Title of Invention

"A RECOMBINANT DNA VACCINE"

Abstract A recombinant DNA vaccine comprising: an antigen-encoding region comprising a nucleotide sequence encoding a HIV antigen; and a biologically active component-encoding region comprising a nucleotide sequence encoding the Al domain of the A subunit of cholera toxin or fragment thereof, and wherein the Al domain of the A subunit or fragment thereof retains the ADP-ribosylating activity of the cholera toxin.
Full Text The present invention provides £0=exprfiasiojQ DNA vaccines and methods, for vaccinating animals against viral, bacterial and parasitic pathogens. In particular, the present invention relates to DNA vaccines that co-express antigens in combination with biologically-active components, such as adjuvants, immunoregulatory agents, antisense RNAs, and/or catalytic RNAs.
BACKGROUND OF THE INVENTION
Conventional DNA vaccines are normally produced as a plasmid that can be introduced into animal tissue and therein expressed by animal cells to produce a messenger ribonucleic acid (mRNA) molecule, which is translated to produce one protein, one fragment of a protein or one fusion protein.
A diverse array of conventional DNA vaccines are known in the art. These vaccines generally include a plasmid vector, a promoter for transcription initiation that is active in eukaryotic cells, and a vaccine antigen (Gurunathan, et al, Ann. Rev. Immunol., 18:927 (2000); Krieg, Biochim. Biophys. Acta., 1489:107 (1999); Cichutek, Dev. Biol. Stand., 100:119 (1999); Davis, Microbes Infect, 1:7 (1999); Leitnex, Vaccine, 18:765 (1999)).
Examples of plasmid vectors that have been used in conventional DNA vaccines include pBR322 (ATCC# 31344); pUC19 (ATCC# 37254); pcDNA3.1 (Invitrogen, Carlsbad CA 92008; Cat. NO. V385-20; DNA sequence available at www.invitrogen.com/vectordata/index.html); pNGVL (National Gene Vector Laboratory, University of Michigan, MI); p414cyc (ATCC# 87380), p414GALS (ATCC# 87344), pBAD18 (ATCC# 87393), pBLCAT5 (ATCC# 77412),

pBluescriptUKS, (ATCC# 87047), pBSL130 (ATCC# 87145), pCM182 (ATCC# 87656), pCMVtkLUC (ATCC# 87633), pECV25 (ATCC#77187), pGEM-7zi (ATCC# 87048), pGEX-KN (ATCC# 77332), pJC20 (ATCC# 87113, pUBHO (ATCC# 37015), pUB18 (ATCC# 37253).
Examples of promoters that have been used in conventional DNA vaccines include the SV40 early promoter (GenBank accession # M99358, Fiers, et al., Nature, 273: 113-120 (1978)); the cytomegalovirus immediate early promoter/enhancer (GenBank accession # "AF025843); and the rous sarcoma virus long terminal repeat prompter (Genbank accession # M83237; Lon, et al., Hum. Immunol., 31: 229-235 (1991)); eukaryotic promoters or parts thereof, such as ß-casein (GenBank accession # AF194986; Fan, et al., Direct submission (2000)); uteroglobin (GenBank accession # NM003357; Hay, et al., Am. J. Physiol., 268: 565-575 (1995)); p-actin (GenBank accession # NM001101; ref Vandekerckhove and Weber, Proc. Natl. Acad. Sci. U.S.A., 73: 1106-1110 (1978)); ubiquitin (GenBank accession # AJ243268; Robinson. Direct Submission, (2000)) or tyrosinase (GenBank accession # NM000372; Shibaharo, et al., Tohoku J. Exp. Med., 156:403-414 (1988)) promoters.
Examples of vaccine antigens that have been used in conventional DNA vaccines include Plasmodium vivax and Plasmodium falciparum antigens; Entamoeba histolytica antigens; Hepatitis C virus antigens, Hepatitis B virus antigens, HIV-1 antigens, Semliki Forest virus antigens, Herpes Simplex viral antigens, Pox virus antigens, Influenza virus antigens, Measles virus antigens, Dengue virus antigens and Papilloma virus antigens. A comprehensive reference database of DNA vaccine citations is available at (www.DNAvaccine.com/Bibho/articles.htm).
Since their inception in 1993, conventional DNA vaccines encoding an antigen under the control of an eukaryotic or viral promoter have been used to immunize rodents (e.g., mice, rats and guinea pigs, swine, chickens, ferrets, non-human primates and adult volunteers (Webster, et al., Vacc., 12:1495-1498 (1994); Bernstein, et al., Vaccine, 17:1964 (1999); Huang, et al.,Virol Immunol., 12:1 (1999); Tsukamoto, et al., Virology, 257:352 (1999); Sakaguchi, et al., Vaccine, 14:747 (1996); Kodihalli, et al., J. Virol., 71: 3391 (1997); Donnelly, et al., Vaccine, 15:865 (1997); Fuller, et al.,


Vaccine, 15:924 (1997); Fuller, et al., Immunol. Cell Biol., 75: 389 (1997); Le, et al., Vaccine, 18:1893 (2000); Boyer, et al., J. Infect. Dis., 181:476 (2000));
Although conventional DNA vaccines induce immune responses against a diverse array of antigens, the magnitudes of the immune responses have not always been sufficient to engender protective immunity. Several approaches have been developed to increase the immunogenicity of conventional DNA vaccines, including the use of altered DNA sequences, such as the use of antigen-encoding DNA sequences optimized for expression in mammalian cells (Andre, J. Virol., 72:1497 (1998); Haas, et al., Curr. Biol. 6:315-24 (1996); zur Megede, ., J. Virol., 74:2628 (2000); Vinner, et al., Vaccine, 17:2166 (1999); Krieg, Biochim. Biophys. Acta., 1489:107 (1999); McAdam, et al., J. Virol., 74: 203-208 (2000); Davis, Curr. Top. Microbiol. Immunol., 247:17 (2000); McCluskie, Grit. Rev. Immunol., 19:303 (1999); Davis, Curr. Opin. Biotechnol, 8:635 (1997); Lobell, J. Immunol., 163:4754 (1999)). The immunogenicity of conventional DNA vaccines can also be modified by formulating the conventional DNA vaccine in an adjuvant, such as aluminum phosphate or aluminum hydroxyphosphate (Ulmer, et al., Vaccine, 18:18 (2000)), monophosphoryl-lipid A (also referred to as MPL or MPLA; Schneerson, et al., J. Immunol., 147: 2136-2140 (1991); Sasaki, et al., Inf. Immunol., 65: 3520-3528 (1997); Lodmell, et al., Vaccine, 18: 1059-1066 (2000)), QS-21 saponin (Sasaki, et al., J. Virol., 72:4931 (1998); dexamethasone (Malone, et al., J. Biol. Chem., 269:29903 (1994); CpG DNA sequences (Davis, et al., J. Immunol., 15:870 (1998); lipopolysaccharide (LPS) antagonist (Shata and Hone, PCT International Application No. PCT/US00/27402), a cytokine (Hayashi, et al., Vaccine, 18: 3097-3105 (2000); Sin, et al., J. Immunol., 162: 2912-2921 (1999); Gabaglia, et al., J. Immunol., 162: 753-760 (1999); Kim, et al., Eur. J. Immunol., 28:1089 (1998); Barouch, et al., J. Immunol., 161:1875 (1998); Okada, et al., J. Immunol., 159:3638 (1997); Kim, et al., J. Virol, 74:3427 (2000)), or a chemokine (Boyer, et al, Vaccine, 17(Suppl 2):S53 (1999); Xin, et al., Clin. Immunol., 92:90 (1999)).
Cholera toxin (Ctx) is a well-known adjuvant that is typically used to augment the immunogenicity of mucosal vaccines, such as those given intranasally or orally (Xu-Amano, et al., J. Exp. Med., 178:1309 (1993); VanCott, et al., Vaccine, 14:392 (1996); Jackson, R. J. et al., Infect, hnmun., 61:4272 (1993); Marinaro, M. et al., Ann.

New York Acad. Sci., 795:361 (1996); Yamamoto, S. et al., J. Exp. Med., 185:1203 (1997); Porgador, et al., J. Immunol., 158:834 (1997); Lycke and Holmgren, Monogr., Allergy, 24:274 (1988); Hornquist and Lycke, Eur. J. Immunol., 23:2136 (1993); Hornquist, et al., Immunol., 87:220 (1996); Agren, et al., Immunol. Cell Biol., 76:280 (1998)). The adjuvant activity of Ctx is mediated by the Al domain of the A subunit of Ctx -(herein referred to as CtxAl); chimeric proteins comprised of an antigenic protein fused to the CtxAl protein demonstrate that CtxAl alone possesses adjuvant activity (Agren, et al, J. Immunol., 164:6276 (2000); Agren, et al., Immunol. Cell Biol., 76:280 (1998); Agren, et al., J. Immunol., 158:3936 (1997)). The utilization of the A subunit, the Al domain of Ctx or analogues thereof in a DNA vaccine has not heretofore been reported.
More recently the use of Ctx as an adjuvant has been extended to transcutaneous vaccines (Glenn, et al., Infect. Immun., 67:1100 (1999); Scharton-Kersten, et al., Vaccine ,17(Suppl. 2):S37 (1999)). Thus, recent evidence suggests that cholera toxin (CT) as an adjuvant applied topically with an antigen to the skin surface (i.e. transcutaneous vaccination) elicits IgG responses against the antigen, whereas topical application of the antigen alone does not induce detectable IgG response (Glenn, et al., supra (1999); Scharton-Kersten, et al., supra (1999)).
Although the function of the human immunodeficiency virus (HIV) Tat protein in viral RNA expression is well established, the auxiliary functions ascribed to Tat remain controversial (Gallo, Proc. Natl. Acad. Sci. 96:8324 (1999)). A growing consensus suggests that Tat possesses immunoregulatory properties (Viscidi, et al., Science, 246:1606 (1989); Frankel, et al., Proc. Natl. Acad. Sci., 86:7397 (1989); Frankel and Pabo, CelL 55:1189 (1988); Ito, et al., AIDS Res. Hum Retroviruses, 14:845 (1998); Wrenger, et al., J Biol Chem., 272:30283-8 (1997); Wrenger, et al., FEBS Lett., 383:145 (1996); Wrenger, et al., J. Biol. Chem., 272:30283 (1997); Zauli, et al., Blood, 80:3036 (1992); Lachgar, et al., Biomed. Pharmacother., 50:13 (1996)). In one study, recombinant Tat was shown to inhibit antigen-specific T cell proliferation in peripheral blood mononuclear cells (PBMCs) collected from healthy volunteers (Viscidi, et al., Science, 246:1606 (1989)). hi another independent study, recombinant Tat inhibited the proliferation of purified T cells in response to

immobilized CD3-specific monoclonal antibodies (Meyaard, et al., Eur. J. Immunol., 22: 2729-2732 (1992)). The latter result suggests that the immunoregulatory activity of Tat is exerted directly on T cells. In agreement, Westendorp, et al., (Westendorp, et al., Nature, 375: 497-500 (1995)) showed that purified Tat sensitized a T cell line and enriched primary CD4+ and CD8+ T cells to cell death by apoptosis. Oxidation of Tat (Westendorp, et al., supra, (1995)) or pretreatment of Tat with anti-Tat monoclonal antibodies (McCloskey, et al.; J Immunol., 158:1014 (1997)) was shown to eliminate the pro-apoptotic activity, suggesting that a native Tat structure and binding to a cellular target maybe central to the apoptosis activity.
In contrast, expression of Tat by transfected Jurkat cells did not render them sensitive to anti-CD3-mediated apoptosis (McCloskey, et al., supra (1997); Gibellini, et al., Br. J. Haematol., 89:24 (1995)). Thus, Tat might protect HIV-infected T cells from pro-apoptotic signals and yet exert pro-apoptotic affects on uninfected T cells (McCloskey, et al., supra (1997); Gibellini, et al., supra (1995)).
Tat has been shown to alter the function of antigen presenting cells (herein referred to as APCs). Data have been reported showing that extracellular Tat induces interferon-a secretion by peripheral blood mononuclear cells, which in turn suppresses lymphocyte proliferation (Zagury, et al., Proc. Nat. Acad. Sci. U.S.A, 95: 3851-3856 (1998)). Another report suggests that the RGD domain of Tat inhibits the uptake of apoptotic blebs by dendritic cells (Zoch, et al., AIDS, 11:1227-1235 (1997)). Yet another report indicated that Tat may induce transforming growth factor-beta (TGF-p) expression, which is know to alter APCs and impart immunosuppressive activity (Gibellini, et al., Br. J. Haematol., 88:261 (1994); Zauli, et al., Blood, 80:3036 (1992)). Collectively, these observations suggest that the immunoregulatory activity of Tat may encumber a broad array of immune cell subsets.
A common prediction among previous studies, is that infected cells release Tat and that exogenous Tat subsequently imparts its immunoregulatory affects on mononuclear cells patrolling the foci of an HIV infection (Viscidi, et al., supra (1989); Frankel, et al., supra (1989); Frankel and Pabo, supra (1988); Ito, et al., supra (1998); Wrenger, et al., supra (1997); Wrenger, et al, supra (1996); Wrenger, et al.,

supra (1997); Zauli, et al., supra (1992); Lachgar, et al., supra (1996); Zocchi, et al. supra (1997)). In support of this notion, it is believed that soluble exogenous Tat is transported by an as yet undefined mechanism into the intracellular compartment (e.g., the cytoplasm and nucleus) of cell cultured in vitro (Vives, et al., J. Biol. Chem., 272:16010 (1997); Ma, et al., J. Virol., 71:2495 (1997); Valvatae, et al., AIDS Res. Hum. Retroviruses, 12:611 (1996); Chen, et al., Anal. Biochem., 227:168 (1995); Ensoli, et al., J. Virol., 67:277 (1993); Mann and Frankel, EMBO J., 10:1733 (1991); Frankel and Pabo, Cell, 55:1189 (1988)). Indeed, chimeric fusion proteins incorporating the Tat transcellular uptake sequence have become a molecular tool for introducing passenger proteins into mammalian cells (Kim, et al., J. Immunol., 159:1666 (1997); Fawell, et al., Proc. Natl. Acad. Sci., 91:664 (1994)).
However, the levels of Tat (up to 10 µg/ml) used to induce anti-proliferative and pro-apoptotic effects in vitro, as observed in the reports cited above, may not occur during the natural course of an HIV infection (Helland, et al., J. Virol., 65:4547 (1991)). An alternative view, therefore, is that expression of Tat by T cells down regulates HLA class I levels in the infected cell (Carroll, et al., Mol. Immunol., 35:1171-1178 (1998); Matsui, et al., J. Acquir. Immune Defic. Syndr. Hum. Retrovirol., 11(3)233 (1996); Howcroft et al., Science, 260: 1320-1322 (1993)). Others have demonstrated the down regulation of HLA class II molecules (Kanazawa, et al., Immunity, 12: 61-70 (2000); Tosi, et al., Eur. J. Immunol., 30: 19-28 (2000)). These studies adhere to the notion that immunoregulation by Tat occurs primarily in HIV-infected cells. None of these reports rule out the possibility that immunoregulatory activity of Tat may be mediated through a combination of intercellular and intracellular effects.
Hence, an animal model that mimics the immunoregulatory property of Tat would be a useful tool to define the mechanism utilized by Tat to influence immune function aid for the development and assessment of preventive and therapeutic strategies (e.g., jharmaceutics and vaccines) against the auxiliary function(s) (e.g., mmunoregulatory) of Tat. Unfortunately, heretofore expression of Tat in transgenic nice caused pleiotropic pathological affects (Choi, et al., J Biol Chem., 275:3693 2000); Brady, et al., J. Virol., 69: 7622 (1995); Kundu, et al., Blood, 94: 275 (1999)), naking them difficult to adapt for use in controlled immunological studies. More

recently, a murine model was reported in which recombinant Tat was shown to modestly suppress the serum IgG and proliferative responses to an HIV-1 p24 vaccine (Cohen, et al., Proc. Natl. Acad. Sci. U.S.A., 96: 10842-10847 (1999)). However, the immunosuppressive activity required large quantities of purified recombinant Tat, which is difficult to produce and expensive to purchase commercially. Further, the recombinant Tat used in the above-cited study was deactivated by oxidation (Cohen, et., supra (1999)); thus, the murine model is highly susceptible to qualitative variations in the recombinant Tat employed and its shelf half-life. Accordingly, at present there is no satisfactory laboratory animal model that reproducibly mimics the immunoregulatory properties of the HIV-1 Tat protein.
The prior art provides for conventional DNA vaccines. The immunogenicity of conventional DNA vaccines is modified by mixing the conventional DNA vaccine with an adjuvant or a second plasmid encoding an immunoregulatory protein (e.g., a cytokine or chemokines).
However, heretofore, there has been no demonstration that DNA vaccines that co-express an antigen in combination with adjuvants, immunoregulatory agents, antisense RNAs, and catalytic RNAs are more effective than a mixture of a conventional DNA vaccine and a plasmid that encodes an immunoregulatory protein. That is, until the present invention which provides the first DNA vaccine that co-expresses an antigen and a biologically-active component such as, an adjuvant, immunoregulatory agent, antisense RNA, or catalytic RNA and that is shown hereinbelow to be more effective than the sum of its parts.
SUMMARY OF THE INVENTION
The present invention describes the novel and unexpected finding that co-expression DNA (CED) vaccines display unprecedented immunogenic properties. An important application of CED vaccines is that they are capable of inducing significantly stronger immune responses against vaccine antigens than conventional DNA vaccines. Another important application of CED vaccines is that they are capable of inducing systemic tolerance. Further, the present invention provides the first documentation that CED

vaccines are more effective than the sum of the parts.
In one aspect the present invention provides for CED vaccines that co-express at least one antigen in combination with at least one biologically-active component including, but not limited to adjuvants, immunoregulatory agents, antisense RNAs, and/or catalytic RNAs.
In another aspect the present invention provides CED vaccines that can be used to enhance immune responses, induce systemic tolerance" and/or develop prophylactic and therapeutic agents.
A still further aspect of the present invention provides for an animal model, e.g., murine, that reproducibly mimics the immunoregulatory properties of the HIV-1 Tat protein thereby providing for the development of prophylactic and therapeutic agents. against HIV-1.
Another aspect of the present invention provides for assays usable in the development of therapeutic agents against Tat-mediated immune deviation, the development of therapeutic vaccines against Tat-mediated immune deviation and development of preventive vaccines against Tat-mediated immune deviation.
Yet another aspect of the present invention provides a DNA vaccine against HIV comprising a HIV antigen and an immunoregulatory agent for the treatment and/or prevention of Tat-mediated immune deviation.
A still further aspect provides for a DNA vaccine against HIV comprising a nucleotide sequence encoding a CDld epitope and CDld and/or an immunoregulatory agent for the treatment and/or prevention of Tat-mediated immune deviation.
Yet a further aspect relates to DNA vaccines that co-express an antigen and an adjuvant, immunoregulatory agent, antisense RNA, or catalytic RNA, wherein the latter enhances the immune response to the antigen.

Another aspect of the present invention relates to a kit comprising any one or more of the DNA vaccines of the present invention embodied in a plasmid or expression cassette for insertion into a plasmid. The kit optionally comprises one or more instruments and/or reagents for vaccinating an animal and also may comprise instructions for preparing the vaccine for administration and/or for vaccinating an animal.
These and other aspects of the present invention, will be apparent from the detailed description of the invention provided hereinafter
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows a diagrammatic depiction of a generic DNA vaccine that co-expresses an antigen and an adjuvant, immunoregulatory agent, antisense RNA, or catalytic RNAs through the use of a dicistronic mRNA.
Figure 2 shows diagrammatic depictions of a generic DNA vaccine that co-expresses an antigen and an adjuvant, immunoregulatory agent, antisense RNA, or catalytic RNA each using an independent promoter.
Figure 3 shows the nucleotide sequence of htat and the amino acid sequence of htat
Figure 4 shows the recombinant DNA strategy used to construct pOGLl -wT.
Figure 5 shows the serum IgG response to HIV-l gpl20 by mice that were vaccinated with pOGLl and pOGLl-wT that a strong serum IgG response against gpl20 was developed, whereas the mice vaccinated with pOGLl-wT did no develop an anti-gp l20 IgG response.
Figure 6 shows the results of the ELISPOT assay which indicate that mice vaccinated with plasmid pOGLl develop a strong gpl20-specific IFN--secreting CD8+ T cell response, whereas the mice vaccinated with pOGLl-wT did not elicit a measurable gpl20-specific IFN--secreting CD8+ T cell response.


Figure 7 shows the results of mice challenged with vaccinia-env vector strain vT26, which expresses Env of HIV-IMN.
Figure 8 shows the scheme used in the construction of a novel DNA vaccine that co-expresses an antigen (e.g., gpl20) and an adjuvant (e.g., CtxAl), referred to herein as "pOGLl-Al", constructed by replacing tat in pOGLl-wT with .sequences encoding the Al domain of CT (i.e. CtxAl).
Figure 9 shows data indicating that mice vaccinated with pOGLl-Al develop a serum IgG response against gpl20 that is 10-fold greater than the anti-gpl20 serum IgG response in pOGLl-vaccinated mice 22 days after vaccination, when the peak response occurs in these latter mice.
Figure 10 shows data indicating that mice vaccinated with the dicistronic DNA vaccine pOGLl-Al and the mixture of pOGLl and pRc/CMV-ctxAl developed strong serum IgG responses against gpl20 that were substantially stronger that the anti-gpl20 serum IgG response that arose in pOGLl vaccinated mice.
Figure 11 shows the recombinant DNA strategy used to incorporate TRP-1 into a constructed pOGLl-wT.
Figure 12 shows the recombinant DNA strategy used to incorporate nucleotide sequences encoding for TRP-1 and TGF-ß- into a pcDNA3.1.
Figure 13 shows the results of an ELISPOT assay showing that mice vaccinated with plasmid pOGLl, pOGLl-T and pOGLl-pOGL2 developed a strong gpl20-specific IFN--secreting CD8 T cell response, whereas mice vaccinated with pOGLl-wT did not elicit a measurable gp 120-specific IFN-γ-secreting CD8 T cell response.
Figure 14 is a flow diagram illustrating an algorithm for construction of CED vaccines.


DETAILED DESCRIPTION OF THE INVENTION
Generic structure of co-expression DNA vaccines: Two preferred configurations are provided as exemplary of the CED vaccines of the present invention. The first preferred configuration expresses a dicistromc mRNA comprising a plasmid backbone, a promoter that is functional in eukaryotic cells, an internal ribosomai entry site additional genetic element, at least one vaccine antigen, and at least one biologically-active component including immunoregulatory proteins and peptides. Further, the CED vaccines of the present invention can encode adjuvants, antisense RNAs and/or catalytic RNAs. Diagrammatic depiction of generic CED vaccines that express dicistronic mRNAs are shown in Figure 1.
In the second configuration, the CED vaccine expresses at least two products from distinct promoters comprising a plasmid backbone, a promoter that is functional in eukaryotic cells, at least one vaccine antigen, and at least one biologically-active component such as an immunoregulatory protein or peptide. Further, the CED, vaccines of the present invention can encode adjuvants, antisense RNAs and/or catalytic RNAs. Diagrammatic depictions of generic CED vaccines that express two mRNAs are shown in Figure 2.
Plasmid vectors useful for co-expression DNA vaccines: The particular plasmid
backbone employed in the present invention is not critical thereto, and can be selected from any of the many commercially available cassettes, such as pBR322 (ATCC# 31344); pUC19 (ATCC# 37254); pcDNA3.1zE0 (Invitrogen Cat.# V790-20), pRc/CMV (GenBank accession E14286) obtained from Invitrogen Corporation (San Diego, CA); pXTl (GenBank accession M26398) or pSG5 (GenBank accession AfO 13258), obtained from Stratagene (La JoIIa, CA); pPUR (GenBank accession U07648) or pMAM (GenBank accession U02443) obtained from ClonTech (Palo Alto, CA); pDual (GenBank accession # AF041247); pG51uc (GenBank accession # AF264724); pACT (GenBank accession # AF264723); pBIND (GenBank accession # AF264722); pCI-Neo (GenBank accession # U47120); pCMV-BD (GenBank accession # AF151088); pIRES-P (GenBank accession # Z75185); pRL-CMV (GenBank accession # AF025843) or synthesized either denovo or by adaptation of a

publicly or commercially available eukaryotic expression system. Procetlures for de novo DNA synthesis are described herein below.
Promoters useful fnr m-expression DNA vaccines: The particular promoter employed in the present invention may be selected from promoters useful for driving expression of genes in animal cells, such as the viral promoters or parts or derivatives thereof, such as the cytomegalovirus immediate early promoter/enhancer (GenBank accession # AF025843X and rous sarcoma virus long terminal repeat promoter (GenBank accession # M83237; Lon, et al., Hum. Immunol., 31: 229-235 (1991)).
Alternatively, the promoter employed in the present invention can be selected from eukaryotic promoters useful for driving expression of genes in animal cells or parts thereof including but not limited to the P-casein promoter (GenBank accession # AF194986; Fan, et al., Direct submission {2000)); uteroglobin promoter (GenBank accession # NM003357; Hay, et al., Am. J. Physiol., 268: 565-575 (1995)); the desmin gene, promoter that is only active in muscle cells (Loirat, et al., Virology, 260:74 (1999)); the constitutively expressed p-actin promoter (GenBank accession # NM001101; Vandekerckhove and Weber. Proc. Natl. Acad. Sci. U.S.A., 73: 1106-1110 (1978)); ubiquitin (GenBank accession # AJ243268) or the tyrosinase promoter (GenBank accession # NM0O0372; Shibaharo, et al, J. Exp. Med., 156: 403-414 (1988)).
Although the particular promoter is not critical to the present, there will be exceptions when the object is to selectively target expression to specific cell types. In this case, the selected promoter is one that is only active in the target cell type. Examples of tissue specific promoters include, but are not limited to, ß SI- and ß-casein promoters which are specific for mammary tissue (Platenburg, et al., Trans. Res, 3:99-108 (1994); and Maga, et al., Trans. Res., 3:36-42 (1994)); the phosphoenolpyruvate carboxykinase promoter which is active in liver, kidney, adipose, jejunum and marnmary tissue (McGrane, et al, J. Reprod. Fert, 41:17-23 (1990)); the tyrosinase promoter which is active in lung and spleen cells, but not testes, brain, heart, liver or kidney (Vile, et al., Cane. Res., 54:6228-6234 (1994)); the involucerin promoter which is only active in differentiating keratinocytes of the squamous epithelia

(Carroll, et al„ J. Cell Sci., 103:925-930 (1992)); the uteroglobin promoter which is active in lung and endometrium (Helftenbein, et al., Annal. N.Y. Acad. Sci., 622:69-79 (1991)) and the desmin gene promoter that is only active in muscle cells (Loirat, et al., Virology, 260:74 (1999)).
Internal ribosomeentry sites useful for co -expression DNA vaccines: Translation of mRNA in eukaryotic cells requires the presence of a ribosomal recognition signal. Prior to initiation of translation of mRNA in eukaryotic cells, the 5-prime end of the mRNA molecule is "capped" by addition of methylated guanylate to the first mRNA nucleotide residue (Lewin, Genes V, Oxford University Press, Oxford (1994); Damellet, et al., Molecular Cell Biology, Scientific American Books, Inc., W.H. Freeman and Co., New York, NY (1990)). It has been proposed that recognition of the translational start site in mRNA by the eukaryotic ribosomes involves recognition of the cap, followed by binding to specific sequences surrounding the initiation codon on the mRNA. After recognition of the mRNA by the ribosome, translation initiates and typically produces a single protein species per mRNA molecule (I^ewin, Genes V, Oxford University Press, Oxford (1994); Darnell, et al., Molecular Cell Biology, Scientific American Books, Inc., W.H. Freeman and Co., New York, NY (1990)).
It is possible for cap independent translation initiation to occur and/or to place multiple eukaryotic coding sequences within a eukaryotic expression cassette if an internal ribosome entry sequence (IRES) is present on the mRNA molecule (Duke, et al., J. Virol., 66:1602-1609 (1992)). IRES are used by viruses and occasionally in mammalian cells to produce more than one protein species per mRNA molecule as an alternative strategy to mRNA splicing ((Creancier, et al., J. Cell. Biol., 150:275 (2000); Lzquierdo and Cuezva, Biochem. J., 346:849 (2000)).
The particular IRES employed in the present invention is not critical and can be selected from any of the commercially available vectors that contain IRES sequences such as those located on plasmids pCITE4a-c (Novagen, http://www.novagen.com); US patent # 4,937,190); pSLIRESll (Accession: AF171227; pPV (Accession # Y07702); pSVIRES-N (Accession #: AJ000156); Creancier, et al., J. Cell Biol., 10: 275-281 (2000); Ramos and Marrinez-Sala, RNA, 10: 1374-1383 (1999); Morgan, et

al, Nucleic Acids Res., 20: 1293-1299 (1992); Tsukiyama-Kohara, et al., J. Virol., 66: 1476-1483 (1992); Jang and Wimmer, et al., Genes Dev., 4: 1560-1572 (1990)), on the dicistronic retroviral vector (Accession #: D88622); found in eukaryotic cells such as the Fibroblast growth factor 2 IRES for stringent tissue-specific regulation (Creancier, et al., J. Cell. Biol., 150:275 (2000)) or the Ihternal-ribosome-entry-site of the 3'-untranslated region of the mRNA for the beta subunit of mitochondrial H+-ATP synthase (Izquierdo and Cuezva, Biochem. J., 346:849 (2000)).
Antigens nseful for co-expression DNA vaccines- In the present invention, the CED encodes an antigen which may be either a foreign antigen or an endogenous antigen.
As used herein, "foreign antigen" refers to a protein or fragment thereof, which is foreign to the recipient animal cell or tissue including, but not limited to, a viral protein, a parasite protein, an immunoregulatory agent, or a therapeutic agent.
The term "endogenous antigen" is used herein to refer to a protein or part thereof that is naturally present in the recipient animal cell or tissue, such as a cellular protein, a immunoregulatory agent, or a therapeutic agent.
The foreign antigen may be a protein, an antigenic fragment or antigenic fragments thereof that originate from viral and parasitic pathogens.
Alternatively, the foreign antigen may be encoded by a synthetic gene and may be constructed using conventional recombinant DNA methods (See example 1 for synthetic gene construction procedures); the synthetic gene may express antigens or parts thereof that originate from viral and parasitic pathogens. These pathogens can be infectious in humans, domestic animals or wild animal hosts.
The foreign antigen can be any molecule that is expressed by any viral or parasitic pathogen prior to or during entry into, colonization of, or replication in their animal host.
The viral pathogens, from which the viral antigens are derived include, but are not


limited to, Orthomyxoviruses, such as influenza virus (Taxonomy ID: 59771); Retroviruses, such as RSV, HTLV-1 (Taxonomy ID: 39015) and HTLV-U (Taxonomy ID: 11909); Herpes viruses, such as EBV (Taxonomy ID: 10295), CMV (Taxonomy ID: 10358) or herpes simplex virus (ATCC #: VR-1487); Lentivirases, such as HIV-1 (Taxonomy ID: 12721) and HIV-2 Taxonomy ID: 11709); Rhabdoviruses, such as rabies; Picomoviruses, such as Poliovirus (Taxonomy ID: 12080); Poxviruses, such as vaccinia Taxonomy ID: 10245); Rotavirus Taxonomy ID: 10912); and Parvoviruses, such as adeno-associated virus 1 (Taxonomy ID: 55106).
Examples of viral antigens include, but are not limited to, the human immunodeficiency virus antigens Nef (National Institute of Allergy and Infectious Disease HIV Repository Cat. # 183; GenBank accession # AF238278), Gag, Env (National Institute of Allergy and Infectious Disease HIV Repository Cat. # 2433; GenBank accession # U39362), Tat (National Institute of Allergy and Infectious Disease HIV Repository Cat. # 827; GenBank accession # M13137), Rev (National Institute of Allergy and Infectious Disease HIV Repository Cat. # 2088; GenBank accession # L14572), Pol (National Institute of Allergy and Infectious Disease HIV Repository Cat. # 238; GenBank accession # AJ237568) and T cell and B cell epitopes of gpl20 (Hanke and McMichael, AIDS Immunol Lett., 66:177 (1999); Hanke, et al., Vaccine, 17:589 (1999); Palker, et al., J. Immunol., 142:3612-3619 (1989)); the hepatitis B surface antigen (GenBank accession # AF043578; Wu, et al., Proc. Natl. Acad. Sci., USA, 86:4726-4730 (1989)); rotavirus antigens, such as VP4 (GenBank accession # AJ293721; Mackow, et al., Proc. Natl. Acad. Sci., USA, 87:518-522 (1990)) and VP7 (GenBank accession # AY003871; Green, et al., J. Virol, 62:1819-1823 (1988)); influenza virus antigens, such as hemagglutinin (GenBank accession # AJ404627; Pertmer and Robinson, Virology, 257:406 (1999)); nucleoprotein (GenBank accession # AJ289872; Lin, et al., Proc. Natl. Acad. Sci., 97: 9654-9658 (2000)); and herpes simplex virus antigens, such as thymidine kinase (GenBank accession # AB047378; Whitley, et al., In: New Generation Vaccines, pages 825-854).
The parasitic pathogens, from which the parasitic antigens are derived, include but are not limited to, Plasmodium spp., such as Plasmodium falciparum (ATCC#: 30145);

irypanosome spp., such as Trypanosoma cruzi (ATCC#: 50797); Giardia spp., such as Giardia intestinalis (ATCC#: 30888D); Boophilus spp.; Babesia spp., such as Babesia microti (ATCC#: 30221); Entamoeba spp., such as Entamoeba histolytica (ATCC#: 30015); Eimeria spp., such as Eimeria maxima (ATCC# 40357); Leishmania spp., (Taxonomy ID: 38568); Schistosome spp., such as Schistosoma mansohi (GenBank accession # AZ301495); Brugia spp., such as Brugia malayi (GenBank accession # BE352806); Fascida spp., such as Fasciola hepatica (GenBank accession # AF286903); Dirofilaria spp., such as Dirofilaria immitis (GenBank accession # AF008300); Wuchereria spp., such as Wuchereria bancrofli (GenBank accession # AF250996); and Onchocerea spp; such as Onchocerca volvulus (GenBank accession # BE588251).
Examples of parasite antigens include, but are not limited to, the pre-erythrocytic stage antigens of Plasmodium spp. (Sadoff, et al, Science, 240:336-337 (1988); Gonzalez, et al., J. Infect. Dis., 169:927 (1994); Sedegah, et al., Proc. Natl. Acad. Sci., 91:9866 (1994); Gramzinski, et al., Vaccine, 15:913 (1997); Hoffman, et al., Vaccine, 15:842 (1997)), such as the circumsporozoite antigen of P. falciparum (GenBank accession # M22982) P vivax (GenBank accession # M20670); the liver stage antigens of Plasmodium spp. (Hollingdale, et al., Ann. Trop. Med. Parasitol., 92:411 (1998), such as the liver stage antigen 1 (as referred to as LSA-1; GenBank accession # AF086802); the merozoite stage antigens of Plasmodium spp. (Holder, et al., Parassitologia, 41:409 (1999); Renia, et al., Infect, hnmun., 65:4419 (1997); Spetzler, et al., Int. J. Pept. Prot. Res., 43:351-358 (1994)), such as the merozoite surface antigen-1 (also referred to as MSA-1 or MSP-1; GenBank accession # AF199410); the surface antigens of Entamoeba histolytica (Mann, et al., Proc. Natl. Acad. Sci., USA, 88:3248-3252 (1991)), such as the galactose specific lectin (GenBank accession # M59850) or the serine rich Entamoeba histolytica protein (also referred to as SREHP; Zhang and Stanley, Vaccine, 18:868 (1999)); the surface proteins of Leishmania spp. (also referred to as gp63; Russell, et al., J. ImmunoL, 140:1274-1278 (1988); Xu and Liew, Immunol., 84: 173-176 (1995)), such as 63 kDa glycoprotein (gp63) of Leishmania major (GenBank accession # Y00647 or the 46 kDa glycoprotein (gp46) of Leishmania major (Handman, et al., Vaccine, 18: 3011-3017 (2000); paramyosin of Brugia malayi (GenBank accession # U77590; Li, et al., Mol. Biochem. Parasitol.,

49:315-323 (1991)); the triose-phosphate isomerase of Schistosoma mansoni (GenBank accession # W06781; Shoemaker, et al., Proc. Natl. Acad. Sci., USA, 89:1842-1846 (1992)); the secreted globin-like protein of Trichostrongylus colubriformis (GenBank accession # M63263; Frenkel, et al., Mol. Biochem. Parasitol., 50:27-36 (1992)); the glutathione-S-transferases of Fasciola hepatica (GenBank accession # M77682; Hillyer, et al., Exp.-Parasitol., 75:176-186 (1992)); Schistosoma bovis (GenBank accession # M77682); S. japonicum (GenBank accession # U58012; Bashir, et al., Trop. Geog. Med., 46:255-258 (1994)); and KLH of Schistosoma bovis and S. japonicum (Bashir, et al., supra).
As mentioned earlier, the CED vaccines of the present invention may encode an endogenous antigen, which may be any cellular protein, immunoregulatory agent, or therapeutic agent, or parts thereof, that may be expressed in the recipient cell including, but not limited to, tumor, transplantation and autoimmune antigens, or fragments and derivatives of tumor, transplantation and autoimmune antigens thereof. Thus, in the present invention, the CED vaccine may encode tumor, transplant, or autoimmune antigens or parts or derivatives thereof. Alternatively, the CED vaccine may encode synthetic genes, which encode tumor-specific, transplant, or autoimmune antigens or parts thereof.
Examples of tumor specific antigens include prostate specific antigen (PSA) (Gattuso, et al., Human PathoL, 26:123-126 (1995)), TAG-72 and CEA (Guadagni, et al., Int. J. Biol. Markers, 9:53-60 (1994)); human tyrosinase (GenBank accession # M27160; Drexler, et al., Cancer Res., 59:4955 (1999); Coulie, et al., J. Imrnunothera, 14:104-109 (1993)); tyrosinase-related protein (also referred to as TRP; GenBank accession # AJ132933; Xiang, et al., Proc. Natl. Acad. Sci., 97:5492 (2000)); and tumor-specific peptide antigens (Dyall, et al., J. Exp. Med., 188:1553 (1998).
Examples of transplant antigens include the CD3 molecule on T cells (Alegre, et al., Digest. Dis. Sci., 40:58-64 (1995)) and histocompatibility antigens such as HLA A, HLA B, HLA C, HLA DR and HLA DQ (Janeway, et al., In: Immunobiology: The immune system in health and disease (Fourth Edition), Current Biology Publications, London W1P 6LB, United Kingdom, Ch. 13, pp509-519 (1999)).

Examples of autoimmune antigens include IAS B chain, which is useful in therapeutic vaccines against autoimmune encephalomyelitis (GenBank accession # D88762; Topham, et al., Proc. Natl. Acad. Sci., 91:8005-8009 (1994)); glatamic acid decarboxylase, which is useful in therapeutic vaccines against insulin-dependent type 1 diabetes (GenBank accession # NM013445; Qin, et al., J. Autoimmun., 11:591 (1998)); thyrotropin receptor (TSHr), which is useful in therapeutic vaccines against Grave's disease (GenBank accession # NM000369; Costagliola, et al., J. Clin. Invest., 105:803 (2000)) and tyrosinase-related protein 1, which is useful in therapeutic vaccines against vitiligo (GenBank accession # NM000550; Overwijk, et al., Proc. Natl. Acad. Sci., 96:2982 (1999)).
TmmunnregnlatnTy mnlftrailfts useful for co-exprpissinn DNA vaminRn- In the present invention, in addition to encoding an exogenous or endogenous antigen, the CED vaccines can also encode a biologically-active component including an immunoregulatory molecule. A diagrammatic depiction of a generic CED vaccine encoding a vaccine antigen and an immunoregulatory molecule on a dicistronic DNA expression cassette is shown in Figure 1. A diagrammatic depiction of a generic CED vaccine encoding a vaccine antigen and an immunoregulatory molecule that are expressed by separate promoters is shown in Figure 2.
The particular immunoregulatory molecule used in the CED vaccine of the present invention may include:
• growth factors, such as TGF-p (GenBank accession # Q99988), monocyte colony stimulating factor (M-CSF, GenBank accession # E02187), granulocyte-monocyte colony stimulating factor (GM-CSF, GenBank accession # Ml 0663);
• cytokines (e.g;, GenBank accession # U31279), such as interleukin-2 (IL-2, GenBank accession # AF031845), interleukin-4 (IL-4, GenBank accession # M13982), interleukin-5 (IL-5, GenBank accession # AF051372), interleukin-6 (ILr6, GenBank accession # NM002184), interleultin-10 (JL-10, GenBank accession # X78437), interleukin-12 (IL-12, GenBank accession # AF180563); interleukin-18 (QV18, GenBank accession # NM 001562); interferon-gamma

inducible protein (GenBank accession # BE501937); and interferon-gamma (EFN-γ. GenBank accession # AW079182);
• chemokines, such as macrophage inhibitory protein-1 alpha (MIP-lα,
GenBank accession # A34528), macrophage inhibitory protein-1 beta (MIP-
lß GenBank accession # AF031587), macrophage inhibitory protein-3 alpha
- (MIP3α, GenBank accession # A17117), monocyte derived chemokine (MDC, GenBank accession # AF076596), RANTES (GenBank accession # AF266753), interleukin-8 (IL-8, GenBank accession # S78555), and stromal cell derived factor-lalpha (SDF-lα, GenBank accession # AF189724);
• co-stimulatory molecules, such as CD80 (GenBank accession # NM005191); CD86 (GenBank accession # NM019388); cytotoxic T-lymphocyte-associated protein-4 (CTLA-4, GenBank accession # AH002733); CD28 (GenBank accession # NM006139); CD40 (GenBank accession # Y10507); and CD40 ligand (GenBank accession # D31793);
• cytokine receptors such as the alpha chain of the interferon-gamma receptor (GenBank accession # AW771757); the beta chain of the interferon-gamma receptor (GenBank accession # AW771346);
• viral immunoregulatory molecules, such as the Tat protein of human immunodeficiency virus-1 (HIV-1, GenBank accession # U39362), HIV-2 (GenBank accession # AF208027), simian immunodeficiency virus (SIV, GenBank accession # U42720), or feline immunodeficiency virus (FIV, GenBank accession # NC 001482; Albott, et al., Proc. Natl. Acad. Sci., 86:5743 (1989)), the Tax protein of human T-cell lymphotropic virus type 1 (HTLV-1, GenBank accession # NC 001436) and HTLV-II (GenBank accession # NC 001488); and
• bacterial toxins that up-regulate cAMP-levels such as the A subunit (referred to herein as CtxA) of cholera toxin (GenBank accession # D30052 and D30053), the A subunit of heat-labile toxin (referred to herein as EltA) of enterotoxigenic Escherichia colt (GenBank accession # M35581); pertussis toxin SI subunit (PtxSl, GenBank accession # AJ007364, AJ007363, AJ006159, AJ006157, etc.), and adenylcyclase toxin of Bordetella pertussis

(ATCC # 8467) or Bordetella bronchiseptica (ATCC # 7773).
Antisense RNA useful for co-exprriession DNA vaccines: In the present invention, in addition to encoding a vaccine antigen, the CED vaccine can also express antisense RNA. A diagrammatic depiction of a generic CED vaccine encoding a vaccine antigen and an antisense RNA on a dicistronic DNA expression cassette is shown in Figure 1
A diagrammatic depiction of a generic CED vaccine encoding a vaccine antigen and an antisense RNA that are expressed by separate promoters is shown in Figure 2.
The particular antisense RNA used in the present invention includes antisense RNAs that target molecules present within the recipient cell, including but not limited to RNA species encoding the cell immunoregulatory molecules, such as described hereinabove.
Catalytic RNA useful for co-expression DNA vaccines; In the present invention, in addition to encoding a vaccine antigen, the CED vaccine can also express catalytic RNA. A diagrammatic depiction of a generic CED vaccine encoding a vaccine antigen and a catalytic RNA on a dicistronic DNA expression cassette is shown in Figure 1. A diagrammatic depiction of a generic CED vaccine encoding a vaccine antigen and a catalytic RNA that are expressed on separate DNA expression cassettes is shown in Figure 2.
The particular catalytic RNA used in the present invention includes catalytic RNAs that target molecules present within the recipient cell. These include but are not limited to RNA species encoding cell immunoregulatory molecules, such as described hereinabove.
A DNA vaccine against HIV comprising CDld epitoppes and an immunnregulatory agent- The present invention provides a DNA co-expression vaccine that expresses the CDld epitopes of HIV-1 and an immunoregulatory molecule either on a dicistronic DNA expression cassette or on separate DNA expression cassettes for the treatment and prevention of Tat-mediated immune deviation.

CDld is a non-polymorphic histocompatibility leukocyte antigen (HLA) of humans that is structurally related to HLA-A, HLA-B and HLA-C (Martin, et al., Proc. Natl. Acad. Sci. USA, 83:9154 (1986); Albertson, D.G., et al., EMBO J., 7:2801 (1988); Calabi, et al.,. Eur. J. Immunol: 19:285-292 (1989)) and or class 1 major histocompatibility (MHC) molecules in mice (Porcelli S., Adv. Immunolg., 59:1-98 (1995); Poreelli', et al., Proc. Natl. Acad. Sci. USA, 84:9189(1987)). Although CDld is capable of presenting lipids and glycolipids, such as a-galactocerimide (Kaeano, et al., Int. Immunol., 11:881 (1997)), microbial glycolipids (Beckman, et al., Nature, 372:691 (1994)), and cellular lipids (Gumperz, et al, Immunity, 12.211 (2000)), it has been demonstrated that CD Id-restricted CD8+ T cells recognize peptides that contain the following conserved motif:


(Table Removed)

W denntex tryptophan Y denoted tyrosine, F denotes phenylalanine X dp.nntp.fi any amino arid, Vdenotes valine, L denotes leurine, [denotes itnleucine and Q denotes vhitnminp. The motif is flanked by up to 8 amino acids on the amino terminal end and up to 15 amino acids on the carboxyl terminal end (Tangri, et al., Proc. Natl. Acad. Sci., 95:14314 (1998); Castano, et al., Science, 269:223 (1995)), wherein the flanking sequences are typically enriched with hydrophobic amino acid residues (Castano, et al., supra (1995).
Induction of CD Id-restricted antigen-specific CD8 T cells has been accomplished using conventional DNA vaccines, however, it requires the expression of CDld by antigen presenting cells (Lee, et al., J. Exp. Med., 187:433 (1998)). Thus, expression of the aforementioned CDld-epitopes in conjunction with CDld (GenBank accession # NP001757) on a CED vaccine of the present invention will coordinate the effective

induction of CD Id-restricted CD8+ T cell responses.
Examples of CDld epitopes include amino acids 52-71, 105-124, and 222-241 of the HIV-l reverse transcriptase (such as SEQ ID NOs: 21 and 22) (The reference HIV-l sequence used to locate the CDld epitopes described herein is HBX2), amino acids 49-68 of the HIV-l protease, amino acids 67-86 of the HIV-l 66 Kda protein, amino acids 1-20 of the HIV-l Vif, amino acids 3-22, 35-54, 662-681, and 786-805 of the HIV-l 160 KDa envelope glycoproteins (gpl60), amino acids 28-47 of the HIV-l Tat protein, and amino acids 111-130 of the HIV-l Nef protein. These epitopes can be expressed singly or as chimeric fusions containing two or more of the epitopes. To facilitate targeting of the CD Id-restricted epitopes to the endosomal compartment where association with CDld occurs (Tangri, et al., supra (1998)), one or more CDld-restricted epitopes can be expressed as a fusion protein containing a GPI anchor sequence using procedures described elsewhere (Schofield, et al., Science, 283:225 (1999)). The nucleotide sequence encoding the above CD1 epitopes are incorporated into the CED vaccines of the present invention. The immunoregulatory molecule used in conjunction with the HIV-l CDld epitopes in the CED vaccine may include any of the immunoregulatory molecules set forth above.
DNA vaccines useful for a rpnrine mode1 of Tat-mediated immune deviation- The particular DNA vaccines employed in the present invention are suitably configured using at least one of three following preferred configurations:
The first preferred configuration utilizes a DNA vaccine that expresses a dicistronic mRNA and generally comprises a plasmid vector, a promoter that is functional in eukaryotic cells, an internal ribosomal entry site additional genetic elements, an experimental antigen (e.g. HIV-l antigens such as the Env, gpl20, gpl20, Pol, Gag, Nef, or Rev proteins), and the HIV-l Tat protein. Diagrammatic depiction of a generic CED vaccine for expressing a dicistronic mRNA is shown in Figure 1.
In a second preferred configuration, the DNA vaccine that expresses at least two products, one is an experimental antigen (e.g. HIV-l antigens such as the Env, gpl20, gpl20, Pol, Gag, Nef, or Rev proteins), and the other is the HIV-l Tat protein; the

expression in this configuration occurs from distinct promoters as shown in Figure 2.
In a third configuration, two DNA vaccines are used as a mixture, one that expresses an experimental antigen (e.g. HIV-l antigens such as the Env, gpl20, gpl20, Pol, Gag, Nef, or Rev proteins) and another that expresses the HIV-l Tat protein.
The particular Tat gene used in the present invention is not critical; examples of suitable sources include HIV-l, HIV-2 or SIV (AIDS Repository, National Institute of Allergy and Infectious Disease, Bethesda MD). Alternatively a synthetic Tat gene (htat) can be constructed that is optimized for expression in mammalian cells using any of the aforementioned HIV-l, HIV-2 or STV Tat amino acid sequences as blueprints and the codon replacement strategy described elsewhere (Haas, et al., Curr. Biol, 6:315-24 (1996); Andre, et al., J. Virol., 72:1497-503 (1998)). The plasmid vectors, promoters, and IRES may be any of those set forth above.
Generic structure of DNA vaccines that co-express an antigen anrl an, adjuvant: The particular novel DNA vaccines, which co-express an antigen and an adjuvant, employed in the present invention can be readily synthesized and formulated, preferably using one of the following two preferred configurations.
The first preferred configuration of a DNA vaccine that co-expresses an antigen and an adjuvant utilizes a dicistronic mRNA and generally comprises a plasmid vector, a promoter that is functional in eukaryotic cells, an internal ribosomal entry site, additional genetic elements, at least one vaccine antigen, and an bacterial toxin that augments cAMP levels (e.g., a member of the family of bacterial adenosine diphosphate-ribosylating exotoxins (i.e. CtxA of Vibrio choleraited, EltA of Escherichia coli); an adenylate cyclase-hemolysin (i.e. CyaA of Bordetella spp)). Diagrammatic depiction of a generic DNA vaccine that co-expresses an antigen and an adjuvant through the use of a dicistronic mRNA is shown in Figure 1.
In the second configuration, the DNA vaccine that co-expresses an antigen and an adjuvant utilizes two promoters and is composed of a plasmid vector, two promoters that are functional in eukaryotic cells, at least one antigen, and an bacterial toxin that

augments cAMP levels (e.g., a member of the family of bacterial ade diphosphate-ribosylating exotoxins (i.e. CtxA of Vibrio cholera or EltA of Escherichia coli); an adenylate cyclase-hemolysin (i.e. CyaA of Bordetella spp)). Diagrammatic depictions of a generic DNA vaccine that co-expresses an antigen and an adjuvant that utilizes two promoters is shown in Figure 2.
The particular adjuvant that constitutively augments cAMP levels may be the A subunit of cholera toxin (i.e. CtxA; GenBank accession no. X00171, AF175708, D30053, D30052,), or parts thereof (e.g., the Al domain of the A subunit of Ctx (i.e. CtxAl; GenBank accession no. K02679)), from any classical Vibrio cholerae (e.g., V, cholerae strain 395, ATCC # 39541) or El Tor V. cholerae (e.g., V. cholerae strain 2125, ATCC # 39050) strain. Alternatively, any bacterial toxin that increases cellular cAMP levels, such as a member of the family of bacterial adenosine diphosphate-ribosylating exotoxins (Krueger and Barbier, Clin. Microbiol. Rev., 8:34 (1995)), may be used in place of CtxA, for example the A subunit of heat-labile toxin (referred to herein as EltA) of enterotoxigenic Escherichia coli (GenBank accession # M35581), pertussis toxin SI subunit (e.g., ptxSl, GenBank accession # AJ007364, AJ007363, AJ006159, AJ006157, etc.). As another example, the adjuvant may be one of the adenylate cyclase-hemolysins of Bordetella pertussis (ATCC # 8467), Bordetella bronchiseptica (ATCC # 7773) or Bordetella parapertussis (ATCC # 15237), e.g., the cyaA genes of B. pertussis (GenBank accession # XI4199), B. parapertussis (GenBank accession # AJ249835) or B. bronchiseptica (GenBank accession # Z37112).
Genetic engineering procedues and reagennts for the preparation of co-expressinn DNA vaccines: The construction of CED vaccines is accomplished using an assortment of well-known recombinant DNA procedures.
Algorithm fnr rtm rrmstnip.tinn of co-mirprfissinn DNA vaccines: As mentioned earlier,
the components of the CED vaccines of the present invention comprise a plasmid backbone carrying a multi-component DNA insert comprising at least one promoter, DNA encoding the first protein product, DNA encoding the second protein product, and an IRES (e.g., In instances when the protein products are expressed from dicistronic mRNA). Due to the requirement of components that are not always

available from a single source, an algorithm for the assembly of the pertinent components in shown in Figure 14 that illustrates isolation of the individual DNA components, construction, purification and formulation of the CED vaccine.
Recombinant DMA methods- The CED vaccines described herein are produced using procedures well known in the art. Examples include polymerase chain reaction (PCR; Sambrook, et al., Molecular cloning; A laboratory Manual: Vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989)); DNA synthesis using an Applied Biosystems DNA synthesizer (Perkin Elmer ABI 3948, using the standard cycle as according to procedures provided by the manufacturer); agarose gel electrophoresis (Ausubel, Brent, Kingston, Moore, Seidman, Smith and Struhl, Current Protocols in Molecular Biology: Vol. 1 and 2, Greene Publishing Associates and Wiley-Interscience, New York (1990)); restriction endonuclease digestion of DNA (Sambrook, et al., supra (1989)); annealing DNA fragments using bacteriophage T4 DNA ligase (New England Biolabs, Cat #202CL; Sambrook, Fritsch, and Maniatis. Molecular cloning; A laboratory Manual: Vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989)); introducing recombinant plasmids into Escherichia coli by electrotransformation (also called electroporation; (Sambrook, et al., supra (1989)); culturing of E. coli isolates that carry recombinant plasmids on solid media (e.g., Tryptic Soy Agar; Beckton Dickenson, Sparks, MD cat #211046) or in liquid media (e.g., Tryptic Soy Broth; Beckton Dickenson, Sparks, MD cat #211771) containing the appropriate antibiotics (e.g., 100 µg/ml ampicillin 20 µg/ml chloramphenicol or 50 µg/ml kanamycin) for the selection of bacteria that carry the recombinant plasmid; isolation of plasmid DNA using commercially available DNA purification kits (Qiagen, Santa Clarita, CA EndoFree Plasmid Maxi Kit, cat # 12362); transfection of murine and human cells using the FuGENER proprietary multi-component transfection system using the procedure recommended by the manufacturer (Roche Diagnostics Corporation, Roche Molecular Biochemicals, Indianapolis, in cat # 1815091; e.g., Schoonbroodt and Piette, Biochemica, 1:25 (1999)); culturing murine or human cells lines in RPMI 1640 medium (Life Technologies, Gaithersburg MD) containing 10% (v/v) fetal calf serum (Gemini Bioproducts, Calabasas, CA. cat #100-107; See also Current Protocols in Immunology); analysis of tissue culture supematants and cell lysates by sodium

dodecylsufate-polyacrylamide gel electrophoresis (SDS-PAGE; Harlow and Lane. Using Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, (1988)) and immunoblotting (Harlow and Lane. Using Antibodies, A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY, (1988)); quantitation of recombinant proteins produced by recombinant plasmids in murine or human cells using quantitative -imrriunoblot, capture enzyme-linked immunosorbent assays (ELISAs; Ausubel, et al., Current Protocols in Molecular Biology: Vol. 1 and 2, Greene Publishing Associates and Wiley-Merscience, New York (1990)); alternatively the capture ELISAs can be conducted by a commercial facility such as the U-Quant Facility at the IHV, UMBI, MD, which used Endogen and R&D Systems quantitative ELISA products. (E.g.,, mIFN ELISA kit cat #EM-1001-1 from Endogen, Woburn, MA. mIL4 ELISA kit cat #M4000, mIL5 ELISA kit cat # M5000, mELlO ELISA kit cat #M1000, from R&D Systems, Minneapolis, MN), or quantitative reverse transcriptase (RT)-PCR (Ausubel, et al., IN: Current Protocols in Molecular Biology: Vol. 1 and 2, Greene Publishing Associates and Wiley-Interscience, New York (1990)), using the Thermoscript RT-PCR System (Life Technologies, Gaithersburg MD; cat #11146-016).
Generation of specific DNA sftqnenr.es: DNA sequences encoding the individual
elements of CED vaccines, such as the promoter, enhancer, genetic element, vaccine antigen, internal ribosome entry site (IRESs), immunoregulatory protein, antisense RNA and catalytic RNA, can be obtained from the American Type Culture Collection (ATCC, Manassas, VA). Bacteria containing the recombinant plasmid that carries the sequence of interest are cultured, the plasmid DNA is purified and the target sequence is isolated by using restriction endonucleases or by PCR amplification as described hereinbelow.
Alternatively, in instances where the desired DNA sequence is not available at the ATCC, individual DNA sequences can be made de novo using the DNA sequence from GenBank or from commercial gene databases, e.g., Human Genome Sciences (Gaithersburg, MD), as the blueprint of the target gene, DNA fragment, or parts thereof. Thus, de novo-generated DNA encoding promoters, enhancers, genetic elements, vaccine antigens, internal ribosome entry sites (IRESs), immunoregulatory

proteins, antisense RNA and catalytic RNA are created by first synthesizing 100 to 200 nucleotide overlapping oligonucleotides that are subsequently aimealed to form double stranded DNA and joined by ligation to form a larger fragment. The joined fragments are then purified and joined by ligation to yet another joined fragment to create larger fragments and so on until the full-length DNA molecule is created. After each round of ligation the joined fragments can be amplified by PCR to increase the yield of the joined fragments. Procedures for de novo DNA synthesis are well known to the art and are described elsewhere (Andre, et al., supra, (1998); Haas, et al., supra, (1996)); alternatively synthetic designer genes can be purchased commercially, e.g., from the Midland Certified Reagent Co. (Midland, TX). Following completion of the de novo gene synthesis the integrity of the coding sequence in the resultant DNA fragment is verified by automated dideoxynucleic acid sequencing at a facility that has the appropriate capabilities and equipment, such as the Biopolymer Core Facility, University of Maryland, Baltimore MD.
Purification nf co-expression DNA vaccines- The specific method used to purify the CED vaccines of the present invention are not critical and may be selected from previously described procedures used to purify conventional DNA vaccines (e.g., endotoxin-free large-scale DNA purification kits from Qiagen, Santa Clarita, CA; "EndoFree Plasmid Maxi Kit", cat # 12362), or two rounds of purification using Cesium chloride density gradients (Ausubel, et al., supra (1990)). Alternatively, purified lots of CED vaccines can be obtained from commercial sources that have the capacity to produce endotoxin-free plasmid DNA preparations using the Good Manufacturing Procedures as outlined by the US Food and Drug Administration (e.g., Ameba lysate agglutination assay, Schwartzman assay in New Zealand White Rabbits).
Formulation of co-expression DNA vaccines: The specific method and reagents
used to formulate the CED vaccines described herein is not critical to the present invention. Examples include formulations that combine the CED vaccine with a physiological buffer (Feigner, et al., US Patent # 5589466 (1996)); aluminum phosphate or aluminum hydroxyphosphate (e.g., Ulmer, et al, Vaccine, 18:18 (2000)), monophosphoryl-lipid A (also referred to as MPL or MPLA; Schneerson, et al., J.


Immunol., 147: 2136-2140 (1991); e.g., Sasaki, et al., Inf. Immunol., 65. 3520-3528 (1997); Lodmell, et al., Vaccine, 18: 1059-1066 (2000)), QS-21 saponin (e.g., Sasaki, et al., J. Virol., 72:4931 (1998)); dexamethasone (e.g., Malone, et al., J. Biol. Chem., 269:29903 (1994)); CpGDNA sequences (Davis, et al., J. Immunol., 15:870 (1998)); lipopolysaccharide (LPS) antagonist (e.g., Shata and Hone, PCT/OOUS/27402), a second plasmid encoding a cytokine (e.g., Hayashi, et al., Vaccine, 18: 3097-3105 (2000); Sin, et al., J. Immunol, 162: 2912-2921 (1999); Gabaglia, et al. J. Immunol., 162: 753-760 (1999); Kim, et al., Eur J Immunol., 28:1089 (1998); Kim, et al., Eur. J. Immunol., 28:1089 (1998); Barouch, et al., J. Immunol., 161:1875 (1998); Okada, et al., J. Immunol., 159:3638 (1997); Kim, et al., J. Virol., 74:3427 (2000)), or a second plasmid encoding a chemokine (e.g., Boyer, et al., Vaccine, 17(Suppl 2):S53 (1999); Xin, et al., Clin. Irnrmmol., 92:90 (1999)).
Vaccination strategies- The CED vaccine can be introduced into the animal by intravenous, intramuscular, intradermal, intraperitoneally, intranasal and oral inoculation routes. The specific method used to introduce the CED vaccines described herein into the target animal is not critical to the present invention and can be selected from conventional DNA vaccination methods for intramuscular, intravenous, intradermal, intraperitoneally, and intranasal routes of inoculation (an extensive database of publications describing the above cited vaccination procedures is located at www.DNAvaccine.com/Biblio/articles.html).
Oral inoculation of the target animal with the CED vaccines of the present invention can be achieved using an non-pathogenic or attenuated bacterial DNA vaccine vector (Powell, et al., US Patent No. 5,877,159 (1999)). The amount of the bacterial DNA vaccine vector of the present invention to be administered will vary depending on the species of the subject, as well as the disease or condition that is being treated. Generally, the dosage employed will be about 103 to 1011 viable organisms, preferably about 105 to 109 viable organisms.
The bacterial DNA vaccine vector carrying the CED vaccine of the present invention is generally administered along with a pharmaceutically acceptable carrier or diluent. The particular pharmaceutically acceptable carrier or diluent employed is not critical

to the present invention. Examples of diluents include a phosphate buffered saline, buffer for buffering against gastric acid in the stomach, such as citrate buffer (pH 7.0) containing sucrose, bicarbonate buffer (pH 7.0) alone (Levine, et al., J. Clin. Invest, 79:888-902 (1987); and Black, et al., J. Infect. Dis., 155:1260-1265 (1987)), or bicarbonate buffer (pH 7.0) containing ascorbic acid, lactose, and optionally aspartame (Levine, et al., Lancet, 11:467-470 (198§)). Examples of carriers include proteins, e.g., as found in skim milk, sugars, e.g., sucrose, or polyvinylpyrrolidone. Typically these carriers would be used at a concentration of about 0.1-90% (w/v) but preferably at a range of 1-10% (w/v).
The following examples are provided for illustrative purposes only, and are in no way intended to limit the scope of the present invention.
F.ramplfs 1 Recombinant TTMA procedures
RpagRnts, bacterial strains and plasmids
Restriction endonucleases (New England Biolabs Beverly, MA), T4 DNA ligase (New England Biolabs Beverly, MA) Taq polymerase (Life technologies, Gaithersburg, MD) were used according to the manufacturers' protocols. Plasmid DNA was prepared using small-scale (Qiagen Miniprep kit) or large-scale (Qiagen Maxiprep kit) plasmids DNA purification kits according to the manufacturer's protocols (Qiagen, Santa Clarita, CA). Nuclease-free, molecular biology grade milli-Q water, Tris-HCl (pH 7.5), EDTA pH 8.0, 1M MgCk, 100% (v/v) ethanol, ultra-pure agarose, and agarose gel electrophoresis buffer were purchased from Life technologies, Gaithersburg, MD. DNA ligation reactions and agarose gel electrophoresis were conducted according to well-known procedures (Sambrook, et al., supra (1989); Ausubel, et al., supra (1990)).
PCR primers were purchased from the University of Maryland Biopolymer Facility (Baltimore, MD) and were synthesized using an Applied Biosystems DNA synthesizer (model 373 A). PCR primers were used at a concentration of 200 uJvl and annealing temperatures for the PCR reactions were determined using Clone manager software.

PCRs were conducted in a Strategene Robocycler, model 400880 (Strategene, La Jolla, CA). Annealing, elongation and denaturation times in the PCRs were set according to well-known procedures.
A synthetic tat gene (htat), optimized for expression in mammalian cells and encoding
the HIV-IMN Tat protein was purchased from Midland Certified Reagent Company
(Midland, TX). The codon usage pattern was optimized for expression of the Tat-
encoding synthetic DNA in mammalian cells, as reported previously (Haas, et al.,
Curr. Biol., 6: 315-24 (1996); Andre, et al., J Virol., 72: 1497-503 (1998)). The
synthetic nucleotide sequence and amino acid sequence of htat are shown in Figure 5.
The DNA encoding the synthetic, codon-optimized HIV-IMN Tat gene was amplified
using forward primer 5'-
GCCAAATACATGGCCATTGAGCCCGTGGACCCTCGCCTGGAGCCCT (SEQ
ID NO: 19) and reverse primer 5'-
ATAAGAATCTCGAGCAGCTGGAATTCGCGGCCGGCTGATCAG (SEQ ID NO: 20).
Nucleotide sequencing to verify die DNA sequence of each recombinant plasmid described in the following examples was accomplished by conventional automated DNA sequencing techniques using an Applied Biosystems automated sequencer, model 373 A.
Escherichia coli strain Stable2 served as host of the recombinant plasmids described in the examples below. Wild type Vibrio cholerae served as a source of DNA sequences encoding the Al domain of the A subunit of cholera toxin and was provided by the Department of Microbiology and Immunology, University of Maryland, Baltimore.
Recombinant plasmids were introduced into E. coli strain Stable2 by electroporation using a Gene Pulser (BioRad Laboratories, Hercules, CA) set at 200Q, 25 up and 2.5 kV as described (Hone, et al., Vaccine, 9: 810-816 (1991)).
All bacteria were grown at 37°C on tryptic soy agar or in tryptic soy broth, unless

stated otherwise. When appropriate, the media were supplemented with 100 ug/ml ampicillin (Sigma, St. Louis, MO).
Bacterial strains were stored at -80°C suspended in tryptic soy broth containing 30% (v/v) glycerol at ca. 10 colony-forming units (cfus) per ml.
Plasmid pCITE4a, which contains the IRES of equine encephalitis virus, was purchased from Novagen (Madison Wl).
Plasmid pcDNA3.1zEO, which contains the colEl replicon, an ampicillin-resistance allele, the CMV immediate-early promoter, a multicloning site and the bovine hemoglobin poly-adenosine sequence, was purchased from Clonetcch (Clonetech, Palo Alto, CA).
Plasmid pEFla-syngpl20MN carrying synthetic DNA encoding HIV-IMN gpl20 (referred to herein as hgpl20), in which the native HIV-1 leader peptide is replaced by the human CD5 leader peptide and the codons are optimized for expression in mammalian cells is described elsewhere (Andre, et al., supra, (1998); Haas et al., supra, (1996)).
Restriction endonuclease digestion, ligation, and plasmid DNA preparation techniques were all conducted as described hereinbelow.
F.Yamplp. 7
Construction of a co-expression DNA vaccine mending a vanoinf: antigfln and an
immiinnregnlatory protfiin
Sonme nf DNA sftgnftnrjw Construction of a conventional DNA vaccme, pOGLl,
was achieved by PCR-amplifying hgpl20 from a plasmid pEFla-syugpl20MN
(Andre, et al., supra, (1998); Haas et al-, supra, (1996)) using forward primer 5'-
GGGGGGGGATCCATGCCCATGGGGTCTCTGCAACCGCTG (SEQ ID NO: 14)
and reverse primer 5'-


GGGGGCGGCCGCTTATTAGGCGCGCTTCTCGCGCTGCACCACIGCG (SEQ ID NO: 15). The resultant PCR-generated DNA fragment was digested with restriction endonucleases BaniHL and NotI and annealed (E.g., by ligation with T4 Ugase) with plasmid pcDNA3.1zEO (Invitrogen, Carlsbad, CA, Cat. No. V860-20), which had been digested with the identical restriction endonucleases. The annealed chimeric plasmid DNA was introduced into E. colt strain Stable2 by electroporation and positive clones were identified by screening small-scale plasmid DNA preparations isolated from individual clones for the appropriate restriction endonuclease digestion patterns. An isolate, referred to herein as strain HI 058, containing the plasmid referred to herein as pOGLl, which is pcDNA3.1zEo containing the BamHL-Notl hgpl20 fragment, was stored at -80°C. Additional analysis by restriction endonuclease digestion, PCR of the hgpl20 DNA, and dideoxynucleotide sequencing of the cloned hgpJ20 DNA in pOGLl was conducted to verify that the hgpl20 DNA was not altered during construction.
Crmstmtrtirm nf a synthetic, rrtdnn nptJTrn7ftH Tat allftlp.- A synthetic Tat gene (htat)
optimized for expression in mammalian cells was designed using the HIV-IMN tat amino acid sequence as a blueprint (GenBank accession no. AR034234) and the codon replacement strategy described elsewhere (Haas, et al., Curr. Biol., 6:315-24 (1996); Andre, et al., J Virol., 72, 1497-503 (1998)). The nucleotide sequence of htat is shown in Figure 3 (SEQ ID NO: 18). A 306 bp synthetic double stranded DNA fragment encoding htat was purchased from Midland Certified Reagent Co. (Midland, TX); the synthetic fragment encodes the complete (e.g., first and second exons) 102 amino acid HIV-IMN tat open reading frame with BaniHl and EcoRl restriction endonuclease sites incorporated into the 5-prime and 3-prime ends, respectively.
A plasmid that expresses HIV-1 Tat protein alone, referred to herein as pOGL2, was constructed by inserting htat into the plasmid pcDNA3.1zEo. Briefly, the synthetic htat DNA was digested with restriction endonucleases BamHl and EcoEl and annealed to BamHl-, i?coRI-digested pcDNA3. IZEO using T4 DNA ligase.
DNA encoding the IRES of equine encephalitis virus, referred to as the cap-independent translational enhancer (CITE), was amplified by PCR from purified

plasmid pCITE4a (Novagen, Madison WI) DNA using forward primer 5'-ATAAGAATGCGGCCGCTAAGTAAGTAACITAAGTTCCGGTTATTTTCCACG ATATTGCCGTCTTTTGGCAA (SEQ ID NO: 16) and reverse primer 5'-GCCAAATACATGGCCATATTATCATCGTGTTTTTCAAAGGAA (SEQ ID NO: 17).
Cn-expression DNA vacnirtfi nonstnictinn strategy: A CED vaccine that expresses the HIV-IMN gpl20 and Tat proteins, referred to herein as pOGLl-wT, was constructed hy three-way ligation of hgpl20, CITE, and htat DNA as shown in Figure 4. First, DNA encoding CITE was amplified by PCR from plasmid pCITE4a and digested with Notl and Mscl and the CTTE-encoding fragment was separated from the remainder of the vector using agarose gel electrophoresis (life Technologies, Gaithersburg, MD) and purified using Qiagen gel extraction kit (Qiagen, Valencia, CA). The htat gene was isolated from Mscl- and Xhol-digested pOGL2 DNA using the same purification strategy. Plasmid pOGLl was digested with Notl and Xhol. The purified CITE and htat DNA fragments were then mixed with Nod-digested pOGLl DNA at a molar ratio of 1:1:1 and the resulting mixture was annealed by ligation and introduced into strain Stable2 by electroporation. Single colony isolates were screened for the presence of recombinant plasmids with the appropriate molecular structure by isolating plasmid DNA and analyzing it by restriction endonuclease digestion and PCR; an isolate containing the appropriate recombinant plasmid, referred to herein as "pOGLl-wT", was identified and the strain harboring pOGLl-wT, referred to herein as "T128" was stored at -80°C. Dideoxynucleotide sequencing of the gpl20-CTTE-Tat-encoding DNA in pOGLl-wT was conducted to verify that it was not altered during construction.
Example 3
Tnduption "f systemic tnlftranr.p. with a rrt-ftYpresainn DNA vaccine encoding a vaccine antigen and an iTmrmnoregnlatnrypTntein
VaraiTiatinTi r>f mice and inHnr.Hon nf immune Hftviatimv To investigate the properties of the Tat containing DNA vaccines including, pOGLl, pOGLl-wT and pOGL2, a comparative study was conducted in which the immunogenicity of gpl20 expressed

by plasmids pOGLl and pOGLl-wT was assessed in BALB/c mice. To assure that differences in immunogenicity were not due to gpl20 expression differences, the level of gpl20 expression by pOGLl, pOGL2 and pOGLl-wT was assessed in transiently transfected BALB/c P815 cells and C57BL/6; the expression levels were found to be indistinguishable (300 - 500 ng per 106 cells).
Source nf laboratory animals and handling: BALB/c and C57B1/6 mice aged 6-8 weeks were certified to be specific pathogen free and upon arrival at the University of Maryland Biotechnology Institute Animal Facility were maintained in a microisolator environment and allowed to fee and drink ad lib.
An immunogenicity study was conducted using 4 groups of 6 BALB/c mice that were vaccinated intramuscularly with three 100 ug-doses of endotoxin-free plasmid DNA suspended in saline (0.85% (w/v) NaCl) at weekly intervals. A fourth 100 (j.g was injected intramuscularly 28 days after the third dose. Li parallel, a negative control group of 6 BALB/c mice received four 100 ug-doses of plasmid pcDNA3.1zEo DNA using the same protocol.
TABLE 1


(Table Removed)


Semm Rnrymn-linked immimnsnrhp.nt assays (FLISAs)' Blood (ca. 100 µl per
mouse) was collected before and at weekly intervals after vaccination. The presence of gpl20-speciflc IgG in the sera of the vaccinated mice was determined by ELISA. Aliquots (0.3 µg suspended in 100 µl PBS, pH 7.3) of purified glycosylated HIV-IMN gpl20 (Virostat, Portland) were added to individual wells of 96-well Immulon plates (Dynex technologies Inc, Virginia, USA). After incubating 16-20 hr at 4°C, the plates were washed three times with washing buffer (Kirkegaard and Perry Laboratories,


Gaithersburg, Maryland) and 200 µl of blocking buffer (Kirkegaard and Perry Laboratories, Gaithersburg, Maryland, USA) was added and the plates were incubated for 1 hr at 24°C. After the blocking was complete, duplicated sets of each serum sample were diluted serially in 3-fold increments (Starting at 1:10) in blocking buffer and incubated for 1 hr at room temperature. Then, the plates were washed six times with washing buffer and 100 µl of horseradish peroxidase-labelled goat anti-mouse IgG (Sigma Immunochemicals, USA), diluted in 1/2000 in blocking buffer, was added to each well and the plates were incubated for 1 hr at 24°C. The plates were washed an additional six times with washing buffer and 100 µl of ABTS substrate (Kirkegaard and Perry Laboratories, Gaithersburg, Maryland, USA) was added and the plates were incubated for 30 min at 24°C. The absorbance was measured at 405 nm using a Wallac dynamic reader model 1420. A similar procedure was conducted to measure gpl20-specific IgG subtypes, IgGl, IgG2a and IgG2b, except that rat anti-mouse IgGl, IgG2a, and IgG2b antibodies conjugated to horseradish peroxidase (diluted 1:8000, 1:2000, 1:1000 and 1:1000, respectively; BioSource International, Keystone, USA) were used in place of the goat anti-mouse IgG..
Kngymft-Hnlrerl imTrmnfi spot (F.T.TSPOT) assay for TntFirfftrnn-γ-serTetTng r.fills- Four weeks after the final vaccination spleens were aseptically removed from the vaccinated mice and single cell suspensions were prepared by teasing whole spleens between two sterile glass microscope slides. The erythrocytes were lysed in Tris-buffered ammonium chloride pH 7.4 (Biofluids); the unlysed cells were harvested by centrifugation at 250 x g for 10 min and washed two times in RPMI-1640 medium containing 2% (v/v) fetal bovine serum (FBS; Hyclone). Interferon-y (rFN-γ-secreting cells (ISCs) specific for gpl20 were enumerated using an ELISPOT assay. Briefly, 96-well filtration plates (Millipore, Bedford, MA) were coated overnight with 100 u.1 of rat anti-mouse IFN-y antibody (clone R4-6A2, Pharminogen, San Diego, CA) and 5 jig/ml of PBS. After 24 hours, the plates were washed three times with washing buffer (PBS containing 0.5 % (v/v) Tween-20; Sigma). The plates were blocked with 200 til of complete RPMI-1640 containing 10% (v/v) fetal bovine serum (FBS) at 37°C. After one hour, the plates were washed three times with washing buffer. Three-fold dilutions of immune spleen cells in complete RPMI-1640 containing 10%

(v/v) FBS were added to the wells along with 20 units of recombinant mouse interleukin-2 (TL-2; R&D) and 105 10-ME fibroblasts per well, with or without the peptide P18MN (i.e., NH2-RIfflGPGRAFrTTKN-COOH) (GenBank accession # NM 001101). After culturing the cells for 24-36 hrs at 37°C in a humidified 5% C02 atmosphere, the plates were washed 3 times with H2O and three times with washing buffer, and the^ incubated for two hounrat 25°C with 100 ul of PBS containing 0.5% (v/v) Tween-20, 1% (w/v) BSA (Sigma) and biotinylated anti-mouse EFN-y antibody clone XMG1.2 (2 jag/ml; Pharminogen, San Diego, CA). Subsequently, the plates were washed 3 times with washing buffer and then 100 p.1 of ExtraAvidin-alkaline phosphatase (Sigma, St. Louis MO) diluted 2000-fold in washing buffer was added to each well. After an additional incubation period of 30 min at 25°C, the plates were washed a further 3 times with washing buffer and developed using freshly prepared BCIP/NBT substrate (Sigma).
CD8 and CD4 cells were depleted by negative selection from splenocytes that had been stimulated for 6 days in vitro with the V3 peptide using Dynabeads according to the manufacturer's protocols (Dynal). Briefly, 100 ul of mouse anti-CD8 Dynabeads or mouse anti-CD4 Dynabeads were washed three times in HBSS and then resuspended in 100 (J of complete RPMI medium. The Dynabeads were then added to tubes containing 10 splenocytes suspending 2 ml complete RPMI medium and incubated for 20 minutes at 4°C, with continuous gentle agitation. The spleen cell suspensions were placed into a Dynal magnet for 3 minutes and the non-attached cells were aspirated (CD8-depleted or CD4-depleted cells) and used in the above ELISPOT assay or Cr-release assay.
Inhibition of MHC Class-1 presentation was accomplished by adding an H-2kd-specific mAb during the final stimulation step in the ELISPOT assay described above. The purified anti-mouse class I mAb (anti-H-2k clone SF1-1.1; Pharmingen) was dialysed in PBS overnight to remove the azide. This antibody or dialyzed isotype control antibody (mouse IgG2a; Pharmingen), were added to the splenocytes at a final concentration of 5 (ig/ml, along with V3 peptide (5 (j.g/ml).

Quantitation of cytokines in culture, snpernatants- Cytokines were quantitated using commercially available capture ELISA kits (e.g., The IFN-y ELISA kit, Cat. No. EM-1001-1 from Endogen, Woburn, MA; the interleukin-4 (herein called "IL-4") ELISA kit from R&D Systems, Minneapolis, MN, Cat. No. M4000; the interleukin-5 (herein called "EL-5") ELISA kit cat # M5000; the interleukin-10 (herein called "IL-10") EUSA kit Cat. No. M1000, from R&D Systems, Minneapolis, MN) or the U-Quant Facility (Institute of Human Virology, University of Maryland Biotechnology Institute, Baltimore, MD), that uses the aforementioned capture ELISA kits to measure IFN-y, BL-4, IL-5, and IL-10 levels.
The results of the serum IgG response to HIV-1 gpl20 measured'in sera are shown in Figure 5 and Table 2. The mice vaccinated with pOGLl developed a strong serum IgG response against gpl20, whereas the mice vaccinated with pOGLl-wT did not develop a strong anti-gpl20 IgG response. The mice vaccinated with pOGLl developed a strong serum IgG response against gpl20, whereas the peak anti-gpl20 IgG response that ensued following vaccination with pOGLl-wT was about 30-fold less than the response in pOGLl-vaccinated mice (Table 2). The kinetics of the gpl20-specific serum IgG response in mice vaccinated with pOGLl-wT also differed from the analogous response in mice vaccinated with pOGLl. Thus, detectable gpl20-specific IgG arose after a single dose of pOGLl, whereas this response was only marginally evident in mice vaccinated with 2 doses of pOGLl-wT (i.e., a titer of 1:30, 34 days after vaccination, compared to a titer of 1:1000 at the same time point in mice vaccinated with pOGLl; Figure 7).
TABLE 2


(Table Removed)

To assess the magnitude of the CD8 T cell response in the vaccinated mice, splenocytes were harvested 28 days after the fourth vaccination from half (3 mice) of the mice vaccinated with pOGLl, pOGLl-wT or pOGL2 as described above. Subsequently, unfractionated, CD4 T cell- and CD8 T cell-depleted splenocytes were used to enumerate gpl20-specific, interferon-y (rFN-v)-secreting CD8 T cells by ELISPOT, as described above. The results of the ELISPOT assay as shown in Figure 6 indicate that mice vaccinated with plasmid pOGLl develop a strong gpl20-specific IFN-γ-secreting CD8 T cell resppnse, whereas the mice vaccinated with pOGLl-wT did not elicit a measurable gpl20-specific IFN-7-secreting CD8+ T cell response. Taken together, the serum IgG and CD8 T cell data show that co-expression of immunoregulatory protein Tat with vaccine antigen gpl20 by CED vaccine pOGLl-wT results in a complete block in the gpl20-specific serum IgG and splenic CD8+ T cell responses that develop when mice are vaccinated with pOGLl, which expresses gpl20 alone.
In a parallel experiment, mice were vaccinated with four (4) 100 \ig doses of pOGL2 or pOGLl-wT using the above intervals between doses. The mice were then boosted with mice 10 ug of purified glycosylated gpl20 formulated in 100 |J of Freud’s complete adjuvant FCA 92 days after the first vaccination. ELISAs were used to monitor these mice for the development of gpl20-specific serum IgG in sera collected at weekly intervals, as above. The results of the ELISAs showed that both groups (e.g., pOGL2 and pOGLl-wT-prirned) developed a high-level gpl20-specific serum IgG response. However, the response in the pOGL2 primed mice was predominated by a strong gpl20-specific IgGl and IgG2a subtype responses, whereas in the pOGLl-wT-primed mice the serum IgG response gpl20-specific produced gpl20 specific IgGl and a small IgG2a response as shown in Table 3.
TABLE 3

(Table Removed)

This observation provides evidence that the lack of gpl20-specific serum IgG and CD8+ T cell responses during the initial vaccination schedule with the- CED vaccine pOGLl-wT was the result of systemic tolerance and mediated through immune deviation. An analogous form of systernic tolerance through immune deviation is observed in mice vaccinated in the anterior chamber of the eye (Koevary and Beandry. Ocul. Immunol. Inflamm., 8: 39-47 (2000). Immune deviation is a powerful tool for inducing or restoring tolerance and is useful in the prevention and treatment of inflammatory diseases, such as host-versus-graft tissue rejection and autoimmune diseases.
To determine whether co-expression of Tat and gpl20 on a CED vaccine were necessary to yield the full immunoregulatory effect of Tat, a second experiment was conducted in which groups of 6 BALB/c mice were vaccinated intramuscularly with 40 p.g of either pOGL2, pOGLl, pOGLl-wT or a mixture of 40 pig each of pOGLl and pOGL2 (the latter expresses Tat alone). The mice were given booster vaccinations comprised of the same dose of vaccine 14 and 42 days after the primary vaccination. In a similar vein to the first experiment, mice vaccinated with pOGLl developed a strong gpl20-specific serum IgG response, whereas the mice vaccinated with pOGLl-wT developed only low-level gpl20-specific serum IgG. In contrast, the mice vaccinated with the mixture of pOGLl and pOGL2 developed a gpl20-speciflc serum IgG response that was similar in magnitude to the response induced by pOGLl as shown in Figure 6. Importantly, this result shows that the immunoregulatory properties of Tat are better harnessed in the context of the CED vaccine than in the context of the DNA vaccine mixture.
m summary, the experiments described in this example show that a CED vaccine (E.g., pOGLl-wT) that expresses an antigen (E.g., E0V-1 gpl20) and an immunoregulatory protein (E.g., HIV-1 Tat) induces systemic tolerance against the

antigen through immune deviation. Thus, CED vaccines comprised of an antigen and Tat, such as pOGLl-wT, are useful for inducing or restoring systemic tolerance through immune deviation; hence CED vaccines containing Tat are useful for the prevention and treatment of inflammatory diseases (E.g., Host-versus-graft tissue rejection and autoimmune diseases).
In addition, we have shown that CED vaccine pOGLl-wT exploits the immunoregulatory properties of Tat more effectively than a mixture of two conventional DNA vaccines (E.g., pOGLl + pOGL2). Thus, CED vaccines are an enhanced modality for utilizing immunoregulatory agents (E.g., Growth factors, hormones, cytokines and chemokines).
Example 4
Rftf.aH immunity reveals additional p.vidfinrift nf Tat-mftdiatftH immune rteviarirm
CnnRtmnlinn nf a mutant HftrivarivR nf Tat- A mutant derivative of Pat (hereinafter referred to as Ahtat) was constructed to assess the role of the LTR-activating property of Tat in the modulation of the host response. Ahtat, which lacks a 66 bp region encoding amino acids 30 to 51 , was derived from the wild type htat gene (i.e. pOGL2) by two rounds of PCR. During the first round of PCR two fragments were generated: one fragment (135 bp) encoding the 5-prime end of Ahtat, which was amplified using the htat forward primer shown in Example 1, with reverse primer 5'-GCCAAATACATGGCCATTGAGCCCGTGGACCCTCGCCTGGAGCCCT (SEQ ID NO: 19); and a second fragment (208 bp) encoding the 3-primc end of Ahtat, which was amplified using the htat reverse primer shown in example 1 with forward primer 5'- ATAAGAATCTCGAGCAGCTGGAATTCGCGGCCGGCTGATCAG (SEQ ID NO: 20). The two PCR-generated fragments encoding the 5' and 3' ends of bJitat were fractionated by agarose gel electrophoresis and purified using the Qiagen gel fragment purification Kit (Qiagen, CA; Cat No. 28704). A second PCR reaction was then executed comprised of the purified fragments encoding the 5' and 3' ends of Ahtat as template and the original htat primers. The latter PCR generated the complete AAtof-encoding sequence (276 bp) flanked by Mscl and Xhol recognition

sites. The PCR-generated fragment was fractionated by agarose gel electrophoresis and purified using the Qiagen gel fragment purification Kit (Qiagen, CA; Cat No. 28704) and digested with Mscl and Xhol. Simultaneously, pOGLl-wT was digested with BstEU and Xhol, resulting in two fragments, a 5051 bp fragment encoding PCDNA3.1ZEO and a 2271 fragment encoding the hgpl20::ClTE::htat dicistronic gene cassette. The hgpl20::ClTE::htat fragment was fractionated by agarose gel electrophoresis, purified using the Qiagen gel fragment purification Kit (Qiagen, CA; Cat No. 28704) and digested with Mscl. The resultant 1939 bp fragment encoding Agpl20::CITE was fractionated by agarose gel electrophoresis, purified using the Qiagen gel fragment purification Kit (Qiagen, CA; Cat No. 28704). A three way ligation reaction was then conducted using the purified BstEU-XhoJ pcDNA3.1zEo, BstEU-Mscl hgpl20mn::CITE, and Mscl-Xhol Ahtat fragments as substrates for the ligation reaction. The annealed DNA was introduced into E. coli strain Stable2 by electroporation and individual clones were screened by analyzing small-scale plasmid DNA preparations isolated from individual clones for the appropriate BstEU, Xhol, Mscl digestion patterns. An isolate (referred to herein as strain "T145") was identified that contained the anticipated plasmid (referred to herein as "pOGLl -AT") and was stored at -80°C. Additional analysis by restriction endonuclease digestion, PCR of pOGLl-AT DNA, and dideoxynucleotide sequencing of Ahtat in pOGLl-AT was conducted to verify that the PCR-generated fragment was not altered during construction.
Cell line culture and transfenrion procedures: Murine P815 (H-2d; ATCC No. TIB-64) cells were obtained from the American Type Culture Collection (Manassas VA). HeLa-(LTR-tac2) cells were obtained from the National Institutes of Health AIDS Research and Reference Program (NIAID, Bethesda MD). The murine and human cell lines were maintained in complete medium (CM), which was composed of RPMI 1640 medium (Life Technologies, Gaithersburg MD) supplemented with 10 mM HEPES pH 7.3 (Life Technologies, Gaithersburg MD), 10% (v/v) fetal calf serum (Gemini Bioproducts, Calabasas, CA), 4 mM glutamine (Life Technologies, Gaithersburg MD, 1 mM sodium pyruvate (Life Technologies, Gaithersburg MD), 100 µg/ml each of penicillin and streptomycin (Life Technologies, Gaithersburg MD).

Plasmids pOGLl, pOGL2, pOGLl-wT and pOGLl-AT were introduced into P815 cells using the FuGENE® multi-component transfection system (Roche Molecular Biochemicals, Indianapolis, IN cat # 1-815-091). Stable cell lines were selected 7 days after the transfection by adding zeomycin (200 µl/ml) to the culture media. Expression of p-galactosidase by HeLa-(LTR-lacZ) cells was determined using a fluorochrornogenic |3-galactosidase assay system (Promega, Madison City, WI; Cat. No. E2000); fiuorochrome levels were measured using a Wallac Victor-2D fluorometer (Turku, Finland), p-galactosidase activities were expressed in terms of relative light units (RLUs) per mg of protein per hour.
Vaccination of mice: Female specific-pathogen free BALB/c mice aged 6-8 weeks were obtained from Charles River (Bar Harbor, Maine). The mice were maintained in a rnicroisolator environment and allowed to feed and drink ad lib. To evaluate the immunogenicity of the DNA vaccines developed for this study, groups of mice were vaccinated intramuscularly with 40 p.g of endotoxin-free ( Measurement nf serum TgG spftr.ifir, to Tat- Venous blood (ca. 100 µl per mouse) was collected before and at regular intervals after vaccination, and allowed to coagulate; after centrifugation the sera were collected and stored at -20°C. A standard enzyme-linked immunosorbent assays (ELISA) was used to measure the level of Tat-specific IgG in triplicate sets of sera serially diluted in 3-fold increments (Starting at 1:30). Prior to adding the sera, individual wells of 96-well Immulon plates (Dynex Technologies Inc, Virginia, USA) were coated with purified rTat protein (Advanced BioScience Laboratories, Kensington, MD). Alkaline phosphatase-labelled goat anti-mouse IgG (Sigma, St. Louis MO) was used as secondary antibody and absorbance values were measured at 450 nm. End-point titers were calculated by interpolation, using the mean background absorbance plus three standard deviations as the cut-off.
Measurement of cell-mediated immune responses- Gp 120-Specific T Cell proliferation
was measured using splenocytes that were harvested 10 days after the final

vaccination and placed in CM containing p-mecaptoethanol (5 µM). T cell proliferation was measured by tritiated thymidine (3H-TdR) incorporation, as described in Wu, et al., AIDS Res. Hum. Retrovir. 13, 1187-1194 (1997); the stimulants used in each proliferation assay included fully-glycosylatcd purified HIV-IMN gpl20 (10 ug/ml; Virostat Inc., Portland OR), a mitogen control (anti-mouse CD3 (Pharmingen, San Diego, CA)), and endotoxin-free ovalbumin (10 fig/ml; Sigma, St. Louis MO) as a negative control.
Single cell suspensions of splenocytes (Wu, et al., AIDS Res. Retrovir., 13:1187-1194 (1997)) were prepared 10 days after the final vaccination. The splenocytes were cultured for 6 days in CM containing 5 ug/ml of the immunodominant peptide of HIV-1 Env (Takahashi, et al., Proc. Natl. Acad. Sci., 85, 3105-3109 (1988)), designated P18MN (RIfflGPGRAFYTTKN). 10 R7 recombinant mouse interleukin-2 (R&D Systems, Minneapolis, MN) was added to these cultures after the initial three days of in vitro culture. Following in vitro stimulation, Env-specific IFN-γ-secreting T cells were enumerated using an IFN-γ-ELISPOT assay, as originally described by Versteegen, et al., J. Immunol. Meth., Ill, 25-29 (1988) and subsequently modified (Miyahira, et al., J. Immunol. Meth., 181, 45-54 (1995)). Three-fold dilutions of the splenic cell populations-(from 105 to 103 cells) were mixed with 105 P815 cells in complete medium containing 10 IU recombinant mouse interleukin-2 (R&D Systems, Minneapolis, MN), either with or without 5 ug/ml of peptide P18MN-
CD4+ or CD8+ cells were depleted by negative selection from splenic cells using CD4+- or CD8+-specific DynabeadsR, respectively, according to the manufacturer's protocols (Dynal, Lake Success, NY). The unfractionated, and CD4- and CD8-depleted cells were used immediately in the IFN-γ-ELISPOT assays.
Var.r.inia-F.nv challenge- The level of antiviral protection induced by each DNA vaccine modality was determined using a vaccinia-env challenge model, as described in Belyakov, et al., Proc. Natl. Acad. Sci., 95:1709-1714 (1998). Briefly, inocula of vP1174 were prepared by culturing the recombinant vaccinia on BSC-1 cells until 90% of the cells were lysed. The lysed cells were removed from the culture

supernatants by centrifugation at 4,000 x g for 10 min and aliquots of the supernatants were stored in liquid nitrogen until used. The culture supernatants typically yielded about 5 x 109 vP 1174 pfu/ml, as determined by a direct plaque assay on BSC-1 cells. Mice were inoculated with 3 x 107 pfu of vP 1174 via intraperitoneal injection six to nine days after vaccination. Six days after the challenge the ovaries of the mice were harvested and homogenized with a mechanical tissue grinder. The homogenates-were clarified by centrifugation at 4000 x g for 10 min and the vP1174 pfu in the resultant supernatants were enumerated by infecting BSC-l-cell monolayers with 10-fold serial dilutions of these fluids and counting plaques after two days in culture at 37°C in a 5% C02 environment.
Expression of gp 120 and Tat- Experiments were conducted to verify that the DNA
vaccines used in this study expressed comparable levels of gpl20 and/or biologically
active Tat. To determine whether expression of Tat influenced the level of gpl20
expression, a semi-quantitative gpl20 capture assay (Abacioglu, et al., ADDS Res.
Hum. Retrovir. 10: 371-381 (1994)) was employed to measure the level of gpl20
expressed by P815 cells transiently transfected with pOGLl-wT, pOGLl-T, or
parent plasmid pOGLl (Table 4). The results demonstrate that gpl20 is expressed at
comparable levels by pOGLl, pOGLl-wT and pOGLl-AT, which adds further
support to the notion that co-expression of Tat did not prevent gpl20 expression in
vivo.
The activity of the Tat protein expressed by plasmids pOGL2, pOGLl-wT and pOGLl-AT was assessed using HeLa-LTR-/acZ cells transiently transfected with these plasmids, as outlined in the methods. These assays demonstrated that plasmids pOGL2 and pOGLl-wT activated significant levels of LTR-lacZ expression, whereas plasmid pOGLl-AT, which harbors the deletion-modified tat gene, Ahtat, did not activate measurable levels of LTR-lacZ expression as shown below in Table 4.
TABLE 4

(Table Removed)



Tnfhiftnr.pt of Tat on thn indiir.ftnn nf gp170-spftr,ifin rall-mfidiatRrl responses: To assess the CD4 T cell responses following vaccination with pOGLl, pOGLl-wT, or pOGLl-AT, BALB/c mice were vaccinated using the above protocol and the level of gpl20-specific T cell proliferation was measured 3H-TdR incorporation in splenocytes 10 days after the third vaccination. In contrast to the humoral responses, the proliferation assays revealed little difference in the magnitudes of the gpl20-specific proliferation following three doses of the gpl20-expressing DNA vaccines. The results suggest that Tat does not significantly alter the level of MHC class H-restricted presentation to, and CD4+ T cell recognition of, gpl20 in mice.
Tat DNA var.r-.inr.s induce low numbers of TFN-γ-F.T JSPOT: In parallel, the Tat-specific IFN-γ-ELISPOT responses were evaluated in mice vaccinated intramuscularly three times with 40 jjg of pOGL2 or pOGLl-wT, using the same spacing between the doses as before. Negative control mice were vaccinated with pOGLl. Enumeration of IFN-γ-ELISPOTs to full-length Tat or a peptide spanning Tat amino acids 31-50 revealed relatively low numbers of spot-forming cells (i.e. ca. 150-200 Tat-specific IFN-γ-ELISPOTs per 10* splenocytes) in mice vaccinated with either pOGL2 or pOGLl-wT (data not shown).
Tat diminignpg antiviral immunity to gp120: Antiviral immunity in the vaccinated mice was assessed 28 days after the third vaccination using the vaccinia-env challenge model described by Belyakov, et al., supra. The vaccinated mice were challenged

with 3x10 pfu of vaccinia-en v vector strain vT26, which expresses Bnv of HIV-IMN, as described in Belyakov, supra. Six days after the challenge the ov;iries of the mice were harvested and the number of infectious challenge vT26 viral particles present in these tissue samples was enumerated according to Belyakov, supra. The results of the challenge assay (Figure 7) showed that only vaccination with pOGLl afforded strong antiviral immunity against vaccinia-e/iv, whereas the mice-vaccinated with pOGLl-wT, pOGLl-AT or a mixture of pOGLl and pOGL2 did not develop significant antiviral immunity against the challenge virus.
A Tat siihimit vacr.iTiPi mnfftrs protection against the immune modulating activity nf Tat- To assess whether vaccination with a Tat subunit vaccine afforded protection against the immune-modulating properties of Tat, a group of 3 BALB/c mice was vaccinated with three 100 ug doses of purified recombinant Tat (rTat; Advanced BioScience Laboratories, Kensington, MD) on days 0, 14 and 28 mixed with 100 ug of LPS from Escherichia coli strain MLK986, which produces a non-pyrogenic lipid A (Hone, et al., J. Hum Virol., 1:251-256 (1998)) and posses similar adjuvant activity to that of monophosphoryl-lipid A (MPLA). To assess the immunogenicity of a candidate Tat DNA vaccine, a second group of BALB/c mice was vaccinated with three 100 pg doses of pOGL2 using that same spacing between doses as used with the rTat vaccine. Control groups of mice remained unvaccinated or were vaccinated with 3 100 ug-doses of PCDNA3.1NEO intramuscularly, as above.
Analysis of the serum IgG responses to Tat in the mice vaccinated with rTat revealed a significant IgG response to Tat (Reciprocal end-point titer of ca. 50,000), whereas the serum IgG antibodies to Tat were not significantly elevated in the mice vaccinated with pOGL2 (Reciprocal end-point titer To assess the protective properties of the two Tat vaccine modalities, the unvaccinated control mice and the mice pre-vaccinated with rTat or pOGL2 were given a second series of vaccinations comprised of three 100-|ig doses of pOGLl-wT 2, 4 and 8 weeks after the final vaccination with rTat and pOGL2. The additional control mice that were pre-vaccinated with PCDNA3.1NEO were given a second series of

vaccinations comprised of three 100-µg doses of pOGLl, 2, 4 and 8 weeks after the final vaccination with PCDNA3.1NEO- Nine days after the second series of vaccinations were completed, each group of mice was challenged wilh 3 x 107 pfu of vaccinia-e/jv vector strain vT26. The levels of antiviral immunity in each group of mice were determined by harvesting the ovaries of the mice six days after the challenge and enumerating the numbers of infectious vT26 viral particles present in these tissue samples (see methods above). This challenge assay showed that prior vaccination with oxidized-rTat afforded strong protection against the immune modulating activity of Tat, whereas the mice vaccinated with pOGL2 did not develop significant levels of protection against the immune modulating activity of Tat (data not shown).
Importantly, an appropriately formulated Tat vaccine was capable of blocking Tat-mediated immune modulation. This is the first report showing that immunization against Tat is capable of completely blocking Tat-mediated immune modulation in an animal model.
F.Y ample 5 The T.TT?-activating activity nf Tat is not required for the induction of immune
deviation
To investigate the immune modulating properties of the ATat on plasmid pOGLl-AT, a similar mouse immunogenicity assay to the one described in Example 4 was conducted using of 5 groups of 6 BALB/c mice vaccinated intramuscularly with two 40 µg-doses of endotoxin-free plasmid DNA at a 14 day interval, as shown in the Table 5. A third 40 µg-dose was injected intramuscularly 28 days after the second dose.
TABLE 5

(Table Removed)

The serum IgG responses to HIV-l gpl20 were measured using pooled sera collected at weekly intervals from the above groups of mice. Mice in group 2 (e.g. vaccinated with pOGLl alone), group 4 (e.g. vaccinated with pOGLl-AT) and group 5 (e.g. vaccinated with a mixture of pOGLl and pOGL2) developed a serum IgG responses against gpl20, whereas the mice in group 3 (vaccinated with the dicistronic DNA vaccine pOGLl-wT) only developed a meager gpl20-specific serum IgG response and the negative control mice in group 1 (e.g. vaccinated with pOGL2 alone) did not develop an anti-gpl20 IgG response, as shown in Figure 5.
Using an IFN-7-specific EIISPOT assay, Env-specific CD8 T cell responses were enumerated in unfractionated, CD4 T cell- and CD8+ T cell-depleted splenocytes harvested from half of the vaccinated mice 28 days after the final vaccination. The results of the EIISPOT assay (Table 6) show that pOGLl (Group 2), pOGLl- AT (Group 4) and the mixture of pOGLl and pOGL2 (Group 5) elicited gpl20-specific IFN-γ-secreting CD8+ T cell responses. In contrast, pOGL2 (Group 1) and pOGLl-wT (group 3) did not elicit measurable gpl20-specific IFN-γ-secreting CD8 T cell responses. (See Figure 13)
TABLE 6

(Table Removed)










As before, the remaining three mice in each group were challenge with 10 pfu of vaccinia-Env vector strain vT26 (AIDS Repository, National Institute of Allergy and Infectious Disease, Bethesda MD), which expresses Env of HIV-IMN, as described (Belyakov, et al., supra (1998)). Five days after the challenge the ovaries of the mice were harvested and the number of infectious challenge virus particles present in these tissues samples was enumerated (Belyakov, et al., supra (1998)). The results of the challenge assay showed that only vaccination with pOGLl afforded strong anti-viral immunity against vaccinia-Env; the mice other groups, including the mice vaccinated with pOGLl-AT, did not develop significant antiviral immunity.
The serum IgG and CD8+ T cell ELISPOT data showed that pOGLl-AT does not suppress the Env-specific response to the same extent as pOGLl-wT However, the viral challenge data show that mutant Tat, ATat, is still capable of mediating immune deviation, since mice vaccinated with pOGLl-AT did not develop measurable anti-viral immunity. Thus, the LTR:activating activity of Tat is not required for the induction of immune deviation.
fYmgtrnp.rirm of a nn-ftYprftssirm TYNA varrine enr/vting a varaine antigen and an
itnnminostirmilatnry protein
DNA vaccine constructon strategy: A novel DNA vaccine that co-expresses an antigen (e.g., gpl20) and an adjuvant (e.g., CtxAl), referred to herein as "pOGLl-Al", was constructed by replacing tat in pOGLl-wT with sequences encoding the Al domain of CT (i.e. CtxAl). The strategy used to construct the plasmid pOGLl-Al is shown in Figure 8. All procedures used in the construction of pOGLl-Al, including

restrietion endonuclease digestions, agarose gel electrophoresis, DNA purification, DNA ligation and PCR are generally described hereinabove.
Specifically, the recombinant plasmid pOGLl-Al was constructed, wherein gpl20 of HIV-IMN and the Al domain of the A subunit of cholera toxin (referred to herein as "Ctx") are co-expressed. Ctx is a well-known mucosal adjuvant (Xu-Amano, et al., J. Exp. Med., 178:1309 (1993); VanCott, et al., Vaccine, 14:392 (1996); Jackson, R. J. et al., Infect Immun., 61:4272 (1993); Marinaro, M. et al., Ann. New York Acad. Sci., 795:361 (1996); Yamamoto, S. et al, J. Exp. Med., 185:1203 (1997); Porgador, et al., J. Immunol, 158:834 (1997); Lycke and Holmgren, Monogr., Allergy, 24:274 (1988); Hornquist and Lycke, Eur. J. Immunol., 23:2136 (1993); Hornquist, et al., Immunol., 87:220 (1996); Agren, et al., Immunol. Cell Biol., 76:280 (1998)). The adjuvant activity of Ctx is mediated by the Al domain of the A subunit of Ctx (herein referred to as CtxAl). Chimeric proteins comprised of an antigen fused to CtxAl demonstrate the CtxAl is an adjuvant (Agren, et al., J. Immunol., 164:6276 (2000); Agren, et al., Immunol. Cell Biol., 76:280 (1998); Agren, et al., J. Immunol., 158:3936 (1997)). However, the utilization of the Al domain in a CED vaccine has not heretofore been reported.
The plasmid vector of pOGLl-Al is pcDNA3.1zEo, which was purchased from Iuvitrogen (Carlsbad, CA). DNA encoding the IRES of equine encephalitis virus, herein referred to as the cap-independent translational enhancer (U.S. patent number 4,937,190), was amplified from plasmid pCITE4a (Novagen, Madison WI; Cat. No. 69912-1; U.S. patent number 4,937,190) using forward primer 5'-ATAAGAATGCGGCCGCTAAGTAAGTAACTTAAGTTCCGGTTATTTTCCACG ATATTGCCGTCTTTTGGCAA (SEQ ID NO 16) and reverse primer 5'-GCCAAATACATGGCCATATTATCATCGTGTTTTTCAAAGGAA (SEQ ID NO: 17).
DNA encoding the gp 120 gene, which was optimized for expression in mammalian
cells (Andre et al., supra, (1998); Haas et al., supra, (1996)), was amplified from a
plasmid pEFla-syngpl20MN (Andre et al., supra, (1998); Haas et al, supra, (1996))
using forward primer 5'-

GGGGGGGGATCCATGCCCATGGGGTCTCTGCAACCGCTG (SEQ ID NO: 14) and reverse primer 5'-GGGGGCGGCCGCTTATTAGGCGCGCTTCTCGCGC TGCACCACGCG. (SEQ ID NO: 15).
DNA encoding CtxAl was amplified from plasmid pCVD002 provided by the Center for Vaccine Development, University of Maryland, Baltimore; Lochman and Kaper, J.
Nucleotide sequence of CtxAl
1 AATGATGATA AGTTATATCG GGCAGATTCT AGACCTCCTG ATGAAATAAA GCAGTCAGGT 61 GGTCTTATGC CAAGAGGACA GAGTGAGTAC TTTGACCGAG GTACTCAAAT GAATATCAAC 121 CTTTATGATC ATGCAAGAGG AACTCAGACG GGATTTGTTA GGCACGATGA TGGATATGTT 181 TCCACCTCAA rPAGTTTGAG AAGTGCCCAC TTAGTGGGTC AAACTATATT GTCTGGTCAT 241 TCTACTTATT ATATATATGT TATAGCCACT GCACCCAACA TGTTTAAGGT TAATGATGTA 301 TTAGGGGCAT ACAGTCCTCA TCCAGATGAA CAAGAAGTTT CTGCTTTAGG TGGGATTCCA 361 TACTCCCAAA TATATGGATG GTATCGAGTT CATTTTGGQG TGCTTGATGA ACAATTACAT 421 CGTAATAGGG GCTACAGAGA TAGATATTAC AGTAACTTAG ATATTGCTCC AGCAGCAGAT 481 GGTTATGGAT TGGCAGGTTT CCCTCCGGAG CATAGAGCTT GGAGGGAAGA GCCGTGGATT S41 CATCATGCAC CGCCGGGTTG TGGGAATGCT CCAAGATCAT CG-- SEQ ID NO:2
Biol. Chem., 258:13722 (1983)), which has a copy of cholera toxin genes ctxA and ctxB. The nucleotide sequence of ctxA was obtained from GenBank (Accession # A16422, SEQ ID NO: 1). CtxAl-encoding sequence (SEQ ID NO: 2) was amplified using forward primer S'-CCC AAG CTT ATG AAT GAT GAT AAG TTA (SEQ ID NO: 3) and reverse primer 5'-GGG GCG GCC GCT TAC GAT GAT CTT GGA GC (SEQ ID NO: 4). The primers incorporated a HindlR recognition site to the 5'-end of the PCR-generated product and a Noil site to the 3'-end by primer extension. The PCR reaction mixture included 10 ul of both primers, 10mM dNTP, 50 µl of 10X PCR buffer without MgCl2, 62.5 µl of 25 mM MgC12, 2.5 µl of pRc/CMV (0.65µg/ul), 352.5 µl of DEPC treated water and 2.5 µl of AmpliTaq polymerase. The PCR protocol included 35 cycles of a temperature regime including 1 minute at 94°C, 2 minutes at 55°C and 3 minutes at 72°C.
The PCR-generated product was digested with HindTO. and NotI and inserted into the pRc/CMV (Invitrogen, Carlsbad, CA), by ligation. The ligation reaction was terminated and the DNA was introduced into E. coli DH5α by chemical transformation. The transformed bacilli were plated on LB plates supplemented with 100 µg/ml ampicillin at 37°C for 16 hr. Isolated colonies were selected and grown overnight in 3 ml of LB

medium supplemented with 100 µg/ml ampicillin. DNA was extracted from overnight liquid cultures using a Qiagen mini plasmid DNA preparation kit (Cat No Q7106). Plasmid DNA was screened for insert by digesting with HindIII and Not1 followed by agarose gel electrophoresis. Several clones that tested positive for the ctxAl insert were also tested for CtxAl functional activity in 293 cells (ATCC # CRL-1573). Plasmid DNA was transfected into 293 cells using Superfect as per the manufacture's instructions (Qiagen, Valencia CA; Cat No 301305). Transfection efficiency was determined using a Promega ß-Galactosidase assay as per the manufacture's instructions. cAMP production by transfected cells was assayed using a kit from Amersham as per the manufacture's instructions.
Example 7 Imunogericity of a co-expression DNA vaccine encoding a vaccine antigen and an
immunnstimiilatory protein
The immunostimulatory activity of CED vaccine pOGLl-Al was characterized by comparing the immunogenicity of DNA vaccine pOGLl and pOGLl-Al in BALB/c mice. Briefly, groups of 3 BALB/c mice were vaccinated intramuscularly with two 100 jag-doses of endotoxin-free plasmid DNA at 14 day intervals. Another group of 3 BALB/c mice received two 100 µg-doses of plasmid pcDNA3.1 DNA using the same protocol.
Sera were collected before or 10, 12, 22, 34, 50, 60 and 80 days after the first vaccination and used to measure the serum IgG response against HIV-IMN gpl20 by ELISA, as described above.
The results show that mice vaccinated with CED vaccine pOGLl-Al develop a serum IgG response against gpl20 that is 10-fold greater than the anti-gpl20 serum IgG response in pOGLl-vaccinated mice 34 days after vaccination, when the peak response occurs in these latter mice. Following day 34, the serum IgG response continues to rise in mice vaccinated pOGLl-Al, whereas the response induced by pOGLl wanes; 80 days after vaccination the gpl20-specific response elicited by pOGLl-Al is 1000-fold greater than the serum IgG response in mice vaccinated with

pOGLl or a mixture of pOGLl and pcDNA-Al (Figure 9).
Example 8
A DNA vaccine that co-expresses an antigen and an adjuvant significanttly augments the
cell-mediated immune response in the antigen
To assess the magnitude of the CD8 T cell response in the mice vaccinated with pOGLl-Al and pOGLl, splenocytes were harvested 80 days after the first vaccination, as described above. Subsequently, un-fractionated splenocytes were used to enumerate gpl20-specific, IFN-γ-secreting CD8+ T cells by ELISPOT, as described above. The results of the EOSPOT assay were similar to the results of the ELISA data, in that mice vaccinated with pOGLl-Al developed a significantly stronger IFN-γ-secreting CD8 T cell response than mice vaccinated with a mixture of pOGLl (Table 7).
TABLE 7



(Table Removed)

To further evaluate the potency of the CD8 T cell response, the cytotoxic effector function of the gpl20-specific CD8 T cells was assessed using a short-term Cr-release CTL assay. The results of CTL assays corroborated with the results of the ELISPOT assays and showed that mice vaccinated with pOGLl-Al developed a stronger CTL response than mice vaccinated with pOGLl.
Rr ample 9
The use of cholera toxin as an adjuvant enables the induction of long-lived humoral responses (Unpublished observation). To determine if this property was preserved in the CED vaccine, pOGLl-Al, the humoral response to gpl20 was followed for 40 weeks

after vaccination. Thus, a group of BALB/c mice was vaccinated intramuscularly with 100 µg-doses of endotoxin-free pOGLl-Al DNA on weeks 0, 2, and 10. Another group of mice was vaccinated three times on weeks 0, 2, and 10 with a mixture of 100 µg pOGLl and 100 µg pRc/CMV-ctxA/ (expresses the Al subunit of cholera toxin). A negative control group of 3 BALB/c mice received three 100 ug-doses of the expression vector pcDNA3.1 DNA using the same protocol.
Sera were collected before and at 1 month intervals after the first vaccination and used to measure the serum IgG response against HIV-IMN gpl20 by EUCSA.
In agreement with earlier results, mice vaccinated with the dicistronic DNA vaccine pOGLl-Al and the mixture of pOGLl and pRc/CMV-ctxAl developed strong serum IgG responses against gpl20 that were substantially stronger than the anti-gpl20 serum IgG response that arose in pOGLl-vaccinated mice. (Figure 10). In addition, the response induced by pOGLl waned 26 weeks after vaccination, whereas the gpl20-specific serum IgG responses elicited by pOGLl-Al and the mixture of pOGLl and pRc/CMV-ctxA/ remained elevated for the duration of the 40-week monitoring period. Thus, expression of a vaccine adjuvant at the cite of vaccination with a DNA vaccine, either as part of a dicistronic DNA vaccine or as part of a mixture as outlined in the example, results in the induction of long-lived humoral responses against the vaccine antigen. These data clearly demonstrate that expression of both a vaccine antigen and an adjuvant at the site of vaccination preserves the immune-stimulating properties of the adjuvant.
The contrasting effectiveness of CtxAl (e.g., The adjuvant) in a DNA vaccine mixture (e.g., pOGLl + pRc/CMV-Al) compared to CtxAl co-expressed on a single plasmid with the antigen (e.g., pOGLl-Al) demonstrates the principle that DNA vaccines that co-express an antigen and an adjuvant are more effective at utilizing the irnmunostimulatory properties of the adjuvant than a mixture of two plasmids. The data show that co-expression of an antigen (e.g., gpl20) and an adjuvant (e.g., CtxAl) effectively (and synergistically) harnesses the activity of the adjuvant. Therefore, DNA vaccines that co-express an antigen and an adjuvant are useful for the induction of strong humoral and cell-mediated immune responses against antigens.

Construction of a o-expression DNA vaccine encoding an autoimmune antigen and
an immunoregulatory gprtein
A co-expression DNA vaccine comprised of sequences encoding human Tyrosinase-Related Protein 1 (TRP-1, Ace. # X51420) and the Human Immunodeficiency Virus protein Tat was constructed as follows. DNA expressing TRP-1 was cloned into the plasmid pOGLl-wT, by substituting the hgp/20-encoding DNA (Figure 11). Escherichia coli containing the plasmid pHTalpha2, which expresses TRP-1, was obtained from ATCC (Manassas, VA; #65118); pHTalpha2 DNA was purified using the Qiagen Maxi Prep protocol (Valencia, CA; Cat. # 12262). PCR was then conducted to amplify the TRP-1 encoding sequence on pHTalpha2. The restriction endonuclease sites Nhel(5') and NotI(3') were incorporated into the PCR-generated product by primer extension. The resulting PCR product was digested with the aforementioned enzymes (Purchased from New England Biolabs, Beverly, MA; Cat. #131S and #189S) to yield a 1608 bp fragment with Nhel and Notl compatible ends. Plasmid pOGLl-wT was also digested with Nhel and Notl, resulting in a 5789 bp product and a 1543 bp product (comprised of the plasmid backbone pcDNA3.1zeo as well as the IRES and htat). The TRP-1-encoding 1608 bp fragment from the above described PCR and the 5789 bp fragment were purified by gel extraction (Qiagen; Cat. # 28706). These fragments were annealed together using DNA T4 Ligase according to the manufacturer's directions (New England Biolabs; Cat. #202CS).
The E. Coli strain Stable2, prepared as chemically competent cells (Life Technologies, Gaithersburg MD, Cat # 10268-019), was then transformed with the 7397 bp annealed product and positive clones were selected using TSA containing AmpiciUin. Isolated colonies were selected, numbered, and allowed to further incubate (30°C, 20 hrs) and plasmids were purified from these putative clones using the Qiagen Mini-Prep system (Cat # 12123). The presence of plasmids that display the appropriate restriction enzyme pattern were screened with the Nhel and Notl restriction enzymes. Positive clones were then selected and stored at -80°C in TSB containing 30% glycerol. One of these clones, herein referred to as T212 was sent to Aldeveron (Fargo, ND) for the

production of purified, endotoxin-free pOGL4 plasmid DNA vaccine. The sequence of the novel vaccine was then verified by the University of Maryland's Biopolymer Lab (Baltimore, MD).
F,xamp1e„11
Construction of a co-exprpssinn DNA vaccine, encoding an autoimmune anrigen and T
cell growth factor-heta
To construct a DNA vaccine comprised of sequences encoding TRP-1 and Transforming Growth Factor-P (TGF-ß Acc. # V00083), three separate DNA fragments were generated and annealed (Figure 12). The DNA fragment encoding TRP-1 is obtained by cloning a PCR generated TRP-1 fragment and inserting it into the well-known expression vector pcDNA3.1. To this end, plasmid pcDNA3.1 DNA is digested with the restriction enzymes Nhel and NotI (as describe in example 6 above), to yield a 4931 bp fragment. This fragment is purified by fractionating the DNA by agarose gel electrophoresis; the 4931 by pair fragment is isolated using the Qiagen agarose purification kit. PCR is performed on pHTalpha2, following the identical protocol as used in example 6 above. This latter PCR generated product is also digested with NotI and Nhel and the 1608 bp fragment is purified using the Qiagen agarose gel extraction kit. The purified 4931 bp pcDNA3.1 and 1608 bp TRP-1 fragment are subsequently annealed with T4 DNA ligase as before. E.coli strain Stable2 is transformed with the resultant 6539 product and Ampicillin resistant clones are screened by the same method as above. An isolate containing the desired recombinant plasmid, referred to here in as pOGL7, is then used as a source of large-scale plasmid DNA production that is obtained commercially from Aldeveron, LLC (Fargo, North Dakato)
This plasmid is then cleaved with the restriction enzymes NotI and Xhol (NEB, Cat. #146S) to generate the DNA fragment encoding pcDNA linked to TRP-1 and the 6533 bp fragment is purified through agarose gel extraction as above.
A second DNA fragment comprised of the sequence encoding the CITE region of the VEE virus which provides an IRES sequence and is useful for co-expression of two

proteins from a single promoter. Thus, plasmid pcDNA-hml20:CITE:Tat is digested with the restriction enzyme MscI (NEB; Cat# 534S) and NotI yielding four fragments: 1467, 531, 1535, and 3790 bp in size; the 531 bp fragment contains the CITE region and is purified using the Qiagen agarose gel extraction procedure cited above. The final DNA fragment is a 370 bp DNA sequence encoding TGF-ß and is obtained through PCR amplification as follows: An E. Coli HB101 derivative containing plasmid phTGFB-2, which encodes the entire human TGF-P product, was obtained from ATCC (Manassas VA, ATCC No. 59954). Plasmid pHTGFB-2 DNA was purified using the Qiagen MaxiPrep Protocol. The pHTGFB-2 plasmid is then used as a source and PCR is then conducted to amplify only the mature TGF-B encoding sequence. Through primer extension PCR, MscI and Xhol restriction enzyme sites are incorporated into the PCR-generated product; the resultant 370bp fragment is cleaved with these enzymes and purified by gel extraction as described above.
Finally, the 6533 bp DNA fragment composed of pcDNA3.1::TRP-1, the 531 bp DNA fragment encoding CITE, and the 370 bp DNA fragment encoding TGF-P are annealed together using T4 DNA ligase as above. The resulting 7434 bp recombinant plasmid is transformed into Stable2 bacteria. Ampicillin-resistant clones are then screened as above by restriction enzyme analysis and a clone containing the appropriate plasmid that displays the predicted digestion pattern by agarose gel electrophoresis is selected and stored at -80 C in TSB containing 30% (v/v) glycerol. A large scale preparation of this plasmid, here in referred to as pcDNA:TRP-l::CITE::TGF-p, for vaccination of mice is purchased from Adeveron; automated DNA sequencing of the TRP-1::CITE::TGF-|3 fragment is conducted to verify the structural integrity of this DNA prior to vaccination of the mice.
F-rample 17 Construcion of a co-expression DNA vaccine encoding a vaccine antigen and an
immunostimulartory aduuvant
Novel DNA vaccines were constructed that co-expresses an antigen (e.g., gpl20) and an adjuvant, e.g., enzymatically active domains of E. coli heat labile enterotoxin (LT),

pertussis toxin (PT) from B. pertussis and the adenylate cyclase toxin (cya) from B. pertussi. LT is highly homologous to cholera toxin (CT) and like CT, leads to the upregulation of intracellular cAMP levels through the ADP-ribosylation of Gsa which in turn constitutively activates adenylate cyclase. PT increases intracellular cAMP levels through the ADP-ribosylation of Gi which in turn prevents the inhibition of adenylate cyclase. Adenylate cyclase toxin increases intracellular cAMP by transferring a functional adenylate cyclase enzyme into the cytoplasm of target cells.
All procedures used in the construction of pOGLl-Al hereinabove, including restriction endonuclease digestions, agarose gel electrophoresis, DNA purification, DNA ligation and PCR were generally followed.
The nucleotide sequence of the A subunit of LT was obtained from Pub Med (Accession # M57244 SEQ ID. NO: 5). The Al subunit starts at position 1 and the coding sequence extends through position 582. The A2 subunit starts at position 583 and the coding sequence extends through position 723. The following PCR primers were made to clone the LTA1 subunit into the eukaryotic expression plasmid pRc/CMV. The forward primer 5' CGC GCG AAGCTT ATG GGC GAC AGA TTA TAC CGT GCT GAC TCT (SEQ ID NO: 6) and reverse primer 5' CGC GCG GCGGCCGC TTA TTA GAT TGT TCT TGA TGA ATT TCC (SEQ ID NO: 7). The forward primer has a Hind IE restriction enzyme site and the reverse primer has a Not I restriction enzyme site.
The plasmid used for the PCR template was pCVD 403 and provided by the Center for Vaccine Development, University of Maryland and which contained the gene encoding LT. The same method described for cloning CTA1 into pRc/CMV was used to clone LTA1 into pRc/CMV.
The nucleotide sequence PT was obtained from Pub Med (Accession # E01352, SEQ ID NO: 8). The SI subunit starts at position 609 and the coding sequence extends through position 1313. The following PCR primers were made to clone the PTS1 subunit into the eukaryotic expression plasmid pRC/CMV. The primers used included the forward primer 5' CGC GCG AAGCTT ATG GAC GAT CCT CCC

GCC ACC GTA TAC CGC (SEQ ID NO: 9) and the reverse primer CGC GCG GCGGCCGC. TTA TTA GAA CGA ATA CGC GAT GCT TTC GTA (SEQ ID NO: 10). The forward primer has a Hind HI restriction enzyme site and the reverse primer has a Not I restriction enzyme site.
The plasmid used for the PCR template was pBLUE/S 1 wt was provided by the Center for Vaccine Development, University of Maryland and which contained the gene encoding PTS1. The same method described for cloning CTA1 into pRC/CMV was used to clone PTS1 into pRC/CMV.
The nucleotide sequence the B. pertussis cya gene was obtained from Pub Med (Accession # Y00545, SEQ ED NO: 11). cyaA contains the enzymatically active adenylate cyclase enzyme of adenylate cyclase toxin and the enzymatic activity is confined to the first 400 amino acids (Hanski, TIBS 1989). The coding sequence for the first 400 amino acids of cyaA starts at position 981 and extends through position 2181. The following PCR primers were made to clone the first 400 amino acids of cyaA into the eukaryotic expression plasmid pRC/CMV, forward primer CGC GCG AAGCTT ATG CAG CAA TCG CAT CAG GCT GGT TAC (SEQ ID NO: 12) and reverse primer CGC GCG GCGGCCGC TTA TTA CTG GCG TTC CAC TGC GCC CAG (SEQ ID NO: 13). The forward primer has a Hind III restriction enzyme site and the reverse primer has a Not I restriction enzyme site.
The plasmid used for the PCR template was pBLUE/cya/cla was provided by the Center for Vaccine Development, University of Maryland) which contained the gene encoding PTS1. The same method described for cloning CTA1 into pRC/CMV was used to clone the first 400 amino acids of cyaA into pRC/CMV.
DMA Vaccine Adjuvant Studies- After the DNA vaccine constructs have been cloned, they will be grown in a large scale and purified. The constructs will also be tested for endotoxin contamination. An example of a DNA vaccine adjuvant study will be outlined below.

The animal model will be BALB/C or C57BL6 mice. Each experimental and control group will be made up of 5 mice. The following control groups will be used in each study.
1. A negative control group that will receive saline during immunizations.
2. An antigen alone group that will be immunized with the plasmid expressing the antigen of interest (OVA, GP-120, etc.).
3. An adjuvant alone group that will be immunized with the plasmid expressing the putative adjuvant (CTA1, LTA1, PTS1 etc.). There will be a separate group for each adjuvant being tested in the study.
The experimental groups used in the study will be co-immunized with the plasmid expressing the antigen and with the plasmid expressing the putative adjuvant. There will be a separate experimental group for each adjuvant being tested.
To begin the study each animal from each group will receive the first intra-muscular immunization. The control mice receiving one plasmid alone will be immunized with 100 µg of the respective plasmid. The experimental mice will be co-immunized with 100 µg of the antigen expressing plasmid mixed with 100 ug of the adjuvant expressing plasmid. The volume of the injection will be held constant between groups and the negative control group will receive an equal volume of saline. Four teen days later the above immunization will be repeated. At 14 day intervals sera will be collected from individual mice and will be screened for anti-antigen Ig subclasses by ELISA. After the final collection of sera the mice will be sacrificed and the spleens will be harvested. The spleens will be screened for antigen specific T cells.
While the invention has been described in detail, and with reference to specific embodiments thereof, it will be apparent to one of ordinary skill in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof. Various references are cited throughout this specification; the entire disclosure of each such reference is incorporated herein by reference in its entirety for all purposes.



WE CLAIM:
1. A recombinant DNA vaccine comprising:
an antigen-encoding region comprising a nucleotide sequence encoding a HIV antigen; and
a biologically active component-encoding region comprising a nucleotide sequence encoding the Al domain of the A subunit of cholera toxin or fragment thereof, and wherein the Al domain of the A subunit or fragment thereof retains the ADP-ribosylating activity of the cholera toxin.
2. The recombinant DNA vaccine as claimed in claim 1, wherein the antigen-encoding region is operatively linked to a promoter which drives transcription in one or more eukaryotic cell types.
3. The recombinant DNA vaccine as claimed in claim 1, wherein the biologically active component-encoding region is operatively linked to a promoter which drives transcription in one or more eukaryotic cell types.
4. The recombinant DNA vaccine as claimed in claim 1, wherein the antigen-encoding region is separated from the biologically active component-encoding region by a coding region comprising a nucleotide segment encoding an internal ribosome entry sequence.
5. The recombinant DNA vaccine as claimed in claim 4, wherein the internal ribosome entry sequence is a cap-independent translational enhancer.
6. The recombinant DNA.vaccine as claimed in claim 1, wherein antigen component comprises gpl20 or hgpl20.

7. The recombinant DNA vaccine as claimed in claim 1, wherein the antigen-encoding region and the biologically-active component-encoding region are provided in one expression cassette or as separate expression cassettes.
8. The recombinant DNA vaccine as claimed in claim 7, wherein the expression cassette comprises a plasmid backbone.
9. The recombinant DNA vaccine as claimed in claim 8, wherein the plasmid backbone is selected from the group consisting of: pBR322, pUC19, pcDNA3.1ZEO, pRc/CMV, pXTl, pSG5, pPUR, pMAM, pDual, pG51uc, pACT, pBIND, pCI-Neo, pCMV-BD, pIRES-P, pRL-CMV.
10. The recombinant DNA vaccine as claimed in claim 8 comprising the nucleotide sequence of pOGLl-wT, pOGLl-AT or pOGLl-Al.
11. The recombinant DNA vaccine as claimed in claim 1, wherein the antigen-encoding region and the biologically-active component-encoding region are provided as separate expression cassettes in separate plasmids.

Documents:

00338-delnp-2003-abstract.pdf

00338-delnp-2003-assignment.pdf

00338-delnp-2003-claims.pdf

00338-delnp-2003-correspondence-others.pdf

00338-delnp-2003-description (complete)-09-05-2008.pdf

00338-delnp-2003-description (complete).pdf

00338-delnp-2003-drawings.pdf

00338-delnp-2003-form-1.pdf

00338-delnp-2003-form-13.pdf

00338-delnp-2003-form-18.pdf

00338-delnp-2003-form-2.pdf

00338-delnp-2003-form-3.pdf

00338-delnp-2003-form-5.pdf

00338-delnp-2003-gpa.pdf

00338-delnp-2003-pct-210.pdf

00338-delnp-2003-pct-304.pdf

338-DELNP-2003-Abstract-(23-09-2008).pdf

338-DELNP-2003-Abstract-09-05-2008.pdf

338-DELNP-2003-Claims-(23-09-2008).pdf

338-DELNP-2003-Claims-09-05-2008.pdf

338-DELNP-2003-Correspondence-Others-(23-09-2008).pdf

338-DELNP-2003-Correspondence-Others-09-05-2008.pdf

338-DELNP-2003-Correspondence-Others-14-05-2008.pdf

338-DELNP-2003-Description (Complete)-(23-09-2008).pdf

338-DELNP-2003-Description (Complete)-30-12-2008.pdf

338-DELNP-2003-Drawings-(23-09-2008).pdf

338-DELNP-2003-Drawings-09-05-2008.pdf

338-DELNP-2003-Form-1-(23-09-2008).pdf

338-DELNP-2003-Form-1-09-05-2008.pdf

338-DELNP-2003-Form-2-(23-09-2008).pdf

338-DELNP-2003-Form-2-09-05-2008.pdf

338-DELNP-2003-Form-2-30-12-2008.pdf

338-DELNP-2003-GPA-09-05-2008.pdf

338-DELNP-2003-Others-Document-(23-09-2008).pdf


Patent Number 234566
Indian Patent Application Number 00338/DELNP/2003
PG Journal Number 26/2009
Publication Date 26-Jun-2009
Grant Date 08-Jun-2009
Date of Filing 10-Mar-2003
Name of Patentee UNIVERSITY OF MARYLAND BIOTECHNOLOGY INSTITUTE
Applicant Address RESEARCH ADMIN./TECH. DEV., SUITE 200, 701 E. PRATT STREET, BALTIMORE, MD 21202 USA
Inventors:
# Inventor's Name Inventor's Address
1 DAVID HONE 7927 RUSTLING BARK COURT, ELLICOTT CITY MD 21043 USA
2 GEORGE LEWIS 2802 ST. PAUL STREET, BALTIMORE MD 21218 USA
3 TIMOTHY FOUTS 7523 SWAN POINT WAY COLUMBIA MD 21045 USA
4 KEN BAGLEY 7602 OLD HARTFORD ROAD, BALTIMORE MD 21234 USA
5 MICHAEL BOYSON APT. 1033, 2501 ST. PAUL STREET, BALTIMORE MD 21218 USA
6 CHRISTINE OBRIECHT P.O.BOX 47, ELLICOTT CITY MD 21041 USA
7 MT SHATA 624 JEFFERSON BLVD., FISH KILL, NY 12524 USA
8 SIMON AGWALE 3546 CARRIAGE HILL CIRCLE, RANDALLSTOWN, MD 21153 USA
PCT International Classification Number C12N 15/40
PCT International Application Number PCT/US01/28365
PCT International Filing date 2001-09-10
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 60/231,449 2000-09-08 U.S.A.
2 60/231,070 2000-09-08 U.S.A.
3 60/231,376 2000-09-08 U.S.A.
4 60/231,403 2000-09-08 U.S.A.