Indian Patents
Title of Invention

BILE ACID DERIVATIVES AS FXR LIGANDS FOR THE PREVENTION OR TREATMENT OF FXR-MEDIATED DISEASES OR CONDITIONS
Abstract The present invention relates to compounds of formula (I) wherein R is hydrogen or alpha-hydroxy, the hydroxyl group in position 7 is in the alpha or beta position; and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.
Full Text BILE ACID DERIVATIVES AS FXR LIGANDS FOR THE PREVENTION OR
TREATMENT OF FXR-MEDIATED DISEASES OR CONDITIONS
Field of the invention
The present invention relates to Famesoid X receptor (FXR) modulators
which can be used for the treatment of cholestatic disorders, in particular to bile acid
derivatives wherein the C6 contains an ethyl and the C24 carboxy group is
transformed into a sulphate group.
Background of the invention
Famesoid X Receptor (FXR) is an orphan nuclear receptor initially identified
from a rat liver cDNA library (BM. Forman, et al., Cell 81:687-693 (1995)) that is
most closely related to the insect ecdysone receptor. FXR is a member of the nuclear
receptor family of ligand-activated transcription factors that includes receptors for
the steroid, retinoid, and thyroid hormones (DJ. Mangelsdorf, et al., Cell 83:841-850
(1995)). Northern and in situ analysis show that FXR is most abundantly expressed
in the liver, intestine, kidney, and adrenal (BM. Forman, et al., Cell 81:687-693
(1995) and W. Seol, et al., Mol. Endocrinnol. 9:72-85 (1995)). FXR binds to DNA
as a heterodimer widi the 9-cis retinoic acid receptor (RXR). The FXR/RXR
heterodimer preferentially binds to response elements composed of two nuclear
receptor half sites of the consensus AG(G/T)TCA organized as an inverted repeat
and separated by a single nucleotide (IR-1 motif) (BM. Forman, et al., Cell 81:687-
693 (1995)). An early report showed that rat FXR is activated by micromolar
concentrations of farnesoids such as famesol and juvenile hormone (BM. Forman, et
al., Cell 81:687-693 (1995)). However, these compounds failed to activate the
mouse and human FXR, leaving the nature of the endogenous FXR ligand in doubt.
Several naturally-occurring bile acids bind to and activate FXR at physiological

concentrations (PCT WO 00/37077, published 29 June 2000)). As discussed therein,
the bile acids that serve as FXR ligands include chenodeoxycholic acid (CDCA),
deoxycholic acid (DCA), lithocholic acid (LCA), and the taurine and glycine
conjugates of these bile acids.
Bile acids are cholesterol metabolites that are formed in the liver and secreted
into the duodenum of the intestine, where they have important roles in the
solubilization and absorption of dietary lipids and vitamins. Most bile acids (~95%)
are subsequently reabsorbed in the ileum and returned to the liver via the
enterohepatic circulatory system. The conversion of cholesterol to bile acids in the
liver is under feedback regulation: bile acids down-regulate the transcription of
cytochrome P450 7a (CYP7a), which encodes the enzyme that catalyzes the rate
limiting step in bile acid biosynthesis. There is data to suggest that FXR is involved
in the repression of CYP7a expression by bile acids, although the precise mechanism
remains unclear (DW. Russell, Cell 97:539-542 (1999)). In the ileum, bile acids
induce the expression of the intestinal bile acid binding protein (IBABP), a
cytoplasmic protein which binds bile acids with high affinity and may be involved in
their cellular uptake and trafficking. Two groups have now demonstrated that bile
acids mediate their effects on IBABP expression through activation of FXR, which
binds to an IR-1 type response element that is conserved in the human, rat, and
mouse IBABP gene promoters. Thus FXR is involved in both the stimulation
(IBABP) and the repression (CYP7a) of target genes involved in bile acid and
cholesterol homeostasis.
EP 1392714 discloses 3α,7α-dihydroxy-6α-ethyl-5P-cholan-24-oic acid
(hereinafter also referred to as 6-ethyl-chenodeoxycholic acid, 6-EDCA), solvates
and amino acids conjugates thereof as FXR agonists, which can be used in the
preparation of medicaments for the prevention or treatment of FXR-mediated
diseases or conditions.

EP 1568796 discloses 6-ethyl-ursodeoxycholic acid (6-EUDCA) derivatives
as FXR agonists and their use in the prevention or treatment of FXR-mediated
diseases or conditions.
Brief summary of the invention
According to a first aspect, the present invention provides compounds of
formula (I):
wherein R is hydrogen or alpha-hydroxy,
the hydroxyl group in position 7 is in the alpha or beta position;
and pharmaceutically acceptable salts, solvates or amino acid conjugates
thereof.
In one embodiment, the compound of formula (I) is in the form of a
chenodeoxycholic acid derivative. In another embodiment, the compound of
formula (I) is in the form of a ursodeoxycholic acid derivative. In still another
embodiment, the compound of formula (I) is in the form of a cholic acid derivative.
In another embodiment, the compound of formula (I) is in the form of a
triethyl ammonium salt:


6. In another embodiment, the compound of formula (I) is in the form of a
sodium salt:
In another aspect, the present invention provides a method for the prevention
or treatment of an FXR mediated disease or condition. The method comprises
administering a therapeutically effective amount of a compound of formula (I). The
present invention also provides the use of a compound of formula (I) for the
preparation of a medicament for the prevention or treatment of an FXR mediated
disease or condition.
In certain embodiments, the FXR-mediated disease or condition is
cardiovascular disease, atherosclerosis, arteriosclerosis, hypercholesteremia, or
hyperlipidemiachronic liver disease, gastrointestinal disease, renal disease,
cardiovascular disease, metabolic disease, cancer (i.e., colorectal cancer), or
neurological indications such as stroke. In certain embodiments, the chronic liver
disease is primary biliary cirrhosis (PBC), cerebrotendinous xanthomatosis (CTX),
primary sclerosing cholangitis (PSC), drug induced cholestasis, intrahepatic
cholestasis of pregnancy, parenteral nutrition associated cholestasis (PNAC),
bacterial overgrowth or sepsis associated cholestasis, autoimmune hepatitis, chronic
viral hepatitis, alcoholic liver disease, nonalcoholic fatty liver disease (NAFLD),
nonalcoholic steatohepatitis (NASH), liver transplant associated graft versus host
disease, living donor transplant liver regeneration, congenital hepatic fibrosis,
choledocholithiasis, granulomatous liver disease, intra- or extrahepatic malignancy,

Sjogren's syndrome, Sarcoidosis, Wilson's disease, Gaucher's disease,
hemochromatosis, or alpha 1 -antitrypsin deficiency. In certain embodiments, the
gastrointestinal disease is inflammatory bowel disease (IBD) (including Crohn's
disease and ulcerative colitis), irritable bowel syndrome (IBS), bacterial overgrowth,
malabsorption, post-radiation colitis, or microscopic colitis. In certain
embodiments, the renal disease is diabetic nephropathy, focal segmental
glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic
glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis,
or polycystic kidney disease. In certain embodiments, the cardiovascular disease is
atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, or
hypertriglyceridemia. In certain embodiments, the metabolic disease is insulin
resistance, Type I and Type II diabetes, or obesity.
In another aspect, the present invention provides a pharmaceutical
composition comprising a compound of formula (I) and a phannaceutically
acceptable carrier or diluent.
In another aspect, the present invention provides a process for preparing a
compound of formula (I) and phannaceutically acceptable salts, solvates or amino
acid conjugates thereof.
Brief description of the figures
Figure 1 shows the transactivation assay result in a graph format. Each data
point is the average of triplicate assays. CTRL: control; INT-747: 6-ECDCA; UPF-
987.
Figure 2 shows the dose response of INT-747 and UPF-987 in the
transactivation assay.
Figure 3 shows FXR target gene expression in vitro. The result is the mean
of two quantitative Real-Time PCR experiments.
Figure 4 shows representative FXR target gene expression in cells derived

from mouse liver in vivo. The data is the mean of two quantitative Real-Time PCR
experiments.
Figure 5 shows the effect of UPF-987 on weight loss induced by TNBS.
Figure 6 shows the effect of UPF-987 on stool consistency.
Figure 7 shows the effect of UPF-987 on mucosal damage score.
Figure 8 shows the effect of UPF-987 on mouse colon genes expression. The
result is the mean of two quantitative Real-Time PCR experiments.
Figure 9 shows the effect of UPF-987 on plasmatic bilirubin in ANIT-induced
cholestasis.
Figure 10 shows the effect of UPF-987 on plasmatic AST in ANIT-induced
cholestasis.
Figure 11 shows the effect of UPF-987 on plasmatic ALP in ANIT-induced
cholestasis.
Figure 12 shows the effect of UPF-987 on plasmatic gammaGT in ANIT-
induced cholestasis.
Figure 13 shows the effect of UPF-987 on plasmatic cholesterol in ANIT-
induced cholestasis.
Figure 14 shows the effect of UPF-987 on body weight in ANIT-induced
cholestasis.
Figure 15 shows the effect of UPF-987 on liver weight in ANIT-induced
cholestasis.
Figure 16 shows the effect of UPF-987 on FXR target genes expression in the
liver of ANIT-induced cholestatic rat. The result is the mean of two quantitative
Real-Time PCR experiments.
Figure 17 shows the effect of INT-1103 on plasmatic bilirubin in ANIT-
induced cholestasic rats.
Figure 18 shows the effect of INT-1103 on plasmatic AST in ANIT-induced

cholestasic rats.
Figure 19 shows the effect of INT-1103 on plasmatic ALT in ANIT-induced
cholestasic rats.
Figure 20 shows the effect of INT-1103 on plasmatic ALP in ANIT-induced
cholestasic rats.
Figure 21 shows the effect of INT-1103 on plasmatic gammaGT in ANIT-
induced cholestasic rats.
Figure 22 shows the effect of INT-1103 on body weight in ANIT-induced
cholestasic rats.
Figure 23 shows the resulting liver ratio (liver weight/body weight x 100).
Figure 24 shows the effect of INT-1103 on plasmatic bilirubin in BDL-
induced cholestasic rats.
Figure 25 shows the effect of INT-1103 on plasmatic AST in BDL-induced
cholestasic rats.
Figure 26 shows the effect of INT-1103 on plasmatic ALT in BDL-induced
cholestasic rats.
Figure 27 shows the effect of INT-1103 on plasmatic ALP in BDL-induced
cholestasic rats.
Figure 28 shows the effect of INT-1103 on plasmatic gammaGT in BDL-
induced cholestasic rats.
Figure 29 shows the effect of INT-1103 on body weight in BDL-induced
cholestasic rats.
Figure 30 shows the resulting liver ratio (liver weight/body weight x 100).
Figure 31 shows the effect of INT-1103 and INT-747 on bile flow in naive
rats.
Figure 32 shows the effect of INT-1103 and INT-747 on bile flow in estrogen
colestatic rats.

Figure 33 shows the effect of INT-1103 and INT-747 on liver ratio in
estrogen colestatic rats.
Figure 34 shows the effect of INT-1103 and INT-747 on body weight in
estrogen colestatic rats.
Figure 35 shows the resulting insulin gene expression by Quantitative Real-
Time PCR.
Figure 36 shows the surface tension (dyne/cm) plotted against the logarithm
of the bile salt concentration (mM) in water.
Figure 37 shows the surface tension (dyne/cm) plotted against the logarithm
of the bile salt concentration (mM) in NaCl 0.15 M.
Figure 38 shows the secretion rate of taurine conjugated INT-747. Data are
reported as concentration in bile and should be corrected by the bile volume.
Figure 39 shows the secretion rate of glycine conjugated INT-747. Data are
reported as concentration in bile and should be corrected by the bile volume.
Figure 40 shows the secretion rate of INT-747. Data are reported as
concentration in bile and should be corrected by the bile volume.
Figure 41 shows the secretion rate of INT-747 epimers. Data are reported as
concentration in bile and should be corrected by the bile volume.
Figure 42 shows the secretion rate of taurine conjugated epimers of INT-747.
Data are reported as concentration in bile and should be corrected by the bile
volume.
Figure 43 shows the secretion rate of INT-1103. Data are reported as
concentration in bile and should be corrected by the bile volume.
Figure 44 shows the secretion rate of INT-1103 and its main metabolite 3-
Glucuronides. The relative amount are expressed as analytical signal. Data are
reported as concentration in bile and should be corrected by the bile volume.
Figure 45 shows the secretion rate of INT-1103 main metabolites identified in

bile using mass spectrometry. Data are reported as concentration in bile and should
be corrected by the bile volume.
Figure 46 shows the secretion rate of INT-1103 main metabolites identified in
bile using mass spectrometry zoom display. Data are reported as concentration in
bile and should be corrected by the bile volume.
Figure 47 shows the metabolic stability of INT-747 and INT-1103 in human
stools cultures. Chenodeoxycholic was used as a reference natural analogue.
Figure 48 shows the metabolic stability of INT-1103 in simulated pancreatic
fluid. Olive oil was used as a reference as reported in the USP protocol. The
compound is very stable and the ester bond (sulphate) is not hydrolyzed by
pancreatic esterases, suggesting a high stability in human duodenal and upper
intestine content.
Detailed description of the invention
The present invention relates to compounds of general formula (I):

wherein R is hydrogen or alpha-hydroxy,
the hydroxyl group in position 7 is in the alpha or beta position;
and pharmaceutically acceptable salts, solvates or amino acid conjugates
thereof.
Suitable pharmaceutically acceptable salts according to the present invention
will be readily determined by one skilled in the art and will include, for example,
basic salts such as alkali or alkaline-earth metallic salts made from aluminium,

calcium, lithium, magnesium, potassium, sodium, and zinc or organic salts made
from N,N'-dibenzylethyIenediamine, chlorprocaine, choline, diethanolamine,
ethylendiamine, meglumine (N-methylglucamine), and procaine. Salts with
pharmaceutically acceptable amines such as lysine, arginine, tromethamine,
triethylamine and the like can also be used. Such salts of the compounds of formula
(I) may be prepared using conventional techniques, from the compound of Formula
(I) by reacting, for example, the appropriate base wim the compound of Formula (I).
When used in medicine, the salts of a compound of formula (I) should be
pharmaceutically acceptable, but pharmaceutically unacceptable salts may
conveniently be used to prepare the corresponding free base or pharmaceutically
acceptable salts thereof.
As used herein, the term "solvate" is a crystal form containing the compound
of formula (I) or a pharmaceutically acceptable salt thereof and either a
stoichiometric or a non-stoichiometric amount of a solvent. Solvents, by way of
example, include water, methanol, ethanol, or acetic acid. Hereinafter, reference to a
compound of formula (I) is to any physical form of that compound, unless a
particular form, salt or solvate thereof is specified.
As used herein, the term "amino acid conjugates" refers to conjugates of the
compounds of formula (I) with any suitable amino acid. Preferably, such suitable
amino acid conjugates of the compounds of formula (I) will have the added
advantage of enhanced integrity in bile or intestinal fluids. Suitable amino acids
include but are not limited to glycine and taurine. Thus, the present invention
encompasses the glycine and taurine conjugates of any of die compounds of formula
(I)-
In one embodiment, the compound of formula I is a chenodeoxycholic acid
derivative, wherein the hydroxyl group in 7 is in the alpha position and R is
hydrogen.

In another embodiment, the compound of formula I is a ursodeoxycholic acid
derivative, wherein the hydroxyl group in 7 is in the beta position and R is
hydrogen.
In another embodiment, the compound of formula I is a cholic acid
derivative, wherein the hydroxyl group in 7 is in the alpha position and R is alpha-
hydroxy.
Hereinafter all references to "compounds of formula (I)" refer to compounds
of formula (I) as described above together with their and pharmaceutically
acceptable salts, solvates or amino acid conjugates thereof.
The compounds of formula I may be prepared starting from the 6-ethyl-7-
keto-cholic acids, prepared as disclosed in EP 1392714 and EP 1568796, suitably
protected at the 3-hydroxy moiety, by a reaction sequence comprising the
transformation of the C24 carboxy group into a iodine atom, the conversion of the
latter into an hydroxyl group, reduction of the 7-keto group to give the
corresponding 3-alpha or 3-beta hydroxyl group, the selective sulfonylation of the
C24 hydroxy group and the deprotection of the 3-hydroxy group.
The reaction scheme and the reagents used in each step are reported in the
following scheme showing the preparation of 3α,7α,23-trihydroxy-6α-ethyl-24-nor-
5β-cholan-23 -sulphate in the form of triethylammonium salt (UPF-987 or compound
(9) below). The same scheme may be adapted, by suitably substituting the reagents
and/or starting materials and optionally by also changing reaction sequences and
protective groups, for the preparation of other compounds of formula I.


The reaction scheme and the reagents used in each step are reported in the
following scheme below showing the preparation of 3α,7α,23-trihydroxy-6α-ethyl-
24-nor-5β-cholan-23-sulphate in the form of sodium salt (INT-1103 or compound
(10) below). The same scheme may be adapted, by suitably substituting the reagents
and/or starting materials and optionally by also changing reaction sequences and
protective groups, for the preparation of other pharmaceutically acceptable salt
forms of formula I.


As explained in greater detail in the experimental section, compound 9 was
tested in a cell-free assay and transactivation assay in a human hepatocyte cell line
and in vivo in intact mice and rats rendered cholestatic by administration of alfa-
nafthylsiotiocyanate (ANIT). In the FRET assay, the compound was found to be
approximately 1000 fold more potent than chenodeoxycholic acid (CDCA) in
activating FXR. In the tranactivation assay Compound 9 caused 2 fold induction of
bile acid transporter, BSEP (bile salt export pump) and the small heterodimeric
partner (SHP, an atypical nuclear receptor that lacks a ONA-binding domain).

Further it potently suppressed Cyp7Al, SREPB-lc and the fatty acid synthase
(FAS), thus indicating that FXR activation by the compound of the invention allows
selective modulation of genes involved in bile acid synthesis as well as in lipid,
cholesterol and glucose metabolism. Therefore, compounds of formula (I) act as
selective modulators of the bile acid transporters and increase the flux of biliary
acids in the liver; furthermore, they potently regulate genes involved in lipid and
cholesterol metabolism and for this reason they can be used for the prevention or
treatment of FXR-mediated diseases or conditions, which include chronic liver
disease (involving one or more of cholestasis, steatosis, inflammation, fibrosis, and
cirrhosis), gastrointestinal disease, renal disease, cardiovascular disease, and
metabolic disease. Chronic liver diseases which may be prevented or treated using
compounds of formula (I) include but are not limited to primary biliary cirrhosis
(PBC), primary sclerosing cholangitis (PSC), cerebrotendinous xanthomatosis
(CTX), drug induced cholestasis, intrahepatic cholestasis of pregnancy, parenteral
nutrition associated cholestasis (PNAC), bacterial overgrowth or sepsis associated
cholestasis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease,
nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH),
liver transplant associated graft versus host disease, living donor transplant liver
regeneration, congenital hepatic fibrosis, choledocholithiasis, granulomatous liver
disease, intra- or extrahepatic malignancy, Sjogren's syndrome, Sarcoidosis,
Wilson's disease, Gaucher's disease, hemochromatosis, and alpha 1-antitrypsin
deficiency. Gastrointestinal diseases which may be prevented or treated using
compounds of formula (I) include but are not limited to inflammatory bowel disease
(IBD) (including Crohn's disease and ulcerative colitis), irritable bowel syndrome
(IBS), bacterial overgrowth , malabsorption, post-radiation colitis, and microscopic
colitis. Renal diseases which may be prevented or treated using compounds of
formula (I) include but are not limited to diabetic nephropathy, focal segmental

glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic
glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis,
and polycystic kidney disease. Cardiovascular diseases which may be prevented or
treated using compounds of formula (I) include but are not limited to
atherosclerosis, arteriosclerosis, dyslipidemia, hypercholesterolemia, and
hypertriglyceridemia. Metabolic diseases which may be prevented or treated using
compounds of formula (I) include but are not limited to insulin resistance, Type I
and Type II diabetes, and obesity.
The methods of the present invention comprise the step of administering a
therapeutically effective amount of a compound of formula (I). As used herein, the
term "therapeutically effective amount" refers to an amount of a compound of
formula (I) which is sufficient to achieve the stated effect. Accordingly, a
therapeutically effective amount of a compound of formula (I) used in a method for
the prevention or treatment of FXR mediated diseases or conditions will be an
amount sufficient to prevent or treat the FXR mediated disease or condition.
Similarly, a therapeutically effective amount of a compound of formula (I) for use in
a method for the prophylaxis or treatment of cholestatic liver diseases or increasing
bile flow will be an amount sufficient to increase bile flow to the intestine.
The amount of the compound of formula (I) which is required to achieve the
desired biological effect will depend on a number of factors such as the use for
which it is intended, the means of administration, and the recipient, and will be
ultimately at the discretion of the attendant physician or veterinarian. In general, a
typical daily dose for the treatment of FXR mediated diseases and conditions, for
instance, may be expected to lie in the range of from about 0.01 mg/kg to about 100
mg/kg. This dose may be administered as a single unit dose or as several separate
unit doses or as a continuous infusion. Similar dosages would be applicable for the
treatment of other diseases, conditions and therapies including the prophylaxis and

treatment of cholestatic liver diseases.
Thus, in a further aspect, the present invention provides pharmaceutical
compositions comprising, as active ingredient, a compound of formula (I) together,
and/or in admixture, with at least one pharmaceutical carrier or diluent. These
pharmaceutical compositions may be used in the prophylaxis and treatment of the
foregoing diseases or conditions.
The carrier must be pharmaceutically acceptable and must be compatible
with, i.e. not have a deleterious effect upon, the other ingredients in the composition.
The carrier may be a solid or liquid and is preferably formulated as a unit dose
formulation, for example, a tablet which may contain from 0.05 to 95% by weight of
the active ingredient. If desired, other physiologically active ingredients may also be
incorporated in the pharmaceutical compositions of the invention.
Possible formulations include those suitable for oral, sublingual, buccal,
parenteral (for example subcutaneous, intramuscular, or intravenous), rectal, topical
including transdermal, intranasal and inhalation administration. Most suitable means
of administration for a particular patient will depend on the nature and severity of
the disease or condition being treated or the nature of the therapy being used and on
the nature of the active compound, but where possible, oral administration is
preferred for the prevention and treatment of FXR mediated diseases and conditions.
Formulations suitable for oral administration may be provided as discrete
units, such as tablets, capsules, cachets, lozenges, each containing a predetermined
amount of the active compound; as powders or granules; as solutions or suspensions
in aqueous or non-aqueous liquids; or as oil-in-water or water-in-oil emulsions.
Formulations suitable for sublingual or buccal administration include
lozenges comprising the active compound and, typically a flavoured base, such as
sugar and acacia or tragacanth and pastilles comprising the active compound in an
inert base, such as gelatine and glycerine or sucrose acacia.

Formulations suitable for parenteral administration typically comprise sterile
aqueous solutions containing a predetermined concentration of the active compound;
the solution is preferably isotonic with the blood of the intended recipient.
Additional formulations suitable for parenteral administration include formulations
containing physiologically suitable co-solvents and/or complexing agents such as
surfactants and cyclodextrins. Oil-in-water emulsions are also suitable formulations
for parenteral formulations. Although such solutions are preferably administered
intravenously, they may also be administered by subcutaneous or intramuscular
injection.
Formulations suitable for rectal administration are preferably provided as
unit-dose suppositories comprising the active ingredient in one or more solid carriers
forming the suppository base, for example, cocoa butter.
Formulations suitable for topical or intranasal application include ointments,
creams, lotions, pastes, gels, sprays, aerosols and oils. Suitable carriers for such
formulations include petroleum jelly, lanolin, polyethyleneglycols, alcohols, and
combinations thereof.
Formulations of the invention may be prepared by any suitable method,
typically by uniformly and intimately admixing the active compound with liquids or
finely divided solid carriers or both, in the required proportions and then, if
necessary, shaping the resulting mixture into the desired shape.
For example a tablet may be prepared by compressing an intimate mixture
comprising a powder or granules of the active ingredient and one or more optional
ingredients, such as a binder, lubricant, inert diluent, or surface active dispersing
agent, or by moulding an intimate mixture of powdered active ingredient and inert
liquid diluent.
Suitable formulations for administration by inhalation include fine particle
dusts or mists which may be generated by means of various types of metered dose

pressurised aerosols, nebulisers, or insufflators.
For pulmonary administration via the mouth, the particle size of the powder
or droplets is typically in the range 0.5-10 μm, preferably 1-5 μm, to ensure delivery
into the bronchial tree. For nasal administration, a particle size in the range 10-500
μm is preferred to ensure retention in the nasal cavity.
Metered dose inhalers are pressurised aerosol dispensers, typically containing
a suspension or solution formulation of the active ingredient in a liquefied
propellant. During use, these devices discharge the formulation through a valve
adapted to deliver a metered volume, typically from 10 to 150 μl, to produce a fine
particle spray containing the active ingredient. Suitable propellants include certain
chlorofluorocarbon compounds, for example, dichlorodifluoromethane,
trichlorofluoromethane, dichlorotetrafluoroethane and mixtures thereof. The
formulation may additionally contain one or more co-solvents, for example, ethanol
surfactants, such as oleic acid or sorbitan trioleate, anti-oxidants and suitable
flavouring agents.
Nebulisers are commercially available devices that transform solutions or
suspensions of the active ingredient into a therapeutic aerosol mist either by means
of acceleration of a compressed gas typically air or oxygen, through a narrow
venturi orifice, or by means of ultrasonic agitation. Suitable formulations for use in
nebulisers consist of the active ingredient in a liquid carrier and comprise up to 40%
w/w of the formulation, preferably less than 20% w/w. The carrier is typically water
or a dilute aqueous alcoholic solution, preferably made isotonic with body fluids by
the addition of, for example, sodium chloride. Optional additives include
preservatives if the formulation is not prepared sterile, for example, methyl hydroxy-
benzoate, anti-oxidants, flavouring agents, volatile oils, buffering agents and
surfactants.
Suitable formulations for administration by insufflation include finely

comminuted powders which may be delivered by means of an insufflator or taken
into the nasal cavity in the manner of a snuff. In the insufflator, the powder is
contained in capsules or cartridges, typically made of gelatin or plastic, which are
either pierced or opened in situ and the powder delivered by air drawn through the
device upon inhalation or by means of a manually-operated pump. The powder
employed in the insufflator consists either solely of the active ingredient or of a
powder blend comprising the active ingredient, a suitable powder diluent, such as
lactose, and an optional surfactant. The active ingredient typically comprises from
0.1 to 100 w/w of the formulation.
In addition to the ingredients specifically mentioned above, the formulations
of the present invention may include other agents known to those skilled in the art of
pharmacy, having regard for the type of formulation in issue. For example,
formulations suitable for oral administration may include flavouring agents and
formulations suitable for intranasal administration may include perfumes.
Therefore, according to a further aspect of the present invention, there is
provided the use of the compounds of formula (I) in the preparation of medicaments
for the prevention or treatment of FXR mediated diseases or conditions.
The invention will be hereinafter illustrated in more detail in the following
Examples.
EXAMPLE 1
Chemistry. Melting points were determined with a Buchi 535 electrothermal
apparatus and are uncorrected. NMR spectra were obtained with a Broker AC 200
MHz spectromer, and the chemical shifts are reported in parts per million (ppm).
The abbreviations used are as follows: s, singlet; bs, broad singlet; d, doublet; dd,
double doublet; m, multiplet; q, quartet, t, triplet. Flash column chromatography was
performed using Merck silica gel 60 (0.040-0.063 mm). TLC was carried out on
precoated TLC plates with silica gel 60 F-254 (Merck). Spots were visualized with

phosphomolybdate reagent (5% solution in EtOH). The reactions were carried out
under a nitrogen atmosphere.
3a-Terrahydropyranyloxy-7-keto-5/?-choIan-24-oic Acid (2)
3,4-dihydro-2H-pyrane (1.74 ml, 19 mmol) in dioxane (12 ml) was dropped
slowly to a solution of p-Toluenesulfonic acid (115 mg, 0.6 ml) and 6a-ethyl-7-
ketolithocholic acid (5.0 g, 12 mmol) in dioxane (55 ml). The reaction mixture was
stirred at room temperature for 2 hours. Water (40 ml) was then added, and the
mixture was partially concentrated under vacuum and extracted with EtOAc (4 x 25
ml). The combined organic fractions were washed with brine (1 x 50 ml), dried over
anhydrous Na2SO4 and evaporated under vacuum to afford 6 g of compound 2. The
crude derivative was used for the next step without further purification.
1H NMR: (200 MHz, CDC13) δ: 0,68 (3H, s, C-18 Me); 0,8 (3H, t, 7= 4 Hz,
C-26); 0,98 (3H, d, 7=6,5, C-21 Me); 1,17 (3H, s, C-19 Me); 3.4-3,7 (4H, m, C-23
CH2, C-6); 3,8-3,9 (1H, m, C-3); 2,6-2,8 (1H, m, C-6).
13C NMR (50,3 MHz, CDCl3) 3: 212,41, 179,42, 54,75, 52,10, 21,79, 18,30,
12,04.
3α-Tetrahydropyranyloxy-7-keto-24-nor-5β-cholan-23-I (3)
Under irradiation with a 300 w tungsten lamp, iodine (5 g, 20 mmol) in CCl4
(75 ml) was added dropwise to a solution of 2 (5.5 g, 11 mmol) and lead tetra-
acetate (4.9 g, 11 mmol) in CC14 (200 ml). The reaction mixture was stirred until the
colour was permanent (18 h). The mixture was cooled and filtered on celite. The
organic phase was washed with a 5% Na2S2O3 solution, 5% NaOH, brine (15 ml),
dried over anhydrous Na2S04 and evaporated under vacuum. The residue was
purified by silica gel flash chromatography using a mixture of light
petroleum/EtOAc 95/5 as mobile phase to give 4.6 g of compound 3 (40% yield).
1H NMR: (200 MHz, CDCl3) δ: 0,54 (3H, s, C-18 Me); 0.68 (3H, t, 7=7,36
MHz, C-25); 0,79 (3H, d, 7=5,2 MHz, C-21); 1,09 (3H, s, C-19); 2,55 (1H, m, C-

26); 2,96 (1H, m, C-23); 3,16 (1H, m, C-23); 3,20 (1H, m, C-6'); 3,76 (1H, m, C-
6'); 4,59 (1H, m, C-T).
13C NMR (50,3 MHz, CDCl3) δ: 212.50, 96.56, 95.99, 74.90, 74.60, 62.63,
54.63, 52.08, 50.78, 50.58, 49.84, 48.91, 43.38, 42.70, 40.11, 38.90, 36.92, 35.81,
34.34, 34.10, 31.07, 30.06, 29.61, 28.26, 27.85, 25.97, 25.42, 24.54, 23.49, 21.75,
19.76, 19.59, 18.88, 17.84, 12.05, 11.98, 5.26.
3a-hydroxy-6α-ethyl-7-keto-24-nor-5β-cholan-23-I (4)
The compound 3 (2.2 g, 3.8 mmol) was stirred in a solution of HC1 37% in
THF (50 ml) overnight at room temperature. The reaction mixture was washed with
a saturated solution of NaHC03 (20 ml), H20 (20 ml), brine (20 ml) dried over
Na2S04 and evaporated under vacuum to afford 1.4 g of compound 4 (80% yield).
The crude derivative was used for the next step without further purification.
1H NMR: (200 MHz, CDCl3) δ: 0,68 (3H, s, C-l 8 Me); 0.82 (3H, t, .7=7,36
MHz, C-21); 0,93 (3H, t, 7=5,2 Hz, C-21 Me); 1,26 (3H, s, C-19 Me); 3.08 (1H, m,
C-23); 3,37 (1H, m, C-23); 3.61 (1H, m, C-3).
13C NMR (50,3 MHz, CDCl3) 6: 212.81, 71.09, 54.63, 51.93, 50.60, 49.84,
48.93, 43.64, 42.70, 40.11, 38.92, 36.92, 35.63, 34.19, 31.71, 31.06, 29.78, 28.25,
27.89, 25.96, 25.42, 24.51, 23.48, 21.79, 19.56, 18.77, 18.22, 17.85, 12.02, 11.95,
5.22.
3α-terr-ButhyIdimethylsiIyloxy-6α-ethyl-7-keto-24-nor-5β-cholan-23-I (5)
To a solution of 4 (1.4 g, 2.8 mmol) in CH2C12 (30 ml),
tert-butyldimethylsilylchloride (496 mg, 3.22 mmol) and imidazole (230 mg, 3.36
mmol) were added and the mixture was stirred overnight at room temperature. The
reaction mixture was washed with a saturated solution of NaHC03 (30 ml), brine (30
ml), and dried over anhydrous Na2SO4. The organic phase was evaporated under
vacuum to afford 1.5 g of compound 5 (87% yield). The crude derivative was used for
the next step without further purification.

1H NMR: (200 MHz, CDCl3) δ: 0.02 (6H, s, (CH3)2Si); 0,65 (3H, s,
C-18 Me); 0.85 (9H, s, (CH3)3CSi); 1,19 (3H, s, C-19); 3,16 (1H, m, C-23); 3.30
(1H, m, C-23); 3.48 (1H m, C-3).
13C NMR (50,3 MHz, CDC13) δ: 212.56, 71.93, 54.63, 51.89, 50.62, 49.81,
48.90, 43.34, 42.72, 40.11, 38.89, 36.92, 35.62, 34.37, 31.97, 30.34, 28.26, 25.83,
25.61, 24.57, 23.48, 21.77, 18.81, 17.84, 12.02, 11.92, 5.27, -4.70.
3a-tert-ButhyldimethylsiIyloxy-6α-ethyI-7-keto-24-nor-5β-cholan-23-oIe
(6)
To a solution of 5 (1.2 g, 1.96 mmol) in acetone (12 ml), Ag2C03
(1.1 g, 3.9 mmol) was added. The reaction mixture was refluxed overnight and then
cooled to r.t., filtered on celite washed with acetone and the combined organic
phases were concentrated to yield 1 g of compound 6. The crude derivative was used
for the next step without further purification.
1H NMR: (200 MHz, CDCl3) δ: 0.02 (6H, s, (CH3)2Si); 0,65 (3H, s,
C-18 Me); 0.88 (9H, s, (CH3)3CSi); 3,16 (1H, m, C-23); 3.37 (1H m, C-3); 3.69 (2H.
m, C-23).
13C NMR (50,3 MHz, CDC13) δ: 212.64, 71.96, 60.84, 55.27, 50.66, 49.87,
48.94, 43.37, 42.69, 38.94, 35.64, 34.39, 32.70, 32.00, 30.36, 29.68, 28.53, 25.85,
24.64, 23.50, 21.80, 18.84,12.01, 11.94, -4.68.
3α-tert-Buthyldimethylsilyloxy-7α-hydroxy-6α-ethyl-24-nor-5β-cholan-
23-ole (7)
To a solution of 6 (1 g, 1.96 mmol) in a mixture of THF (50 ml) and H2O
(12.5ml), NaBH4 (740 mg, 19.6 mmol) was added and the mixture was stirred at
room temperature for 1 hours and 30 minutes. The reaction solution was partially
concentrated under vacuum and extracted with CHC13 (3 x 20 ml). The combined
organic layers were washed with brine (1 x 50 ml), dried over anhydrous Na2SO4,
and evaporated under vacuum. The crude residue was purified by silica gel flash

chromatography using a mixture of CH2Cl2:MeOH 99:1 as mobile phase to give 0.8
g of 7 (81% yield).
1H NMR: (200 MHz, CDCl3) δ: 0.04 (6H, s, (CH3)2Si); 0,66 (3H, s,
C-18 Me); 0.88 (9H, s, (CH3)3CSi); 3,16 (1H, m, C-23); 3.37 (1H m, C-3); 3.69 (1H,
m, C-7, 2H, m, C-23).
13C NMR (50,3 MHz, CDCl3) δ: 73.30, 70.85, 60.82, 56.31, 50.55, 45.28,
42.77, 41.17, 40.03, 39.62, 38.95, 35.74, 35.52, 34.10, 33.14, 32.93, 31.01, 28.40,
25.98, 23.70, 23.18, 22.22, 20.72, 18.79,11.62, -4.60.
3a-tert-Buthyldimethylsilyloxy-7α-hydroxy-6α-ethyl-24-nor-5β-cholan-
23-sulphate triethyl ammonium salt (8)
To a solution of 7 (0.5 g, 0.99 mmol) in THF (7 ml) cooled at -3°C, Et3N (0.3
ml, 2.1 mmol) was added and the resulting mixture was stirred for 10 min. CISO3H
(0.1 ml, 1.5 mmol) was added and the mixture was stirred overnight at room
temperature. Water (10 mi) was then added and the mixture was extracted with
CH2Cl2 (3x15 ml), dried over anhydride Na2S04 and evaporated under vacuum.
The crude sulphate derivative was used for the next step without further purification.
3a,7o,23-trihydroxy-6o-ethyl-24-nor-5β-cholan-23-sulphate triethyl
ammonium salt (9)
To a solution of 8 (0.5 g, 0.77 mmol) in acetone (8 ml), PdCl2(CH3CN)2 (10
mg, 0.05 eq) was added and the mixture was stirred at room temperature for 3 hours.
The reaction mixture was filtered, concentrated under vacuum and purified by
medium pressure Lichroprep RP-8 using a MeOH//H2O 8/2 mixture as mobile phase
to afford 0.115 g of 9, mp 118-121°C
1H NMR (200 MHz, CD3OD) δ: 0.70 (3H, s, C-18 Me); 0.91 (3 H, m, C-21
Me, 3 H, C-25); 0.98 (3 H, d, /= 6.4 Hz, C-19 Me); 1.32 (9 H, t, ./= 7.3 Hz, (CH3-
CH2)3N); 3.20 (6 H, q,J= 7.31 Hz, (CH3-CH2-)3N; 3.31 (1 H, m,
C-3); 3.65 (1 H, bs, C-7); 4.03 (2H, m, CH2-23).

13C NMR (CD3OD) δ: 9.23, 12.05, 12.19, 19.14, 21.97, 23.52, 23.76, 24.57,
34.23, 34.51, 36.56, 36.65, 36.79, 41.06, 41.55, 43.13, 47.73, 50.28, 51.68, 57.80,
67.19,71.16,73.23.
3α,7α,23-trihydroxy-6α-etbyl-24-nor-5β-cholan-23-sulphate sodium salt
(10)
To a solution of 8 (0.4 g, 0.72 mmol) in a mixture of acetone (4 ml) and H2O
(0.08 ml), PdCl2(CH3CN)2 (10 mg, 0.05 eq) was added and the resulting mixture was
stirred at room temperature for 3 hours. The reaction mixture was filtered over celite
and concentrated under vacuum. The resulting residue was treated with a methanolic
solution of 10% NaOH for 2h. The resulting mixture was concentrated under
vacuum and submitted to liquid medium pressure purification using a mixture of
CH3OH/H2O (7:3) as mobile phase to afford 0.09 g of 10 (25% yield).
EXAMPLE 2
Biological activities
Tests were first carried out in order to verify whether UPF-987 modulates
FXR-regulated genes, in comparison with chenodeoxycholic acid (CDCA). CDCA is
a primary bile acid that functions as an endogenous ligand of the farnesoid-x-
receptor (FXR; NR1H4). The biological activity of UPF-987 on FXR activity was
first tested in an in vitro assay using the fluorescence resonance energy transfer
(FRET) cell free assay, described in Pellicciari R., et al. J Med Chem. 2002
15;45.3569-72.
Briefly, reactions contained europium-labeled anti-GST antibody and
streptavidin-conjugated allophycocyanin, FXR GST-LBD fusion proteins and
biotinylated SRC1 sensor peptide. Reactions were incubated at room temperature for
1 h in FRET buffer (10 mM Hepes, pH 7.9, 150 mM NaCl, 2 mM MgC12, 1 mM
EDTA, 0.1 mg/ml BSA). FRET was measured on a Victor 1420 multilabel counter.

In the FRET cell-free assay, the recruitment of Scr-1, a co-activating factor
for FXR, occurs at a concentration of compound that is almost 300-fold lower than
that required for the natural FXR-ligand CDCA (Table 1).

1 Relative recruitment of the SRC1 peptide to FXR where CDCA = 100%.
All data are mean ± SE, n = 4.
It was also evaluated if UPF-987 modulated FXR-regulated genes in a
cellular assay using a human hepatocyte cell line (HepG2). In a cell transfection
assay using the HepG2 cell line, UPF-987 proved a potent FXR ligand. Exposure of
HepG2 cells to UPF-987 transactivates FXR. In other experiments using liver cells
transfected with viral constructs carrying the FXR gene or other nuclear receptors
cloned upstream to the luciferase gene, it was found that UPF-987 functions as a
selective FXR ligand in mouse, rat, and human hepatocytes. A detailed description
of these methods can be found in the following reference: Fiorucci S., et al.
Gastroenterology 2004.
Briefly, for luciferase assay, HepG2 cells were cultured in E-MEM
supplemented with 1 % penicillin/streptomycin, 1% L-glutamine and 10% fetal
bovine serum (high glucose) (CELBIO). Cells were grown at 37°C in 5% CO2. All
the transfections were making using a calcium phosphate coprecipitation method in
the presence of 25 uM chloroquine as inhibitor for DNA degradation. Transient
transfections were performed using 500 ng of reporter vector phsp27-TKLUC, 200
ng pCMV-Pgal, as internal control for transfection efficiency, and SO ng of each
receptor expression plasmid pSG5-FXR, pSG5-RXR. The pGEM vector was added

to normalize the amounts of DNA transfected in each assay (2.5 μg). The
transfection efficiency was evaluated by p-gal expression, obtained by co-
transfecting the cells with pCMV-pgal plasmid. Forty-Eight hours post-transfection,
HepG2 cells were stimulated with 1 μM UPF-987 for 18 h. Control cultures received
vehicle (0.1% DMSO) alone. Cells were lysed in 100 ul diluted reporter lysis buffer
(Promega), and 0.2 ul cellular lisate was assayed for luciferase activity using
Luciferase Assay System (Promega). Luminescence was measured using an
automated luminometer. Luciferase activities were normalized for transfection
efficiencies by dividing the relative light units by p-galactosidase activity.
Regulation of FXR Target Gene Expression by UPF-987 in HepG2 Cells
To establish if UPF-987 is a FXR modulator and exerts differential activities,
human HepG2 cells were exposed to UPF-987, CDCA (natural FXR ligand) and to
its 6-ethyl-derivative, 6-ECDCA, which is a potent FXR ligand. The effects of these
ligands on FXR responsive genes was then investigated by quantitative reverse
transcription PCR (qRT-PCR).
Briefly, all PCR primers were designed using PRIMER3-OUTPUT software
using published sequence data from the NCBI database. Total RNA was isolated
(TRIzol reagen, Invitrogen srl, Milan, Italy) from specimens taken from livers. One
microgram of purified RNA was treated with DNAse I for 10 minutes at room
temperature, followed by incubation at 95°C for 3 minutes in the presence of 2.5
mmol/L EDTA. The RNA was reverse transcribed with Superscript III (Invitrogen,
Carsbad, CA) in 20uL reaction volume using reandom primers. For quantitative RT-
PCR, 100 ng template was dissolved in a 25 μL containing 0.3 umol/L of each
primer and 12.5 μL of 2X SYBR Green PCR Master mix (Fynnzimes-DyNAmo
SYBRR Green qPCR mix). All reactions were performed in triplicate, and the
thermal cycling conditions were as follows: 2 minutes at 95°C, followed by 50
cycles of 95°C for 20 seconds, 55°C for 20 seconds and 72°C for 30 seconds on

iCycler iQ instrument (Bio-Rad, Hercules, CA). The mean value of the replicates for
each sample was calculated and expressed as the cycle threshold (CT; cycle number
at which each PCR reaction reaches a predetermined fluorescent threshold, set
within the linear range of all reactions). The amount of gene expression was then
calculated as the difference (ACT) between the CT value of the sample for the target
gene and the mean CT value of that sample for the endogenous control (GAPDH).
Relative expression was calculated as the difference (AACT) between ACT values of
the test control sample for each target gene. The relative mRNA expression was
shown as 2-AACT (Figure 3). The Primers used in Real-Time PCR were:
hGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa;
hCYP7Al: caccttgaggacggttccta and cgatccaaagggcatgtagt;
hSHP: gctgtctggagtccttctgg and ccaatgatagggcgaaagaagag;
hBSEP: gggccattgtacgagatcctaa and tgcaccgtcttttcactttctg;
hSREBPlc: gcaaggccatcgactacatt and ggtcagtgtgtcctccacct.
In contrast to Figure 3, a different in vitro experiment using quantitative
reverse transcription PCR, demonstrated that while no direct cell toxicity was
observed upon exposure to any of these ligands, exposure of HepG2 cells to CDCA
and its 6-ECDCA derivative, resulted in a 2-3 fold induction of SHP, an FXR
regulated gene. By contrast, despite the fact that UPF-987 is a FXR ligand (see
above), it stimulates SHP expression. All the FXR ligands tested, namely CDCA, 6-
ECDCA and UPF-987 exerted the same effect on CYP7al (all agents caused a 60-
70% reduction of the expression of CYP7α1 mRNA). In addition, exposure to UPF-
987 induced BSEP and SHP mRNA expression (approximately 2-3 fold induction).
This effect was significantly more pronounced with UPF-987 than with the other
FXR ligands. Furthermore, similarly to the other ligands, exposure to UPF-987
resulted in a potent inhibition of SREPB-1c and FAS mRNA expression. Taken
together, these data suggest that UPF-987 is an FXR modulator that functions as a

potent FXR ligand, and unexpectedly alters FXR regulated genes, causing
significant induction of bile acid transporters (for example BSEP) and potent
suppression of lipid-related genes. In addition, UPF-987 represses the expression of
Cyp7al, a gene that is critically involved in bile acid synthesis from cholesterol.
The regulation of these FXR target genes suggests that UPF-987 is a gene-selective
FXR ligand that may inhibit bile acid biosynthesis through the classical pathway
while increasing bile acid secretion from hepatocytes, without interfering with SHP
expression. This effect is desirable, since it narrows the pharmacological activities
of these FXR ligands, and might prevent metabolic activation typically associated
with SHP induction.
Results of In vitro pharmacology studies on UPF-987 are shown in Table 2
below.



Example 3
Regulation of FXR target genes by UPF-987 in vivo
Background
Compound 9 is also referred to as UPF-987. FXR plays a key role in the
transcriptional regulation of genes involved in bile acid metabolism and
lipid/cholesterol and glucose homeostasis. The regulation of these interactions is
highly complex and contains multiple feedback loops to self-regulate the
transcriptional circuits. The overlapping range of agonistic and antagonistic ligands,
as well as of target genes shared by FXR with other metabolic nuclear receptors
including PPARs and LXR, may serve as a redundant safety mechanism to elicit a
protective response so that even when one pathway is compromised, a salvage
pathway takes over. Crucial to the complexity of putative convergent and divergent

functions of the metabolic nuclear receptors are their transcriptional coactivators and
corepressors, that will be recruited in various manner from FXR modulators.
FXR modulators will be used for the treatment of the inflammatory,
cholestatic, fibrotic liver disorders, and metabolic disorders including
hypertriglyceridemic and hypercholesterolemia states and, by extension,
atherosclerosis and its complications.
In conclusion, FXR is emerging as a particularly intriguing therapeutic target,
not only for the promising application associated with its modulation but also for its
peculiar mechanism of ligand recognition and gene activation.
Materials and Methods
Animals
Six- to eight-week old female Balb/c mice were obtained from Charles River
(Charles River Laboratories, Inc., Wilmington, MA). Animals were fed a standard
chow pellet diet, had free access to water, and were maintained on a 12-h light/dark
cycle. All procedures in this study were approved by the Animal Study Committees
of the University of Perugia (Italy) according to governmental guidelines for animal
care. Animals were treated for 5 days by intraperitoneal injection of 6-ECDCA
Smg/Kg/day, while control animals were treated with vehicle alone (methyl-
cellulose). At the end of the experiment mice were sacrificed and liver was removed
to perform Real Time PCR analysis of FXR target genes.
Quantitative Real-Time PCR
Quantitative Real-Time PCR was performed as above (see 1.1 Materials and
Methods). The primers used were:
mGAPDH: ctgagtatgtcgtggagtctac and gttggtggtgcaggatgcattg
mBSEP: aaatcggatggtttgactgc and tgacagcgagaatcaccaag
mSHP: tctcttcttccgccctatca and aagggcttgctggacagtta
mCYP7Al: aagccatgatgcaaaacctc and gccggaaatacttggtcaaa

mSREBPlc: gatcaaagaggagccagtgc and tagatggtggctgctgagtg
Results
In vivo administration of the UPF-987 to intact mice for 4 days at the dose of
S mg/kg resulted in a potent induction of BSEP and SHP in the liver. Despite
encouraging yet inconsistent target gene expression data with preliminary in vitro
assays discussed above, the observed in vivo data suggest potent downregulation
(60-70% reduction) of Cyp7al. UPF-987 which also caused 90% inhibition of
SREBP-lc and reduced FAS mRNA expression in the liver (Fig. 5).
Example 4
Evaluation of UPF-987 anti-inflammatory activity in TNBS mouse model of
colitis
Materials and Methods
Colitis models
The intracolonic application of the hapten TNBS causes acute and chronic colitis in
rodents. Mucosal inflammation in TNBS-colitis has a prominent neutrophilic
infiltrate, but also comprises influx of CCR1+ and CCR5+ macrophages and
monocytes as well as a prominent IL-12 and IFN-dependent T lymphocyte (Thl)
activation. Histopathological features resemble human Crohn's disease, transmural
inflammation, granulomas, Assuring ulcers and "skip lesions" (regions of ulceration
separated by regions of normal mucosa". TNBS-colitis serves as a useful pre-
clinical model for testing established and innovative treatments for Crohn's disease.
Animals
Animals were monitored daily for appearance of diarrhea, loss of body weight, and
survival. At the end of the experiment, surviving mice were sacrificed, blood
samples collected by cardiac puncture, and a 7 cm segment of colon was excised,
weighed, and macroscopic damage was evaluated.
Induction of Colitis and Study Design

Colitis was induced in BALB/c mice (8 weeks old) by intra-rectal administration of
TNBS (0.5 mg/mouse) Beginning three hours later and continuing at 24-h intervals
for five days, the mice were administered intra- peritoneally, UPF-987 (0.3-1-
3mg/kg) or vehicle (methyl cellulose 1 %). Each group consisted of 5 or 7 mice.
The mice were sacrificed 18h after the final administration of the test drug or
vehicle. The severity of colitis was scored by assessing the macroscopic
appearance. The latter is an index of granulocyte infiltration in the tissue. The
macroscopic scoring of colitis has been described in detail by Fiorucci et al, and
involved blind scoring on a 0 (normal) to 4 (severe damage) scale. Body weight and
stool consistency was recorded at the start and end of the study. Tissue samples
were collected from the distal colon of each mouse and processed, as described
previously.
Macroscopic Grading of Colitis
Colons were examined under a dissecting microscope (x 5) and graded for
macroscopic lesions on a scale from 0 to 10 based on criteria reflecting
inflammation, such as hyperemia, thickening of the bowel, and the extent of
ulceration.
Quantitative Real-Time PCR
Mouse colon genes expression was evaluated by quantitative real-time polymerase
chain reaction (RT-PCR) like previously described. Total RNA was isolated from
speciments taken from distal colon. Followed primers were designed using
PRIMER3-OUTPUT software, using published sequence data from the NCBI
database:
mGAPDH: ctgagtatgtcgtggagtctac and gttggtggtgcaggatgcattg
mTNFa: acggcatggatctcaaagac and gtgggtgagcacgtagt
mILip: tcacagcagcacatcaacaa and tgtcctcatcctcgaaggtc
mIL6: ccggagaggagacttcacag and tccacgatttcccagagaac

mINFy: gctttgcagctcttcctcat and gtcaccatccttttgccagt
miNOS: acgagacggataggcagaga and cacatgcaaggaagggaact
mTGβ1: ttgcttcagctccacagaga and tggttgtagagggcaaggac
mFXR: tgtgagggctgcaaaggttt and acatccccatctctctgcac
Example 5
Evaluation of efficacy of UPF-987 in rat cholestatic model (ANIT)
Background
Cholestasis results in intrahepatic accumulation of cytotoxic bile acids which
cause liver injury ultimately leading to biliary fibrosis and cirrhosis. Cholestatic
liver damage is counteracted by a variety of intrinsic hepatoprotective mechanisms.
Such defense mechanisms include repression of hepatic bile acid uptake and de novo
bile acid synthesis. Furthermore, phase I and II bile acid detoxification is induced
rendering bile acids more hydrophilic. In addition to "orthograde" export via
canalicular export systems, these compounds are also excreted via basolateral
"alternative" export systems into the systemic circulation followed by renal
elimination. Passive glomerular filtration of hydrophilic bile acids, active renal
tubular secretion, and repression of tubular bile acid reabsorption facilitate renal bile
acid elimination during cholestasis. The underlying molecular mechanisms are
mediated mainly at a transcriptional level via a complex network involving nuclear
receptors and other transcription factors. So far, the farnesoid X receptor FXR,
pregnane X receptor PXR, and vitamin D receptor VDR. have been identified as
nuclear receptors for bile acids. However, the intrinsic adaptive response to bile
acids cannot fully prevent liver injury in cholestasis. Therefore, additional
therapeutic strategies such as targeted activation of nuclear receptors are needed to
enhance the hepatic defense against toxic bile acids.
Materials and Methods
Animals

Wistar Rats studies were approved by the Animal Study Committee of the
University of Perugia. Male Wistar rats (200-250 g) were obtained from Charles
River Breeding Laboratories (Portage, MI) and maintained on standard laboratory
rat chow on a 12-h light/dark cycle.
Colestatic models: Method:alpha-naphtbyl-isothiocyanate (ANIT)
The first rats group (N=6) was treated, daily, by ANIT 100mg/kg via gavage
(colestatic inducer), the second and third groups (N=6) were treated by ANIT
100mg/kg via gavage plus UPF-987 5 and 3 mg/kg intrapcritoncally daily. Control
rats (N=4) were administered vehicle (physiologic solution LP.). At the end of the
study, rats were sacrificed under anaesthesia with sodium pentobarbital (50 mg/kg
t.p.) and terminally bled via cardiac puncture; the liver was removed and weighted
for examination and blood samples were taken.
Quantitative Real-Time PCR
Rat genes expression was evaluated by quantitative real-time polymerase chain
reaction (RT-PCR) as previously described herein. The following PCR primers were
designed using PRIMER3-OUTPUT software using published sequence data from
the NCBI database:
rGAPDH: atgactctacccacggcaag and atgactctacccacggcaag
rSHP cctggagcagccctcgtctcag and aacactgtatgcaaaccgagga
rBSEP: aaggcaagaactcgagataccag and tttcactttcaatgtccaccaac
rCYP7Al: ctgcagcgagctttatccac and cctgggttgctaagggactc
rCYP8Bl: cccctatctctcagtacacatgg and gaccataaggaggacaaaggtct
rNTCP: gcatgatgccactcctcttatac and tacatagtgtggccttttggact
rMdrl: cgttgcctacatccaggttt and gccattgcctgaaagaacat
rMdr2: gttctcgctggtcttcttgg and cgtctgtggcgagtcttgta
rMMP2: gatggatacccgtttgatgg and tgaacaggaaggggaacttg
Results

UPF-987 was tested in vivo for its ability to protect against cholestasis
induced in rat by α-naphthylisothiocyanate (ANIT). ANIT administration leads to a
severe cholestasis, previous studies by Fionicci et al. (unpublished) have shown that
6-ECDCA is not effective in reducing liver injury in this model. Administration of
UPF-987 attenuates liver injury in ANIT treated rats, as measured by assessing
plasma levels of AST, γGT and alkaline phosphatase, three markers of cholestasis
and plasma cholesterol. In addition UPF-987, modulates NTCP, CYP7A1 and BSEP
expression.
Example 6
Evaluation of efficacy of INT-1103 in rat cholestatic model (ANIT)
Background
INT-1103 is sulphide derivative of 6-ethyl-chenodeoxycholic acid (6E-CDCA or
INT-747), which is disclosed and in U.S. Patent No. 7,138,390 and incorporated by
reference herein.
Material and Methods
Cholestatic models: alpha-naphthyl-isothiocyanate (ANIT) Wistar Rats
Studies were approved by the Animal Study Committee of the University of Perugia.
Male Wistar rats (200-250 g) were obtained from Charles River Breeding
Laboratories (Portage, MI) and maintained on standard laboratory rat chow on a 12-
h light/dark cycle. The first group (N=8) were treated, daily, by ANIT 100mg/kg via
gavage (colestatic inducer), the second and third groups (N=8) were treated by
ANIT 100mg/kg via gavage plus INT-1103 Smg/kg intraperitoneally daily. Control
rats (N=8) were administered vehicle (physiologic solution LP.). At die end of the
study, rats were sacrificed under anaesthesia with sodium pentobarbital (50 mg/kg
i.p.) and terminally bled via cardiac puncture; the liver was weighted and removed
for examination and blood samples were taken.

Quantitative Real-Time PCR
The expression of rat FXR target genes was evaluated by quantitative real-time
polymerase chain reaction (RT-PCR) as previously described herein. The following
PCR primers were designed using PRIMER3-OUTPUT software using published
sequence data from the NCBI database:
rGAPDH: atgactctacccacggcaag and atgactctacccacggcaag
rSHP cctggagcagccctcgtctcag and aacactgtatgcaaaccgagga
rBSEP: aaggcaagaactcgagataccag and tttcactttcaatgtccaccaac
rCYP7A 1: ctgcagcgagctttatccac and cctgggttgctaagggactc
rCYP8B1: cccctatctctcagtacacatgg and gaccataaggaggacaaaggtct
rNTCP: gcatgatgccactcctcttatac and tacatagtgtggccttttggact
rMdrl: cgttgcctacatccaggttt and gccattgcctgaaagaacat
rMdr2: gttctcgctggtcttcttgg and cgtctgtggcgagtcttgta
rMMP2: gatggatacccgtttgatgg and tgaacaggaaggggaacttg
Example 7
Evalutation of efficacy of INT-1103 in rat cholestatic model (BTL)
Material and Methods
The (BTL) hepatic cholestatic model was induced by bile duct ligation (BDL) of
225-250g old male Wistar rats. Sham-operated rats (N = 8) received the same
laparoscopic procedure, except that the bile duct was manipulated, but not ligated
and sectioned. In total, 24 animals were operated. Three days after surgery,
surviving rats were randomized to receive placebo, intraperitoneally, (fisiologic
solution) (N=6) or INT-1103 5 mg/kg (N=*8). Animals were then treated for 7 days.
At the end of the study, rats were sacrificed under anaesthesia with sodium
pentobarbital (SO mg/kg i.p.) and terminally bled via cardiac puncture; the liver was
weighted and removed for examination and blood samples were taken.

Example 8
Evaluation of efficacy of INT-1103 and INT-747 in bile flow on naive rat
Material and Methods
Adult male Wistar rats weighing 200 to 250 g were used throughout the study.
Before the experiments, the animals were maintained on standard chow and water ad
libitum and housed in a temperature (21-23°C)- and humidity (45-50%)-controlled
room under a 12-h light/dark cycle. All studies were approved by the Animal Study
Committee of the University of Perugia. For bile flow measurement, animals were
anesthetized with a single dose of sodium pentobarbital (50 mg/kg body wt
intraperitoneally) and maintained under this condition throughout the experiment.
After catheterization of the jugular vein using a PE-50 polyethylene tubing
(Intramedic; Clay Adams, Parsippany, NJ), a middle abdominal incision was made,
and the common bile duct was also cannulated (PE-10, Intramedic; Clay Adams)..
Body temperature was maintained at 37.0 to 38.5°C with a warming lamp to prevent
hypothermic alterations of bile flow.. The bile samples were collected by the
external biliary fistula every IS min for 195 min and then weighed in order to
determine the bile flow. Bile flow was determined by gravimetry, assuming a
density of the bile of 1.0 g/ml. Bile collection started between 9:00 and 11:00 AM to
minimize influence of circadian variations. Drugs admininistration was done by
jugular cannula at the doses of 3μmoli/kg/min, control group received vehicle alone
(BSA 2% on fisilogic solution).
Example 9
Ealutation of efficacy of I NT-1103 and INT-747 in bile flow on estrogen
colestatic rat
Material and Methods
Adult male Wistar rats weighing 300 to 350 g were used throughout the study.

Before the experiments, the animals were maintained on standard chow and water ad
libitum and housed in a temperature (21-23°C)- and humidity (45-50%)-controlled
room under a 12-h light/dark cycle. All studies were approved by the Animal Study
Committee of the University of Perugia. Animals were randomly divided into 4
experimental groups :
1. Naïve,(N=5).
2. 17 -ethynylestradiol Smg/kg for 5 days intra-peritoneal, (N=8).
3. 17 -ethynylestradiol 5mg/kg + INT-747 5mg/kg intra-peritoneal, for 5 days
(N=7);
4. 17 -ethynylestradiol Smg/kg + INT-1103 Smg/kg intra-peritoneal, for 5 days
(N=7).
For bile collection, surgical procedures were made on the sixth day ( 1 day after the
administration of the last dose of E217 ). For bile flow measurement, animals were
anesthetized with a single dose of sodium pentobarbital (50 mg/kg body wt
intraperitoneally) and maintained under this condition throughout the experiment. A
middle abdominal incision was made, and the common bile duct was also cannulated
(PE-10, Intramedic; Clay Adams).. Body temperature was maintained at 37.0 to
38.5°C with a warming lamp to prevent hypothermic alterations of bile flow.. Bile
collection started between 9:00 and 11:00 AM to minimize influence of circadian
variations. Bile was collected at 15-min intervals for 120 min, and bile flow was
determined gravimetrically. At the end of the experiments the body and liver rats
was weighted.
Example 10
In vitro study of insulin gene regulation by INT-747 vs INT-1103
Material and Methods
For RT-PCR assay, pancreatic Beta-TC6 cells were cultured in D-MEM

supplemented with 1% penicillin/streptomycin, 1% L-glutamine and 10% fetal
bovine serum (high glucose) (CELBIO). Cells were grown at 37°C in 5% C02 and
treated with INT-1103 and INT-747, at the final concentration 1μM, for 18 hours. At
the and of the experiments the cells were collected for RNA extraction.
Real Time PCR
Quantification of the expression of mouse genes was performed by
quantitative real-time polymerase chain reaction (RT-PCR). All PCR primers were
designed using PRIMER3-OUTPUT software using published sequence data from
the NCBI database. Total RNA was isolated (TRIzol reagen, Invitrogen srl, Milan,
Italy) from speciments taken from livers. One microgram of purified RNA was
treated with DNAse I for 10 minutes at room temperature, followed by incubation at
95°C for 3 minutes in the presence of 2.5 mmol/L EDTA. The RNA was reverse
transcribed with Superscript III (Invitrogen, Carsbad, CA) in 20uL reaction volume
using reandom primers. For quantitative RT-PCR, 100 ng template was dissolved in
a 25 μL containing 0.3 μmol/L of each primer and 12.5 μL of 2X SYBR Green PCR
Master mix (Fynnzimes*DyNAmo SYBRR Green qPCR mix). All reactions were
performed in triplicate, and the thermal cycling conditions were as follows: 2
minutes at 95°C, followed by 50 cycles of 95ºC for 20 seconds, 55°C for 20 seconds
and 72°C for 30 seconds on iCycler iQ instrument (Bio-Rad, Hercules, CA). The
mean value of the replicates for each sample was calculated and expressed as the
cycle threshold (CT; cycle number at which each PCR reaction reaches a
predetermined fluorescent threshold, set within the linear range of all reactions). The
amount of gene expression was then calculated as the difference (ACT) between the
CT value of the sample for the target gene and the mean CT value of that sample for
the endogenous control (GAPDH). Relative expression was calculated as the
difference (AACT) between ACT values of the test control sample for each target
gene. The relative mRNA expression was shown as 2-∆∆CT . The Primers used in

Real-Time PCR were:
mGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa;
raSHP: gctgtctggagtccttctgg and ccaatgatagggcgaaagaagag;
mSREBPlc: gcaaggccatcgactacatt and ggtcagtgtgtcctccacct.
mINS: tgttggtgcacttcctaccc and ttgttccacttgtgggtcct
raSHP: aagggcttgctggacagtta and tctcttcttcctccctatca
mGLUT2: ccctgggtactcttcaccaa and gccaagtaggatgtgccaat
Example 11
Physico-chemical properties of INT-747 and INT-1103
Background
The two bile acid analogues, INT-747 and INT-1103, were admitted to a complete
physico-chemical properties characterization following protocols previously
developed and optimized in our laboratory and previously applied for a complete
screening of a large series of Bile acid analogues (UDCA analogues) developed in
the R. Pellicciari lab. The physico-chemical properties were selected to accurately
define the behaviour in aqueous solutions and in biological fluids and to establish
their potential toxicity to biological membranes, their pharmacokinetics and
pharmacodynamics and biodistribution in the different biological fluids and organs.
Comparative data with natural analogues will be also performed and discussed.
Water Solubility
Only side chain carboxylated BA INT-747, CDCA and UDCA were studied. Solid
BA were suspended in 5 ml of 0.1 M HC1. The saturated solutions, after incubation
for 1 week, were filtered on a Millipore filter (0.22 urn) and the concentration of BA
was measured by HPLC-ESI-MS/MS using C18 column (150mm x 2mm i.d., 4um)
and mobile phases of water containing 15mM acetic acid pH 5 and acetonitrile. The

flow rate was 150 μl/min. The mass spectrometry acquisition was performed in the
multiple reaction monitoring mode using the ESI source in negative ionization.
Water solubility was expressed as μmol/liter

The water solubility was measured for the insoluble protonated species of
carboxylated bile acids at a pH 1. The sulphate compound, UPF 1103 is ionized even
at low pH and in physiological conditions is always soluble in all biological fluids.
The water solubility of INT-747 is 9 uM , lower than CDCA, and comparable with
that of UDCA. Since the CMC of INT-747 is relatively low (see next paragraph), the
low water solubility of INT-747 do not compromise the behaviour of the compound
in a micellar phase; in the case of UDCA, the low water solubility associated with an
high CMC compromises the pH at which the protonated acid goes in solution to
form micelles. The CMpH is, in fact, for UDCA 8.4, which is too high if is not
present a postprandial alkalinization in duodenal content.
Critical Micellar Concentration (CMC)
This value was determined by surface tension measurements using a maximum
bubble-pressure method. The tensiometer was a Sensadyne 6000 (Chem-Dyne
Research Corp., Milwaukee, WI) equipped with two glass probes of 0.5 and 4.0 mm
diameters connected to a source of nitrogen. The bubble frequency was 1
bubble/second in distilled water at 26°C (P=2.7 atm) and the calibration was made
with double-distilled water and methanol. The surface tension of BA sodium salts

solutions both in water and in NaCl 0.15 M was measured at various concentrations
range, 0.2-75 mM and 0.3-100 mM respectively. The surface tension values were
plotted against the logarithm of the bile salt concentration; the regression lines
corresponding to the two parts of the curve (monomelic and micellar phases) were
calculated using the method of least squares, and the intersection of the lines was
taken as the CMC value.

The CMC, as evaluated by surface tension measurements in non equilibrium
conditions i.e. in conditions that impurities do not affect the results, of INT-747 and
INT-1103 are relatively low, similar to CDCA natural analogue. INT-1103 presents
the lower CMC both in water and in presence of counter ion Na+ 150 mM. The low
CMC value of INT-747 is related to the topographic distribution of the ethyl and
hydroxyl groups: the ethyl group in the 6 position is oriented in the β face, the back
of the steroid, contributing to increase the lipophilic extent and area of the surface of

this moiety and therefore the tendency to form micelles. INT-1103 presents the
lower CMC as result of ethyl group in 6 position and the 23 sulphate in the side
chain. The peculiar properties of the sulphate group gave to INT-1103 anionic
surfactant like properties (like sodium dodecyl sulphate) as a result of a negative
charged head and lipophilic tail with a surface lipophilic moiety. The values of the
surface tension activity both at CMC and in micellar phase (50 mM) agree with the
present CMC data, both compounds are surface active and able to lower the surface
tension to a great extent in respect to UDCA and TUDCA. This data further supports
the concept that this compounds are detergent like the CDCA analogue and even
more. INT-747 at a relatively high concentration >60 mM and in the presence of
Na+ 0.15 M form a gel phase and this account for the relatively inaccurate ST data
found in that conditions (Fig. 1) These results are not surprising since other detergent
natural BA like deoxycholic acid behave similarly forming this gel (usually
viscoelastic) particularly for the effect of counter ions like Na+ and Ca++ This phase
evolves to micellar phase with a relatively low kinetics. Moreover this phenomenon
occurs at a very high not physiological concentration.
Octanol/water partition coefficient
1-Octanol/water partition coefficient (log P) was evaluated using a conventional
shake-flask procedure. The experiments were carried out on 0.1 mM bile salt
solution buffered at pH 8 with 0.1 M phosphate buffer to ensure complete ionization
of the BA; the log P values refer to the BA in the ionized form, not to the protonated
species, and the initial concentration of each BA was below its own CMC value. The
aqueous buffer was previously pre-saturated with 1-octanol, 5 ml of 1-octanol pre-
saturated with water was then added and the samples were left to equilibrate for 2
weeks under continuous stirring at room temperature After centrifugation the two
phases were carefully separated. BA concentration in the water phase was measured
with HPLC-ESI-MS/MS using C18 column (150mm x 2mm i.d., 4um) and mobile

phases: A: water containing 15 mM acetic acid pH 5 , B: acetonitrile. The flow rate
was 150 μl/min and the column was maintained at 45°C. The mass spectrometry
acquisition was performed in the multiple reaction monitoring mode using the ESI
source in negative ionization.

The 1-octanol/water partition coefficient was calculated for the ionized species to
facilitate the comparison between the carboxyl and sulphate bile acids since the
latter do not protonated even at very low pH. INT-747 presents a slightly higher
lipophilicity in respect to other dihydroxy bile acids such as UDCA and CDCA. The
increased lipophilicity is the result of the introduction of an ethyl group in position
6. The tendency to distribute in a lipid domain is therefore fisher. The UPF 1103
shows a logP of 2.0, value slightly lower than INT-747 and natural CDCA and
UDCA analogues and this account for the contribution of the sulphate group and
side chain length. Moreover the lipophlicity of INT-1103 is still similar to an
unconjugated BA and higher than taurine conjugated like TCDCA that present a
logP of 0.9. Contrarily to Taurine conjugate which preferentially stay in a water
domain , INT-1103 has a tendency to accumulate in a lipid domain like INT-747.
Albumin binding

Albumin binding was evaluated by equilibrium dialysis at a fixed BA-albumin ratio.
BA was dissolved at a concentration of 100 μM in 5% bovine serum albumin-saline
solution and left to stand for 24 h at 25°C. Two ml of this solution was dialyzed in
cellulose sacs having a molecular weight cut-off of 12-14,000 against 25 ml of
saline solution. The system was equilibrated by mechanical shaking for 72 h at
25°C. BA concentrations of the dialyzed solution and of the starting solution were
determined with HPLC-ESI-MS/MS in the same conditions of the previous analysis.

Both INT-747 and UPF 1103 present a strong interaction with albumin quite similar
to natural dihydroxy bile acid like CDCA and UDCA suggesting a similar kinetic in
the hepatic uptake. Trihydroxy bile acids like cholic acid or taurine conjugated bile
acids show a lower interaction with albumin and this account to the lower serum
concentration at a similar intestinal uptake as a result of a higher first pass
clearance. The unbound fraction (like for many drugs) modulates the liver uptake: as
the fraction increase the higher is the uptake. INT-747 and INT-1103 present a low
unbound fraction and therefore their serum concentration are higher as a result of a
relatively low first pass clearance, and their behaviour is similar to natural analogs.
Critical micellar pH

This value can be experimentally determined by evaluating the pH at which a given
BA starts to precipitate from a micellar solution. It can be calculated from the CMC
Water solubility of the protonated species and pKa using the formula:
CMpH= pKa + log CMC/WS. The CMpH of the studied compounds in comparison
with the natural analogs are reported in Table I.

The CMpH value of INT747 is similar to that of CDCA and lower to UDCA.
According to this value INT747 do not present problems of intestinal solubility and
requires a pH of 7.6 which is physiological to go in solution. For example UDCA
with a CMpH of 8.4 requires an higher alkalinization of the duodenal content and
only in post-prandial phase is solubilized in a micellar phase. UP 1103 having a
sulphate group do not present these problems since is always soluble in the
physiological pH from 2 to 9 since the pKa is very low and the compound do not
protonated to form insoluble molecule. Its behaviour is similar to taurine conjugated
bile acids.
Example 12
Hepatic metabolism and secretion of INT-747 and INT-1103 in rat after one
hour iv infusion at a dose of 3μmol/Kg/min
Background

The BA were administered by infusion to bile fistula rat and bile collected at 15 min
intervals for 7 hours. The bile flow was measured and bile analyzed using HPLC-
ES-MS-MS for the identification of the rate of biliary secretion and to evaluate the
major hepatic metabolites.
HPLC-ES-MS/MS Method
Bile acids and their metabolites were determined by a liquid chromatography-
tandem mass spectrometry (HPLC-MS/MS) method using electrospray (ESI) source
in negative ionization mode. Rat bile samples were brought to room temperature and
diluted 1:100 v/v - 1:1000 v/v with 15 mM ammonium acetate buffer (pH=5). Then,
10 μL were injected into the chromatographic column. Liquid chromatography was
performed using a Waters Alliance 2695 separation module coupled with
autosampler. Bile acids were analyzed using a Synergi Hydro-RP C18 column
(150x2.0mm i.d., 4 μm particle size), protected by a SecurityGuard ODS 4x2.0mm
i.d. precolumn, both supplied from Phenomenex. Bile acids were separated in
elution gradient using 15 mM ammonium acetate buffer (pH = 5.00) as mobile phase
A and acetonitrile as mobile phase B. Mobile phase B was increased from 30% to
64% in 12 min, then to 70% in 8 min, and finally brought to 100% in 10 min and
held constant for 1 min. Flow rate was 150 μL/min and the column was maintained
at 45°C. The column effluent was analysed by ESI-MS/MS using a Quattro-LC
(Micromass) triple quadruple mass spectrometer operating in Multiple Reaction
Monitoring (MRM) acquisition mode. MassLynx software version 4.0 was used for
data acquisition and processing.
Results
INT-747 is secreted into bile mainly as taurine conjugate and its recovery is almost
complete: at the administered dose more than 99 % of the infused molecule is
secreted into bile as shown in fig 3. At the last point of bile collection a relatively
high amount of the taurine conj. compound is still secreted in bile. The maximum

secretion rate is achieved after 120 minutes just at the end of the infusion. A steady
state concentration is maintained for additional 30 minutes. The taurine conjugation
process begin very early and appears efficient at the administered dose. Trace
amount of the compound is also conjugate with glycine, less than 0.2% and similar
amount is secreted as such in bile. The behaviour of INT-747 is similar to that of
natural dihydroxy analogs such as CDCA or UDCA which are secreted into bile
only as taurine and glycine conjugates. Differently, trihydroxy BA such as CA, can
be also partially secreted in unconjugated form. The extent of a BA that can be
secreted unmodified is related to its lipophilicity and is dose and species dependent.
The behaviour in term of hepatic uptake and secretion of this molecule is quite
similar to natural analogue like CDCA and the rate of hepatic secretion is related to
that of taurine conjugation mediated by a Co A activation and taurine liver
availability. The preferential conjugation with taurine is peculiar to rat and other
species (dog, mice,..) and in man this compound is amidated mainly with glycine.
According to these date seems that INT-747 is efficiently take up and secreted by
the liver. The hepatic metabolism of INT-747 produces mainly the taurine conjugate
form. Trace amount of glycine conjugate are secreted in bile and also very low
amount is secreted as such, (fig 37 and 38). Minor epimers of both unconjugated and
taurine conjugated are present in bile (fig 39 and 40).
INT-1103 is secreted in bile partially unmodified as reported in fig 41. The amount
of INT-1103 secreted in bile is approx. 30-40% of the administered dose and its
secretion rate is relatively low and at the end of the collection period a relatively
high amount of the molecule is still secreted into bile. The main hepatic metabolite
of INT-1103 in rat at the administered dose is the 3-glucoronide as reported in fig
42. The amount of this compound has not be quantified since the pure reference
standard is not available. Other metabolites are secreted into bile as reported in fig

43 and in more details in fig 43 and fig 44. The main identified metabolites is the 3-
sulphate conjugate, an hydroxy analog (one more hydroxyl ) , keto derivatives and
epimers of INT-1103. The exact amount of these compound were not quantified
since the standards are not yet available.
These data suggest that INT-1103 can be secreted in bile as such and its behaviour is
different from natural dihydroxy analogs such as CDCA and INT-747 that require a
conjugation with taurine and glycine to be secreted into bile. This is a main requisite
for molecules with this lipopbilicity. On the contrary trihydrohy BA such as CA or
UCA can be secreted in bile also partially as such. The sulphate group present in
INT1103 facilitate the secretion process even if the molecule is still quite lipophilic
and the behaviour is between an unconjugated and taurine conjugated bile acid.
Moreover the liver strong metabolize this compound forming more hydrophilic
compound such as 3-glucuronides, 3-sulphates and hydroxylated analogs. The
extensive metabolism do to retained compound is related to the animal species and
to the administered dose and according to these data we can speculate that this
compound present a metabolism more similar to an "acids steroids" slightly different
from a common bile acid, but maybe sharing same properties. We do not know the
metabolism in human but if its behaviour is more like a steroid is may be underwent
to 3-glucuronidation even in humans. The compound was administered iv and
addition data are required to evaluate the extent of its intestinal absorption ie passive
or active like a taurine conjugate.
Example 13
In vitro metabolic stability in human stools culture
Stability to Intestinal Bacteria; 7α-dehydroxylation
Homogenized fresh human stools (500 mg) were transferred into sterile vials to

which 5 mL of sterilized chopped meat-glucose medium (Scott Lab., Fiskville, RI)
was added. BA were then added at a final concentration of 0.05 mM. Vials were
incubated at 37 C; then, at 0, 4, 8, 16, 20, 24, and 72 h after the addition of the BA,
the reaction was stopped with 150 L of 30% KOH. The samples were centrifuged at
3500 rpm for 10 min; from the supernatant the BA were isolated by C-18 solid-
phase extraction and analyzed by TLC and HPLC-ES-MS/MS. Thin-layer
chromatography (TLC), utilizing silica gel 0.25 m thickness plates (Merck,
Darmstat, Germany), was employed as the first screening test. The solvent system
used for the separation of conjugated BA was composed of propionic acid/isoamyl
acetate/water/N-propanol (3:4:1:2, v/v/v/v; solvent I), and that of the unconjugated
BA was acetic acid/carbon tetrachloride/isopropyl ether/isoamyl acetate/water/N-
propanol/benzene (1:4:6:8:2:2, v/v/v/v/v/v; solvent II). Separated BA were revealed
with 5% phosphomolybdic acid cthanol solution. Both INT-747 and INT-1103 are
very stable when incubated in human stool cultures and even after 24 hour more than
85 % of the compounds can be recovered unmodified as reported in Fig 45 . On the
contrary the reference natural analogue COCA present an half-life time of almost
one hour and after 8 hours of incubation is almost completely metabolized (7-
dehydroxylated) to form lithocholic acid.
Results
These data, shown in Figure 46, suggest that the presence of the ethyl group in the 6
position protect the 7 hydroxyl group toward oxidation or removal by steric
hindrance. In addition both analogues are very stable and particularly INT-1103. The
side chain ester bond is quite stable in the human stool culture. No minor
metabolites have been found by HPLC-ES-MS/MS
Example 14
In vitro metabolic stability in simulated duodenal/pancreatic fluid (USP

specification)
Material and Methods
This study has been performed only for INT 1103 since it contain an ester bond in
the side chain and the aim was to verify the stability in presence of esterase enzymes
like present in duodenal and pancreatic juice. Simulated pancreatic fluid was
prepared by dissolving 10 g/L Pancreatin (Sigma P8096: pancreatin from porcine
pancreas, activity 1x USP specifications) in 0.05M phosphate buffer, pH = 7.2 ± 0.1.
Then, 4-mL aliquots of the simulated pancreatic fluid were added of 50 μM INT-
1103 and incubated for different times (0, 30, 60, 90, 120, 180 and 240 min) at
37°C. After incubation, a 2-mL aliquot of each solution was added with 2 mL of
0.1M NaOH and subjected to bile acids extraction by SPE and analysis by thin-layer
chromatography and mass spectrometry as described above.

CLAIMS
1. A compound of formula (I):

wherein R is hydrogen or alpha-hydroxy
the hydroxyl group in position 7 is in the alpha or beta position
and pharmaceutically acceptable salts, solvates or amino acid conjugates thereof.
2. A compound of formula (I) wherein the hydroxy group in 7 is in the alpha
position and R is hydrogen.
3. A compound of formula (I) wherein the hydroxy group in 7 is in the beta
position and R is hydrogen.
4. A compound of formula (I) wherein the hydroxy group in 7 is in the alpha
position and R is alpha-hydroxy.
5. A compound of formula (I) wherein the pharmaceutically acceptable salt is:


6. A compound of formula (I) wherein the pharmaceutically acceptable salt is:

7. A method for the prevention or treatment of an FXR-mediated disease or
condition in a mammal comprising administering to the mammal suffering from an
FXR-mediated disease or condition a therapeutically effective amount of a
compound of formula (I) according to any one of claims 1-4.
8. A method according to claim 5 wherein the FXR-mediated disease or
condition is selected from the group consisting of chronic liver disease,
gastrointestinal disease, renal disease, cardiovascular disease, and metabolic disease.
9. A method according to claim 6 wherein the chronic liver disease is selected
from the group consisting of primary biliary cirrhosis (PBC), cerebrotendinous
xanthomatosis (CTX), primary sclerosing cholangitis (PSC), drug induced
cholestasis, intrahepatic cholestasis of pregnancy, parenteral nutrition associated
cholestasis (PNAC), bacterial overgrowth or sepsis associated cholestasis,
autoimmune hepatitis, chronic viral hepatitis, alcoholic liver disease, nonalcoholic
fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), liver transplant
associated graft versus host disease, living donor transplant liver regeneration,
congenital hepatic fibrosis, choledocholithiasis, granulomatous liver disease, intra-
or extrahepatic malignancy, Sjogren's syndrome, Sarcoidosis, Wilson's disease,
Gaucher's disease, hemochromatosis, and alpha 1-antitrypsin deficiency.

10. A method according to claim 6 wherein the gastrointestinal disease is
selected from the group consisting of inflammatory bowel disease (IBD), Crohn's
disease, ulcerative colitis, irritable bowel syndrome (IBS), bacterial overgrowth ,
malabsorption, post-radiation colitis, and microscopic colitis.
11. A method according to claim 6 wherein the renal disease is selected from the
group consisting of diabetic nephropathy, focal segmental glomerulosclerosis
(FSGS), hypertensive nephrosclerosis, chronic glomerulonephritis, chronic
transplant glomerulopathy, chronic interstitial nephritis, and polycystic kidney
disease.
12. A method according to claim 6 wherein the cardiovascular disease is selected
from the group consisting of atherosclerosis, arteriosclerosis, dyslipidemia,
hypercholesterolemia, and hypertriglyceridemia.
13. A method according to claim 6 wherein the metabolic disease is selected from
the group consisting of insulin resistance, Type I and Type II diabetes, and obesity.
14. A pharmaceutical composition comprising a compound of formula (I)
according to any one of claims 1-4 and a pharmaceutically acceptable carrier or
diluent.
15. Use of a compound of formula (I) as defined in claims 1-4 for the preparation
of pharmaceutical compositions for the prevention or treatment of FXR-mediated
diseases or conditions.

16. Use of a compound of formula (I) as defined in claims 1-4 for the preparation
of pharmaceutical compositions for the prevention or treatment of a FXR-mediated
disease or condition selected from the group consisting of chronic liver disease,
gastrointestinal disease, renal disease, cardiovascular disease, and metabolic disease,
cardiovascular disease, atherosclerosis, arteriosclerosis, hypercholesteremia, and
hyperlipidemia.
17. Use of a compound of formula (I) as defined in claims 1-4 for the preparation
of pharmaceutical compositions for the prevention or treatment of cholestatic liver
diseasesa chronic liver disease selected from the group consisting of primary biliary
cirrhosis (PBC), cerebrotendinous xanthomatosis (CTX), primary sclerosing
cholangitis (PSC), drug induced cholestasis, intrahepatic cholestasis of pregnancy,
parenteral nutrition associated cholestasis (PNAC), bacterial overgrowth or sepsis
associated cholestasis, autoimmune hepatitis, chronic viral hepatitis, alcoholic liver
disease, nonalcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis
(NASH), liver transplant associated graft versus host disease, living donor transplant
liver regeneration, congenital hepatic fibrosis, choledocholithiasis, granulomatous
liver disease, intra- or extrahepatic malignancy, Sjogren's syndrome, Sarcoidosis,
Wilson's disease, Gaucher's disease, hemochromatosis, and alpha 1-antitrypsin
deficiency.
18. Use of a compound of formula (I) as defined in claims 1-4 for the preparation
of pharmaceutical compositions for the prevention or treatment of a gastrointestinal
disease selected from the group consisting of inflammatory bowel disease (IBD),
Crohn's disease, ulcerative colitis, irritable bowel syndrome (IBS), bacterial
overgrowth , malabsorption, post-radiation colitis, and microscopic colitis.

19. Use of a compound of formula (I) as defined in claims 1-4 for the preparation
of pharmaceutical compositions for the prevention or treatment of a renal disease
selected from the group consisting of diabetic nephropathy, focal segmental
glomerulosclerosis (FSGS), hypertensive nephrosclerosis, chronic
glomerulonephritis, chronic transplant glomerulopathy, chronic interstitial nephritis,
and polycystic kidney disease.
20. Use of a compound of formula (I) as defined in claims 1-4 for the preparation
of pharmaceutical compositions for the prevention or treatment of a cardiovascular
disease selected from the group consisting of atherosclerosis, arteriosclerosis,
dyslipidemia, hypercholesterolemia, and hypertriglyceridemia.atherosclerosis,
arteriosclerosis, hypercholestremia, and hyperlipidemia.
21. Use of a compound of formula (I) as defined in claims 1-4 for the preparation
of pharmaceutical compositions for the prevention or treatment of a metabolic
disease selected from the group consisting of insulin resistance, Type I and Type II
diabetes, and obesity.
22. Pharmaceutical compositions containing a compound of formula (I) as
defined in claims 1-4 in admixture with pharmaceutically acceptable carriers and/or
diluents.

The present invention relates to compounds of formula (I) wherein R is hydrogen or alpha-hydroxy, the hydroxyl group in position 7 is
in the alpha or beta position; and pharmaceutically acceptable salts, solvates
or amino acid conjugates thereof.

Documents:

5290-KOLNP-2008-(04-03-2010)-FORM-13.pdf

5290-KOLNP-2008-(13-06-2014)-ANNEXURE TO FORM 3.pdf

5290-KOLNP-2008-(13-06-2014)-CORRESPONDENCE.pdf

5290-KOLNP-2008-(13-06-2014)-OTHERS.pdf

5290-KOLNP-2008-(17-12-2014)-ABSTRACT.pdf

5290-KOLNP-2008-(17-12-2014)-ANNEXURE TO FORM 3.pdf

5290-KOLNP-2008-(17-12-2014)-ASSIGNMENT.pdf

5290-KOLNP-2008-(17-12-2014)-CLAIMS.pdf

5290-KOLNP-2008-(17-12-2014)-CORRESPONDENCE.pdf

5290-KOLNP-2008-(17-12-2014)-DESCRIPTION (COMPLETE).pdf

5290-KOLNP-2008-(17-12-2014)-DRAWINGS.pdf

5290-KOLNP-2008-(17-12-2014)-FORM-2.pdf

5290-KOLNP-2008-(17-12-2014)-OTHERS.pdf

5290-KOLNP-2008-(17-12-2014)-PA.pdf

5290-KOLNP-2008-(17-12-2014)-PETITION UNDER RULE 137.1.pdf

5290-KOLNP-2008-(17-12-2014)-PETITION UNDER RULE 137.pdf

5290-KOLNP-2008-(23-12-2013)-ANNEXURE TO FORM 3.pdf

5290-KOLNP-2008-(23-12-2013)-CORRESPONDENCE.pdf

5290-KOLNP-2008-(30-12-2014)-CORRESPONDENCE.pdf

5290-KOLNP-2008-(30-12-2014)-OTHERS.pdf

5290-kolnp-2008-abstract.pdf

5290-KOLNP-2008-ANEXURE TO FORM 3.pdf

5290-KOLNP-2008-ASSIGNMENT-1.1.pdf

5290-KOLNP-2008-ASSIGNMENT.pdf

5290-kolnp-2008-claims.pdf

5290-KOLNP-2008-CORRESPONDENCE 1.1.pdf

5290-KOLNP-2008-CORRESPONDENCE-1.1.pdf

5290-KOLNP-2008-CORRESPONDENCE-1.2.pdf

5290-kolnp-2008-correspondence.pdf

5290-kolnp-2008-description (complete).pdf

5290-kolnp-2008-drawings.pdf

5290-kolnp-2008-form 1.pdf

5290-KOLNP-2008-FORM 13.pdf

5290-KOLNP-2008-FORM 18.pdf

5290-KOLNP-2008-FORM 3-1.2.pdf

5290-KOLNP-2008-FORM 3.1.1.pdf

5290-kolnp-2008-form 3.pdf

5290-kolnp-2008-form 5.pdf

5290-kolnp-2008-international publication.pdf

5290-kolnp-2008-international search report.pdf

5290-KOLNP-2008-PA.pdf

5290-kolnp-2008-pct request form.pdf

5290-kolnp-2008-specification.pdf

abstract-5290-kolnp-2008.jpg


« Previous Patent
Next Patent »
Patent Number 265427
Indian Patent Application Number 5290/KOLNP/2008
PG Journal Number 09/2015
Publication Date 27-Feb-2015
Grant Date 24-Feb-2015
Date of Filing 29-Dec-2008
Name of Patentee INTERCEPT PHARMACEUTICALS, INC.
Applicant Address 18 DESBROSSES STREET, NEW YORK
Inventors:
# Inventor's Name Inventor's Address
1 FIORUCCI, STEFANO VIA DEI NARCISI, 25, I-06100, PERUGIA, ITALY
2 PELLICCIARI, ROBERTO VIA ROCCHI, 60, I-06100, PERUGIA
3 PRUZANSKI, MARK 421 HUDSON STREET,, NEW YORK, NY 10014
PCT International Classification Number A61K 31/575
PCT International Application Number PCT/US2007/014829
PCT International Filing date 2007-06-27
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 60/816,635 2006-06-27 U.S.A.