15 4752 4760 [47] WO03/024480 [48] WO03/024481 [49] Gluck et al (2002) Vaccine 20 B10-B16 [50] CP-A-0689454 [51] Johnson et al (1999) BiooigMed Chem Lett 9 2273-2278 [52] Dyans et al (2003) Dcpei t Rev Vaccines2219-229 [53] Meraldi etal (2003) Vaccme 21 2485-2491 [54] Pajak et al (2003) Vaccme 21 836-842 [55] KanchmallaeM/ (2003) Nucleic Acids Resea? ch 31 2393-2400 [56] WO02/26757 [57] WO99/62923 [58] Krieg (2003) Nature Medicine 9 831-835 [59]McClushe et al (2002) FEMS Immunology and Medical Microbiology 32 179-185 [60] WO98/40100 [61] US patent 6,207,646 [62] US patent 6 239,116 [63] US patent 6,429,199 [64] Kandimilla et al (2003) Biochemical Society Transactions 31 (part 3) 654-658 [65] Blackwell et al (2003) J Immunol 170 4061-4068 [66] Kneg (2002) Trends Immunol 23 64-65 [67] WO01/95935 [68] Kandimalla et al (2003) SBRC 306 948-953 [69] Bhagat et al (2003) BBRC 300 853-861 -74- WO 2005/111066 PCT/IB2005/001775 [70]WO03/035836 [71]WO95/17211 [72] WO98/42375 [73] Beignon et al (2002) Infect Immun 70 3012-3019 [74] Pizza et al (2001) Vaccine 19 2534-2541 [75] Pizza et al (2000) Int J Med Microbwl 290 455-461 [76] Scharton-Kersten etal (2000) Inject Immun 68 5306-5313 [77] Ryan et al (1999) Infect Immun 67 6270-6280 [78] Partidos et al (1999) Immunol Lett 61209-216 [79] Peppolom et al (2003) Expert Rev Vaccines 2 285-293 [80] Pine et al (2002) J Control Release 85 263-270 [81]Domemghini et al (1995) Mot Microbwl 15 1165-1167 [82] WO99/40936 [83]WO99/44636 [84] Singh et al] (2001) JCont Release 70 267 276 [85] WO99/27960 [86] US patent 6 090 406 [87] US patent 5 916 588 [88]EP-A-0626169 [89] WO99/52549 [90] WO01/21207 [91] WO0I/2U52 [92] Andnanov et al (1998) Bwmatenals 19 I09-U5 [93] Payne el al(1998) Adv Drug Dcltvety Review 31 185-196 [94] Stanley (2002) Clin Exp Dermatol 27 571-577 [95] Jones (2003) Curr Opin Investig Drugs 4 214-218 [961WO99/11241 [97]WO94/00153 [98] WO98/57659 [99] European patent applications 0835318, 0735898 and 0761231 [100]WO03/009869 [101] Almeida &AIpar (1996) J DrugTargeting3 455-467 [102] Agarwal &Mishra(1999)Indian JExpBxolZl 6-16 [103]Costantino et al (1992) Vaccine 10 691-698 [104] Costantino etal (1999) Vaccine 17 1251 1263 [105]WO03/007985 [106] Watson (2000) Pediatr Infect DtsJ\9 331-332 [107] Rubin (2000) PediaU Clm North Am 47 269-285, v [108] Jedrzejas (2001) Mia obwl Mol Bml Rev 65 187-207 [109] Bell (2000)Pediati Infect DisJ19 1187 1188 [110] Iwarson (1995) APMIS 103 321-326 -75- WO 2005/111066 PCT/IB2005/001775 [111] Gerhch et al (1990) Vaccine 8 Suppl S63-68 &79-80 [112] Vaccines (1988) eds Plotkin & Mortimer ISBN 0-7216-1946-0 [113] Del Guidice etal (1998) Molecular Aspects of Medicine 19 1-70 [114] Gustafsson etal (1996)N Engl J Med. 334 349-355 [115] Rappuoh etal (1991) TIBTECH9 232-238 [116] Sutler et al (2000) Pediati CtmNorthAm 47 287-308 [117] Zimmerman & Spam (1999) Am Fam Physician 59 113-118, 125-126 [118] McMichael (2000) vaccine 19 Suppl 1 S101-107 [119] Schuchat (1999) Lancet 353(9146) 51-6 [120] WO02/34771 [121] Dale (1999) Infect Dis Clin North Am 13 227-43, V111 [122] Ferretti et al (2001)PNAS USA 98 4658-4663 [123]Kuroda et al (2001) Lancet 357(9264) 1225-1240, see also pages 1218-1219 [124] EP-A-0372501 [125]EP-A-0378881 [126] EP-A-0427347 [127]WO93/17712 [128] WO94/03208 [129] WO98/58668 [130] EP-A 0471177 [131] WOOO/56360 [132]WO91/01146 [133] WO00/61761 [134]WO01/72337 [135] Resea) ch Disclosure, 453077 (Jan 2002) [I36]Needleman&Wunsch(1970)/Mol Biol 48,443-453 [ 137] Rice et al (2000) Ti ends Genet 16 276-277 [138] Gennaro (2000) Remington The Science and Practice of Pharmacy 20th edition, ISBN 0683306472 [139] Methods In Enzymology (S ColowickandN Kaplan, eds Academic Press Inc) [140] Handbook of Experimental Immunology Vols I-IV (DM Weir and CC Blackwell, eds, 19S6, Blackwell Scientific Publications) [141] Sambrook, et al, Molecular Cloning A Laboratory Manual (2nd Edition, 1989) [142] Handbook of Surface and Colloidal Chemistry (Budi, K S ed , CRC Press, 1997) [143] Short Protocols in Moleculai Biology 4th ed (Ausubel et al eds, 1999, John Wiley & Sons) [144] Molecular Biology Techniques An Intensive Laboratory Course (Ream et al, eds, 1998, Academic Press) [H5]PCR(Introduction to BiotechniquesSeries) 2nded (Newton & Graham eds 1997 Springer Verlag) [146] Mason etal (2003)Infect Immun 11 3454-3462 [I47]Drdile etal (1993) Infect Immun 61 81-90 76 WO 2005/111066 PCT/IB2005/001775 CLAIMS 1 A polypeptide comprising an amino acid sequence that has at least 75% sequence identify to one or more of SEQ ID NOS 1566,5095,1570,5094,1574,5903,1578,5092,2,4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38? 40,42,44,46 48,50,52,54,56,58,60,62,64,66,6S, 70,72,74 76,78, 80, 82,84,86 88 90 92,94,96,98, 100 102, 104,106, 108,110,112,114,116, 118, 120,122,124,126,128,130,132,134,136,138,140,142,144,146,148 150, 152,154,156,158,160,162,164 166 168,170,172,174,176,178,180,182,184,186,188,190,192,194,196,198, 200 202 204 206,208,210,212,214,216,218 220,222,224,226,228, 230,232,234,236,238,240,242,244,246, 248,250,252 254 256,258 260,262,264,266,268,270,272,274,276,278,280 2S2 284,286,2S8,290,292,294, 296,298,300, 302,304,306,308,310,312,314,316,318,320,322,324, 326 328,330,332,334,336,338, 340 342 344,346,348,350,352,354 356 358 360,362,364 366,368,370,372,374,376,378,380,382,384,386,388,39Os 392,394,396,398,400,402 404,406,408,410 412,414,416,418,420 422,424,426,428,430,432,434,436 438 440,442,444,446,448,450,452,454,456,458,460,462,464,466,468 470 472,474,476,478,480,482,484,486, 488,490,492,494,496,498,500, 502,504,506,508,510,512,514,516, 518,520,522 524, 526, 528, 530, 532, 534, 536 538 540 542 544,546 548,550,552,554,556 558,560 562,564,566 568,570 572, 574 576 578, 580 582 584,586, 588, 590,592,594, 596,598,600,602,604,606, 60S, 610,612, 614,616,618,620,622,624 61$ 628,630 632,634,636, 638,640,642, 644,646,648,650,652,654, 656 658, 660, 662,664,666,668,670,672 674 676, 678 680,682,684,686,688,690,692 694 696,698 700,702,704 706,708 710 712,714,716 718,720 722,724 726, 728,730,732,734,736,738,740,742,744,746,748,750,752,754,756,758,760,762,764,766,768,770,772,774, 776,778,780, 782,784 786,7S8,790,792,794,796,798,800,802,804, S06,808, 810 812,814,816,818,820, 822, 824,826,828, 830,832,834,836,838,840,842,844,846, 848,850 852 854, 856,858, 860,862,864,866, 868, 870, 872,874,876 878,880 882,884,886 888,890 892,894,896,898,900,902,904,906,908,910,912,914,916, 918, 920,922,924, 926,928 930,932,934,936,938,940,942,944,946,948, 950,952,954,956,958,960 962,9645 966 968, 970, 972, 974, 976, 978, 980, 982,984, 986, 9S8, 990, 992, 994, 995 998,1000, 1002,1004,1006 1008,1010, 1012, 1014, 1016,1018, 1020, 3022, 1024,1026 1028 1030, 1032, 1034, 1036, 1038, 1040, 1042, 1044, 1046, 1048 1050,1052,1054,1056,1058, 1060,1062, 1064,1066 1068,1070, 1072,1074,1076,1078, 1080,1082, 1084,1086, 1088, 1090,1092,1094, 1096 1098,1100,1102,1104,1106,1108,1110,1112,1114,1116 1118 1120, 1122,1124, 1126, 1128,1130,1132,1134,1136, 1138,1140, 1142, 1144, 1146, 1148,1150,1152 1154,1156 1158,1160,1162, 1164,1166,1168,1170,1172, 1174 1176 U78 1180 1182, 1184 1186, 1188, 1190 1192,1194, 1196, 1198,1200, 1202 1204, 1206,1208, 1210 1212, 1214, 1216, 1218 1220 1222, 1224, 1226, 1228, 1230s 1232, 1234, 1236, 1238, 1240,1242,1244,1246,1248, 1250,1252,1254,1256, 1258 1260,1262,1264,1266,1268 1270,1272 1274 1276, 1278,1280,1282,1284, 1286,1288,1290,1292, 1294,1296,1298,1300,1302, 1304, 1306,1308, 1310,1312,1314, 1316,1358, 1320,1322,1324, 1326,1328,1330, 1332,1334,1336,1338, 1340,1342, 1344,1346,1348, 1350,1352, 1354, 1356, 1358, 1360,1362, 1364,1366, 1368, 1370, 1372, 1374, 1376,1378,1380, 1382, 1384, 1386,1388, 1390, 1392,1394 1396,1398 1400, 1402,1404,1406, 1408,1410, 1412, 1414, 1416 1418 1420,1422, 1424,1426,1428, 1430 1432 1434, 1436 1438, 1440,1442,1444, 1446,1448,1450,1452,1454 1456,1458,1460 1462,1464, S466 1468 1470,1472,1474,1476,1478, 1480 1482 1484 i486 1488S1490,1492 1494 1496 1498,1500,1502,1504 1506,1508,1510, 1512,1514 1516,1518,1520, 1522, 1524,1526, 1528,1530,1532,1534 1536,153S, 1540,1542, 1544, 1546,1548,1550, 1552,1554,1556,1558,1560,1562,1564,1566,1568,1570, 1572, 5574, 1576, 1578,1580 1582 1584,1586,15S8,1590, 1592, 1594,1596,1598,1600,1602 1604, 1606 1608,1610 1612 1614,1616,1618, 1620 1622 1624,1626 1628, 1630,1632, 1634 1636 1638 1640,1642,1644 1646 1648,1650,1652, 1654,1656, -77. WO 2005/111066 PCT/IB2005/001775 1658, 1660,1662, 1664, 1666,1668,1670, 1672,1674,1676, 1678, 1680,1682,1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700,1702, 1704,1706, 1708,1710,1712, 1714,1716 1718, 1720,1722,1724, 1726, 1728, 1730, 1732, 1734, 1736, 1738, 1740, 1742,1744 1746,1748 1750 1752 1754,1756, 1758, 1760, 1762, 1764, 1766,1768,1770, 1772 1774, 1776, 1778, 1780, 1782 1784 1786,1788, 1790,1792, 1794 1796, 1798, 1800, 1802 1804, 1806, 1808, 1810, 1812, 1814, 1816, 1818, 1820, 1822, 1824, 1826, 1828, 1830, 1832, 1834, 1836, 1838, 1840, 1842, 1844, 1846, 1848,1850, 1852,1854,1856, 1858, 1860,1862,1864, 1866,1868 1870,1872,1874, 1876,1878,1880, 1882, 1884 1886,1888,1890 1892, 1894,1896, 1898,1900,1902, 1904 1906,1908, 1910,1912,1914, 1916,1918, 1920, 1922, 1924,1926,1928, 1930, 1932,1934, 1936,1938,1940,1942, 1944,1946 1948, 1950, 1952, 1954,1956, 1958, 1960, 1962, 1964, 1966, 1968, 1970, 1972, 1974, 1976, 1978, 1980, 1982, 1984, 1986, 1988, 1990, 1992, 1994, 1996, 199S, 2000, 2002, 2004, 2006, 2008, 2010, 2012, 2014,2016, 2018, 2020, 2022 2024, 2026,2028 2030,2032, 2034, 2036, 2038, 2040, 2042, 2044, 2046, 2048, 2050, 2052, 2054, 2056, 2058, 2060, 2062, 2064, 2066, 2068, 2070, 2072, 2074, 2076, 2078, 2080 2082, 2084, 2086, 2088, 2090,2092, 2094, 2096,2098, 2100, 2102,2104, 2106, 2108, 2110, 2112, 2114, 2116, 2118, 2120, 2122, 2124, 2126, 2128, 2130, 2132, 2134, 2136, 2138, 2140,2142, 2144, 2146, 2148, 2150, 2152,2154,2156 2158,2160,2162 2164 2166,2168 2170 2172 2174 2176 2178 2180 2182 2184 2186,2188 2190, 2192 2194 2196, 2198, 2200, 2202, 2204, 2206, 2208, 2210 2212 2214 2216, 2218, 2220, 2222 2224 2226, 2228 2230 2232 2234, 2236, 2238, 2240, 2242,2244, 2246, 2248, 2250,2252, 2254, 2256, 2258, 2260, 2262, 2264, 2266, 2268, 2270, 2272, 2274, 2276, 2278, 2280, 2282, 2284, 2286 2288 2290 2292, 2294, 2296 2298, 2300, 2302 2304, 2306 2308 2310, 2312, 2314, 2316, 2318, 2320, 2322, 2324, 2326 2328 2330 2332, 2334, 2336, 2338 2340 2342, 2344 2346 2348, 2350, 2352 2354, 2356, 2358,2360, 2362 2364, 2366, 2368, 2370, 2372, 2374, 2376, 2378, 2380, 2382, 2384, 2386, 2388, 2390, 2392, 2394, 2396, 2398, 2400, 2402, 2404, 2406, 2408, 2410, 2412, 2414, 2416, 2418, 2420, 2422, 2424, 2426, 2428, 2430, 2432, 2434, 2436 2438, 2440, 2442 2444 2446, 2448 2450, 2452, 2454, 2456 2458, 2460, 2462, 2464, 2466 2468, 2470 2472 2474, 2476 2478, 2480 2482, 2484, 2486, 2488 2490, 2492 2494 2496, 2498, 2500, 2502, 2504, 2506, 2508, 2510, 2512, 2514, 2516, 2518, 2520, 2522, 2524, 2526, 2528, 2530, 2532, 2534, 2536, 2538, 2540, 2542, 2544, 2546, 2548, 2550, 2552, 2554, 2556, 2558, 2560, 2562, 2564, 2566, 2568, 2570, 2572, 2574, 2576, 2578, 2580,2582, 2584, 2586 2588, 2590, 2592 2594 2596 2598, 2600 2602, 2604, 2606, 2608 2610,2612,2614 2616,2618 2620 2622 2624,2626 2628,2630 2632,2634 2636 2638 2640 2642 2644 2646, 2648, 2650, 2652, 2654, 2656, 2658, 2660, 2662, 2664, 2666, 2668, 2670, 2672, 2674, 2676, 2678, 2680, 2682, 2684, 2686, 2688, 2690, 2692, 2694, 2696, 2698, 2700, 2702, 2704, 2706, 2708, 2710, 2712, 2714, 2716, 2718, 2720, 2722, 2724, 2726, 2728 2730 2732 2734 2736 2738, 2740,2742 2744,2746 2748, 2750, 2752, 2754, 2756 2758 2760, 2762, 2764, 2766, 2768 2770, 2772 2774, 2776 2778 2780 2782, 2784, 2786 2788, 2790, 2792, 2794, 2796, 2798, 2800, 2802, 2804, 2806, 2808, 2810, 2812, 2814, 2816, 2818, 2820, 2822, 2824,2826, 2828, 2830, 2832, 2834, 2836, 2838, 2840, 2842, 2844, 2846, 2848, 2850, 2852, 2854, 2856, 2858 2860 2862 2864, 2866, 2868 2870, 2872, 2874 2876, 2878, 2880, 2882, 2884 2886, 2888, 2890 2892, 2894 2896 2898 2900 2902, 2904, 2906, 2908,2910, 2912 2914, 2916, 2918, 2920, 2922 2924~2926, 2928, 2930 2932, 2934 2936, 2938, 2940 2942, 2944, 2946, 2948, 2950 2952, 2954, 2956 2958, 2960, 2962 2964, 2966 2968, 2970, 2972, 2974 2976, 2978, 2980, 2982,2984, 2986, 2988, 2990, 2992, 2994, 2996, 2998, 3000, 3002, 3004,3006, 3008,3010, 3012, 3014 3016, 3018, 3020, 3022 3024, 3026, 3028, 3030,3032 3034 3036, 3038, 3040, 3042 3044,3046,3048, 3050, 3052, 3054,3056 3058, 3060,3062, 3064 3066, 3068 3070, 3072, 3074,3076 3078 3080, 3082, 3084 3086 3088, 3090 3092 3094 3096 3098, 3100, 3102,3104,3106,3108,3110,3112,3114,3116,3118,3120,3122,3124,3126 3128,3130,3132,3134,3136,3138, 3140, 3142, 3144, 3146, 3148, 3150, 3152, 3154, 3156,3158 3160, 3162, 3164,3166,3168, 3170 3172 3174, 3176, -78- WO 2005/111066 PCT/IB2005/001775 3178, 3180, 3182, 3184, 3186, 3188, 3190, 3192,3194,3196,3198, 3200, 3202, 3204, 3206, 3208, 3210, 3212, 3214, 3216, 3218,3220, 3222, 3224,3226, 3228, 3230,3232 3234,3236, 3238, 3240, 3242 3244 3246, 3248, 3250, 3252, 3254, 3256, 32:>8, 3260, 3262,3264, 3266, 3268,3270, 3272, 3274, 3276, 3278, 3280, 3282, 3284, 3286 3288, 3290, 3292, 3294, 3296, 3298, 3300, 3302, 3304, 3306, 3308, 3310, 3312, 3314, 3316, 3318, 3320, 3322, 3324, 3326, 3328, 3330, 3332, 3334, 3336, 3338, 3340, 3342, 3344,3346, 3348, 3350, 3352, 3354, 3356, 3358, 3360, 3362, 3364, 3366, 3368, 3370, 3372, 3374, 3376,3378, 3380, 3382, 3384, 3386, 3388, 3390, 3392 3394, 3396, 3398, 3400,3402,3404, 3406, 3408,3410, 3412, 3414, 3416, 3418, 3420, 3422,3424,3426, 3428 3430, 3432, 3434, 3436, 3438, 3440 3442 3444, 3446, 3448, 3450, 3452, 3454, 3456, 3458, 3460, 3462, 3464, 3466, 3468, 3470,3472, 3474, 3476, 3478, 3480, 3482 3484 3486 3488 3490 3492, 3494 3496, 3498, 3500, 3502, 3504, 3506, 3508, 3510, 3512, 3514, 3516, 3518, 3520, 3522, 3524, 3526, 3528, 3530, 3532,3534, 3536,3538, 3540, 3542, 3544, 3546, 3548, 3550, 3552, 3554, 3556, 3558, 3560, 3562, 3564, 3566, 3568 3570 3572 3574 3576 3578, 3580 3582, 3584 3586, 3588, 3590,3592, 3594, 3596, 3598, 3600, 3602, 3604, 3606, 3608, 3610, 3612,3614, 3616, 3618, 3620, 3622,3624, 3626, 3628, 3630,3632, 3634, 3636, 3638,3640, 3642, 3644, 3646, 3648, 3650, 3652, 3654, 3656, 3658, 3660, 3662, 3664,3666, 3668, 3670, 3672, 3674, 3676, 3678 3680, 3682, 3684, 3686, 3688, 3690, 3692, 3694 3696 3698,3700 3702, 3704, 3706, 3708, 3710 3712 3714 3716, 3718 3720, 3722, 3724, 3726, 3728, 3730, 3732, 3734, 3736,3738, 3740, 3742, 3744, 3746, 3748, 3750 3752, 3754 3756 3758, 3760 3762, 3764, 3766, 3768, 3770 3772, 3774, 3776, 3778, 3780, 3782, 3784, 3786, 3788, 3790, 3792, 3794, 3796, 3798, 3800, 3802, 3804, 3806, 3808, 3810, 3812, 3814, 3816, 3818, 3820,3822, 3824, 3826, 3828, 3830, 3832, 3834, 3836, 3838, 3840, 3842, 3844, 3846, 3848,3850, 3852, 3854, 3856, 3858, 3860, 3862, 3864, 3866 3868, 3870, 3872, 3874, 3876, 3878,3880, 3882, 3884 3886 3888 3890, 3892, 3894 3896,3898, 3900, 3902, 3904, 3906, 3908, 3910, 3912, 3914, 3916,3918, 3920, 3922, 3924,3926, 3928, 3930, 3932, 3934, 3936, 3938, 3940, 3942, 3944, 3946, 3948, 3950, 3952, 3954, 3956,3958, 3960, 3962, 3964, 3966 3968, 3970, 3972, 3974 3976, 3978, 3980, 3982 3984 3986, 3988 3990 3992, 3994,3996,3998, 4000 4002, 4004, 4006, 4008, 4010, 4012 4014, 4016, 4018, 4020, 4022, 4024 4026 4028 4030 4032 4034, 4036, 4038, 4040, 4042, 4044, 4046, 4048, 4050, 4052, 4054, 4056, 4058, 4060, 4062, 4064,4066,4068, 4070, 4072, 4074, 4076, 4078, 4080, 4082, 4084, 4086, 4088, 4090,4092,4094,4096, 4098, 4100, 410?, 4104, 4106, 4108,4110 4112,4114 4116 4118 4120,4122 4124,4126 4128, 4130, 4132, 4134, 4136 4138, 4140, 4142, 4144, 4146,4148, 4150, 4152, 4154, 4156 4158, 4160, 4162, 4164, 4166, 4168,4170 4172, 4174, 4176 4178,4180, 4182, 4184,4186, 4188, 4190, 4192, 4194,4196, 4198,4200, 4202, 4204 4206,4208, 4210, 4212, 4214, 4216, 4218, 4220, 4222, 4224, 4226, 4228, 4230, 4232, 4234, 4236, 4238, 4240, 4242, 4244, 4246, 4248, 4250, 4252, 4254, 4256, 4258, 4260, 4262, 4264, 4266, 4268, 4270, 4272, 4274 4276, 4278, 4280, 4282, 4284 4286 4288, 4290, 4292,4294,4296, 4298, 4300, 4302, 4304, 4306, 4308 4310, 4312,4314, 4316, 4318, 4320 4322 4324 4326 4328 4330, 4332, 4334, 4336, 4338, 4340, 4342, 4344, 4346, 4348, 4350, 4352, 4354, 4356, 4358, 4360 4362, 4364, 4366, 4368, 4370,4372, 4374 4376, 4378, 4380,4382, 4384, 4386 4388,4390 4392 4394,4396,4398,4400 4402 4404 4406,4408 4410 4412,4414 4416,4418,4420 4422 4424 4426,4428,4430 4432, 4434, 4436,4438, 4440, 4442, 4444, 4446,4448, 4450, 4452, 4454 4456 4458, 4460, 4462, 4464, 4466, 4468, 4470, 4472, 4474 4476, 4478, 4480 4482, 4484, 4486, 4488, 4490, 4492, 4494,4496, 4498, 4500, 4502, 4504, 4506, 4508, 4510,4512,4514, 4516, 4518, 4520, 4522 4524, 4526, 4528, 4530, 4532, 4534, 4536, 4538 4540,4542, 4544 4546, 4548, 4550, 4552, 4554, 4556 4558, 4560 4562 4564 4566 4568 4570 4572, 4574, 4576, 4578,4^80, 4582, 4584, 4586 4588 4590, 4592, 4594, 4596 4598 4600, 4602 4604 4606 4608 4610, 4612, 4614 4616, 4618 4620, 4622 4624,4626,4628,4630, 4632, 4634 4636, 4638,4640 4642, 4644, 4646, 4648,4650, 4652, 4654,4656, 4658, 4660 4662, 4664, 4666, 4668, 4670, 4672, 4674, 4676, 4678, 4680, 4682, 4684, 4686, 4688 4690, 4692, 4694, 4696 -79- PCT7IB2005/001775 4698, 4700, 4702 4704, 4706 4708, 4710,4712, 4714, 4716, 4718, 4720, 4722, 4724, 4726, 4728,4730, 4732, 4734, 4736, 4738, 4740 4742, 4744, 4746, 4748, 4750, 4752, 4754, 4756, 4758, 4760, 4762 4764 4766, 4768, 4770, 4772, 4774, 4776, 4778, 4780, 4782, 4784, 4786, 4788, 4790,4792, 4794, 4796, 4798, 4800, 4802, 4804 4806, 4808, 4810, 4812, 4814, 4816 4818 4820 4822, 4824 4826, 4828 4830 4832 4834, 4836 4838 4840 4842, 4844 4846, 4848, 4850, 4852, 4854 4856, 4858, 4860 4862, 4864, 4866, 4868, 4870, 4872, 4874, 4876, 4878, 4880, 4882, 4884, 4886, 4888, 4890, 4892, 4894, 4896, 4898, 4900, 4902,4904, 4906, 4908, 4910, 4912, 4914, 4916, 4918, 4920, 4922, 4924, 4926, 4928, 4930, 4932, 4934, 4936, 4938, 4940, 4942, 4944, 4946, 4948, 4950, 4952, 4954, 4956, 4958, 4960, 4962 4964, 4966, 4968 4970 4972, 4974, 4976, 4978, 4980, 4982, 4984, 4986, 4988, 4990, 4992, 4994, 4996, 49% 5000, 5002, 5004 5006, 5008 5010 5012, 5014, 5016, 5018, 5020, 5022, 5024, 5026, 5028, 5030, 5032, 5034, 5036, 5038, 5040, 5042, 5044, 5046, 5048, 5050, 5052, 5054, 5056, 5058, 5060, 5062 5064, 5066 5068, 5070 5072, 5074, 5076 5078,5080,5088,5089,5090,5091,5092,5093 5094 & 5095 2 The polypeptide of claim 1 comprising one or more of amino acid sequences SEQ ID NOS 2,4 6,8,10,12, 14,16,18, 20,22,24,26,28,30, 32,34,36,38,40,42,44 46,48,50,52,54,56, 58,60,62,64,66,68,70,72,74,76,78 80 82 84, 86 88 90 92 94 96 98 100 102,104 106 108 HO, 112 114 116 118, !20,122 124 126 128 130 132 134, 136,138,140,142,144 146,148, 150 152,154 b6, 158 160,162 164,166 168,170,172 174,176,178,180, 182, 184, 186,188, 190, 192, 194, 196, 198, 200, 202,204 206 208,210,212, 214,216,218,220,222,224,226, 228, 230 232,234,236, 238, 240,242, 244, 246, 248 250,252 254,256,258,260 262,264,266,268 270,272,274,276,278, 280 282 284 286 288 290, 292, 294, 296, 298, 300, 302, 304, 306, 308 310, 312, 314 316 318, 320, 322, 324, 326, 328, 330, 332, 334 336, 338 340 342 344, 346 348 350 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378,380, 382,384,386,388,390, 392, 394,396,398, 400, 402,404,406,408, 410,412,414 416,418,420,422, 424,426,428, 430,432,434,436,438 440,442 444,446, 448, 450,452, 454 456,458,460,462,464,466, 468,470, 472 474,476,478,480 482 484,486, 488,490 492, 494, 496,498 500 502 504, 506, 508,510,512,514,516, 518, 520,522,524,526, 528, 530, 532, 534, 536,538, 540,542 544 546,548,550, 552, 554, 556, 55S, 560, 562,564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 5S4,586, 588, 590 592,594, 596,598, 600 602,604, 606 608, 610 612 614 616, 618, 620 622, 624, 626 628 630; 632, 634 636, 638 640, 642, 644 646, 648 650 652, 654 656,658, 660 662 664, 666,668, 670,672,674,676, 678, 680 682,684, 686, 688, 690, 692, 694 696 698, 700,702,704,706,708, 710, 712, 714,716, 718, 720, 722,724, 726,728, 730,732 734 736, 738, 740,742,744,746,748,750,752,754 756 758, 760, 762, 764, 766, 768, 770, 772, 774, 776,778 780, 782, 784, 786, 788 790, 792, 794 796, 798 800, 802 804, 806 808, 810, 812,814, 816, 818, 820, 822, 824,826, 828,830, 832, 834 836, 838 840, 842, 844 846,848 850, 852 854, 856 858 860 862, 864, 866, 86S, 870, 872, 874 876 878 880, 882,884,886, 888, 890 892, 894, 896, 898, 900,902 904,906,908,910 912 914,916, 918,920,922,924 926, 928,930,932 934, 936, 938, 940, 942,944,946 948 950, 952,954,956, 958, 960,962,964, 966,968,970 972 974, 976, 978,980 982, 984, 986, 988,990,992 994 996,998 1000, 1002, 1004, 1006, 1008, 1010, 1012 1014, 1016, 1018, 1020, 1022 1024, 1026 1028 1030 1032, 1034 1036, 1038 1040 1042 1044 1046 1048, 1050 1052 1054, 1056 1058 1060, 1062, 1064, 1066 1068, 1070, 1072, 1074 1076, 1078 1080, 1082, 1084, 1086, 1088 1090, 1092, 1094, 1096, 1098, 1100, 1102, 1104, 1106, 1108, 1110, 1112 1114,1116 1118,1120,1122,1124,1126,1128,1130,1132 1134,1136 1138 1140,1142,1144,1146,1148,1130 1152,1154,1156,1158 1160 1162,1164,1166,1168,1170,1172,1174 1176 1178 1180,1182,1184,1186 1188, 1190, 1192, 1194, 1196, 1198 1200 1202, 1204 1206, 1208 1210 1212 1214, 1216 1218, 1220, 1222, 1224,1226, 1228, 1230, 1232, 1234, 1236 1238, 1240, 1242, 1244, 1246, 1248, 1250, 1252, 1254, 1256, 1258, 1260, 1262,1264 1266,1268 1270 1272 1274 1276 1278 1280 1282 1284 1286 1288 1290,1292,1294 1296 1298 1300,3302 80- WO 2005/111066 PCT/IB2005/001775 1304,1306, 1308,1310, 1312, 1314,1316,1318,1320, 1322,1324,1326,1328, 1330,1332, 1334, 1336,1338, 1340, 1342, 1344, 1346 1348, 1350, 1352 1354, 1356, 1358, 1360, 1362, 1364, 1366 I36S, 1370, 1372 1374, 1376, 1378, 1380 1382, 1384, 1386, 1388, 1390 1392, 1394, 1396, 1398, 1400 1402, 1404 1406, 1408, 1410, 1412,1414, 1416 1418,1420,1422,1424, 1426,1428,1430, 1432, 1434,1436,1438,1440, 1442, 1444,1446,1448, 1450,1452, 1454, 1456, 1458, 1460, 1462, 1464, 1466, 1468, 1470, 1472, 1474, 1476, 1478, 1480, 1482, 1484, 1486, 1488, 1490 1492 1494, 1496, 1498, 1500, 1502,1504, 1506, 1508,1510, 1512,1514,1516 1518, 1520, 1522, b24, 1526,1528, 1530, 1532, 1534,1536 1538, 1540, 1542,1544, 1546,1548,1550,1552,1554, 1556, 1558,1560, b62,1564,1566,1568, 1570, 1572, 1574, 1576, 1578, 1580,1582, 1584,1586, 1588, 1590, 1592, 1594, 1596 1598, 1600, 1602, 1604, 1606, 1608,1610, 1612, 1634, 1616, 1618, 1620 1622 1624, 1626, 1628,1630, 1632 1634 1636 1638 1640 1642, 1644 1646, 1648, 1650, 1652, 1654, 1656, 1658, 1660 3662, 1664,1666, 1668, 1670 1672,1674,1676, 1678,1680 1682, 1684, 1686, 1688, 1690, 1692, 1694, 1696, 1698, 1700, 1702, 1704, 1706, 1708, 1710,1712, 1714 1716,1718, 1720, 1722, 1724 1726, 1728 1730, 1732, 1734, 1736,1738 1740, 1742,1744, 1746, 1748,1750, 1752, 1734,1756, 1758, 1760, 1762, 1764, 1766, 1768, 1770, 1772, 1774 1776, 1778 1780 1782 1784 1786 1788 1790, 1792,1794, 1796, 1798 1800, 1802 1804 1806 1808 1810 1812 1814 1816 1818 1820 1822 1824, 1826 1828 1830 1832 1834 1836, 1838, 1840, 1842, 1844 1846 1848, 1850 1852, 1854, 1856, 1858 I860, 1862, 1864, 1866 1868, 1870, 1872 1874, 1876, 1878, 1880, 1882, 1884, 1886, 1888, 1890, 1892, 1894, 1896, 1898, 1900, 1902,1904, 1906, 1908, 1910, 1912, 1914, 1916, 1918, 1920, 1922, 1924, 1926, 1928, 1930, 1932, 1934, 1936 1938, 1940, 1942, 1944, 1946 I94S 1950 1952 1954, 1956, 1958, 1960, 1962, 1964 1966 1968, 1970, 1972,1974, 1976,1978,1980, 1982,1984, 1986, 1988 1990 1992, 1994, 1996, 1998 2000 2002, 2004, 2006, 2008 2010, 2012, 2014, 2016, 2018, 2020, 2022, 2024, 2026, 2028, 2030, 2032 2034, 2036, 2038, 2040, 2042, 2044, 2046, 2048, 2050, 2052, 2054, 2056 2058 2060, 2062, 2064 2066 2068, 2070, 2072, 2074 2076 2078 2080 2082 2084 2086 2088, 2090, 2092 2094 2096 2098 2100 2102,2104,2106,2108,2130 2112 2114,2116 2118 2120,2122 2124 2126,2128,2130,2132 2134,2136 2138, 2140, 2142, 2144, 2146, 2148, 2150, 2152, 2154 2156, 2158, 2160,2162,2164, 2166, 2168, 2170 2172, 2174,2176, 2178, 2180, 2182, 2184, 2186, 2188 2190, 2192,2194 2196 2198, 2200 2202, 2204, 2206, 2208 2210, 2212, 2214, 2216, 2218 2220 2222 2224 2226 2228 2230, 2232 2234 2236, 2238 2240 2242 2244 2246 2248 2250 2252 2254 2256, 2258 2260 2262 2264 2266 2268, 2270 2272 2274, 2276 2278, 2280, 2282, 2284 2286, 2288 2290, 2292, 2294, 2296, 2298, 2300, 2302, 2304, 2306, 2308,2310, 2312, 2314, 2316, 2318, 2320, 2322 2324, 2326 2328 2330, 2332, 2334, 2336, 2338, 2340, 2342, 2344, 2346, 2348, 2350, 2352, 2354, 2356, 2358, 2360 2362, 2364 2366, 2368 2370 2372,2374 2376 2378,2380,2382,2384 2386,2388,2390,2392,2394,2396,2398 2400,2402,2404, 2406, 2408, 2410, 2412, 2414, 2416, 2418, 2420, 2422, 2424, 2426, 2428, 2430, 2432, 2434, 2436, 2438, 2440, 2442, 2444, 2446, 2448 2450, 2452 2454, 2456, 2458, 2460, 2462, 2464, 2466, 2468, 2470, 2472, 2474, 2476 2478 2480 2482, 2484, 2486, 2488, 2490, 2492 2494, 2496, 2498, 2500, 2502 2504, 2506, 2508, 2510 2512 2514, 2516, 2518, 2320, 2522, 2524, 2526, 2528 2530, 2532, 2534, 2536, 2538, 2540, 2542, 2544, 2546, 2548, 2550 2552, 2554, 2556, 2558 2560 2562, 2564 2566 2568, 2570, 2572 2574, 2576, 2578 2580, 2582, 2584, 2586, 2588, 2590, 2592, 2594, 2596, 2598, 2600, 2602, 2604, 2606, 2608, 2610, 2612, 2614, 2616, 2618, 2620, 2622, 2624, 2626, 2628, 2630, 2632, 2634, 2636, 2638 2640, 2642 2644, 2646 2648 2650 2652 2654 2656 2658 2660 2662, 2664 2666, 2668 2670 2672, 2674, 2676, 2678, 2680 2682, 2684, 2686, 2688 2690, 2692, 2694, 2696, 2698, 2700 2702, 2704, 2706 2708 2710, 2712 2714, 2716 2718, 2720, 2722, 2724, 2726,2728 2730 2732, 2734, 2736, 2738, 2740 2742, 2744, 2746, 2748, 2750, 2752, 2754, 2756, 2758, 2760, 2762, 2764, 2766, 2768, 2770, 2772,2774, 2776, 2778, 2780, 2782, 2784, 2786 2788, 2790 2792 2794 2796 2798 2800 2802 2804 2806 2808 2810 2812 2814, 2816 2818 2820 2822 81- WO 2005/111066 PCT/IB2005/001775 2824, 2826,2828, 2830, 2832, 2834, 2836, 2838, 2840, 2842, 2844, 2846, 2848, 2850, 2852,2854, 2856, 2858, 2860, 2862, 2864, 2866, 2868, 2870, 2872, 2874, 2876, 2878, 2880, 2882, 2884 2886, 2888 2890 2892, 2894 2896 2898, 2900, 2902, 2904, 2906, 2908, 2910, 2912, 2914 2916 2918 2920 2922, 2924 2926, 2928, 2930, 2932, 2934 2936, 2938, 2940, 2942, 2944, 2946, 2948, 2950,2952, 2954, 2956, 2958, 2960, 2962,2964, 2966, 2968, 2970, 2972,2974, 2976 2978,2980, 2982, 2984, 2986, 2988,2990, 2992, 2994, 2996, 2998,3000,3002, 3004, 3006,3008,3010, 3012, 3014, 3016, 3018, 3020,3022, 3024, 3026 3028, 3030 3032, 3034 3036,3038,3040, 3042, 3044, 3046,3048,3050 3052, 3054 3056, 3058,3060, 3062 3064,3066, 3068, 3070, 3072, 3074,3076 3078 3080, 3082, 3084, 3086, 3088, 3090, 3092, 3094, 3096,3098,3100,3302,3104, 3106, 3108, 3110, 3112,3114,3116, 3118, 3120, 3122, 3124,3126, 3128, 3130, 3132,3134,3136,3138, 3140,3142, 3144, 3146,3148, 3150, 3152, 3154, 3156, 3158, 3160 3162, 3164, 3166, 3168, 3170, 3172,3174,3176, 3178,3180,3182,3184, 3186, 3188,3190, 3192, 3194, 3196 3198, 3200, 3202, 3204,3206,3208, 3210,3212,3214, 3216,3218 3220,3222, 3224, 3226,3228,3230,3232, 3234, 3236, 3238,3240, 3242 3244 3246, 3248 3250 3252, 3254,3256, 3258,3260, 3262, 3264,3266,3268,3270, 3272, 3274, 3276, 3278, 3280, 3282, 3284,3286, 3288, 3290, 3292, 3294, 3296, 3298, 3300, 3302,3304,3306, 3308, 3310, 3312, 3314, 3316, 3318, 3320,3322, 3324, 3326, 3328, 3330,3332,3334, 3336, 3338 3340, 3342 3344, 3346, 3348 3350 3352, 33^4 3356, 3358, 3360, 3362, 3364, 3366, 3368, 3370, 3372, 3374, 3376, 3378, 3380, 3382, 3384, 3386, 3388, 3390, 3392, 3394, 3396, 3398,3400, 3402,3404 3406 3408, 3410,3412, 3414, 3416, 3418, 3420,3422, 3424,3426, 3428 3430, 3432, 3434, 3436, 3438, 3440, 3442,3444,3446, 3448, 3450, 3452, 3454, 3456, 3458,3460,3462,3464, 3466 3468, 3470, 3472,3474, 3476, 3478, 3480, 3482, 3484 3486 3488, 3490, 3492 3494,3496,3498,3500, 3502,3504 3506, 3508,3510,3512, 3514, 3516 3518, 35J0, 3522,3524, 3526 3528, 3530,3532,3534,3536,3538, 3540, 3542 3544, 3346 3548, 3550, 3552, 3554, 3556, 3558,3560,3562, 3564, 3566,3568,3570,3572,3574,3576, 3578 3580 3582, 3584, 3586, 3588, 3590 3592, 3594, 3596, 3598 3600 3602, 3604, 3606 3608, 3610 3612, 3614 3616 3618 3620, 3622 3624,3626, 3628, 3630 3632, 3634,3636 3638 3640, 3642, 3644,3646,3648,3650, 3652, 3654,3656 3658, 3660 3662 3664 3666 3668, 3670, 3672,3674 3676, 3678, 3680 3682,3684,3686,3688,3690, 3692, 3694, 3696, 3698,3700, 3702, 3704 3706 3708, 3710, 3712, 3714,3716, 3718, 3720,3722,3724,3726, 3728,3730 3732, 3734, 3736, 37J8, 3740, 3742,3744, 3746, 3748, 3750, 3752, 3754 3756, 3758, 3760,3762,3764, 3766 3768, 3770, 3772, 3774 3776,3778, 3780 3782, 3784 3736, 3788,3790 3792, 3794, 3796 3798,3800,3802, 3804,3806,3808, 3810, 3812,3814, 3816,3818,3820, 3822 3824, 3826, 3828, 3830, 3832, 3834, 3836,3838, 3840, 3842,3844 3846, 3848, 3850, 3852, 3854, 3856, 3858, 3860, 3862, 3864, 3866, 3868, 3870, 3872 3874 3876 3878 3880, 3882 3884 3886 3888,3890,3892,3894 3896,3898 3900,3902 3904,3906 3908,3910 3912,3914 3916 3918,3920,3922,3924, 3926 3928,3930, 3932, 3934 3936, 3938 3940 3942 3944 3946 3948 3950 3952 3954, 3956 3958, 3960, 3962, 3964, 3966, 3968, 3970 3972, 3974, 3976, 3978, 3980, 3982, 3984, 3986, 3988, 3990, 3992, 3994 3996, 399S 4000 4002, 4004,4006 4008, 4010, 4012, 4014,4016,4018, 4020, 4022,4024, 4026, 4028, 4030, 4032, 4034 4036 4038, 4040, 4042, 4044, 4046, 4048, 4050, 4052, 4054, 40^6 4058, 4060, 4062, 4064, 4066, 4068, 4070 4072, 4074, 4076, 4078,4080,4082,4084 4086,4088 4090,4092,4094 4096 4098 4100 4102,4104,4106,4108 4110,4112,4114, 4116, 4118, 4120, 4122, 4124, 4126, 4128, 4130,4132, 4134, 4136, 4138, 4140, 4142, 4144, 4146 4148, 4150, 4152, 4154, 4156, 4158, 4160, 4162, 4164, 4166,4168,4170, 4172,4174, 4176, 4178, 4180, 4182, 4184 4186, 4188 4190, 4192,4194,4196 4198 4200,4202 4204,4206 4208 4210,4212,4214 4216,4218 4220,4222 4224,4226 4228, 4230 4232, 4234, 4236 4238 4240 4242 4244 4246 4248, 42DO 4252 4254, 4256 4258 4260 4262 4264, 4266, 4268 4270, 4272, 4274, 4276 4278 4280, 4282, 4284, 4286, 4288, 4290 4292, 4294 4296, 4298 4300, 4302, 4304, 4306, 4308, 4310, 4312, 4314, 4316, 4318, 4320, 4322, 4324, 4326, 4328 4330, 4332 4334 4336, 4338 4340 4342, -82- WO 2005/111066 PCT/IB2005/001775 4344, 4346,4348,4350, 4352, 4354, 4356,4358, 4360, 4362, 4364, 4366, 4368 4370, 4372, 4374, 4376 4378, 4380, 4382, 4384, 4386,4388, 4390, 4392 4394 4396, 4398, 4400, 4402, 4404,4406,4408, 4410, 4412, 4414, 4416, 4418, 4420, 4422, 4424, 4426, 4428,4430, 4432,4434,4436, 4438, 4440, 4442, 4444, 4446, 4448, 4450, 4452, 4454, 4456, 4458, 4460, 4462, 4464, 4466, 4468, 4470,4472, 4474,4476, 4478, 4480,4482, 4484, 4486, 4488, 4490, 4492,4494, 4496,4498 4500 4502 4504,4506 4508 4510,4512,4514 4516 4518 4520,4522,4524 4526,4528,4530 4532 4534, 4536, 4538, 4540 4542 4544,4546 4548, 4550 4552, 4554, 4556, 4558, 4560, 4562, 4564, 4566, 4568,4570 4572, 4574, 4576,4578, 4580, 4582,4584,4586,4588, 4590, 4592, 4594, 4596,4598, 4600, 4602, 4604, 4606,4608, 4610, 4612, 4614, 4616, 4618, 4620, 4622, 4624, 4626, 4628, 4630, 4632, 4634, 4636, 4638, 4640, 4642, 4644, 4646, 4648, 4650, 4652 4654, 4656, 4658, 4660 4662, 4664, 4666, 4668, 4670, 4672, 4674, 4676, 4678 4680, 4682,46S4, 4686 4688, 4690, 4692, 4694,4696 4698 4700,4702 4704, 4706 4708, 4710,4712, 4714, 4716, 4718 4720 4722, 4724, 4726, 4728 4730, 4732,4734, 4736,4738, 4740 4742, 4744, 4746, 4748, 4750, 4752, 4754, 4756, 4758,4760 4762, 4764, 4766,4768, 4770, 4772,4774,4776, 4778 4780, 4782, 4784, 4786,4788, 4790,4792 4794,4796, 4798, 4800, 4802, 4804,4806, 4808, 4810, 4812, 4814, 4816, 4818, 4820, 4822, 4824, 4826, 4828, 4830, 4832, 4834, 4836 4838, 4840 4842 4844 4846 4848 4850 4852, 4854 4856, 4858, 4860, 4862 4864 4866, 4868, 4870, 4872, 4874 4876, 4878, 4880, 4882, 4884, 4886, 48S8, 4890, 4892, 4894, 4896, 4898, 4900, 4902, 4904, 4906, 4908, 4910, 4912, 4914, 4916, 4918, 4920, 4922 4924 4926 4928, 4930 4932, 4934 4936 4938 4940, 4942 4944 4946 4948 4950 4952, 4954 4956,4958, 4960, 4962, 4964, 4966, 4968, 4970 4972, 4974, 4976, 4978,4980, 4982, 4984, 4986, 4988 4990, 4992, 4994, 4996, 4998, 5000, 5002, 5004, 5006, 5008, 5010, 5012, 5014, 5016, 5018, 5020, 5022, 5024, 5026, 5028, 5030, 5032, 5034, 5036, 5038, 5040, 5042, 5044, 5046, 5048, 5050, 5052, 5054, 5056, 5058, 5060, 5062 5064 5066 5068 5070 5072 5074 5076 5078 5080 5088 5089, 5090,5091 5092 5093 5094 & 5095 3 A poiypcptide comprising a fragment of at least 7 consecutive amino acids from one or more of SEQ ID KOS 1566, 5095,1570 5094,1574, 5903,1578,5092,2,4, 6, 8,10,12,14,16,18,20,22,24,26, 28 30,32,34,36,38,40,42,44, 46, 48 50 52,54, 56, 38, 60, 62,64,66,68 70,72,74,76,78,80,82 84 86 88 90,92 94,96 98,100,102, 104, 106 308 110 112 114,116 118,120 122 \% 126,128,130,132,134,136,138,140,142,144 146,148,150 152 154, 156,158 160, 162, 164, 166, 168 170, 172 174 176,178 180, 182, 384, 186, 188, 190, 192, 194, 196, 198,200,202 204,206,208 210 212,214,216,218 220 222,224,226 228 230,232,234,236 238 240,242,244 246 248,250 252, 254, 256, 258 260 262 264 266 268 270,272 274 276 278,280 282,284,286 288,290,292 294 296 298 300, 302,304, 306, 308, 310,312,314 316 318 320,322, 324,326,328 330,332,334,336, 3J8, 340,342,344 346, 348, 350,352, 354, 356, 358,360, 362,364 366,368,370, 372,374,376,378,380,382,384,386,388,390, 392,394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414 416, 418, 420, 422, 424, 426, 428, 430, 432 434,436 43S 440, 442 444 446 448, 450 452 454 456 458 460 462,464,466 468 470 472 474, 476, 478,480, 482 484 486,488,490 492, 494,496 498,500,502 504, 506 508 510 512,514 516 518, 520,522, 524, 526, 528, 530,532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552,554, 5:>6 558,560,562, 564, 566, 568, 570,572,574, 576,578, 580, 582, 584,586, 588, 590, 592, 594, 596, 598, 600 602, 604, 606, 608,610, 612,614,616 618, 620,622, 624, 626,628,630, 632, 634, 636, 638, 640 642 644, 646, 648, 650, 652, 654, 656 658, 660, 662 664, 666,668 670, 672 674,676,678, 680 682 684 686 688 690, 692, 694 696, 698 700, 702 704 706,708 710 712, 714,716 718,720 722, 724,726, 728,730, 732, 734, 736, 738, 740, 742, 744, 746 748, 750, 752,754, 756, 758,760,762,764,766, 768,770,772,774,776,778, 780, 782, 784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810 812, S14, 816, 818, 820, 822, 824, 826, 828 830 832, 834 S36 838 840, 842, 844, 846 848 850 852, 854 856, 858, 860, 862,864, 866 868, 870 872, 874, 876 878,880, 882 884, 886,888 890, 892 894 896 898 900 902 904, 906 908, 910 912,914, 916,918,920, 922 -83- WO200V111066 PCT/IB2005/001775 924,926,928,930,932,934, 936, 938,940, 942,944,946, 948,950,952,954 956, 958 960 962 964, 966, 968, 970, 972,974, 976,978, 980, 982, 984, 986, 988,990,992,994, 996,998,1000 1002,1004,1006,1008,1010,1012,1014, 1016 1018 1020 1022 1024 1026 1028,1030,1032,1034,1036, 1038, 1040, 1042, 1044, 1046,1048,1050,1052, 1054, 1056, 1058, 1060, 1062, 1064, 3066, 1068, 1070, 1072, 1074, 1076, 1078, 1080, 1082 1084, 1086 1088, 1090 1092, 1094, 1096, 1098, 1100, 1102, 1104,1106, 1108 1110,1112 1114, 1116,1118 1120, 3122,1124,1126, 1128, 1130,1132,1134, 1136, 1138, 1140 1142,1144,1146 1148 1150,1152 1154,1156,1158 1160,1162, 1164, 1166, 1168 1170 1172, 1174 1176, 1178 1180 1182, 1184, 1186, 1188, 1190, 1192 1194, 1196, 1198, 1200, 1202, 1204 1206,1208,1210, 1212, 1214,1216,1218,1220, 1222, 1224,1226,1228,1230 1232,1234, 1236,1238 1240 1242, 1244, 1246, 1248, 1250, 1252, 1254, 1256,1258, 1260, 1262 1264, 1266, 1268, 1270, 1272, 1274, 1276, 1278 1280, 1282, 1284, 1286, 1288, 1290, 1292, 1294, 1296, 1298 1300, 1302, 1304 1306 1308, 1310, 1312, 1314, 1316, 1318, 1320, 1322, 1324, 1326 1328, 1330, 1332,1334, 1336 1338, 1340, 1342, 1344, 1346, 1348,1350, 1352, 1354,1356, 13^8, 1360, 1362, 1364, 1366, 1368, 1370, 1372, 1374 1376, 1378, 1380, 1382, 1384 1386 1388 1390 1392, 3394, 1396, 1398, 1400, 1402, 1404, 1406, 1408, 1410, 1412, 1414, 1416 1418, 1420, 1422 1424, 1426, 1428, 1430 1432, 1434,1436, 1438, 1440 1442 1444, 3446, 1448, 3450 1452, 1454, 1456, 1458, 1460, 1462, 1464, 1466, 1468 1470 1472,1474,1476, 1478, 3480, 1482,1484, 1486, 1488, 1490, 1492, 1494, 1496, 1498, 1500, 1502, 1504, 1506, 1508, 1510 1512 1514, 1516 1518, 1520, 1522, 1524, 1526 1528, 1530, 1532 1534, 1536 1538, 1540, 1542, 1544, 1546, 1548, 1550, 1552, 1554, 1556, 1558 1560, 1562 1564, 3566, 1568, 1570 1572,1574 1576, 1578 1580, 1582, 1584, 1586, 1588 1590, 1592 1594, 1596 1598, 1600, 1602, 1604, 1606, 1608, 1610, 1612, 1614, 1616, 1618, 1620, 3622, 1624, 1626 1628 1630,1632,1634,1636,1638,1640, 1642,1644, 1646,1648,1650 1652,1654, 1656 3658, 1660 1662, 1664, 1666, 1668, 1670, 1672, 1674, 1676, 1678, 1680, 1682, 3684, 1686, 1688, 1690, 1692, 1694 1696, 1698 1700, 1702, 1704, 1706, 1708, 1710, 3712, 3714 1716 1718, 1720 1722, 1724 3726, 1728, 1730, 1732 1734, 1736, 1738, 1740 1742 1744, 1746, 1748, 1750, 1752, 1754, 1756, 1758, 1760, 1762, 1764, 1766, 1768, 1770 1772, 1774, 1776 1778 1780 1782 1784 1786, 1788, 1790 1792, 1794 3796 1798 1800 3802 1804 1806 1808 1810 1812, 1814, 1816, 1818, 1820, 1822, 1824,1826 1828,1830, 1832,1834, 1836, 1838, 1840, 1842, 1844,1846, 1848,1850, 1852, 1854, 1856, 1858, I860, 1862, 1864, 3866, 1868, 1870, 1872, 3874, 1876, 1878, 1880, 1882, 1884, 1886, 1888, i890, 1892, 1894, 1896, 1898 1900 1902 1904, 1906 3908, 1910 1912, 1914, 1916, 1918, 1920, 1922, 1924, 1926 1928 1930, 1932, 1934, 1936, 1938, 1940, 3942, 1944, 1946, 1948, 1950, 19:>2, 1954, 1956, 3958, I960, 1962, 1964, 1966 3968, 1970, 1972, 1974, 1976, 1978 1980, 1982, 1984, 1986, 3988, 1990 1992, 1994 1996 1998,2000,2002, 2004 2006 2008 2010,2012,2014 2016 2018 2020,2022,2024,2026,2028,2030,2032,2034,2036 2038,2040, 2042, 2044 2046 2048, 2050, 2052 2054, 2056, 2058, 2060,2062,2064, 2066, 2068, 2070, 2072 2074, 2076 2078, 2080, 2082, 2084, 2086, 2088, 2090, 209?, 2094, 2096 2098 2100 2102 2104 2106,2108,2110,2112 2114 2116 2118,2120,2122,2124, 2126, 2128,2130 2132 2134 2136 2138 2140,2142,2144,2146,2148,2150,2152,2154, 2156, 2158 2360, 2162, 2164, 2166 2168, 2170, 2172, 2174 2176, 2178 2180, 2182, 2184, 2186, 2188, 2190, 2192 2194, 2196 2198, 2200, 2202 2204, 2206, 2208, 2210, 2212, 2214, 2216 2218, 2220, 2222, 2224 2226,2228 2230, 2232, 2234, 2236, 2238, 2240, 2242, 2244, 2246, 2248, 2250 2252, 2254, 2256, 2258, 2260, 2262, 2264, 2266 2268, 2270, 2272, 2274, 2276, 2278, 2280, 2282 2284, 2286 2288 2290, 2292, 2294 2296 2298 2300 2302, 2304, 2306, 2308, 2310, 2312, 2314, 2316, 2318, 2320, 2322 2324 2326, 2328, 2330, 2332 2334, 2336, 2338, 2340, 2342, 2344, 2346, 2348 2350 2352 2354 2356, 2358,2360, 2362, 2364, 2366 2368, 2370, 2372, 2374, 2376, 2378, 2380 2382, 2384,2386, 2388,2390, 2392, 2394, 2396, 2398, 2400, 2402,2404, 2406, 2408, 2410, 2432, 2414 2416, 2438 2420, 2422, 2424, 2426, 2428, 2430 2432, 2434, 2436, 2438 2440 2442, 2444 2446 2448 2450 2452 2454, 2456, 2458, 84- WO 2005/111066 PCT/IB2005/001775 2460, 2462, 2464 2466, 2468, 2470, 2472, 2474, 2476, 2478, 2480, 2482, 2484, 2486, 2488, 2490, 2492,2494, 2496, 2498, 2500, 2502, 2504, 2506, 2508, 2510, 2512, 2514, 2516, 2518, 2520 2522 2524,2526, 2528, 2530, 2532, 2534,' 2536, 2538, 2540 2542, 2544, 2546, 2548, 2550, 2552 2554, 2556, 2558,2560 2562 2564, 2566, 2568,2570 2572, 2574, 2576, 2578 2580, 2582, 2584, 2586 2588, 2590, 2592, 2594, 2596,2598, 2600 2602, 2604, 2606,2608, 2610, 2612, 2614, 2616 2618, 2620, 2622, 2624, 2626, 2628, 2630, 2632, 2634, 2636, 2638, 2640, 2642 2644,2646, 2648, 2650, 2652, 2654 2656, 2658, 2660 2662, 2664, 2666, 2668, 2670, 2672 2674,2676 2678 2680, 2682,2684, 2686, 2688, 2690, 2692, 2694, 2696 2G98, 2700, 2702, 2704, 2706, 2708, 2710,2712, 2714, 2716, 2718, 2720 2722, 2724, 2726, 2728, 2730 2732, 2734, 2736, 2738, 2740, 2742, 2744, 2746, 2748,2750, 2752,2754, 2756, 2758, 2760, 2762, 2764 2766, 2768 2770, 2772, 2774, 2776, 2778, 2780, 2782,2784, 2786, 2788, 2790, 2792, 2794,2796,2798, 2800 2801 2804,2806 2*08, 2810, 2812, 2814, 2816, 2818, 2820, 2822, 2824 2826 2828 2830, 2832,2834, 2836 2838 2840, 2842, 2844 2846, 2848, 2850, 2852, 2854 2856, 2858, 2860, 2862,2864, 2866,2868, 2870, 2872, 2874, 2876 2878 2880, 2882, 2884, 2886, 2888, 2890, 2892, 2894, 2896, 2898, 2900, 2902,2904,2906, 290S, 2910,2912, 2914, 2916 2918, 2920, 2922, 2924, 2926, 2928, 2930, 2932, 2934, 2936, 2938, 2940, 2942, 2944 2946 2948, 2950, 2952 2954 2956 2958, 2960, 2962, 2964, 2966 2968 2970 2972 2974 2976 2978 2980 2982 2984 2986,2988 2990 2992, 2994, 2996, 2998, 3000, 3002, 3004, 3006, 3008 3010 3012, 3014, 3016, 3018, 3020, 3022, 3024,3026, 3028, 3030, 3032, 3034, 3036, 3038, 3040, 3042, 3044, 3046, 3048, 3050, 3052, 3054, 3056, 3058, 3060, 3062, 3064, 3066, 3068, 3070, 3072, 3074, 3076, 3078 3080 3082, 3084 3086, 3088, 3090 3092, 3094 3096, 3098, 3100, 3102, 3104 3106, 3108,3110, 3112 3114 3116, 3118, 3120, 3122, 3124 3126, 3128, 3130, 3132 3134, 3136, 3138, 3140, 3142, 3144, 3146,3148 3150 3152 3154 3i56, 3158,3160, 3162, 3164, 3166, 3168, 3170, 3172, 3174, 3176, 3178 3180, 3182, 3184,3186, 3188, 3190, 3192, 3194, 3196, 3198, 3200, 3202, 3204,3206, 3208, 3210, 3212, 3214, 3216, 3218, 3220, 3222,3224, 3226, 3228, 3230, 3232,3234, 3236 3238, 3240,3242 3244 3246, 3248, 3250, 3252,3254 3256 3258, 3260, 3262, 3264, 3266, 3268, 3270, 3272, 3274, 3276, 3278, 3280, 3282, 3284 3286,3288, 3290, 3292 3294 3296, 3298, 3300, 3302, 3304, 3306, 3308, 3310, 3312, 3314, 3316, 3318, 3320, 3322, 3324, 3326, 3328, 3330, 3332, 3334, 3336,3338, 3340, 3342, 3344, 3346, 3348, 3350, 3352, 3354, 3356, 3358,3360, 3362, 3364, 3366 3368, 3370, 3372, 3374 3376, 3378, 3380 3382 3384, 3386, 3388, 3390 3392, 3394, 3396,3398, 3400, 3402, 3404,3406, 3408, 3410,3412,3414,3416 3418 3420 3422 3424,3426 3428 3430 3432,3434 3436,3438,3440,3442,3444,3446, 3448, 3450, 3452, 3454 3456, 3458, 3460, 3462, 3464, 3466, 3468, 3470, 3472,3474, 3476, 3478, 3480, 3482, 3484, 3486, 34SS, 3490, 3492, 3494, 3496 3498,3500,3502 3504 3506 3508,3510,3512 3514 3516,3518,3520,3522, 3524, 3526, 3528, 3530, 3532, 3534 3536, 3538, 3540, 3542 3544 3546, 3548 3550, 3552 3554, 3556 3558 3560 3562,3564,3566 3568, 3570 3572, 3574, 3576, 3578, 3580, 3582, 3584, 3586, 3588, 3590, 3592, 3594, 3596, 3598, 3600, 3602, 3604, 3606, 3608, 3610, 3612, 3614, 3616, 3618, 3620, 3622, 3624, 3626, 3628, 3630, 3632, 3634, 3636, 3638, 3640, 3642 3644 3646, 3648, 3650 3652, 3654, 3656 3658 3660 3662, 3664, 3666 3668 3670, 3672, 3674, 3676 3678 3680, 3682 3684 3686, 3688, 3690, 3692 3694 3696, 3698, 3700, 3702, 3704, 3706, 3708, 3710, 3712, 3714,3716,3718,3720, 3722 3724, 3726, 3728, 3730, 3732, 3734, 3736, 3738, 3740, 3742, 3744, 3746,3748, 3750, 3752, 3754,3756, 3758, 3760, 3762,3764, 3766, 3768, 3770, 3772, 3774, 3776, 3778, 3780, 3782, 3784, 3786, 3788, 3790, 3792, 3794, 3796, 3798 3800, 3802,3804 3806 3808, 3810 3812 3814, 38J6 3818, 3820, 3822, 3824, 3826, 3828 3830 3832 3834 3836 3838, 3840 3842 3844 3846 3848, 3850 3852 3854,3856 3858, 3860 3862, 3864 3866 3868 3870 3872 3874 3876 3878 3880 3882, 3884 3886 3888, 3890, 3892 3894, 3896, 3898, 3900, 3902, 3904, 3906, 3908 3910, 3912 3914, 3916, 3918, 3920, 3922, 3924, 3926,3928, 3930, 3932 3934, 3936 3938, 3940, 3942, 3944,3946,3948, 3950, 3952, 3954 3956, 3958, 3960 3962, 3964, 3966, 3968 3970, 3972, 3974, 3976 3978 -85- WO 2005/111066 PCT/IB2005/001775 3980, 3982, 3984, 3986, 3988, 3990, 3092, 3994, 3996, 3998, 4000, 4002,4004, 4006, 4008,4010, 4012, 4014, 4016, 4018, 4020, 4022, 4024, 4026, 4028, 4030, 4032, 4034, 4036, 4038, 4040, 4042, 4044, 4046, 4048, 4050, 4052, 4054, 4056, 4058, 4060, 4062, 4064, 4066, 4068,4070, 4072, 4074, 4076, 4078, 4080, 4082, 4084, 4086, 4088, 4090, 4092 4094, 4096, 4098, 4100, 4102, 4104, 4106, 4108, 4110, 4112, 4114 4116, 4118, 4120, 4122, 4124, 4126, 4128, 4130, 4132 4134, 4136, 4138, 4140, 4142, 4144, 4146, 4148, 4150, 4152, 4154,4156, 4158,4160, 4162, 4164, 4166, 4168 4170, 4172, 4174, 4176, 4178, 4180 4182, 4184, 4186 4188, 4190, 4192 4194,4196 4198, 4200, 4202, 4204, 4206 4208, 4210, 4212 4214 4216, 4218 4220,4222 4224, 4226, 4228, 4230, 4232,4234, 4236,4238, 4240, 4242, 4244, 4246, 4248, 4250, 4252, 4254, 4256, 4258 4260, 4262,4264, 4266, 4268, 4270, 4272, 4274, 4276, 4278, 4280, 4282, 4284, 4286 4288, 4290, 4292, 4294, 4296, 4298, 4300, 4302, 4304, 4306, 4308, 4310, 4312, 4314, 4316, 4318, 4320, 4322, 4324, 4326, 4328,4330, 4332, 4334, 4336, 4338, 4340, 4342, 4344, 4346,4348 4350, 4352, 4354, 4356, 4358, 4360, 4362, 4364,4366,4368, 4370, 4372,4374 4376 4378 4380 4382,4384, 4386, 4388,4390, 4392, 4394, 4396, 4398, 4400, 4402 4404,4406 4408, 4410 4412, 4414, 4416, 4418, 4420, 4422,4424, 4426, 4428, 4430, 4432, 4434, 4436, 4438, 4440, 4442, 4444, 4446, 4448, 4450, 4452, 4454, 4456, 4458, 4460, 4462, 4464, 4466, 4468 4470 4472, 4474,4476 4478 4480 4482,4484,4486,4488,4490 4492 4494 4496 4498 4500 4502 4504 4506 4508,4510 4512 4514 4516 4518 4520 4522 4524,4526 4528,4530,4532 4534 4536 4538 4540,4542,4544,4546,4548, 45^0 4552 4554 4556, 4558, 4560, 4562, 4564, 4566, 4568, 4570, 4572, 4574, 4576, 4578, 4580, 4582, 4584 4586, 4588, 4590, 4592,4594, 4596, 4598, 4600, 4602, 4604, 4606, 4608, 4610 4612, 4614, 4616, 4618, 4620, 4622, 4624, 4626, 4628, 4630,4632, 4634, 4636, 46^8,4640 4642, 4644, 4646, 4648, 4650, 4652, 4654, 4656, 4658, 4660, 4662, 4664, 4666, 4668,4670, 4672 4674, 4676 4678 4680, 4682, 4684 4686, 4688, 4690, 4692, 4694, 4696, 4698, 4700, 4702, 4704, 4706, 4708, 4710, 4712, 4714, 4716, 4718, 4720 4722, 4724, 4726, 4728, 4730, 4732, 4734, 4736 4738, 4740, 4742, 4744, 4746, 4748, 4750, 4752, 4754, 4756, 4758, 4760, 4762, 4764, 4766, 4768, 4770 4772, 4774, 4776, 4778 4780 4782 4784 4786, 4788 4790, 4792, 4794, 4796, 4798, 4800, 4802, 4804, 4806, 4808, 4810, 4812 4814, 4816 4818 4820, 4822, 4824, 4826, 4S28, 4830, 4832, 4834, 4836, 4838, 4S40, 4842, 4844, 4846, 4848, 4850 4852 4854, 4856, 4858, 4860, 4862, 4864, 4866, 4868, 4870, 4872, 4874, 4876, 4878, 4880, 4882, 4884 4886,4888 4890 4892,4894,4896,4898,4900,4902,4904 4906 4908 4910 4912 4914,4916 4918,4920,4922,4924 4926 4928 4930, 4932, 4934, 4936, 4938, 4940 4942, 4944, 4946, 4948, 4950 4952 49D4 4956, 4958 4960, 4962, 4964, 4966 4968, 4970, 4972 4974, 4976, 4978, 4980, 4982, 4984, 4986, 4988, 4990, 4992 4994, 4996, 4998,5000, 5002 5004, 5006, 5008, 5010, 5012, 5014, 5016, 5018, 5020, 5022, 5024, 3026 5028, 5030, 5032, 5034 5036, 5038, 5040, 5042, 5044 5046, 5048 5050 5052 5054, 5056, 5058 5060, 5062 5064 5066 5068, 5070 5072, 5074, 5076 5078, 5080, 5088,5089,5090,5091 5092,5093,5094 & 5095 4 The polypeptidc of claim 3, wherein the fragment comprises a T-cell or a B-cell epitope from the SEQ ID NO amino acid sequence 5 Antibody that binds to the polypeptidc of any preceding claim 6 Antibody of claim 5, wherein the antibodv is a monoclonal antibody 7 Nucleic acid comprising an nucleotide sequence that has at least 75% sequence identity to one or more of SEQ ID NOS 1565 1569, 1573, b77 1 3,5,7,9,11 13 15 17 19,21,23,25,27,29,31 33,35,37,39,41 43,45,47,49,51,53, 55,57,59,61,63,65,67 69,71,73 75,77,79 81,83 85,87,89 91,93,95 97 99, 101, 103,105, 107,109, 111 113, 115, 117, 119, 121, 123, 125, 127, 129 131 133, 135, 137, 139, 141, 143, 145, 147, 149 151,153 155 157 159 161, 163,165,167 169 171,173 i75 177 179 181,183 185 187 189 191,193 195 197, 199,201,203 205,207 209, -86- WO 2005/111066 PCT/IB2005/001775 211,213,215,217,219,221,223,225,227, 229,231,233,235,237,239,241,243,245, 247,249,251, 253,255,257, 259 261,263,265,267,269,271,273,275, 277,279,281,283,285,287, 289,291 293 295 297 299,301 303, 305, 307,309,311,313,315 317,319,321,323,325,327 329, 331,333, 335,337,339,341,343,345, 347,349, 351, 353, 355,357,359,361,363,365,367,369, 371,373,375,377, 379,381,383,385,387,389,391,393, 395,397,399, 401, 403,405,407,409,411,413,415,417,419,421,423, 425,427,429,431,433,435,437,439,441, 443,445 447, 449 451,453, 455,457 459,461,463,465,467 469,471,473,475,477,479 481,483,485,487,489 491,493,495, 497, 499,501, 503,505,507,509, 511, 513, 515, 517,519, 521, 523, 525, 527, 529,531,533, 535, 537, 539,541,543, 545, 547,549,551,553,555,557,559, 561, 563, 565,567, 569,571, 573,575, 577,579, 581,581, 585, 587, 589, 591, 593, 595,597,599,601,603,605,607, 609, 611,613,615, 617, 619, 621,623, 625 627, 629,631,633, 635, 637, 639, 641, 643,645, 647,649,651,653,655, 657,659,661, 663 665,667, 669,671, 673,675,677,679,681, 683 685, 687, 689, 691,693, 695,697,699 701,703,705 707,709,711, 713,715,717,719,721, 723,725,727,729, 731,733,735,737, 739,741,743,745,747,749,751, 753, 755,757,759, 761,763,765,767,769, 771,773,775,777 779, 781,783, 785, 787,789,791,793,795, 797,799, 801, 803,805 807, 809, 811, 813, 815 817, 819, 821, 823, 825, 827, 829, 831,833, 835, 837, 839, 841, 843,845, 847, 849, 851,853 855 857, 859, 861,863 865 867, 869, 871, 873, 875 877, 879,881, 883, 885, 887,889, 891,893, 895, 897,899,901,903, 905,907,909,911, 913,915, 917,919,921, 923,925, 927,929, 931, 933, 935, 937, 939, 941, 943, 945, 947, 949, 951, 953, 955, 957, 959, 961 963, 965 967, 969, 971 973 975, 977 979, 981, 983, 985, 987 989, 991, 993, 995, 997, 999, 1001, 1003, 1005, 1007, 1009, 1011, 1013 1015 1017, 1019, 1021, 1023, 1025, 1027, 1029, 1031,1033, 1035,1037, 1039,1041,1043, 1045,1047,1049, 1051, 1053, 1055,1057, 1059, 1061, 1063, 1065, 1067, 1069, 1071, 1073, 1075, 1077, 1079, 1081, 1083, 1085, 1087, 1089, 1091, 1093, 1095, 1097, 1099, 1101, 1103, 1105, 1107, 1109, 1111,1113, 1115 1117,1119, 1121,1123,1125, 1127 1129, 1131, 1133, 1135,1137,1139,1141 1143 1145,1147 1149,1151 1153,1155,1157 1159,1161 1163 1165,1167 1169 1171 1173, 1175, 1177 3179, 1181, 1183, 1185, 1187, 1189, 1191, 1193, 1195, 1197, 1199, 1201, 1203, 1205, 1207, 1209, 1211, 1213, 1215 1217, 1219, 1221, 1223, 1225, 1227, 1229, 1231, 1233, 1235, 1237, 1239, 1241, 1243, 1245, 1247, 1249, 1251,1253 1255 1257 1259, 1261, 1263 1265, 1267, 1269, 1271, 1273, 1275, 1277, 1279, 1281, 1283 1285 1287 1289 1291, 1293, 1295, 1297 1299, 1301 1303, 1305, 1307 1309 1311 1313 1315, 1317, 1319, 1321, 1323, 1325, 1327, 1329, 1331, 1333, 1335, H37, 1339, 1343, 1343, 1345, 1347, 1349, 1351, 1353, 1355, 1357, 1359, 1361, 1363, 1365,1367,1369, 1373, 1373, 1375, 1377, 1379, 1381, 1383,1385,1387, 1389,1391, 1393, 1395, 1397, 1399, 1401,1403,1405, 1407, 1409, 141], 1413,3415, 1417, 1419, 1421 1423 1425, 1427,1429, 1431,1433 1435, 1437, 3439, 1441, 1443, 1445, 1447, 1449, 1451, 1453, 1455, 1457, 1459, 1461, 1463, 1465, 1467, 1469, 1471, 1473, 1475, 1477, 1479, 3481, 1483, 1485, 1487/1489,1491, 1493, 1495, 1497, 1499, 1501, 1503, 1505, 1507, 1509, 1511, 1513, 1515, 1517, 1519, 3521, 1523, 1525, 1527, 1529, 1531 3533,1535, 1537, 1539, 3541 1543 1545, 3547, 3549, 1551, 1553, 1555,1557, 1559, 1561 1563 1565 1567, 1569, 1571 1573 1575 1577 1579 1581, 1583 1585 1587 1589 1591, 1593,1595, 1597, 1599,1601, 1603,1605, 1607, 3609, 1611, 1613, 1615, 1617, 1619, 1621, 1623 1625,1627, 1629 1631 1633, 1635, 1637, 1639, 1641, 1643, 1645, 1647, 1649, 1651, 1653, 1655, 1657, 1659, 1661, 1663, 1665 1667, 1669, 1671, 1673, 3675, 1677, 1679, 1681, 1683, 1685, 1687 1689 1691, 1693, 1695, 1697 1699, 1701, 1703, 1705 1707 1709 1711 1713,1715 1717 1719, 1721, 1723, 3725 1727 1729 1731 3733 1735, 1737,1739,1741, 1743, 1745 1747 1749, 1751, 1753, 1755, 1757, 1759, 1761, 1763, 1765 1767, 1769, 1773, 1773, 1775, 1777, 1779 1781, 1783,1785 1787, 1789, 1791, 1793, 1795, 1797, 1799, 1801, 1803,3805, 1807, 1809, 1811 1813,1815, 1817, 1839, 1821, 1823, 1825, 1827, 1829,1831, 1833, 3835, 1837 1839, 1841, 1843, 1845, 1847, 1849, 1851, 1853, 1855, 1857 1859 3861 1863, 1865 1867 1869 1871, 1873 1875 1877, 1879, 1881 1883 1885 1887 1889, 1891, 1893, -87- WO 2005/111066 PCT/IB2005/001775 1895 1897,1899 1901, 1903, 1905, 1907,1909,1911, 1913, 1915, 1917, 1919, 1921, 1923,1925, 1927,1929,1931, 1933, 1935, 1937, 1939, 1941, 1943, 1945, 1947, 1949, 1951, 1953, 1955, 1957, 1959, 1961, 1963 1965, 1967, 1969, 1971,1973,1975, 1977, 1979, 1981, 1983,1985,1987,3989 1991, 1993,1995,1997 1999 2001, 2003, 2005 2007 2009,2011, 2013, 2015, 2017, 2019,2021,2023, 2025, 2027, 2029, 2031, 2033, 2035, 2037, 2039, 2041, 2043, 2045, 2047, 2049, 2051,2053,2055, 2057,2059,2061, 2063, 2065, 2067,2069, 2071, 2073, 2075, 2077, 2079, 2081, 20S3 2085 2087,2089,2091,2093,2095,2097,2099,2101,2103 2105 2107 2109 2111,2313,2115,2117 2119,2121, 2123, 2125, 2127, 2129, 2131, 2133,2135, 2137,2139, 2141, 2143, 2145, 2147 2149, 2151, 2153, 2155,2157, 2159, 2161, 2163,2165, 2167, 2169, 2171,2173, 2175, 2177, 2179 2181, 2183, 2185 2187, 21S9, 2191, 2193, 2195, 2197, 2199 2201 2203 2205, 2207, 2209, 2211, 2213, 2215, 2217, 2219, 2221, 2223, 2225, 2227, 2229 2231, 2233, 2235, 2237, 2239,2241,2243, 2245, 2247,2249,2251, 2253, 2255, 2257, 2259,2261, 2263, 2265, 2267, 2269, 2271 2273 2275 2277,2279 2281, 2283, 2285, 2787, 2289, 2291, 2293 2295 2297, 2299, 2301, 2303,2305, 2307, 2309, 2311, 2313, 2315,2317, 2319,2321, 2323 2325, 2327, 2329, 2331, 2333,2335, 2337, 2339, 2341, 2343, 2345, 2347, 2349, 2351, 2353,2355, 2357, 2359, 2361, 2363, 2365, 2367, 2369, 2371, 2373, 2375, 2377,2379, 2381, 2383, 2385, 2387 2389,2391,2393,2395,2397,2399,2401,2403 2405 2407,2409 2411 2413 2415 2417 2419 2421 2423 2425 2427, 2429 2431 2433 2435 2437, 2439,2441, 2443, 2445, 2447, 2449, 2451, 2453, 2455, 2457, 2459,2461 2463 2465, 2467, 2469 2471, 2473, 2475,2477 2479 2481 2483, 2485, 2487, 2489, 2491, 2493, 2495, 2497, 2499, 2501, 2503, 2505, 2507, 2509, 2511, 2533, 2515, 2517, 2519, 2521, 2523, 2525, 2527, 2529, 2531, 2533, 2535, 2537, 2539, 2541 2543, 2545, 2547, 2549, 2551, 2553, 2555 2557, 2559 2561, 2563, 2565, 2567, 2569, 2571, 2573, 2575 2577, 2579, 2581, 2583, 2585, 2587, 2589, 2591, 2593, 2595 2597, 2599 2601 2603,2605 2607, 2609, 2611, 2613,2615, 2617, 2619, 2621, 2623, 2625, 2627, 2629, 2631,2633, 2635, 2637, 2639, 2641, 2643, 2645, 2647, 2649, 2651, 2653, 2655,2657,2659,2661,2663,2665,2667,2669,2671,2673,2675,2677 2679,2681 2683,2685 2687 2689 2691 2693,2695 2697,2699 2701,2703 2705 2707,2709 2711,2713 2715,2717 2719,2721,2723,2725,2727,2729, 2731, 2733 2735, 2737 2739, 2743 2743, 2745 2747, 2749, 2751, 2753, 2755, 2757, 2759, 2761, 2763, 2765, 2767, 2769, 2771, 2773, 2775 2777, 2779, 2781 2783, 2785, 2787, 2789, 2791, 2793, 2795, 2797, 2799 2801, 2803 2805, 2807,2809,2811,2813,2815,2817,2819,2821,2823,2825 2827,2829 2831 2833 2835 2837,2839 2841 2843 2845, 2847, 2849, 2851, 2853, 2855, 2857, 28D9, 2861, 2863, 2865, 2867, 2869 2871, 2873, 2875, 2877 2879, 2881 2883, 2885 2887, 2889, 2891, 2893, 2895, 2897, 2899, 2901, 2903, 2905, 2907, 2909 2911, 2913, 2915, 2917, 2919, 2921, 2923, 2925, 2927, 2929, 2%\, 2933, 2935, 2937, 2939, 2941, 2943, 2945, 2947 2949, 2951, 2953 29:>5, 2957, 2959,2961,2963,2965,2967,2969,2971 2973 2975 2977,2979 2981,2983,2985,2987 2989,2991,2993 2995, 2997, 2999,3001,3003,3005, 3007, 3009,3011,3013, 3015 3017 3019,3021,3023 3025, 3027, 3029, 3031,3033, 3035, 3037,3039, 3041 ->043,3045, 3047,3049,3051, 3053, 3055, 3057, 3059, 3061, 3063,3065, 3067, 3069, 3071, 3073,3075,3077 3079, 3081, 3083, 3085, 3087,3089, 3091, 3093, 3095, 3097, 3099, 3101, 3103 3105, 3107 3109 3111,3113 3115 3117 3119,3121,3123,3125,3127 3129,3131,3133,3135 3137 3139 3141,3143,3145,3147 3149 3351,3153,3155,3157,3159,316! 3163 3165 3167,3169,3171 3173,3175,3177,3179 3181,3183 318:., 3187, 3189, 3191,3193, 3195,3197,3199,3201, 3203,3205, 3207, 3209, 3211,3213, 3215,3217, 3219,3221,3223, 3225, 3227, 3229, 3231, 3233, 3235, 3237, 3239, 3241, 3243, 3245, 3247, 3249, 3251, 3253, 3255 3257, 3259 3261, 3263,3265 3267,3269 3271,3273 3275,3277,3279 328! 3283 3285,3287,3289,3291,3293,3295,3297,3299, 3301 3303,3305,3307 3309,3311,3313 3315,3317,3319 3321 3323 3325 3327,3329,3331,3333 3335, 3337, 3339,3341,3343,3345,3347,3349,3351,3353 3355,3357,3359 3361,3363,3365 3367,3369 3371 3373,337:., 3377 3379 3381 3383 3385, 3387, 33S9, 3391, 3393 3395,3397,3399 3401,3403 3405,3407 3409 3411 3413 WO 2005/111066 PCT/IB2005/001775 3415,3417, 3419, 3421, 3423,3425,3427, 3429,3431, 3433, 3435,3437, 3439,3441, 3443,3445, 3447, 3449 3451, 3453,3455,3457,3459,3461,3463,3465,3467,3469,3471 3473 3475,3477,3479,3481,3483 3485 3487 3489, 3491, 3493, 3495,3497, 3499, 3501, 3503 3505,3507, 3509 3511,3513, 3515, 3517,3519, 3521, 3523, 3525, 3527, 3529, 3531,3533, 3535, 3537, 3539, 3541, 3543 3545, 3547, 3549,3551, 3553,3555, 3557, 3559, 3561, 3563, 3565, 3567,3569,3571,3573,3575,3577,3579,3581,3583,3585,3587,3589 3591 3593,3595,3597 3599 3601 3603, 3605, 3607, 3609, 3611, 3613, 3615, 3617, 3619,3621 3623, 3625, 3627, 3629, 3631, 3633, 3635, 3637, 3639 3641, 3643,3645, 3647,3649, 3651, 3653,3655,3657,3659, 3661, 3663, 3665, 3667,3669, 3671, 3673,3675, 3677, 3679, 3681, 3683, 3685,3687, 3689, 3691,3693,3695,3697, 3699, 3701, 3703, 3705, 3707, 3709, 3711, 3713, 3715, 3717, 3719, 3721, 3723, 3725, 3727, 3729, 3731, 3733, 3735 3737, 3739, 3741, 3743, 3745, 3747, 3749, 3751, 3753, 3755, 3757,3759,3761, 3763, 3765, 3767, 3769, 3771, 3773, 3775, 3777 3779, 3781, 3783, 3785, 3787, 3789 3791 3793 3795 3797,3799 3801 3803,3805,3807 3809,3811,3813 3815,3817 3819,3821,3823,3825,3827,3829 3831 3833, 3835 3837, 3839, 3841, 3843, 3845,3847,3849, 3851, 3853, 3855, 3S:>7,3859, 3861, 3863, 3865, 3867, 3869, 3871, 3873, 3875,3877, 3879,3881,3883, 3885,3887, 3889, 3891, 3893,3895,3897, 3899 3901 3903, 3905 3907, 3909,3911 3913,3915,3917,3919,3921 3923 3925 3927,3929,3931,3933,3935 3937,3939 3941,3943,3945, 3947 3949 3951, 3953, 3955, 3957, 3959, 3961, 3963, 3965, 3967, 3969 3971, 3973, 3975, 3977, 3979, 3981 3983, 3985, 3987,3989 3991 3993 3995, 3997, 3999, 4001, 4003, 4005, 4007, 4009, 4011, 4013, 4015, 4017, 4019, 4021, 4023, 4025, 4027, 4"029, 4031, 4033, 4015 4037, 4039, 4041, 4043, 4045 4047, 4049, 4051, 4053 4055 4057 4059, 4061, 4063,4065, 4067, 4069 4071, 40/3, 4075, 4077, 4079 408!, 4083, 4085, 4087, 4089 4091, 4093 4095, 4097, 4099,4101,4103,4105 4107 4109 4111,4113 41b, 4117, 4119, 4121, 4123, 4125, 4127, 4129, 4L31, 4133, 4135, 4137, 4139, 4141 4143, 4145, 4147, 4149 4151, 4153, 4155, 4157, 4159, 4161, 4163, 4165, 4167 4169 4171, 4173 4175,4177,4179,4181,4183 4185,4187,4189,4191,4193 4195,4197,4199 4201,4203 4205 4207 4209 4211 4213, 4215, 4217 4219, 4221, 4223, 4225 4227, 4229, 4231, 4233,4235, 4237, 4239 4241, 4243 4245, 4247, 4249, 4251, 42>3 4255, 42:>7, 4259, 4261, 4263, 4265, 4267, 4269, 4271, 4273, 4275, 4277 4279, 4281, 4283, 4285, 4287, 4289, 4291, 4293 4295 4297 4299, 4301, 4303, 4305, 4307, 4309, 4311 4313 4315 4317, 4319, 4321, 4323, 4325, 4327, 4329, 4331 4333, 4333 4337 4339, 4341, 4343 4345, 4347, 4349, 4351, 4353, 4355, 4357, 4359, 4361 4363 4365,4367,4369 4371 4373 4375 4377,4379,4381 4383 4385,4387,4389,4391 4393,4395,4397,4399,4401, 4403 4405, 4407, 4409, 4411, 4413, 4415, 4417, 4419, 4421, 4423, 4425, 4427, 4429 4431, 4433, 4435, 4437, 4439 4441, 4443, 4445, 4447, 4449, 4451, 4453, 4455, 4457,4459 4461 4463 4465 4467 4469, 4471, 4473, 4475,4477 4479 4481,4483,4485 4487,4489 4491,4493,4495 4497 4499 4501 4503,4505,4507,4509,4511,4513,4515, 4517,4519 4521 4523 4525 4527 4529 4531 4533 4535 4537 4539 4541,4543,4545,4547,4549,4551,4553, 4555 4557 4559, 4561, 4563, 4565, 4567, 4569, 4571, 4573, 4575, 4577, 4579, 4581, 4583, 4585, 4587, 4589, 4591, 4593 4595,4597,4599,4601,4603,4605,4607,4609,4611,4613,4615,4617 4619 4621 4623 4625 4627 4629 4631 4633, 4635, 4637, 4639, 4641, 4643 4643 4647 4649 4651, 4653,4655, 4657,4659, 4661, 4663,4665, 4667, 4669, 4671,4673, 4675 4677, 4679, 4681, 4683, 4685, 4687 4689, 4691 4693, 469> 4697, 4699, 4703, 4703 4705, 4707 4709, 4711, 4713, 4715, 4717 4719 4721, 4723, 4725, 4727, 4729, 4731, 4733, 4735, 4737 4739, 4741, 4743, 4745, 4747, 4749, 4751, 4753, 4755, 4757, 4759, 4761, 4763, 4765, 4767,4769, 4771 4773, 4775 4777 4779, 4781, 4783 4785 4787 4789 4791,4793 4795,4797,4799 4801 4803,4805,4807 4809,4811,4813 4815 4817,4819 4821 4823 4825,4827,4829 4831,4833 4835,4837,4839,4841 4843 4845,4847 4849,4851,4853,4855,4857, 4859, 4861, 4863 4865, 4867,4869, 4871, 4873 4875, 4877, 4879, 4881, 4883, 4885, 4887 4889, 4891 4893, 4895, 4897, 4899, 4901, 4903, 4905, 4907, 4909 4911, 4913, 4915, 4917, 4919 4921, 4923 4925, 4927, 4929, 4931, 4933 -89 WO 2005/111066 PCT/IB2005/001775 4935, 4937, 4939,4941, 4943, 4945, 4947, 4949,4951, 49D3, 4955, 4957, 4959, 4961, 4963, 4965, 4967, 4969, 4971, 4973, 4975, 4977, 4979, 49S1, 4983, 4985, 4987, 4989, 4991, 4993, 4995, 4997, 4999 5001, 5003 5005, 5007 5009 5011, 5013, 5015 5017, 5019, 5021, 5023, 5025, 5027, 5029, 5031, 5033 5035, 5037, 5039, 5041, 5043, 5045 5047 5049,5051,5053,5055,5057,5059,5061,5063,5065,5067,5069 5071 5073,5075,5077 and 5079 8 Nucleic acid of claim 7, comprising an nucleotide sequence selected from SEQ ID NOS 1,3 5 7 9 11,13 15, 17, 19, 21,23,25,27,29,31,33,35,37,39,41,43,45,47,49,51, 53 55, 57, 59,61, 63,65,67, 6% 71,73, 75,77 79, 81, 83, 85, 87, 89, 91,93,95,97,99,101,303,105,107,109, 111, 113,115 117,119,121,123,125,127,129,131,133,135, 137,139, 141, 143,145,147,149,151 153,155, 157, 159, 161,163, 165,167,169,171,173,175,177,179, 181, 183, 185, 187, 189, 191,193, 195,197, 199,201,203 205,207,209,211, 213,215,217,219 221, 223, 225,227, 229, 231, 233 235,237,239,241,243 245,247,249 251 253 255 257 259,261 263 265 267 269,271,273 275,277,279, 281,283,285 287,289,291,293,295 297,299 301 303 305 307,309 311,313,315,317,319,321,323,325,327, 329,331,333,335,337,339,341,343,345,347,349,351, 353,355, 357,359,361,363,365,367,369,371,373, 375, 377,379,381,383,385,387,389,391,393,395,397,399,401,403,405 407 409,411,413,415,417 419 421 423 425 427,429 433 433 435 437 439 44! 443 445,447 449 451,453 455 457 459 461 463 465,467 469 471 473,475,477 479 481,483,485 487 489 491,493,495,497,499,501, 503, 505, 507,509, 511, 513,515, 517, 519 521,523,525,527, 529,531,533, 535, 537, 539, 541, 543, 545,547,549, 551, 553, 555, 557, 559,561, 563,565 567, 569,571,573, 575, 577, 579, 58i, 583, ^85, 587 589,591, 593,595,597, 599, 601, 603 605, 607, 609 611,613, 615, 617, 619,621, 623,625, 627, 629, 631,633,635, 637, 639, 641 643 645 647, 649, 651, 653, 655,657 659 661 663, 665, 667 669 671, 673 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707,709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751 753 755, 757 759, 761 763,765, 767,769, 771, 773, 775,777,779,781,783, 785, 787,789,791,793,795, 797, 799, 801, 803, 805, 807, 809 811 813,815 817 819,821 823 825,827 829 831,833,835,837,839,84] 843,845,847,849,851,853 855, 857, S59,861, 863, 865,867,869,871,873, 875,877, 879, 881, 883,885, 887, 889, 891, 893, 895, 897,899, 901, 903, 905, 907, 909, 911,913 915,917,919,921,923,925, 927, 929 931, 933, 935, 937 939, 941,943,945,947 949, 951, 9:>3,955, 957,959,961,963,965,967,909,971,973, 975, 977,979, 981, 983, 985 987, 989,991, 993,995, 997, 999, 1001 1003 1005, 1007, 1009, 1011, 1013 1015, 1017, 1019, 1021, 1023, 1025, 1027 1029, 1031, 1033, 1035, 1037, 1039, 1041, 1043, 1045, 1047, 1049, 1051, 1053, 1053, 1057 1059, 1061, 1063, 1065 1067, 1069, 1071, 1073, 1075, 1077,1079,1081 1083,1085,1087 1089,1091,1093 1095 1097,1099 1101 1103,1105,1107,1109 1111,1113, 1115,1117,1119,1121 1123 1125 1127,1129,1131 1133 1135 1137,1139 1141 1143 1145 1147,1149 1151, 1153, Hi5, 1157, 1159, 1161, 1163, 1165, 1167, 1169, 1171, 1173, 1175, 1177, 1179 1181, 1183, 1185, 1187, 1189, 1191 1193, 1195, 1197, 1199, 1201, 1203, 1205,1207, 1209, 1211, 1213, 1215 1217, 1219, 1221 1223 1225 1227, 1229,1231, 1233, 1235, L237, 1239, 1241, 1243, 1243, 1247, 1249, 1251, 1253, 1255 1257, 1259, 1261, 1263, 1265, 1267,1269 1271, 1273 1273 1277,1279 1281,1283,1285 1287 1289, 1291, 1293 1295 1297 1299, 1301, 1303, 1305, 1307, 1309, 1311, 1313, 1315, 1317,1319, 1321, 1323, 1325 1327, 1329, 1331, 1333, 1335, 1337, 1339, 1341, 1343, 1345, 1347, 1349, 1351, 1353, 1355, 1357, 1359, 1361, 1363, 1365, 1367, 1369, 1371, 1373, 1375, 1377, 1379 1381,1383 1385,1387,1389 1391 1393,1395 1397 1399,1401 1403 1405 1407 1409,1411 1413, 1415, 1417, 1419,1421,1423, 1425,1427, 1429 1431 1433 1435, 1437, 1439, 1441, 1443 1445 1447, 1449,1451, 1453 1455, 1457, 1439,1461 1463, 1465, 1467, 1469, 1471, 1473, 1475, 1477, 1479 1481, 1483 1485 1487, 1489 1491, 1493, 1495, 1497, 1499, 1501 1503, 1505, 1507 1509, 1511,1513 1515, 1517, 1519, 1521 1523, 1525, 1527 1529, 1531 1533, 153o, 1537, 1539 1541, 1543, 1545, 1547, 1549, 1551, 1553, 1555 1557 1559 1561 1563 1565 1567, 1569, -90- WO 2005/111066 PCT/IB2005/001775 1571, 1573, 1575, 15773 1579, 1581, 1583, 1585, 1587, 1589, 1591, 1593, 1595, 1597 1599, 1601, 1603, 1605, 1607, 1609, 1611, 1613, 1615, 1617, 1619, 1621, 1623, 1625 1627 1629, 1631,1633, 1635, 1637, 1639, 1641, 1643, 1645, 1647 1649 1651,1653,1655, 1657,1659 1661,1663, 1665, 1667, 1669, 1671,1673, 1675, 1677, 1679, 1681, 1683, 1685, 3687,1689, 1691, 1693, 1695,1697 1699,1701,1703,1705, 1707, 1709,1711, 1713, 1715, 1717 1719,1721, 1723, 1725, 1727, 1729, 1731, 1733, 1735, 1737, 1739, 1741, 174J, 1745, 1747, 1749, 1751, 1753, 1755, 1757, 1759, 176J, 1763, 1765, 1767, 1769, 1771, 1773, 1775, 1777, 1779,1781, 1783, 1785,1787 1789, 1791, 1793 1795, 1797, 1799, 1801,3803,1805,1807,1809 1811, 1813,1815 1817 1819,1821,1823,1825, 1827,1829, 1831, 1833, 1835, 1837, 1839, 1841 1843, 1845, 1847, 1349, 1851, 1853, 1855, 1857, 1859, 1861, 1863, 1865, 1867, 1869, 1871 1873, 1875, 1877, 1879, 1881, 1883, 1885,18873 1889, 1891, 3893, 1895, 1897, 1899, 1901 1903, 1905, 1907 1909 1911 1913,1915, 1917, 1919,1921 1923, 1925, 1927,1929, 1931,1933, 1935, 1937, 1939,1941, 1943, 1945,1947 1949, 1951 1953 1955 1957 1959, 1961 1963, 1965,1967 1969, 1971,1973, 1975,1977, 1979, 1981, 1983, 1985,1987, 1989,1991,1993,1995,1997, 1999, 2001, 2003, 2005, 2007, 2009, 2011, 2013, 2015, 2017, 2019, 2021, 2023, 2023, 2027, 2029, 2031, 2033, 2035, 2037, 2039, 2041, 2043, 2045, 2047, 2049, 2051, 2053, 2055 2057, 2059, 2061, 2063, 2065 2067,2069,2071,2073 2075 2077 2079 2081 2083,2085 2087 2089 2091 2093,2095 2097,2099 2101 2103, 2103, 2107 2109 2111, 2113, 2115, 2117, 2119, 2121, 2123, 2125, 2127, 2129,2131, 2133, 2135, 2137, 2139, 2141, 2143, 2145, 2147, 2149, 2151, 2153, 2155, 2157, 2159 2161, 2163, 2165, 2167, 2169, 2171, 2173, 2175 2177, 2179, 2181, 2183, 2185, 2187, 2189, 2191, 2193, 2195, 2197, 2199, 2201, 2203, 2205, 2207, 2209, 2211, 2213 22b, 2217, 2219, 2221, 2223, 2225, 2227, 2229, 2231, 2233, 2235, 2237 2239 2241, 2243, 2245, 2247, 2249, 2251 2253, 2255, 2257, 2259, 2261, 2263, 2265, 2267,2269, 2271, 2273, 2275, 2277, 2279, 2281, 2283, 2285 2287, 2289 2291, 2293, 2295, 2297, 2299, 2301, 2303, 2305, 2307, 2309, 2311, 2313, 2315, 2317, 2319, 2321, 2323 2325, 2327, 2329 2331, 2333, 2335,2337, 2339, 2341, 2343, 2345, 2347, 2349, 2351, 2353, 2355, 2357 2359, 2361, 2363 2365,2367, 2369,2371 2373 2375,2377,2379,2381 2383,2385,2387,2389,2391,2393,2395,2397,2399,2401,2403 2405, 2407, 2409, 2411, 2413, 2415, 2417, 2419, 2421, 2423, 2425, 2427, 2429, 2431, 2433, 2435, 2437, 2439, 2441 2443 2445, 2447, 2449, 2451, 2453, 2455, 2457, 2459, 2461, 2463, 2465, 2467 2469 2471 2473 2475, 2477, 2479, 2481, 2483 2485 2487 2489 2491,2493 2495 2497,2499 2501,2303,2305 2507,2309,2511,2313,2515 2517,2519, 2521,2523,2523 2527,2529,2531,2533 2535,2537 2539 2541,2343 2545,2347,2549,2351,2553,2555,2557, 2559, 2561, 2563,2565, 2567, 2569, 2571, 2573, 2575, 2577, 2579, 2581, 2583, 2385, 2587 2589, 2591, 2593, 2595, 2597, 2599, 2601, 2603, 2605, 2607 2609, 261!, 2613, 2615 2617 2619,2621, 2623, 2625, 2627, 2629, 2631, 2633, 2635 2637,2639,2641 2643,2645,2647 2649,2651,2633 2655 2657,2639,2661 2663 2665,2667,2669,2671, 2673, 2675, 2677 2679, 2681, 2683, 2685, 2687, 2689, 269! 2693, 2695, 2697, 2699, 2701, 2703, 2705, 2707, 2709, 2711, 2713, 27(5, 27i7, 2719, 2721, 2723,2725,2727, 2729, 2731, 2733, 2735, 2737, 2739, 2741, 2743, 2745 2747, 2749,2751,2753,2755,2757 2759,2761,2763 2765 2767,2769,2771 2773 2775 2777,2779 2781 2783 2785 2787,2789 2791 2793 2793 2797 2799,2801 2803,2805,2807,2809,2811,2813,2815,2817,2819,2821,2823, 2825 2827,2829,2831 2833,2835 2837,2839,2841 2843,2845,2847,2849 2831,2853,2855,2837,2859,2861, 2863, 2865, 2867, 2869,2871, 2873, 2875, 2877,2879, 2881, 2883, 2885, 2887, 2889, 2891, 2893 2895, 2897, 2899, 2901, 2903, 2905, 2907, 2909, 2911, 2913, 2915, 2917, 2919 2921 2923, 2923, 2927 2929, 2931, 2933, 2935, 2937, 2939,2941 2943 2945,2947 2949,2951,2953 2955,29^7,2959 2961,2963,2965 2967,2969,2971,2973 2975, 2977,2979,2981,2983,2985,2987 2989,2991,2993 2995,2997 2999,3001 3003 3003 3007,3009,3011,3013, 3015 3017,3019,3021 3023 3025, 302/, 3029, 3031, 3033, 3033, 3037, 3039, 3041, 3043 3045 3047,3049,3051, 3053, 3055, 3057, 3059, 3061, 3063, 306\ 3067, 3069 3071, 3073, 3073 3077, 3079 3081 3083 3085 3087 3089 -91 WO 2005/111066 PCT/IB2005/001775 3091, 3093, 3095, 3097, 3099, 3101, 3103, 3105, 3107 3109, 3111, 3U3, 3115, 3117, 3119, 3121, 3123, 3125, 3127 3129,3131,3133,3135,3137 3139,3141,3143 3145,3147,3149 3151,3153,3155,3157,3159 3161,3163,3165, 3167,3169, 3171 3173, 3175, 3177 3179, 31S1 3183, 3185, 3187, 3189, 3191,3193, 3193, 3197, 3199, 3201, 3203, 3205, 3207,3209, 3211, 3213, 3215, 3217 3219, 3221, 3223, 3225, 3227, 3229, 3231,3233, 3235 3237,3239 3241, 3243, 3245, 3247,3249, 3251, 3253, 3255 3237,3259, 3261,3263, 3265, 3267 3269 3271 3273 3275,3277, 3279, 32SI, 3283, 3285 3287, 3289 3291, 3293 3295,3297 3299, 3301, 3303,3305, 3307, 3309, 3311, 3313, 3315 3317 3319, 3321,3323 3325, 3327, 3329, 3331,3333, 3335, 3337, 3339,3341,3343, 3345, 3347, 3349, 3351, 3353, 3355, 3357, 3359,3361,3363, 3365, 3367,1369 3371, 3373, 3375,3377, 3379, 3381,3383 338s 3387, 3389, 3391, 3393, 3395, 3397, 3399, 3401, 3403, 3405, 3407 3409, 3411 3413, 3415, 3417, 3419 3421 3423, 3425, 3427, 3429 3431 3433,3435, 3437, 3439, 3441, 3443, -(445,3447, 3449, 3451, 3453,3455, 3457, 3459 3461, 3463, 3465, 3467, 3469 3471, 3473,3475, 3477, 3479, 3481, 3483,3483, 3487, 3489, 3491, 3493, 3493, 3497,3499, 3501, 3503, 3505 3507, 3509, 3511, 3513 3515, 3517, 3519, 3521, 3523, 3523, 35273 3529, 3531 3533, 3535, 3537, 3539, 3541, 3543, 3545, 3547, 3549,3551 3553, 3555, 3557, 3559, 3561, 3563, 3565, 3567, 3569 3571 3573, 3575, 3577, 3579 3581 3583, 3585,3587,3589 3591,3593 3595 3597,3599 3601 3603 3605,3607 3609 3611 3613,3615,3617,3619 3621, 3623, 3625 3627 3629, 3631, 3633, 3635, 3637 3639, 3641, 3643, 3645, 3647 3649, 3651, 3653, 3655, 3657, 3659, 3661 3663 3665,3667,3669,3671,3673,3675,3677,3679,3681,3683 3685,3687,3689,3691 3693,3695 3697 3699 3701, 3703 3705, 3707, 3709, 3711, 3713, 3715 3717, 3719 3721, 3723, 3725 3727, 3729, 3731, 3733, 3735 3737,3739 3741 3743,3745 3747, 3749, 3751, 3753, 3755, 3757,3739, 3761 3763 3765, 3767, 3769, 3771, 3773, 3775, 3777, 3779, 3781, 3783, 3785,3787, 3789, 3791, 3793, 3795, 3797, 3799, 3801 3803, 3805, 3807, 3809, 3811, 3813, 3815, 3817, 3819, 3821, 3823, 3825, 3827, 3829, 3831, 3833, 3835, 3837 3839, 3841, 3843 3845 3847 3849, 3851, 3853,3855, 3857, 3859 3861, 3863, 3865, 3867, 3869, 3871 3873 3875 3877, 3879 3881, 3883,3885 3887 3889 3891 3893 3895,3897,3899 3901,3903,3905 3907 3909,3911 3913,3915 3917 3919,3921,3923,3925, 3927 3929,3931, 3933 3935, 3937, 3939, 3941, 3943, 3945, 3947, 3949, 3951, 3953, 3955, 3957, 3959, 3961, 3963, 3965, 3967, 3969, 3971, 3973, 3975, 3977, 3979, 3981 3983 3985, 3987,3989, 3991, 3993, 3995, 3997, 3999, 4001, 4003,4005 4007,4009 4011 4013 4015 4017 4019,4021 4023 4025,4027 4029,4031,4033 4035,4037,4039, 4041 4043,4045,4047,4049,4051 4053,4055 4057,4059 4061,4063,4065,4067,4069 4071 4073,4075,4077, 4079,4081,4083,4085,4087,4089,4091,4093,4095 4097,4099,4101,4103 4105,4107,4109,4111,4113 4115, 4117,4119,4121,4123,4125,4127,4129,4131 4133,4135,4137 4139,4141 4143,4145 4147 4149,4151 4153 4155 4157, 4159, 4161, 4163, 4165, 4167, 4)69,4171, 4173, 4175, 4177,4179, 4181, 4183, 4185, 4187,4189, 4191, 4193 4195 4197 4199 4201 4203 4205, 4207 4209, 4211, 4213, 4215,4217, 4219, 4221, 4223, 4225,4227,4229 4231, 4233 4235, 4237 4239, 4241, 4^43, 4245, 4247, 4249, 4251, 4253, 4255, 4257, 4259, 4261, 4263, 4265, 4267, 4269, 4271, 4273, 4275, 4277, 4279, 4281, 4283 4285, 4287 4289 4291 4293, 4295 4297, 4299 4301, 4303, 4305 4307,4309,4311,4313 4315,4317 4319,4321,4323,4325 4327,4329,4331 4333,4335 4337,4339,4341,4343, 4345 4347,4349 4351 4353, 4355 4357, 4359 4361, 4363, 4363, 4367, 4369,4371, 4373, 4375, 4377, 4379, 4381, 4383, 4385, 4387, 4389, 4391, 4393, 4395, 4397, 4399, 4401, 4403, 4405, 4407, 4409, 4411, 4413, 4415 4417, 4419, 4421, 4423, 4425, 4427, 4429, 4431, 4433 4435, 4437, 4439, 4441 4443, 4445, 4447, 4449 4451, 4453, 4453 4457, 4459 4461, 4463, 4465, 4467, 4469 4471 4473, 4475 4477 4479, 4481 4483, 4485 4487 4489, 4491, 4493, 4495, 4497 4499,4501 4503 4505 4507 4509 4511,4513 4515 4517 4519,4521,4523,4525 4527,4529,4531,4533, 4535 4537, 4539, 4541, 4543, 4545, 4547, 4549, 4551 4553, 4555, 4557, 4539, 4561, 4563 4565, 4567, 4569, 4571, 4573, 4575, 4577, 4579, 4581, 4583, 4585, 4587 4589, 4591 4593 4595, 4597 4599 4601 4603 4605 4607, 4609 -92- WO2005/l11066 PCT/IB2005/001775 4611, 4613, 4615, 4617, 4619, 4621, 4623, 4625, 4627, 4629, 4631, 4633, 4635, 4637, 4639, 4641, 4643, 4645, 4647, 4649, 4651, 4653, 4655, 4657, 4659, 4661, 4663, 4665, 4667, 4669, 4671, 4673 4675, 4677, 4679, 4681, 4683, 4685, 4687,4689 4691,4693,4695,4697 4699,4701,4703,4705,4707 4709,4711,4713 4715,4717,4719 4721 4723 4725, 4727, 4729,4731, 4733, 4735, 4737, 4739, 4741,4743, 4745 4747, 4749 4751, 4753, 4755, 4757, 4759,4761, 4763, 4765 4767 4769, 4771, 4773, 4775, 4777, 4779, 4781, 4783, 4785, 4787, 4789, 4791, 4793, 4795, 4797, 4799, 4801, 4803, 4805, 4807, 4809, 4811, 4813, 4815, 4817, 4819, 4821, 4823 4825 4827, 4829, 4831, 4833, 4835, 4837, 4839, 4841, 4843, 4845, 4847, 4849, 4851, 4853, 4855,4857, 4859, 4861 4863, 4865, 4867, 4869, 4871,4873, 487J 4877,4879,4881,4883,4885 4887,4889,4891,4893,4895 4897 4899 4901,4903 4905,4907,4909 4911,4913, 4915, 4917, 4919 4921, 4923, 4925, 4927, 4929, 4931,4933, 4935, 4937, 49J9, 4941, 4943, 4945, 4947, 4949, 49M 4953, 4955, 4957,4959, 4961, 4963, 4965, 4967, 4969, 4971, 4973, 4975,4977, 4979, 4981, 49S3, 4985, 4987, 4989, 4991 4993 4995,4997,4999 5001 5003 5005 5007 5009,5011,5013,5015,5017,5019,5021,5023 5025,5027 5029,5031 5033,5035,5037,5039 5041,5043,5045 5047 5049,5051,5053 5055,5057,5059,5061,5063,5065, 5067,5069, 5071, 5073, 5075,5077 and 5079 9 Nucleic acid that can hybridize to the nucleic ac?d of claim 8 under high stringencj conditions 10 Nucleic acid comprising a fragments of 10 or more consecutive nucleotides from one or more of SEQ ID NOS 1563, 1569, 1573, 1577, I, 3, 5, 7, 9, 11,13, b, 17, 19, 21,23,25, 27,29,31, 33, 35,37, 39 41, 43,45 47, 49 51, 53 ;>5, 57, 59,61,63,65,67,69,71,73,75,77,79,81 83 85 87 89,91 93,95,97,99,101 103,105,107,109,111,113,1b, 117,119,121,123,125,127,129,131,133,135,137,139 141,143 145 147,149 151,153, b5, 157,159 161 163 165,167,169,171,173,175,177,179 181,183,185,187,189 191,193,195,197 199,201,203,205,207 209,211, 213,215, 217,219,221, 223,225, 227, 229,231,233,235,237, 239, 241,243, 245 247 249, 2M, 253,255 257 239 261,263, 265,267,269,271,273, 275, 277,279,281,283,285, 287, 289, 291, 293, 293, 297,299, 301,303, 305, 307, 309 311 313,315,317,319 321,323,325,327,329,331,333,335,337,339,341 343,343,347,349,351 353,333, 357,359,361, 363,365,367, 369, 371,373,375,377,379,381,383, 385,387 389 391,393,395,397, 399, 401,403, 405,407,409,411,413,415,417 419 421,423 425,427,429 431 433,435,437 439,441,443,445 447 449,431 453 455 457,459,461,463,465 467 469,471 473 475 477 479 481 483 485 487 489 491,493 495 497,499 501, 503, 505, 507,509, 511, 513, 515,517,519, 521,523, 525, 527, 529,531 533, 533, 537, 539, 341, 543 543, 547, 549, 551, 553, 555, 357, 559, 561, 563, 565, 567, 569, 371, 573, 575, 577, 579 581 583, 585, 587, 589, 591 593, 595, 597 599,601 603 605,607,609,611 613,615,617,619,621,623 625,627 629 631,633,635,637 639,641,643, 645,647 649,651 653 655,657,659,661 663,665,667 669,671,673,675 677 679,681,683 685,687 689,691 693,695, 697,699,701, 703,705, 707,709,711,713,715,737, 719, 721, 723, 725 727,729,731, 733,735 737, 739, 741,743,745,747,749,751,753,755,757 759,761,763,765 767,769 771,773 773,777,779 781 783 785,787 789,791,793,795,797,799,801 803,805,807,809,811,813 815 817,819 821 823,825,827,829,831 833, 83 J, 837,839,841,843,845 847 849 851, 8S3, 855, 857, 859, 861, 863, 865 867,869 871 873 875,877,879 881,883 885 887 889 891,893,895,897,899,901,903,905,907,909 911,913,915 917,919 921,923,925,927 929,931, 933,935,937, 939,941,943,945, 947,949,951,953, 955, 957,959, 961, 963,965 967, 969, 971, 973,975, 977, 979, 981 983 985,987,989 991 993 995 997,999 1001 1003,1005 1007 1009,1011,1013,1015,1017,1019,1021, 1023,1025,1027 1029,1031 1033,103^1037 1039 1041 1043 1045,1047,1049,1051 1053,1055 1037,1059, 1061, 1063, 1065, 1067 1069, 1071, 107', 1075, !077 10^9, 1081 1083, 1085, 1087, 1089 1091, 1093, 1095,1097, 1099,1101,1103,1105,1107,1109 1111,1113,1115 1117, 1! 19, 1121 1123, ! 125, 1127 1129,1131,1133,1133, -93- WO2005/111066 PCT/IB2005/001775 1137, 1139, 1141, 1143, 1145, 1147, 1149, 1151, 1153, 1155, 1157, 1159, 1161, 1163 1165, 1167, 1169 1171, 1173 1175,1177,1179, 1181 1183 1185, 1187,1189,1191, 1193,1195,1197,1199, 1201, 1203, 1205, 1207,1209,1211, 1213, 1215 1217, 1219, 1221 1223, 1225 1227, 1229, 1231 1233, 1235 1237, 1239, 1241, 1243, 1245, 1247, 1249, 1251, 1253, 1255, 1257 1259, 1261, 1263, 1265, 1267, 1269, 1271, 1273, 1275, 1277, 1279, 1281, 1283, 1285, 1287, 1289, 1291, 1293, 1295, 1297, 1299, 1301, 1303, 1305, 1307, 1309, 1311 1313 1315, 1317, 1319 1321 1323, 1325, 1327 1329,1331, 1333, 1335, 1337, 1339, 1341, 1343, 1345, 1347, 1349, 1351 1353 1355, 1357, 1359, 1361 1363 1365,1367, 1369, 1371, 1373, 1375, 1377 1379 1381 1383,1385,1387,1389,1391,1393, 1395, 1397,1399,1401, 1403, 1405, 1407, 1409 1411, 1433, 1415, 1417,1419, 1421,1423, 1425, 1427, 1429, 1431, 1433, 1435, 1437, 1439, 1441, 1443, 1445, 1447,1449, 1451, 1453, 1455, 1457, 1459, 1461, 1463 1465 1467, 1469, 1471, 1473, 1475 1477, 1479, 1481, 1483, 1485, 1487, 1489, 1491, 1493, 1495 1497 1499, 1501, 1503 1505 1507 1509, 1511, 1513, 15b 1517, 1519 1521,1523 1525, 1527, b29,1531,15333 1535,1537, 1539, 1541,1543, 1545, 1547,1549, 1551, 1553, 1555, 1557, 1559, 1561, 1563, 1565, 1567, 1569, 1571, 1573, 1575, 1577, 1579,1581, 1583, 1585, 1587, 1589 1591, 1593, 1595, 1597, 1599, 1601, 1603, 1605, 1607, 1609, 1611 1613, 1615, 1617, 1619, 1621, 1623 1625, 1627, 1629, 1631, 1633 1635 1637 1639, 1641, 1643, 1645, 1647 1649 1651 1653 1655,1657, 1659, 1661, 1663,1665 1667, 1669, 1671, 1673 1675, 1677, 1679, 1681, 1683, 1685 1687, 1689, 1691, 1693, 1695, 1697, 1699, 1701, 1703 1705 1707, 1709, 1711, 1713, 1715, 1717, 1719, 1721, 1723, 1725, 1727, 1729 1731, 1733, 1735, 1737, 1739, 1741 1743 1745, 1747, 1749, 1751, 1753, 1755, 1757,1759, 1761, [763, 1765, 1767,1769 1771, 1773,1775, 1777 1779, 1781 1783, 1785, 1787 1789 1791 1793, 1795, 1797, 1799 1801, 1803, 1805, 1807 1809, 1811, 1813, 1815, 1817 1819, 1821, 1823, 1825, 1827, 1829, 1831 1833 1835, 1837, 1839, 1841, 1843, 1845, 1847, 1849, 1851 1833, 1855 1857, 1859,186!, 1863,1865, 1867, 1869,18/1, 1873,1875, 1877, 1879, 1881,1883,1885,1S87, 1889 1891, 1893, 1895 1897, 1899, 1901, 1903, 1905, 1907 1909,1911, 1913 1915, 1917, 1919, 1921 1923,1923, 1927 1929, 1931, 1933 1935 i937, 1939 1941, 1943, 1945, 1947, 1949, 1951, 19D3, 1955, 1957, 1959 1961, 1963, 1965 1967,1969, 1971, 1973,1975, 1977, 1979,1981,1983,1985, 1987, 1989, 1991, 1993, 1993, 1997, 1999, 2001, 2003 2005, 2007, 2009 20! I, 2013, 2015, 2017, 2019, 2021, 2023, 2025, 2027 2029 2031, 2033, 2035, 2037 2039, 2041 2043, 2045, 2047, 2049,2051,2053 2035,2057 2059 2061,2063,2065 2067 2069,2071 2073 2073 2077,2079 2081,2083,2085, 2087,2089,2091,2093 2095,2097 2099 2101 2103,2105 2107,2109 2111,2113,2115,2117 2119,2321,2123, 2125, 2127,2129, 2131, 2133, 2135, 2137 2139, 2141, 2143, 2145, 2147, 2149, 2151, 2153, 2155 2157, 2159, 2161, 2163,2165,2167,2169,2171,2173,2175 2177,2179,2181,2183,2185 2187,2189 2191 2193 2195,2197 2199, 2201, 2203, 2205 2207, 2209 2211 2213 2215 2217, 2219, 2221, 2223, 2223, 2227, 2229, 2231, 2233, 2235, 2237, 2239 2241 2243 2245,2247 2249, 22M, 2253 2253 2257,2259,2261 2263,2265,2267,2269,2271,2273,2275, 2277,2279,2281 2283,2285,2287,2289,2291,2293,2295,2297,2299 2301,2303 2305 2307 2309 2311 2313, 2315,2317,2319 2321, 2323, 2325, 2327, 2329,2331, 2333 2335, 2337 2339 2341, 2343, 2345, 2347, 2349, 2351, 2353 2335 2357 2359, 2361, 2363, 236S, 2367, 2369, 2373, 2373, 2375 2377, 2379 2381, 2383 2385, 2387, 2389, 2391, 2393 2395 2397, 2399, 2401, 240;, 2405, 2407, 2409, 2411, 2413 2415, 2417 2419 2421, 2423, 2425 2427, 2429 2431 2433 2435, 2437 2439, 2441, 2443, 2443, 2447, 2449, 2451 2453, 2455, 2457 2459,2461, 2463, 2465, 2467 2469, 2471, 2473, 2473, 2477 2479, 248! 2483 2485, 2487, 2489 2491 2493, 2495, 2497 2499 2501, 2503, 2505,2507 2509,2511 2513,2515,2517 2519 2521,2523 2525,2527 2529 2531 2533,2535 2537,2539,2541, 2543,2545,2547 2549 2551 2553 2555 2557 2559 2561 2563,2565 2567,2569 2571 2573 2575,2577,2579 2581, 2583, 2585, 2587, 2589, 2591, 2393, 2595, 2597, 2599, 2601, 2603, 2605, 2607 2609 2611, 2613,2615, 2617, 2619,2621,2623,2625 2627,2629 2631 2633,2635 2637 2639 2641 2643 2643,2647 2649 2651 2653 2655 -94- WO 2005/111066 PCT/IB2005/001775 2657, 2659, 2661,2663, 2665, 2667, 2669,2671, 2673, 2675, 2677, 2679, 2681, 2683, 2635, 2687 2689, 2691, 2693, 2695, 2697, 2699,2701 2703 2705, 2707, 2709 2713 2713, 2715, 2717, 2719, 2721, 2723, 2725, 2727, 2729, 2731, 2733 2735 2737,2739,2741 2743,2745,2747 2749,2751,2753 2755,2757,27^9 2761,2763,2765,2767 2769 2771, 2773, 2775, 2777, 2779, 2781, 2783,2785,2787, 2789, 2791, 2793, 2795, 2797, 2799, 2801 2803, 2805, 2807, 2809, 2811, 2813, 2815, 2817, 2819, 2821, 2823, 2825, 2827, 2829, 2831, 2833, 2835, 2837, 2839, 2841 2843, 2845, 2847,2849 2851 2853 2855 2857,2859,2861,2863,2865,2867,2869,2871,2873 2873 2877 2879,2881 2883, 2885, 2887, 2889,2891, 2893, 2895, 2897, 2899 2901, 2903, 2905, 2907,2909, 2911, 2913, 2915 2917, 2919, 2921, 2923, 2925, 2927, 2929, 2931, 2933, 2935, 2937, 2939, 2941,2943, 2945, 2947, 2949, 2951, 2953 29D5, 2957, 2959, 2961, 2963, 2965, 2967, 2969, 2971, 2973, 2975, 2977, 2979,2981, 2983,2985, 2987, 2989, 2991 2993, 2995 2997, 2999, 3001,3003,3005,3007,3009, 3011 3013,3015, 3017, 3019,3021,3023, 3025, 3027, 3029 3031, 3033 3035, 3037 3039,3041 3043, 3045, 3047,3049, 3051,3053, 3055 3057,3059, 3061, 3063, 3065, 3067 3069, 3071, 3073, 3075 3077, 3079,3081, 3083, 3085, 3087 3089, 3091, 3093, 3095,3097, 3099, 3101, 3103,3105, 3107, 3109, 3111, 3113,3115, 3117, 3119, 3121, 3123, 3125 3127, 3129,3131, 3133, 3135,3137 3139 3141,3143,3145, 3147,3149, 3151,3153,3155 3157 3159 3161,3163,3165 3167 3169,3171 3173,3173,3177,3179,3181 3183 3185 3187 3189,3191,3193,3195,3197,3199,3201 3203,3205,3207 3209 3211,3213 3215,3217,3219,3221,3223 3225, 3227, 3229, 3231, 3233, 3235, 3237, 3239, 3241, 3243, 3245, 3247, 3249, 3251, 3253 3255, 3257, 3259, 3261, 3263 3265, 3267, 3269, 3271, 3273, 3275, 3277, 3279, 3281, 3283 3285 3287, 3289, 3291 3293, 3295, 3297, 3299 3301 3303,3305,3307 3309, 3311, 3313, 3315,3317, 3319, 332! 3323, 3325 3327 3329 3331,3333, 3335, 3337, 3339, 3341,3343 3345 3347 3349, 3351, 3353,3355 3357, 3359 3361, 3363 3365,3367 3369, 3371, 3373, 3375, 3377, 3379,3381,3383 3385 3387 3389, 3391, 3393,3395, 3397,3399,3401 3403, 3405 3407, 3409, 3411, 3413, 3415, 3417 3419 3421 3423,3425,3427,3429,3431,3433,3435,3437 3439 3441 3443 3445 3447 3449 3451 3453 3455 34D7 3459,3461,3463, 3465, 3467 3469, 3471,3473,3473 3477, 3479, 3481, 3483,3485, 3487, 3489 3491 3493 3495,3497, 3499, 3501, 3503, 3505,3507,3509, 3511, 3513, 3515 3517,3519, 3521, 3523, 3525, 3527 3529, 3531 3533,3535 3537,3539 3541,3543,3545 3547 3549,3551,3553 3555 3557 3D59 3561 3563,3565,3567, 3569 3571 3573 3575, 3577, 3579 3581 3583,3583, 3587 3589 3591 3593 3595 3597 3599 3601, 3603 3605 3607, 3609,3611, 3613, 36i3 3617 3619, 3621,3623 3625, 3627 3629 3631 3633, 3635, 3637, 3639, 3641,3643, 3645 3647 3649, 3651, 3653 3655, 3657, 3659, 3661, 3663, 3665, 3667 3669, 3671, 3673, 3675, 3677, 3679, 3681, 3683 3685, 3687, 3689 3691, 3693, 3693 3697, 3699, 3701,3703, 3705 3707, 3709, 3711, 3713, 3715, 3717, 3719, 3721 3723,3725, 3727,3729, 3731, 3733, 3735, 3737,3739 3741,3743, 3745, 3747, 3749, 3751,3753, 3755, 3757, 3759, 3761 3763, 3765,3767 3769, 3771 3773, 3773,3777 3779, 3781, 3783, 3785, 3787, 3789, 3791, 3793, 3795, 3797 3799, 3801, 3803, 380D, 3807 3809 381!, 3813, 3815, 3817 3819, 3821 3823, 3825, 3827 3829, 3831, 3833 3835, 3837,3839,3841,3843, 3845, 3847 3849, 3851,3853, 3855, 3857, 3859 3861, 3863 3865 3867 3869 3871 3873 3875, 3877, 3879 3881, 3883, 3885, 3887 3889, 3891, 3893, 3895, 3897, 3899, 3901 3903, 3905, 3907, 3909, 3911,3913,3915,3917 3919 3921,3923 3925 3927 3929,3931 3933 3935 3937,3939,3941,3943,3945,3947, 3949 3951, 3953 3953,3957, 3959, 3961, 3963, 3963 3967, 3969, 3971 3973, 3975, 3977, 3979, 3981, 3983, 3985, 3987,3989,3991,3993,3995,3997,3999 4001,4003 4005,4007 4009 4011 4013 4015 4017 4019 4021 4023, 4025, 4027, 4029 4031, 4033, 4035, 4037 4039, 4041, 4043 4045 4047, 4049 4051 4053, 4055 4057 4059, 4061, 4063, 4063, 4067, 4069, 4071, 4073 4075 4077 4079 4081 4083, 4085 4087, 4089 4091, 4093, 4095, 4097, 4099, 4101,4103,4105,4107 4109 4111,4113 4115 4117,4119,4121 4123 4125 4127 4129 4131 4133,4135 4137, 4139,4141,4143,4145,4147 4149 4151 4153,4153,4157 4159 4161 4163 4165 4167 4169,4171,4173 4175 -95- WO 2005/111066 PCT/IB2005/001775 4177, 4179, 4181, 4183, 4185,4187, 4189,4191, 4193, 4195, 4197, 4199, 4201, 4203, 4205, 4207, 4209, 4211, 4213, 4215, 4217, 4219, 4221, 4223, 4225, 4227,4229, 4231, 4233, 4235, 4237, 4239, 424], 4243, 4245, 4247,4249, 4251, 4253, 4255, 4257, 4259, 4261, 4263, 4265,4267, 4269, 4271, 4273, 4275, 4277, 4279, 4281, 4283, 4285, 4287, 4289, 4291, 4293 4295 4297, 4299, 4301 4303,4305, 4307, 4309, 4311, 4313, 4315, 4317, 4319, 4321, 4323 4325 4327 4329, 4331, 4333, 4335 4337 4339, 4341,4343, 4345, 4347, 4349, 4351, 4353, 4355, 4357, 4359, 4361,4363, 4365, 4367, 4369, 4371, 4373, 4375, 4377, 4-t79, 4381, 4383, 4385, 4387, 4389, 4391, 4393, 4395, 4397, 4399, 4401, 4403, 4405, 4407, 4409, 4411, 4413, 4415 4417 4419, 4421, 4423, 4425, 4427, 4429 4431, 4433, 4435 4437, 4439, 4441, 4443, 4445, 4447,4449, 4451, 4453, 4455, 4457,4459,4461, 4463, 4465 4467, 4469, 4471 4473, 4475, 4477, 4479 4481 4483, 4485 4487, 4489, 4491, 4493,4495,4497,4499, 4501, 4503, 4505, 4507, 4509, 4511, 4513, 4515, 4517, 4519, 4521, 4523, 4525, 4527, 4529, 4531, 4533, 4535, 4537, 4539, 4541, 4543, 4545, 4547, 4549, 4551, 4553, 4555, 4557, 4559, 4561, 4563 4565, 4567, 4569,4571,4573,4575, 4577, 4579, 4581, 4583, 4585, 4587, 4589, 4591, 4593, 4595, 4597, 4599 4601, 4603 4605, 4607 4609,4611,4613, 4615, 4617, 4619, 4621, 4623, 4625, 4627,4629,4631, 4633, 4635, 4637,4639, 4641, *643, 4645, 4647,4649,4651, 4653, 4655, 4657, 4659, 4661, 4663, 4665,4667, 4669, 4671,4673,4675,4677 4679,4681 4683,4685,4687,4689,4691 4693 4695,4697 4699 4701,4703 4705,4707, 4709, 4711, 4713,4715 4717 4719, 4721 4723, 4725,4727, 4729, 4731, 4733, 4735, 4737, 4739, 4741 4743 4745 4747, 4749, 4751 4753, 4755, 4757, 4759, 4761,4763, 4765, 4767, 4769, 4771, 4773, 4775, 4777, 4779, 4781, 4783, 4785, 4787,4789, 4791, 4793, 4795, 4797, 4799,4801, 4803, 4805, 4807,4809, 4811, 4813, 4815, 4817,4819, 4821, 4823, 4825, 4827, 4829, 4831, 4833, 4835, 4837, 4839 4841, 4843, 4845 4847 4849, 485], 4853, 4855, 4857, 4859, 4861,4863 4865,4867,4869 4871 4873 4875,4877 4879 4881,4883 4885 4887,4889,4891,4893,4895,4897, 4899, 4901 4903 4905, 4907, 4909, 4911 4913, 4915, 4917, 4919, 4921, 4923, 4925, 4927, 4929, 4931, 4933, 4935, 4937, 4939, 4941, 4943, 4945, 4947, 4949, 4951,4953, 4955, 4957, 4959, 4961, 4963, 4965, 4967, 4969, 4971, 4973 4975, 4977, 4979, 4981, 4983, 4985, 4987,4989 4991 4993, 4995 4997, 4999, 5001, 5003,5005, 5007 5009, 5011, 5013, 5015, 5017, 5019,5021 5023, 5025, 5027,5029 5031, 5033, 5035 5037 5039,5041,5043 5045,3047, 5049, 5051 5053 5055,5057,5059,5061 5063 5065,5067, 5069, 5071, 5073, 5075,5077 and 5079 11 Nucleic acid encoding the polypeptide of any one of claims 1 to 4 12 A composition comprising (a) polypeptide antibody and/or nucleic acid of an) preceding claim and (b) a pharmaceutically acceptable carrier 13 The composition of claim 12, further comprising a vaccine adjuvant 14 Nucleic acid polypeptide, or antibody of any one of claims I to 11 for use as a medicament 15 A method of treating a patient, comprising administering to the patient a therapeutically effective amount of the composition of claim 12 16 The use of nucleic acid, polypeptide, or antibody of any one of claims 1 to 11 in the manufacture of a medicament for treating or preventing disease and/or infection caused by H.influenzae 17 The method of claim 15 or the use of claim 16, for preventing otitis media, bronchitis conjunctivitis, sinusitis, a urinary tract infection pneumonia bacteremia septic arthritis, epiglotitis, pneumonia, empyema, pericarditis, cellulitis, osteomyelitis or meningitis -96-

Documents:

03769-kolnp-2006-abstract.pdf

03769-kolnp-2006-claims.pdf

03769-kolnp-2006-correspondence others.pdf

03769-kolnp-2006-correspondence-1.1.pdf

03769-kolnp-2006-description(complete).pdf

03769-kolnp-2006-form-1.pdf

03769-kolnp-2006-form-3.pdf

03769-kolnp-2006-form-5.pdf

03769-kolnp-2006-g.p.a.pdf

03769-kolnp-2006-international publication.pdf

03769-kolnp-2006-international search authority report.pdf

03769-kolnp-2006-pct request form.pdf

03769-kolnp-2006-priority document.pdf

3769-KOLNP-2006-(26-11-2014)-ABSTRACT.pdf

3769-KOLNP-2006-(26-11-2014)-CLAIMS.pdf

3769-KOLNP-2006-(26-11-2014)-CORRESPONDENCE.pdf

3769-KOLNP-2006-(26-11-2014)-FORM-1.pdf

3769-KOLNP-2006-(26-11-2014)-FORM-2.pdf

3769-KOLNP-2006-ABSTRACT 1.1.pdf

3769-KOLNP-2006-AMANDED CLAIMS.pdf

3769-KOLNP-2006-DESCRIPTION(COMPLETE) 1.1.pdf

3769-KOLNP-2006-ENGLISH TRANSLATION.pdf

3769-KOLNP-2006-EXAMINATION REPORT REPLY RECIEVED.pdf

3769-KOLNP-2006-FORM 1-1.1.pdf

3769-kolnp-2006-form 18.pdf

3769-KOLNP-2006-FORM 2.pdf

3769-KOLNP-2006-FORM 3-1.1.pdf

3769-KOLNP-2006-FORM 5-1.1.pdf

3769-KOLNP-2006-FORM 6.pdf

3769-KOLNP-2006-OTHERS PCT FORM.pdf

3769-KOLNP-2006-OTHERS.pdf

3769-KOLNP-2006-PA.pdf

3769-KOLNP-2006-PETITION FOR DELAY IN FILING.pdf

3769-KOLNP-2006-PETITION UNDER RULE 137.pdf