Title of Invention	OLIGONUCLEOTIDE PRIMER SEQUENCES FOR THE SPECIFIC AND SENSITIVE DETECTION OF BEBESIA BIGEMINA BY POLYMERASE CHAIN REACTION
Abstract	Bovine babesiosis is an economically important tick-borne disease causing considerable mortality and morbidity in purebred and cross-bred cattle while the indigenous and the recovered animals act as reservoir of infection to the susceptible population. For improved management of the disease, refinement of the currently available diagnostic tools is an urgent need. The parasitological and serological techniques in use today suffer from sensitivity and specificity limitations, ideally required for detection of low grade reservoirs of the disease. The polymerase chain reaction (PCR) method offers an exciting prospect of meeting the above requirements. The present invention deals with discovery of pair of oligonucleotide primer sequences of 23 base pairs length: 5" TTCCCACACGGTAGCGCGCAAAA 3"(Forward primer) and 5" GGGCGGTGAAAAGAGCAACGACA 3" (Reverse primer) for the sensitive and specific detection of B. bigemina by PCR method. The primer set was designed and custom synthesi/ed to amplify a single DNA band of 40()bp. The dc novo primers used in the PCR assay were designed using the nucleotide sequence information obtained from a monomorphic DNA fragment amplified by arbitrary primer- polymerase chain reaction from Indian isolates of Bahesia bigemina. The nucleotide sequence data comparison of this product revealed no homology with any known nucleotide sequence information of proto/oan parasites or the common mammalian host species lor the target parasite. The sensitivity limit of the primer set was 5 picograms of template DNA and higher than the previously described primer sequence (Figueroa el c;/.1992). No cross-amplification was evident with heterologous DNAs such as, bovine / hubaline leucocyte DNA and genomic DNAs obtained from common protozoan parasites of bovids like, Theileria annulata, Tryptinosoma cvansi. and Toxoplasma gondii.

Title of Invention

OLIGONUCLEOTIDE PRIMER SEQUENCES FOR THE SPECIFIC AND SENSITIVE DETECTION OF BEBESIA BIGEMINA BY POLYMERASE CHAIN REACTION

Abstract

Bovine babesiosis is an economically important tick-borne disease causing considerable mortality and morbidity in purebred and cross-bred cattle while the indigenous and the recovered animals act as reservoir of infection to the susceptible population. For improved management of the disease, refinement of the currently available diagnostic tools is an urgent need. The parasitological and serological techniques in use today suffer from sensitivity and specificity limitations, ideally required for detection of low grade reservoirs of the disease. The polymerase chain reaction (PCR) method offers an exciting prospect of meeting the above requirements. The present invention deals with discovery of pair of oligonucleotide primer sequences of 23 base pairs length: 5" TTCCCACACGGTAGCGCGCAAAA 3"(Forward primer) and 5" GGGCGGTGAAAAGAGCAACGACA 3" (Reverse primer) for the sensitive and specific detection of B. bigemina by PCR method. The primer set was designed and custom synthesi/ed to amplify a single DNA band of 40()bp. The dc novo primers used in the PCR assay were designed using the nucleotide sequence information obtained from a monomorphic DNA fragment amplified by arbitrary primer- polymerase chain reaction from Indian isolates of Bahesia bigemina. The nucleotide sequence data comparison of this product revealed no homology with any known nucleotide sequence information of proto/oan parasites or the common mammalian host species lor the target parasite. The sensitivity limit of the primer set was 5 picograms of template DNA and higher than the previously described primer sequence (Figueroa el c;/.1992). No cross-amplification was evident with heterologous DNAs such as, bovine / hubaline leucocyte DNA and genomic DNAs obtained from common protozoan parasites of bovids like, Theileria annulata, Tryptinosoma cvansi. and Toxoplasma gondii.

Full Text	4. DESCRIPTION prior art: Babesiosis caused hy Babesia bigemina, an intracellular haemoprotozoan disease of bovids is an economically important tick-borne disease. Clinical manifestations of an acute presentation of the disease include fever, anorexia, dullness, weakness, ataxia, haemoglobinuria, icterus, anaemia and presence of intra-erythrocytic parasites. A characteristic feature of Babesia infection is that animals, which recover from the acute infection, become carriers creating a source of infection to healthy susceptible population. Accurate diagnosis of babesiosis by microscopy is although practiced by clinicians, it is less sensitive. Further it requires well-trained microscopists for unequivocal identification of the organisms, which are morphologically similar, small in size or present in very small numbers. In vitro culture is as sensitive as PCR for identification of carrier cattle, but it is time-consuming and requires expensive tissue culture facilities, trained personnel, with limitation of low sample output. Although, a number of immunodiagnostic techniques have been described for diagnosis of babesiosis, I FAT is still considered a standard test, as it is moderately sensitive, specific and cost-effective. But low sample output and subjective interpretation of results are the major limitations. To date, most ELISAs used in babesiosis diagnosis employ relatively crude antigens, derived from infected erythrocyte preparations. These preparations are therefore, heavily contaminated with host erythrocyte components, leading to false positive results. Figueroa ct al. (Ann. N.Y. Acad. Sci. 3:131-145, 1992) described a PCR /non-radioactive probe assay in which the primers derived from a sequence contained in P ' insert were used to amplify a 278 bp i ragmen i from the genome of B bigemina. By a direct PC'R method. II. bigemina DNA was amplified from 20µl of packed erythrocytes with an estimated parasitaemia of 1 in 10' cells. The PCR based assay was reported to have a threshold sensitivity level of l0pg when the DNA template of B. bigemina (Mexican isolates) was used. This PCR detection system was subsequently incorporated into a multiplex PCR system in detecting cattle infected with B. bigemina. B. hovis and Anaplasma marginale infections. The analytical sensitivity of this assay was determined to be 1x10~7 (Buening and Figueroa, (Ann. N.Y. Acad. Sci. 791:466-468, 1996). Salem (Assuit. I'd. Med. ./., 39: 92-108, 1998) used primer sets and two oligonucleotide probes made from gene encoding a small subunit ribosomal RNA gene of B.hovis and B.bigemina. The analytical sensitivity was 200 parasites per milliliters for B.hovis and 15 parasites for B.bigemina. Salem (Assuit. Vet. Med ./., 40: 38-54, 1999) developed a PCR assay, which amplifies a portion of 644 bp apocytochrome b gene from B.hovis and B.bigemina in one reaction using common PCR primer sets conserved in both the species. The sensitivity of extra-chromosomal DNA based PCR was 50fg for B.bovis and 100 fg for B.bigemina genomic DNA after Southern hybridization. The invention under application has a higher threshold sensitivity level of detection than the previously described with regard to template DNA requirements, as may be needed for a reference laboratory test. The primer set provides a direct signal of the presence or absence of the test organism in the blood sample in one-step reaction without any mandatory requirement of further probing with oligonucieotide probes. RAPD profiles generated from the genomic DNA of four isolates of B. bigemina were analyzed using 34 single stranded arbitrary oligonucieotide primers with a GC content of 50-80% (33 decamers and 12 mer) of which 33 primers were potentially informative. Accordingly, a highly intense monomorphic band of 873 bp (Fig. 1) generated by an arbitrary primer (BG 27), consisting of 10 oligonucleotides (CGGTGGCGAA) of 70% GC content, was selected and cleaned with commercially available kit (Bangalore Genei, India). The isolated fragment was reamplified using the same arbitrary primer. To avoid PCR associated contamination, the band was further purified and used for cloning into pCR4-TOPO TA cloning vector following standard protocol. The cloned fragment was transformed into DH5α strain of E. coll. The recombinant white colonies were further grown in LB broth containing kanamycin (50µg/ml) at 37°C overnight. The plasmid DNA was isolated and subjected to restriction digestion using EcoRl. The nucleotide custom sequencing was performed at Delhi University, South Campus in both directions using T3-T7 primers. From the sequence information, primers were designed using Gene tool lite Launcher software for examining the suitability of B. bigemina specific DNA by double primered PCR assay. A primer set of 23 bp length with the following sequence was designed from the sequence information of B. bigemina cloned DNA fragment. Forward primer 5'TTCCCACACGGTAGCGCGCAAAA 3' Reverse primer 5' GGGCGGTGAAAAGAGCAACGACA 3' The custom synthesized primer was tested for its specificity and sensitivity. The specificity of the primer set was tested with B. Ingemina, T. nnnnlala, T. evansi, bovine DNA, bubaline DNA and T. gondii DNA. PCR assay (25ul volume) using the presently described de novo oligonucieotide primers can be carried out at a concentration of 6 picomoles each, in the presence of Taq polymerase (1-2 units). 5 µl of dN'I'Ps (ImM) and test sample consisting of de-haemoglobini/ed blood or template DNA of varying concentrations, and finally the volume made up with autoclaved distilled water. The designed primer set amplifies a single DNA band of 400bp using standard cycling conditions which can be visualized on an ethidium bromide stained 2 per cent agarose gel (Fig. 2). The analytical sensitivity of this primer set was also determined to a sensitivity level of 5 pg of template DNA of B. bigemina (Fig. 3). The PCR assay using the self designed primer set was also field tested with more then 100 bovine blood samples re¬affirming its specificity to B. bigemina infection. 5. CLAIMS We claim 1. the discovery of de nova oligonucleotide primer sequences for sensitive and specific detection of bigemina, a common haemoprotozoan parasite of cattle by polymerase chain reaction method. 2. using the nucleotide sequence information obtained from a monomorphic DNA fragment amplified by arbitrary primer-polymerase chain reaction (AP- PCR) from Indian isolates of Babesia bigemina, 3. the nucleotide sequence data of the AP-PCR product show no homology with any of the published nucleotide sequence information of protozoan parasites or the common mammalian host species till date, 4. the oligonucleotide primers described by us show higher level of threshold sensitivity ( up to 5 picograms) in comparison to a previously described primer set sequences (Figueroa el a/. 1992) in PCR assay, and thus, is an ideal choice for use in a reference laboratory test for detection of low-grade infections. 5. the oligonucleotide primer sequences show no cross-amplification with bovine or bubaline leucocyte DNA or with the other common protoxoan infections namely, Theilcria annulata. Trypanosomn evansi, and Toxoplasma gondii. 6. the primer set provides a signal for presence or absence of the test organism in one-step reaction without any mandatory requirement of a second step involving Southern hybridisation and; or re-amplification of the amplified product."

Full Text

4. DESCRIPTION prior art:
Babesiosis caused hy Babesia bigemina, an intracellular haemoprotozoan disease of bovids is an economically important tick-borne disease. Clinical manifestations of an acute presentation of the disease include fever, anorexia, dullness, weakness, ataxia, haemoglobinuria, icterus, anaemia and presence of intra-erythrocytic parasites. A characteristic feature of Babesia infection is that animals, which recover from the acute infection, become carriers creating a source of infection to healthy susceptible population. Accurate diagnosis of babesiosis by microscopy is although practiced by clinicians, it is less sensitive. Further it requires well-trained microscopists for unequivocal identification of the organisms, which are morphologically similar, small in size or present in very small numbers. In vitro culture is as sensitive as PCR for identification of carrier cattle, but it is time-consuming and requires expensive tissue culture facilities, trained personnel, with limitation of low sample output. Although, a number of immunodiagnostic techniques have been described for diagnosis of babesiosis, I FAT is still considered a standard test, as it is moderately sensitive, specific and cost-effective. But low sample output and subjective interpretation of results are the major limitations.
To date, most ELISAs used in babesiosis diagnosis employ relatively crude antigens, derived from infected erythrocyte preparations. These preparations are therefore, heavily contaminated with host erythrocyte components, leading to false positive results. Figueroa ct al. (Ann. N.Y. Acad. Sci. 3:131-145, 1992) described a PCR /non-radioactive probe assay in which the primers derived from a sequence contained in P ' insert were used to amplify a 278 bp i ragmen i from the genome of B bigemina. By a direct PC'R method. II. bigemina DNA was amplified from 20µl of packed erythrocytes with an estimated parasitaemia of 1 in 10' cells. The PCR based assay was reported to have a threshold sensitivity level of l0pg when the DNA template of B. bigemina (Mexican isolates) was used. This PCR detection system was subsequently incorporated into a multiplex PCR system in detecting cattle infected with B. bigemina. B. hovis and Anaplasma marginale infections. The analytical sensitivity of this assay was determined to be 1x10~7 (Buening and Figueroa, (Ann. N.Y. Acad. Sci. 791:466-468, 1996). Salem (Assuit. I'd. Med. ./., 39: 92-108, 1998) used primer sets and two oligonucleotide probes made from gene encoding a small subunit ribosomal RNA gene of B.hovis and B.bigemina. The analytical sensitivity was 200 parasites per milliliters for B.hovis and 15 parasites for B.bigemina. Salem (Assuit. Vet. Med ./., 40: 38-54, 1999) developed a PCR assay, which amplifies a portion of 644 bp apocytochrome b gene from B.hovis and B.bigemina in one reaction using common PCR primer sets conserved in both the species. The sensitivity of extra-chromosomal DNA based PCR was 50fg for B.bovis and 100 fg for B.bigemina genomic DNA after Southern hybridization. The invention under application has a higher threshold sensitivity level of detection than the previously described with regard to template DNA requirements, as may be needed for a reference
laboratory test. The primer set provides a direct signal of the presence or absence of the test organism in the blood sample in one-step reaction without any mandatory requirement of further probing with oligonucieotide probes.
RAPD profiles generated from the genomic DNA of four isolates of B. bigemina were analyzed using 34 single stranded arbitrary oligonucieotide primers with a GC content of 50-80% (33 decamers and 12 mer) of which 33 primers were potentially informative.
Accordingly, a highly intense monomorphic band of 873 bp (Fig. 1) generated by an arbitrary primer (BG 27), consisting of 10 oligonucleotides (CGGTGGCGAA) of 70% GC content, was selected and cleaned with commercially available kit (Bangalore Genei, India). The isolated fragment was reamplified using the same arbitrary primer. To avoid PCR associated contamination, the band was further purified and used for cloning into pCR4-TOPO TA cloning vector following standard protocol. The cloned fragment was transformed into DH5α strain of E. coll. The recombinant white colonies were further grown in LB broth containing kanamycin (50µg/ml) at 37°C overnight. The plasmid DNA was isolated and subjected to restriction digestion using EcoRl. The nucleotide custom sequencing was performed at Delhi University, South Campus in both directions using T3-T7 primers. From the sequence information, primers were designed using Gene tool lite Launcher software for examining the suitability of B. bigemina specific DNA by double primered PCR assay. A primer set of 23 bp length with the following sequence was designed from the sequence information of B. bigemina cloned DNA fragment.
Forward primer 5'TTCCCACACGGTAGCGCGCAAAA 3' Reverse primer 5' GGGCGGTGAAAAGAGCAACGACA 3'
The custom synthesized primer was tested for its specificity and sensitivity. The specificity of the primer set was tested with B. Ingemina, T. nnnnlala, T. evansi, bovine DNA, bubaline DNA and T. gondii DNA. PCR assay (25ul volume) using the presently described de novo oligonucieotide primers can be carried out at a concentration of 6 picomoles each, in the presence of Taq polymerase (1-2 units). 5 µl of dN'I'Ps (ImM) and test sample consisting of de-haemoglobini/ed blood or template DNA of varying concentrations, and finally the volume made up with autoclaved distilled water. The designed primer set amplifies a single DNA band of 400bp using standard cycling conditions which can be visualized on an ethidium bromide stained 2 per cent agarose gel (Fig. 2). The analytical sensitivity of this primer set was also determined to a sensitivity level of 5 pg of template DNA of B. bigemina (Fig. 3). The PCR assay using the self designed primer set was also field tested with more then 100 bovine blood samples re¬affirming its specificity to B. bigemina infection.

5. CLAIMS
We claim
1. the discovery of de nova oligonucleotide primer sequences for sensitive and
specific detection of
bigemina, a common haemoprotozoan parasite of cattle by polymerase chain reaction method.
2. using the nucleotide sequence information obtained from a monomorphic
DNA fragment amplified by arbitrary primer-polymerase chain reaction (AP-
PCR) from Indian isolates of Babesia bigemina,
3. the nucleotide sequence data of the AP-PCR product show no homology
with any of the published nucleotide sequence information of protozoan
parasites or the common mammalian host species till date,
4. the oligonucleotide primers described by us show higher level of threshold
sensitivity ( up to 5 picograms) in comparison to a previously described primer
set sequences (Figueroa el a/. 1992) in PCR assay, and thus, is an ideal choice
for use in a reference laboratory test for detection of low-grade infections.
5. the oligonucleotide primer sequences show no cross-amplification with
bovine or bubaline leucocyte DNA or with the other common protoxoan
infections namely, Theilcria annulata. Trypanosomn evansi, and Toxoplasma
gondii.
6. the primer set provides a signal for presence or absence of the test organism
in one-step reaction without any mandatory requirement of a second step
involving Southern hybridisation and; or re-amplification of the amplified
product."

Documents:

http://ipindiaonline.gov.in/patentsearch/GrantedSearch/viewdoc.aspx?id=9SMkV+pj/sSiIk1WAwK+yg==&loc=+mN2fYxnTC4l0fUd8W4CAA==

« Previous Patent

Next Patent »

Patent Number

269419

Indian Patent Application Number

407/DEL/2008

PG Journal Number

44/2015

Publication Date

30-Oct-2015

Grant Date

20-Oct-2015

Date of Filing

18-Feb-2008

Name of Patentee

INDIAN COUNCIL OF AGRICULTURAL RESEARCH (ICAR)

Applicant Address

KRISHI BHAVAN, 1,DR.RAJENDRA PRASAD ROAD, NEW DELHI-110001

Inventors:

#	Inventor's Name	Inventor's Address
1	JAMMI RAGHAVENDRA RAO	HEAD, DIVISION OF PARASITOLOGY, INDIAN VETERINARY RESEARCH INSTITUTE,IZATNAGAR-243122, UTTAR PRADESH
2	ASHOK KUMAR MISHRA	PRINCIPAL SCIENTIST, DIVISION OF PARASITOLOGY, INDIAN VETERINARY RESEARCH INSTITUTE,IZATNAGAR-243122, UTTAR PRADESH
3	REGHU RAVINDRAN	PH.D SCHOLAR, DIVISION OF PARASITOLOGY, INDIAN VETERINARY RESEARCH INSTITUTE, IZATNAGAR-243122, UTTAR PRADESH

PCT International Classification Number

C07H21/04; C12Q1/68

PCT International Application Number

N/A

PCT International Filing date

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1			NA