Title of Invention	COMPOUNDS AND COMPOSITIONS AS LXR MODULATORS
Abstract	The invention provides compounds, pharmaceutical compositions comprising such compounds and methods of using such compounds to treat or prevent diseases or disorders associated with the activity of liver X receptors (LXRs).

Full Text

COMPOUNDS AND COMPOSITIONS AS LXR MODULATORS CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of priority to U,S. Provisional Patent Application numbers 60/543,848, filed 11 February 2004 and 60/623,021, filed 27 October 2004, The full disclosures of these applications are incorporated herein by reference in their entirety and for all purposes. BACKGROUND OF THE INVENTION Field of the Invention [0002] The invention provides compounds, pharmaceutical compositions comprising such compounds and methods of using such compounds to treat or prevent diseases or disorders associated with the activity of liver X receptors (Lars). Background [0003] Liver X receptors (Lars), Lore and LXR(3, are nuclear receptors that regulate the metabolism of several important lipids, including cholesterol and bile acids. While Lerp is expressed ubiquitously in the body, Lora is expressed in the liver and to a smaller degree in the kidneys, small intestine, adipose tissue, spleen and adrenal glands. [0004] Lars bind to the ATP binding cassette transporter-1 (Aback) promoter and increase expression of the gene to produce Aback protein. Aback is a membrane bound transport protein that is involved in the regulation of cholesterol efflux from extra-hepatic cells onto nascent high-density lipoprotein (HDL) particles. Mutations in the Baal gene result in low levels of HDL and an accompanying increased risk of cardiovascular diseases such as arteriosclerosis, myocardial infarction and alchemic stroke. Lora and agonists have been shown to increase Aback gene expression thereby increasing HDL cholesterol and, as a consequence, decreasing both the net absorption of cholesterol and the risk of cardiovascular disease. LXR agonists also up regulate macrophage expression of polio protein E (ape) and Bagel, both of which contribute to the efflux of cellular cholesterol By stimulating macrophage cholesterol efflux through up regulation of Aback, Bagel and/or ape expression, as well as increasing the expression of other target genes including cholesterol ester transfer protein and lipoprotein lipase, LXR agonists influence plasma lipoproteins. [0005] The novel compounds of this invention modulate the activity of Lars and are, therefore, expected to be useful in the treatment of LXR-associated diseases such as cardiovascular diseases, inflammation and disorders of glucose metabolism such as insulin resistance and obesity. [0007] in which: [0008] n is selected from 0,1,2 and 3; [0009] Z is selected from C and S(0); each [0010] Y is independently selected from -CR4== and -N=; wherein R4 is selected from hydrogen, cyano, hydroxyl, C1-6alkyl, C1-6alkoxy, halo-substituted-C1-6alkyl and halo-substituted-C1-6alkoxy; [Olli R1 is selected from halo, cyano, hydroxyl, C1-6alkyl, C1-6alkoxy, halo- substituted-C1-6alkyl, halo-substituted-C1-6alkoxy and -C(0)0R4; wherein R4 is as described above; [0012] R2 is selected from C6-10aryl, C1-6heteroaryl, C3-C12cycloalkyl and C3. gheterocycloalk ill; wherein any aryl, heteroaryl, cyclically or heterocycloalkyl of R2 is optionally substituted with 1 to 5 radicals independently selected from halo, hydroxy, cyano, nitro, C1-6alkyl, C1-6alkoxy, halo-substituted-C1-6alkyl, halo-substituted-C 1. {0014] In a second aspect, the present invention provides a pharmaceutical composition which contains a compound of Formula I or a N-oxide derivative, individual isomers and mixture of isomers thereof; or a pharmaceutically acceptable salt thereof, in admixture with one or more suitable percipients. [0015] In a third aspect, the present invention provides a method of treating a disease in an animal in which modulation of LXR activity can prevent, inhibit or ameliorate the pathology and/or symptomatology of ice diseases, which method comprises administering to the animal a therapeutically effective amount of a compound of Formula I or a N-oxide derivative, individual isomers and mixture of isomers thereof, or a pharmaceutically acceptable salt thereof. [0016] In a fourth aspect, the present invention provides the use of a compound of Formula I in the manufacture of a medicament for treating a disease in an animal in which LXR activity contributes to the pathology and/or symptomatology of the disease. [0017] In a fifth aspect, the present invention provides a process for preparing compounds of Formula I and the N-oxide derivatives, prod rug derivatives, conjugates, protected derivatives, individual isomers and mixture of isomers thereof, and the pharmaceutically acceptable salts thereof. DETAILED DESCRIPIION OF THE INVENTION Definitions [0018] "Alkyl" as a group and as a tactual element of other groups, for example halo-substituted-alkyl and alloy, can be either straight-chained or branched. C1-6alkoxy includes, ethoxy, ethoxy, and the like. Halo-substituted alkyl includes trifluoromethyl, pentafluoroethyl, and the like. [0019] "Oily" means a monocyclic or fused bicycled aromatic ring assembly containing six to ten ring carbon atoms. For example, aryl can be phenyl or apathy, preferably phenyl. "Arlene" means a divalent radical derived from an aryl group. "Heteroaryl" is as defined for aryl where one or more of the ring members are a heteroatoms. For example heteroaryl includes purity, kindly, indazolyl, quinoxalinyl, quinolinyl, banjo rankle, benzopyranyl, benzothiopyianyl, banjo[l ,3]diazoles. imidazolyl, banjo-imidazolyl, pyrimidinyl, foamy, oxazolyl, isoxazolyl, triazolyl, tetrazolyl, pyrazolyl, thinly, etc. C1-6aryl alkyl" means an aryl as described above connected via a alkaline groom ping. For example, C1-6 alkyl includes phenethyl, benzyl, etc. [0020] "Cyclically" means a saturated or partially unsaturated, monocyclic, fused bicyclical or bridged polycyclic ring assembly containing the number of ring atoms indicated. For example, C1-6cycloalkyl includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc, "Heterocycloalkyl" means cyclically, as defined in this application, provided that one or more of the ring carbons indicated, are replaced by a moiety selected from -0-, -N=, -NR", -C(0) -, -S-, -S(0) - or -S(0)2-, wherein R is hydrogen,C1-6alkyl or a nitrogen protecting group. For example, C1-6heterocycloalkyl as used in this application to describe compounds of the invention includes morpholino, pyrrolidinyl, piperazinyl, piperidinyl, piperidinylone, l,4-dioxa-8-aza-spiro[4.5]dec-8-yl, etc. [0021] "Halogen" (or halo) preferably represents chloral or flour, but can also be brome or iodole. [0022] The term "modulate" with respect to an LXR receptor refers to regulation of the LXR receptor and its biological activities associated with the LXR pathway (e.g., transcription regulation of a target gene). Modulation of LXR receptor can be up-regulation (i.e., agonizing, activation or stimulation) or down-regulation (i.e. antagonizing, inhibition or suppression). The mode of action of an LXR modulator can be direct, e.g., through binding to the LXR receptor as a legend. The modulation can also be indirect, e.g., through binding to and/or modifying another molecule which otherwise binds to and activates the LXR receptor, or by stimulating the generation of an endogenous LXR legend. Thus, modulation of LXR includes a change in the bioactivities of an LXR agonist legend (i.e., its activity in binding to and/or activating an LXR receptor) or a change in the cellular level of the legend. [0023] "Treed, "treating" and "treatment" refer to a method of alleviant or abating a disease and/or its attendant symptoms. Description of the Preferred Embodiments [0024] The present invention provides compounds, compositions and methods for the treatment of diseases in which modulation of LXR activity can prevent, inhibit or ameliorate the pathology and/or symptomatology of the diseases, which method comprises administering to the animal a therapeutically effective amount of a compound of Formula I. [0026] in which: [0027] n is selected from 1,2 and 3; [0028] Y is selected from -CH= and-N=; [0029] Ri is selected from halo, C1-6allcyl, and -C(0)0R4; wherein R4 is selected from hydrogen and C1-6alkyl; [0030] R2 is selected from C1-6aryl,C1-6heteroaryl, C1-6cycloalkyl and C3. gheterocycloallcyl; wherein any aryl, heteroaryl, cyclically or heterocycloalkyl of R2 is optionally substituted with 1 to 4 radicals independently selected from halo, hydroxy, C1-6alkyl, halo-substituted-C1-6alkyl and -0C(0)R5; wherein R5 is selected from hydrogen and C1-6alkyl; and [0031] R3 is selected from C1-6aryl, C1-6heteroaryl, C3- ncycloalkyl and C1-6heterocycloalkyl; wherein any aryl, heteroaryl, cyclically or heterocycloalkyl of R3 is substituted with 1 to 5 radicals independently selected from halo, hydroxy], C1-6alkoxy, halo-substituted-C1-6alkyl, halo-substituted-C1-6alkoxy, - OXR7, -OXC(0)NR7R8, -OXC(0)NR7XC(0)OR8, -OXC{0)NR7XORs, - OXC(0)NR7XNR7R8, -OXC(0)NR7XS(0)o-2R83 -OXC(0)NR7XNR7C(0)R8, - OXC(0)NR7XC(0)XC(0)OR8, -OXC(0)NR7R9, -0XC(0)0R7, -OXOR7, -OXR9, -XR9, -0XC(0)R9 and -OXC(0)NR7CR7[C(0)R8]2;wherein X is a selected from a bond and C1-6alkylene; R7 and Rose are independently selected from hydrogen, cyano, C1-6alkyl, OCH2C(0)(CH2)30CH(CH3)2; wherein R9 is phenyl, cyclopropyl-methyl, isoxazolyl, benzthiazolyl, foray, furan-methyl, tetrahydro-fiiranyl, pyridines, 4-oxo-4,5-dihydro-thiazol-2-yl, pyrazolyl, isothiazolyl, l,3,4-thiadiazolyl5 thiazolyl, phenethyl, morpholino, morpholino-propyl, isoxazolyl-methyl, pyrimidinyl, tetrahydro-pyranyl, 2-0X0-2,3-dihydro-pyrimidin-4-yl, piperazinyl, payroll, piperidinyl, pyrazinyl, imidazolyl, imidazolyl-propyl, ben2o[l,3]duopoly, bonze[l,3]duopoly-propyl, 2-oxo-pyrrolidin-l-yl and 2-oxo-pyn:olidin-l-yl-propyl; wherein any alkyl of R9 can have a hydrogen replaced with -C(0)OC2H5; wherein any aryl, heteroaryl or heterocycloalkyl of R9 is optionally substituted with 1 to 4 radicals independently selected from methyl, ethyl, cyclopropyl, ethoxy, trifluoromethyl, -0C(0)CH3. -COOH, -S(0)2NH2, -CH(NH2)=N0H, -C(0)OC2H5, -CH2C(0)0H, -CH2C(0)OC2H5, -CHsCCOpCHs, -C(0)0CH3, -C(0)NH2, -C(0)NHCH3 and -C(0)CH3. [0034] Preferred compounds of Formula I are detailed in the Examples and Table I, infra. Pharmacology and Utility [0035] Compounds of the invention modulate the activity of Lars and, as such, are useful for treating diseases or disorders in which Lars contribute to the pathology and/or symptomatology of the disease. This invention further provides compounds of this invention for use in the preparation of medicaments for the treatment of diseases or disorders in which Lars contribute to the pathology and/or symptomatology of the disease. LXR mediated diseases or conditions include inflammation, cardiovascular disease including arteriosclerosis, arteriosclerosis, hypercholesteremia, hyperlipidemia and disorders of glucose homeostasis, including insulin resistance, type II diabetes, and obesity. [0036] Lipoprotein metabolism is a dynamic process comprised of the production of triglyceride and cholesterol rich particles from the liver as very low-density lipoprotein (VLDL), modification of these lipoprotein particles within the plasma (VLDL to intermediate density (DDL) to low-density lipoprotein (LDL)) and clearance of the particles from the plasma, again by the liver. This process provides the transport of triglycerides and free cholesterol to cells of the body. Reverse cholesterol transport is the proposed mechanism by which excess cholesterol is returned to the liver from extra-hepatic tissue. [0037] The process is carried out by high-density lipoprotein (HDL) cholesterol. The combination of lipoprotein production (VLDL, HDL) from the liver, modification of particles (all) within the plasma and subsequent clearance back to the liver, accounts for the steady state cholesterol concentration in plasma. Compounds of this invention increase reverse cholesterol transport by increasing coolest l efflux from the arteries. This invention includes the use of compounds of this invention for the preparation of a medicament for increasing reverse cholesterol transport. Additionally, this invention provides compounds for inhibit cholesterol absorption and the use of compounds of this invention for the preparation of a medicament for inhibiting net cholesterol absorption. [0038] The compounds of this invention can also be useful for the prevention or treatment of inflammation and neurodegenerative diseases or neurological disorders. Accordingly, this invention also provides a method for preventing or treating inflammation and a method for preventing or treating neurodegenerative diseases or neurological disorders, particularly neurodegenerative diseases or disorders characterized by neuron degeneration, neuron injury or impaired plasticity or inflammation in the CNS. Particular diseases or conditions that are characterized by neuron degeneration, inflammation, cholesterol and lipid abnormalities in the brain and thus benefiting from the growth and/or repair of neurons include stroke, Amities s disease, front-temporal dementias (naturopathies), peripheral neuropathy, Parkinson's disease, dementia with Lewd bodies, Huntington’s disease, amyotrophic lateral sclerosis and multiple sclerosis and Neumann-Pick disease. Diseases or conditions that are characterized by neuron degeneration and/or impaired plasticity include psychiatric disorders such as schizophrenia and depression. Particular diseases or conditions that are characterized by neuronal injury include those conditions associated with brain and/or spinal cord injury, clouding trauma. In addition, the compounds of this invention can be used to treat or prevent various diseases with an inflammatory component, such as rheumatoid arthritis, osteoarthritis, psoriasis, asthma, etc. [0039] LXR agonists improve glucose tolerance and enhance glut4 expression (U.S. Provisional Patent Application 60/436,112, filed 12/23/2002; U. S. Patent Application 10/745,334, filed 12/22/2003). There is a coordinated regulation of genes involved in glucose metabolism in liver and adipose tissue. In the liver, LXR agonists inhibit expression of several genes that are important for hepatic gluconeogenesis, e.g., PGC-la, phosphoenolpyruvate carboxykinase (PEPCK), and glucose-6-phosphatase expression. Inhibition of these gluconeogenic genes is accompanied by an induction in expression of glycosidase, which promotes hepatic glucose utilization. It was also found that mRNA levels were unregulated by LXR agonists in adipose tissue, and that glucose uptake in 3T3-L1 adiposities was enhanced in vitro. [0040] In accordance with these discoveries, the present invention provides methods for enhancing glut4 expression in cells in a subject by administering a compound of the invention to the subject. The present’ invention also provides methods for treating diabetes mellitus and related disorders, such as obesity or hyperglycemia, by administering to a subject an effective amount of a compound of the invention to ameliorate the symptoms of the disease. For example, type 11 diabetes is amenable to treatment with methods of the present invention. By enhancing sensitivity to insulin and glucose uptake by cells, administration with a compound of the invention can also treat other diseases characterized by insulin dysfunction (e.g., resistance, inactivity or deficiency) and/or insufficient glucose transport into cells. [0041] Compounds of the present invention also regulate expression levels of a number of genes that play important roles in liver gluconeogenesis. Accordingly, the present invention further provides methods for reducing gluconeogenesis in a subject by modulating expression of such genes (e.g., PGC-1 and PEPCK). [0042] In the pancreas, LXR activation stimulates insulin secretion via modulation of glucose and lipid metabolism in pancreatic /3-cells, suggesting another mechanism for LXR's anti-diabetic effects. LXR modulators can thus also regulate glucose tolerance by enhancing insulin secretion from the pancreas. [0043] In accordance with the foregoing, the present invention further provides a method for preventing or treating any of the diseases or disorders described above in a subject in need of such treatment, which method comprises administering to said subject a therapeutically effective amount (See, "Administration and Pharmaceutical Compositions", infra) of a compound of Formula I or a pharmaceutically acceptable salt thereof. For any of the above uses, file required dosage will vary depending on tie mode of administration, the particular condition to be treated and the effect desired. Administration and Pharmaceutical Compositions [0044] In general, compounds of the invention will be administered in therapeutically effective amounts via any of the usual and acceptable modes known in the art, either singly or in combination with one or more therapeutic agents. A therapeutically effective amount can vary widely depending on the severity of the disease, the age and relative health of the subject, the potency of the compound used and other factors. In general, satisfactory results are indicated to be obtained systemically at daily dosages of from about 0.03 to 2.5mg/kg per body weight An indicated daily dosage in the larger mammal, e.g. humans, is in the range from about 0,5mg to about loom, conveniently administered, e.g. in divided doses up to four times a day or in retard form. Suitable unit dosage forms for oral administration comprise from ca. 1 to 50mg active ingredient [0045] Compounds of the invention can be administered as pharmaceutical compositions by any conventional route, in particular enter ally, e.g., orally, e.g., in the form of tablets or capsules, or parent rally, e.g., in the form of impeccable solutions or suspensions, topically, e.g., in the form of lotions, gels, ointments or creams, or in a nasal or suppository form or in inhaled forms. Pharmaceutical compositions comprising a compound of the present invention in free form or in a pharmaceutically acceptable salt form in association with at least one pharmaceutically acceptable carrier or diluents can be manufactured in a conventional manner by mixing, granulating or coating methods. For example, oral compositions can be tablets or gelatin capsules comprising the active gradient together with a) diluents, e.g., lactose, dextrose, sucrose, manifold, orbital, cellulose and/or glycogen; b) lubricants, e.g., silica, talcum, stair acid, its magnesium or calcium salt and/or polyethylene glycol; for tablets also c) binders, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth, methyl cellulose, sodium caiboxymethylcellulose and or polyvinylpyroUidone; if desired d) disintegrants, e.g., starches, agar, agonic acid or its sodium salt, or effervescent mixtures; and/or e) absorbents, colorants, flavors and sweeteners. Inject able compositions can be aqueous isotonic solutions or suspensions, and suppositories can be prepared from fatty emulsions or suspensions. The compositions can be sterilized and/or contain adjuvant, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they can also contain other therapeutically valuable substances. Suitable formulations for transferal applications include an effective amount of a compound of the present invention with a carrier. A carrier can include absorbable pharmacologically acceptable solvents to assist passage through the skin of the host. For example, transferal devices are in the form of a bandage comprising a backing member, a reservoir containing the compound optionally with carriers, optionally a rate controlling barrier to deliver the compound to the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin. Matrix transferal formulations can also be used. Suitable formulations for topical application, e.g., to the skin and eyes, are preferably aqueous solutions, ointments, creams or gels well-known in the art. Such can contain solubilizers, stabilizers, and tonicity enhancing agents, buffers and preservatives. [0046] Compounds of the invention can be administered in therapeutically effective amounts in combination wifely one or more therapeutic agents (pharmaceutical combinations). For example, synergistic effects can occur with other substances used in the treatment of cardiovascular, inflammatory and/or neurodegenerative diseases. Examples of such compounds include fib rates, Tads, motorman, etc. Where the compounds of the invention are administered in conjunction with other therapies, dosages of the co-administered compounds will of course vary depending on the type of co-dig employed, on the specific drug employed, on the condition being treated and so forth, [0047] The mention also provides for pharmaceutical combinations, e.g. a kit, comprising a) a first agent which is a compound of the invention as disclosed herein, in free form or in pharmaceutically acceptable salt form, and b) at least one co-agent. The kit can clued instructions for its administration. [004S] The terms "co-administration" or "combined administration" or the like as utilized herein are meant to encompass administration of the selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration or at the same time. [0049] The term "pharmaceutical combination" as used herein means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that the active ingredients, e.g. a compound of Formula I and a co-agent, are both administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" means that the active ingredients, e.g. a compound of Formula I and a co-agent, are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the 2 compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of 3 or more active ingredients. Processes for Making Compounds of the Invention [0050] The present invention also includes processes for the preparation of compounds of the invention. In the reactions described, it can be necessary to protect reactive fictional groups, for example hydroxy, amino, amino, trio or carboy groups, where these are desired in the final product, to avoid their unwanted participation in the reactions. Conventional protecting groups can be used in accordance with standard practice, for example, see T.W. Greene and P. G. M. West in "Protective Groups in Organic Chemistry", John Wiley and Sons, 1991. [0051] Pompoms of Formula I can be prepared by proceeding as in the following Reaction Scheme I: Reactions Scheme I in which n, Y, Z, Rim, R2 and R3 are as defined in the Summary of the Invention. Compounds of Formula I are prepared by reacting a compound of formula 2 with a compound of formula 3 to form a compound of formula 4 which is further reacted with a compound of formula 5 or 6. The entire reaction is carried out in the presence of a suitable solvent (e.g., dichloromethane, or the like) and a suitable base (e.g., DBEA, or the like). The reaction is carried out in the temperature range of about 5 to about 30°C and takes up to 20 hours to complete. Additional Processes for Making Compounds of the Invention [0052] A compound of the invention can be prepared as a pharmaceutically acceptable acid addition salt by reacting the fine base form of the compound with a pharmaceutically acceptable inorganic or organic acid. Alternatively, a pharmaceutically acceptable base addition salt of a compound of the mentions can be prepared by reacting tiiie free acid form of the compound with a pharmaceutically acceptable inorganic or organic base. Alternatively, the salt forms of the compounds of the invention can be prepared using salts of the starting materials or intermediates. [0053] The free acid or free base forms of the compounds of the invention can be prepared from the corresponding base addition salt or acid addition salt from, respectively. For example a compound of the invention in an acid addition salt form can be converted to tie nonexpanding free base by treating with a suitable base (e.g., ammonium hydroxide solution, sodium hydroxide, and the like). A compound of the invention in a base addition salt form can be converted to the corresponding free acid by treating with a suitable acid (e.g., hydrochloric acid, etc.). [0054] Compounds of the innovation in uncivilized form can be prepared from N- oxides of compounds of the invention by tram with a reducing agent (e.g., sulfur, sulfur dioxide, trephines hospice, lithium borohydride, sodium borohydride, phosphorus dichloride, tribromide, or the like) in a suitable inert organic solvent (e.g. acetonitrile, ethanol, aqueous dioxins, or the like) at 0 to 80°C. [0055] Prod rug derivatives of the compounds of the invention can be prepared by methods known to those of ordinary skill in the art (e.g., for further details see Saltier et al., (1994), Bioorganic and Medicinal Chemistry Letters, Vol. 4, p. 1985), For example, appropriate prodrugs can be prepared by reacting a non-derivatives compound of the invention with a suitable carbamylating agent (e.g., 1,1-acyloxyalkylcarbanochloridate, para-nitrophenyl carbonate, or the like). [0056] Protected derivatives of the compounds of the invention can be made by means known to those of ordinary skill in the art A detailed description of techniques applicable to the creation of protecting groups and their removal can be found in T. W. Greene, "Protecting Groups in Organic Chemistry", 3"* edition, John Wiley and Sons, Inc., 1999. [0057] Compounds of the present invention can be conveniently prepared, or formed during the process of the invention, as solvates (e.g., hydrates). Hydrates of compounds of the present invention can be conveniently prepared by recrystallization from an aqueous/organic solvent mixture, using organic solvents such as dioxin, tetrahydrofuran or methanol. [0058] Compounds of the invention can be prepared as their individual stereoisomers by reacting a raceme mixture of the compound with an optically active resolving agent to form a pair of diastereoisomeric compounds, separating the diastereomers and recovering the optically pure enantiomers. While resolution of enantiomers can be carried out using covalent diastereomeric derivatives of the compounds of the invention, dissociable complexes are preferred (e.g., crystalline diastereomeric salts). Diastereomers have distinct physical properties (e.g., melting points, boiling points, solubility, reactivity, etc.) and can be readily separated by taking advantage of these dissimilarities. The diastereomers can be separated by chromatography, or preferably, by separation/resolution techniques based upon differences in solubility. The optically pure enantiomer is then recovered, along with the resolving agent, by any practical means that would not result in recombination. Resolution of file raceme mixture may be carried out using choral HPLC. A more detailed description of the techniques applicable to the resolution of stereoisomers of pompoms from their racemes mixture can be found in Jean Jacques, Andre Culet, Samuel H. Wiley, "Enantiomers, Race mates and Resolutions", John Wiley And Sons, Inc., 1981. [0059] In summary, the compounds of Formula I can be made by a process, which involves: [0060] (a) that of reaction scheme I; and [0061] (b) optionally converting a compound of the invention into a pharmaceutically acceptable salt; [0062] (c) optionally converting a salt form of a compound of the invention to a non-salt form; [0063] (d) optionally converting an unutilized form of a compound of the invention into a pharmaceutically acceptable N-oxide; [0064] (e) optionally converting an N-oxide form of a compound of the invention to its unutilized form; [0065J (f) optionally resolving an individual isomer of a compound of the invention from a mixture of isomers; [0066] (g) optionally converting a non-derivatives compound of the invention into a phannaceutically acceptable prod rug derivative; and [0067] (h) optionally converting a prod rug derivative of a compound of the invention to its non-derivative form. [0068] Insofar as tie production of the starting materials is not particularly described, the compounds are known or can be prepared analogously to methods known in the art or as disclosed in the Examples hereinafter. [0069] One of skill in the art will appreciate that the above transformations are only representative of moods for preparation of the compounds of the present invention, and that other well known methods can similarly be used. Examples [0070] The present invention is farther exemplified, but not limited, by the following examples that illustrate Hue preparation of compounds of Formula I according to the invention. [0071] One half of volume of a solution of KOH (1.06 mol) in 400 mL of Ethos is saturated with H2S. This solution is recombined with the other half of the KOH solution and the resulting solution is stirred under N2 at 45-50 °C before adding 4-chlorobenzotrichloride (0.25 mol) at a rate to keep the temperature at 50-60 °C (- 1,5 hours). The deep red mixture is refluxed for 30 minutes, then treated with a solution of chloroacetic acid (0.35 mol) and NaHCOs (0.35 mol) in H2O (200 mL). The reaction mixture is reheated under reflux for an additional 5 minutes. The resulting brownish-red solution is decanted from the sticky resin and acidified with concentrated Hal to pH == 1. The red solution on crystallization yields (4-chloro-thiobenzoylsulfanyO-acetic acid: H NMR (400 MHz, CDCI3): 5 7.75 (d, 2H), 7.15 (d, 2H), 4.04 (s, 2H). [0072] To a mixture of (4-chloro-thiobenzoylsuIfanyl)-acetic acid (8.31 mol) in 9 mL of Noah (IN) is added hydrazine hydrate (36.7 mL). Glacial acetic acid (2.7 mL) is then added to the solution and the mixture is vigorously stirred. The reaction mixture is diluted with CH2CI2 and the organic layer dried over MgS04 to yield 4-chloro-thiobenzoic acid hydrazine: LC/MS (ES") 186.9 (M+1) [0073] To a heterogeneous mixture of 4-chloro-thiobenzoic acid hydroxide (0.107 mol) in CH2CI2 (1 mL) is added 2-difluoromethoxy-benzaldehyde (0.128 mol) and DIEA (0.128 moll). After 10 minutes the mixture become homogenous and the reaction is complete by TLC and LCMS to give 5-(4-chloro-phenyl)-2-(2-difluoromethoxy-phenyI)-2,3- dihedron-[l ,3s4]thiadiazole which is used in the next step without evaporation of the solvent. [0074] To the solution of 5-(4-chloro-phenyl)-2"(2-difluoromethoxy"phenyI)-2,3- dihedral-[l,3,4]thiadiazole is added DEA (0.16 mol) and 2-fluorobenzoyl chloride (0.16 r moll) and the reaction mixture is stirred for 12 hours at room temperature. After evaporation of the solvent, the residue is purified by automated chromatography (hexane/Echoic) to give 5'( 4-chloro-phenvn-2'f2-difluoromethoxv-phenvlV [l,3,41thiadia2ol-3-vn-f2-fluoro-phenvlVmethanone: ^H NMR (400 MHz, CDCI3) 8 7.39-7.35 (m, IH), 734-7.29 (m, 4H), 7.25 (did, Jujus = 7.8 Hz, J2 =1.2 Hz, IH), 7.19-7.13 (m, 3H), 7.04 (m, IH), 6.97 (m. 2H), 6.50 (odd, // = 71.6 Hz, J2 = 71,2H2, IH). LC/MS: (ES") 462.8 (M+1)^ Example 2 2-l2-r5-r4-Chloro-phenvl)-3"(2.4,6-trifluoro-benzovn"2.3-dihvdro-ri,3,411faiadiazQl-2- viyphenoxvl -ace amide [0075] To a heterogeneous mixture of 4-chloro-thioben2oic acid hydroxide (1.3 inions) in 12 mL of CH2CI2 is added 2-(2-fonnylphenoxy)actinide (1.53 noon) and DIEA (1.53 moll). After 10 minutes the mixture become homogenous and the reaction is complete by TLC and LCMS to give 2-(2-(5-(4"Chlorophenyl)-2,3-dihydro-l,3,4-thiadia2ol-2-yl)phenotype)-actinide which is used as such in the next step without evaporation of the solvent. [0076] To the solution of 2-(2-(5-(4-chlorophenyI)-2,3-dihydro-l,3,4-thiadiazoI-2" eel)peony)ace amide is added DIEA (2,0 mol) and 2,4,6-tri-fluorobenzoyl chloride (2.0 mole) and the reaction mixture is stirred for 12 hours at room temperature. After evaporation of the solvent, the residue is purified by automated chromatography (hexane/Stoic) to give 242-r5-('4-chloro-phenvlV3-f2.4.6-trifluoro-benzovl)-2.3'-dihvdro4L3.41thiadiazol-2-vl> phenoxvl-acetamide: H NMR (400 MHz, CDCI3) 5 7.43 (s, IH), 7.27 (d, 7= 8.8, 2H), 7.15 (m, 2H), 7.14 (d, /- 8,4 Hz, 2H) 6.99 (bs, IH), 6.84 (t, J= 6.4 Hz, 3H), 6.66 (d, J = 8.4 Hz, IH), 6.53 (t, /= 8.0 Hz, 2H), 5.29 (bs, IH), 4.47 (d, J = 1.6 Hz. 2H); LC/MS: (ES" ) 506.2 (M+1 Example 3 2- (2-[5-f 4-Fluoro-nhenvlV3-f 2.4>6-trifluoro-benzovlV2,3-dihvdro-r 13.41thiadiazol-2- vlV6-methoxv-phenoxv -acetified [0077] To a solution of 4-fluorobenzoic acid (35.7 mol) in 72 niL of a mixture of DMF and THF (1:1), is added art-butyl carbonated (37.5 mmol), EDC (39.3 mmol) and N,N" dimethylaminopyridine (0.54 mmol). After 10 minutes the mixture becomes homogeneous and stirring is continued for 3 hours until the reaction is complete by TLC and LC/MS. The reaction mixture is poured into ice. Upon addition of diethyl ether the organic layer is separated. The organic layer is washed with sodium bisulfate, saturated sodium bicarbonate and saturated sodium chloride solution , dried over magnesium sulfate and concentrated to yield N'-(4-fluoro-benzoyl)-hydrazinecarboxyhc acid ear/-butyl ester: MS: (ES"*) 255 (ML)*. [0078] To a mixture of NH4-fluoro-benzoyI)-hydrazine carboxylic acid tert-hutyester (11.1 mmol) in 10 mL of dry THF is added Lawson’s reagent (11.6 mmol) and the mixture is heated in the microwave oven at 80 °C for 20 minutes The reaction mixture is concentrated and purified by automated column chromatography using hexanes/Etowah: ^H NMR (400 MHz, CDCI3) 8 9.8 (bs, IH). 9.05 (bs, IH); 8.0-7.97 (m, 2H), 7.31 (t, 7- 8.4H2, 2H), 1.73 (s, 9H). LC/MS: (ES 271 (M+1 [0079] Trifluoroacetic salt. To a solution of N*-(4-fluoro-thiobenzoyl)- hydrazine carboxylic acid tert-hutyl ester (1.97 mmol) in CH2CI2 is added trifluoroacetic acid (3 mL) and thioanisole (2.7 mmol). The mixture is stirred at room temperature for 1 hour. After evaporation of the solvent the mixture is purified by automated column chromatography (hexanes/Teac) to yield 4-fluoro-thioben2oic acid hydroxide trifluoroacetic acid salt: 'H NMR (400 MHz, CDCI3) 6 9.5 (bs, 3H), 7.8-7.76 (m, 2H), 7.05 (t, 7= 8.4 Hz, 2H); LC/MS: (ES^ 171 (M+1) [0080] Hydrochloride salt. To N*-(4-fluoro-thiobenzoyl)-hydrazine carboxylic acid tert'hntyl ester (18.5 mimeo) is added Hal (4 N) in 1,4-dioxane (185 mmol). The mixture is stirred at room temperature for 1 hour. Hexanes is added to further precipitate the product. The product is filtered off yielding 4-fluoro-thiobenzoic acid hydrazine hydrochloride salt: 'H NMR (400 MHz, CH3OP) 5 7.8 - 7.75 (m, 2H), 7.09 (t, / = 11.6 Hz, 2H). LC/MS: (ES^ 171 (M+l)". Preparation of 3-methoxv-2-tnisopropvlsilanvloxv-benzaIdehvde [0081] 0-vanillin (26.3 mmol) is mixed with TIPSCI (39.6 mmol) and imidazole (78.7 mmol) in a microwave vessel. The mixture is heated in the microwave at 100 "C for 3 minutes. The oily mixture is diluted with Teac (100 mL) and washed with NaHS04 (1 M) (2x50 mL) and brine (50 mL). After drying with MgS04, the filtrate is concentrated. The resultant crude mixture is purified by silica flash chromatography (2% Teac/hexane) to yield 3-methoxy-2-triisopropylsilanyloxy-benzaldehyde as an oil: 'H NMR (400 MHz, CDCI3) 5 10.6 (s, IH), 7.38 (did, J; = 1.6 Hz, J^ - 8 Hz, IH), 7.04 (odd, Juju = 1.6 Hz, /j? = 8 Hz, IH), 6.93 (td, /; = 8 Hz, 72 = 0.8 Hz, IH), 3.82 (s, 3H), 1.34-1,25 (m, 3H), 1.1 (s, 18H); LC/MS (ES"^: 309 (M+l)"". [0082] To a heterogeneous mixture of 4-fluoro-thiobenzoic acid hydroxide salt (2.06 mmol) in 8 mL of CH2CI2 is added 3-methoxy-2-triisopropylsilanyloxy-benzaldehyde (2.27 mmol) and DIEA (4.13 mmol). After 15 minutes the mixture becomes homogenous and the reaction is complete by TLC and LCMS to give 5-(4-fluoro-phenyl)-2-(3-methoxy-2- triisopropylsilanyloxy-phenyl)-2,3-dihydro-[l,3,4]thiadiazole which is used in the next step without evaporation of the solvent. ' [0083] To the solution of 5-(4"fluoro-phenyl)-2-(3-methoxy"2-triisopropylsilanyloxy- phenyl)-2,3-dihydrO"[l,3,4]thiadiazole is added DIEA (3.09 mmol) and 2,4,6-tri- fluorobenzoyl chloride (3.09 mmol) and the reaction mixture is stirred for 12 hours at room temperature. After concentration, the residue is pxirified by automated column chromatography (hexane/Teac) to yield [5-(4-fluoro-phenyl)-2-(3-methoxy-2- triisopropylsilanyloxy-phenyl)"[l,3,4]thiadiazol-3-yl]-(2,4,6-trifluoro-phenyl)-methadone. [0084] To [5"(4-fluoro-phenyl)-2-(3-methoxy-2-triisopropylsilanyloxy-phenyI)- [l,3,4]thiadiazol-3-yl]-(2,4,6-ttifluoro-phenyl)-methadone (32.3 moil) is added tetrabutylammonium fluoride in tetrahydrofuran (1 M) (48.5 /idol). The mixture is stirred for an hour and 2-brdmo-acetamide (48.5 jumbo) is added. The mixture is stirred at room temperature for 12 hours. After evocation of the solvent the residue is purified by preparative LC/MS (20-100 % MeCHSf/HaO) to give 2-{2-r5-f4-fluoro-phenvlV3-(2.4.6-trifluoro-ben20vlV2.3-dihvdro-ri3.41thiadiazol-2-vn-6-methoxv-phenoxv)-ace amide: H NMR (400 MHz, CDCI3): 5 7.63-7.62 (m, 2H), 7.57 (s, IH), 7.22-7.12 (m, 3H), 7.02 (odd, Jj = 8.4Hz, J2 = 2Hz, 2H), 6.9 (bs, IH), 6.85 (t, J- 8.4Hz, 2H), 6.10 (s, IH), 4.83 (d, 7= 15.2 Hz, IH), 4.68 (d, 7= 15.2 Hz, IH), 3.94 (s, 3H). Example 4 3-(3-r5-r4-Fluoro-phenvn-3-f2.4,6-trifluoro-benzovlV23-dihvdro-rL3.41thiadia2ol-2-vl]-2 methoxv-phenoxvmethvl)-benzoic acid methyl ester [0085] Guaiacum (2-methoxy-phenol, 34.6 mmol) is mixed with Tipsily (51.9 knoll) and imidazole (103.8 manhole) in a tube. The mixture is heated in the microwave oven at 180 °C for 3 minutes. The oily mixture is diluted with Etowah (100 anal) and washed with NaHS04 (1 M) (2x50 mL) and brine (50 mL). After drying over anhydrous NAACO, the filtrate is concentrated. The resultant cede mixture is purified by silica flash chromatography (2 % Stoic/hexane) to yield triisopropyl-(2-methoxy-phenoxy)-silage as a colorless oil. Yield: 69%. 1H NMR (400 MHz, CDCI3) 5 6.8-6.89 (m, 4H), 3.8 (s, 3H), 1.22-1.28 (m, 3H), 1.1 (s, 9H), 1.08 (s, 9H). LC/MS (ES^^: (M+1), 281.2. Ruff = 0.8 (5 % Teac/hexane). (Note: Alternatively, conventional heating might be adopted in which case NMP is the solvent of choice). [0086] nubile (2.5 M in hexanes) (36 mmol) is mixed with TMEDA (36 mmol) at 0 °C in a dry round bottom flask for 10 minutes. A solution of triisopropyl-(2"methoxy- peony)-silage (24 mmol) in 25 mL of dry TEIF is added to the above mixture. The mixture is warmed up to room temperature in 2 hours by removal of the ice bath. The slightly yellow solution is then transferred to another dry flask containing dry 7.5 mL of DMF at room temperature. The mixture is stirred vomit. Hal (1 M) is added to the mixture to quench the reaction. The mixture is diluted with Teac (100 mL), washed with Hal (1 M) (2X100 mL) and brine (50 mL) and finally dried over anhydrous NAACO Purification is accomplished by silica flash chromatography (5 % Etowah/hexane) to yield 3-methoxy-2- triisopropylsilanyloxy-benzaldehyde as a colorless oil which needs to be stored at low temperatures: 'H NMR (400 MHz, CDCI3) 5 10.4 (s, IH), 7.42 (did, J; = 7.7 Hz, J2 = 1.7 Hz, IH), 7.67 (d, Joy = 8 Hz, Jib - 1.7 Hz, IH), 7.04 (t, /= 8.4 Hz, IH), 3.96 (s, 3H), 1.26-1.35 (m, 3H), 1.13 (s, 9H), 1.12 (s, 9H). LC/MS (ES" : (M+1) 309.2. Ruff = 0,4 (5 % Etowah/hexane). [0087] N'-(4-fluoro-thiobenzoyI)-hydrazinecarboxyHc acid tert-bntyl ester (1.23 mmol) is dissolved in 5 mL of CH2CI2 at room temperature in a dry round bottom flask. Removal of the ester group is accomplished adding TFA (2 mL) to the solution at room temperature. The reaction is complete after 30 minutes as determined by LC/MS. Solvent is removed in vacuums. The resultant oil is dried on the vacuum line for 30 minutes and dissolved in 1 mL of dry CH2CI2. This solution is added to a mixture of 3-methoxy-2'^ triisopropylsilanyloxy-benzaldehyde (1.23 mmol) and DIEA (4.9 mmol) in 1 mL of dry CH2C12. The mixture is allowed to stand at room temperature in the presence of molecular sieves for 5 minutes. 2,4,6-Trifluoroben2oyl chloride (1.6 mmol) is added and the reaction mixture is kept at room temperature for 16 hours. HCI (1 M) (10 mL) is added to the mixture to quench the reaction. The mixture is diluted with Etowah (50 mL), washed with HCI (1 M) (2X10 mL) and brine (50 mL) and dried over anhydrous Na2S04. Purification is accomplished by silica flash chromatography (5 % Stoic/hexane) to give [5-(4-fluoro- phenyl)-2-(2-methoxy-3"triisopropylsilanyloxy-phenyl)-[l,354]thiadiazol-3-yl]"(2,4,6- triflers-phenyl)-methanone as a colorless oil: ^H NMR (400 MHz, CDCI3) 8 7.54 (dd, J8.8 Hz, J2 = 5.3 Hz, 2H), 7.51 (s, IH), 7.04 (t, J= 8.6 Hz, 2H), 6.95 (t, J= 7.8 Hz, IH), 6.87 (t, /- 8.8 Hz, 2H), 6.77 (t, 7= 7.9 Hz, 2H), 4.03 (s, 3H), 1.27-1.36 (m, 3H), 1.14 (dd, 7/ -/; = 6.3 Hz, 18H); LC/MS (ES^^: (M+1) 309.2. Rf = 0.4 (5 % Stoic/hexanes). [0088] [5-(4-fluoro-phenyl)-2-(2-methoxy-3-triisopropylsilanyloxy-phenyl)- [1,3,4]thiadiazol"3-yl]-(2,4,6-trifluoro-phenyl)-methanone (0.02 mmol) is treated with tetrabutylammonium fluoride (1 M in THF) (0.04 mmol) at room temperature for 30 minutes. 3-Broraomethyl-benzoic acid methyl ester (0.04 mmol) is then added.. After 30 minutes, the reaction is complete as determined by LC/MS. The mixture is diluted with acetonitrile and purified by preparative LC/MS (20-100 % MeCN/H20) to give 3-(3-r5-f4-fluoro-phenvn-3-(2,4.6-trifluoro-benzovlV2,3-dihvdro-|"L3,41thiadiazol-2-vl]-2-methoxv-phenoxvmetfavU-benzoic acid methyl ester as white sound after evaporation of solvent: 'H NMR (400 MHz, CDCI3) 5 8.14 (s, IH), 8.02 (d, 7= 7.8 Hz, IH), 7.67 (d, J= 7.7 Hz, IH), 7.47-7.55 (m, 4H), 7.01-7.07 (m, 3H), 6.94 (t, 7= 8.3 Hz, 2H), 6.77 (t, J= 8.5 Hz, 2H), 5.16 (s, 2H), 4.07 (s, 3H), 3.94 (s, 3H). LC/MS (BS^: (M+1) 610.9. Example 5 4-(3-[S-f4-Fluoro-phenvlV3-f2,4.6-trifluoro-benzovl)-23-dihvdro-('13.41tiiiadiazol-2-vl1- 2-methoxv-phenoxvmethvl>-benzoic acid [0089] [5-(4-fluoro-phenyl)-2-(2-inethoxy-3-triisopropylsilanyloxy-phenyl)- [l,3,4]thiadiazol-3-yl]-(2,4,6-trifluoro-phenyl)-methanone (0.02 mmol) is treated with tetrabutylammonium fluoride (1.0 M in THF) (0.04 annul) at room temperature for 30 minutes. The reaction is complete by LC/MS analysis. 4-Bromomethyl-benzoic acid methyl ester (0.04 mmol) is added, After 30 minutes, the reaction is complete as determined by LC/MS. After dilution with Meow (0.5 mL), Lion (1 M) (0.5 mL) is added. After stirring for 1 hour, the solvent is removed from the reaction mixture. A mixture of Mooch/DMSO is added to the residue and resultant solution is filtered. The clear solution is purified by preparative LC/MS (20-100 % MeCN/HaO) to give 4-l3-f5-f4-fluoro-phenvlV3-f2,4.6-trifluoro-benzovlV2.3-dihvdro-rL3.4")thiadiazol-2-vll-2-methoxv-phenoxvmethvU-benzoic acid as white solid after removal of solvent: H NMR (400 MHz, CDCI3) 6 8.14 (d. J= 8 Hz, 2H), 7.53-7.58 (m, 5H), 7.03-7.05 (m, 3H), 6,94-6.95 (m, 2H), 6.77 (t, J- 8.2 Hz, 2H), 5.2 (s, 2H), 4.08 (s, 3H); LC/MS (ES^: (M+1) 597.3. Example 6 2-(2-[5-(4-Chloro-phenvn-3-f2,4.6-trifluoro-benzovlV2.3-dihvdro-ri.3,4]thiadiazol-2- vile]-phenoxv> -N-methvl-acetamide [0090] (2-Fonnyl-phenoxy)-acetic acid (0.5 girasol) is dissolved in 1 mL of CH2CI2. Oxalis chloride (0.066 mL) is added along with one drop of DMF, After 1 hour, the solvent , is removed from the mixture. The resultant residue is dissolved in 1 mL of CH2CI2 and added to 1 mL of NHaMe in THF (2 M) at ambient temperature. After 16 hours of stirring, the solvent is removed and the mixture is purified by preparative TLC (10 % MeOH/EtOAc) to yield the product 2-(2-formyl-phenoxy)-N-methyl-catamite as an off white sound; LC/MS (ES^: 194.1 (M+l) [0091] The 2-(2-formyl-phenoxy)-N-methyl-acetanilide (0.0311 mmol) is added to 4- chloro-thiobenzoic acid hydrazine (0.0342 mmol) in 0.1 mL of CH2CI2. After 10 minutes, DIEA (0.05 mL) and 2,4,6-trifluoro-benzoyl chloride (0.0467 mmol) are added. The mixture is kept at room traiperature overnight. After removal of solvent, the residue is purified by preparative HPLC (20-100% MeCN/H20 gradient) to give the product 2-l2-['5-f4-chloro-phenvn-3-f2,4,6-trifluoro-benzovl)-2.3-dihvdro-[1.3.4]thiadiazol-2-vll-phenoxvl-N-methvl-acetamide as an off white sound: LC/MS (ES^: 520.1 Alf. Example 7 N-Cvclopropvlmethvl-2-l3-f5-(4-fluoro-phenvlV3"(2,4,6"trifluoro-benzovlV23-dihvdro- [ 1,3.4'|thiadiazol-2-vll ■■2-methoxv-phenoxvl- -ace amide [0092] [5-(4-fluoro-phenyl)-2-(2-methoxy-3-triisopropylsilanyloxy-phenyl)- [l,3,4]thiadiazol-3-yI]-(2,4,6-trifluoro-phenyI)-methanone (3.31 mmol), prepared as described in example 4, is treated with tetrabutylammonitim fluoride (I M in THF) (4.97 mmol) at room temperature for 40 minutes. Methyl bromoacetate (4.97 mmol) is then added. After 12 hours, the reaction is complete as determined by LC/MS. Purification is accomplished by silica flash chromatography (25 % Etowah/hexane) to give {3-[5-(4-fluoro-phenyI)-3-(2,4,6-trifluoro-benzoyl)-2,3-dihydro-[l,3j4]thiadiazol-2"yl]-2-methoxy-phenoxy}-acetic acid methyl ester: ^H NMR (400 MHz, CDCI3) 6 7.52 (m, 3H), 7.04 (m, 3H), 6.95 (dd, Jig = 8.4 Hz, J2 =1.6 Hz, IH), 6.82 (dd, 7/ = 8 Hz, J2 =1.6 Hz), 6.76 (m, 2H), 4.7 (s, 2H), 4.1, (s, 3H); LC/MS (ES^): 505.1 (M+1) [0093] To a solution of {3-[5-(4-fluoro-phenyl)-3-(2,4,6-trifluoro-benzoyI)-2,3- dihedral-[l,3,4]thiadiazol-2-yI]-2-methoxy-phenoxy}"acetic acid methyl ester (2.47 mmol) in 30 mL of a mixture of THF and Mesh (3:2), is added Lion (1 M) (25 awl). After stirring for 12 hours the reaction is complete as determined by LC/MS. The reaction is diluted with ethyl acetate and water, washed with brine and dried over MgS04 and the solvent is removed from the reaction mixture to yield {3"[5-(4-fluoro-phenyl)-3-(2,4,6-trifluoro-benzoyI)-2,3-dihydro- [l,3,4]thiadiazol-2-yl]-2-methoxy-phenoxy}-acetic acid: LC/MS (ES"^: 521.1(M+1)'^. [0094] To a solution of {3-[5-(4-fluoro-phenyl)-3-(2,4,6-trifluoro-benzoyl)-2,3- dihedron-[l,3,4]thiadiazol-2-yl]-2-methoxy-phenoxy)-acetic acid (0.029 mmol) in 1 mL of DMF is added DIEA (0.058 mmol), HATU (0.058 mmol) and cyclopropyl methylamine (0.058 mmol). The reaction mixture is stirred for 12 hours. The mixture is purified by preparative LC/MS (20-100 % MeCN/HaO) to give N-cvclopropvlmethvl-2-(3-r5-f4-fluoro-phenvn3-f2,4.6-trifluoro-benzovD"2,3-dihvdro-rL3.41thiadiazol-2-vl]-2-methoxv-phenoxv-acetamide: *H NMR (400 MHz, CDCU) 5 7.55-7.51 (m, 3H), 7.12 - 6.99 (m, 4H), 6S (d, J = 7.6 Hz, 2H), 6.77 (t, J = 8.4 Hz, 2H), 4.56 (s, 2H), 4.08 (s, 3H), 3.26-3.2 (m, 2Ii), 1.02-^0.99 (m, IH), 0.57-0.52 (m, 2H), 0.25 (m, 2H); LC/MS (ES^: 574.1 (M+l)"". Example 8 2-l2-r5-f4-FluoTO-phenvlV3-f2,4,6-1rifluoro-benzovlV23-dihvdro-fL3,41thiadi^^^ vlVphenoxv\-N-f5-inethvl-isoxazol--3-vIVacetainide [0095] [5-(4-Fluoro-phenyl)-2-(2-triisopropylsilanyloxy-phenyl)-[l,3,4]thiadia2ol-3- eel]-(2,4,6-trifluoro-phenyl)-methadone (3.4 mmol), prepared in a similar manner as described for [5-(4-fluoro-phenyl)-2-(3-methoxy-2-triisopropylsilanyloxy-phenyl)-[l,3,4]thiadiazol-3-yl]-(2,4,6-trifluoro-phenyl)"methanone in example 3, is treated with tetrabutylaramonium fluoride (1.0 M in THF) (5.1 mmol) at room temperature for 40 minutes. Methyl bromoacetate (5.1 mmol) is then added After 12 hours, the reaction is complete as determined by LC/MS. Purification is accomplished by silica flash chromatography (25% Teac/hexane) to give {2-[5-(4-fluorO"phenyl)-3-(2,4,6-trifluoro-bKizoyl)-2,3-dihydro-[l,3,4]thiadiazol-2-yl]-phoenix}"acetic acid methyl ester: H NMR (400 MHz, CDCI3) 8 7.61 (s, IH), 7.54 (m, 2H), 7.04 (m, 3H), 7.01 (d, /= 8.4 Hz, IH) 6.95 (bs, 2H), 4,94 (s, 2H), 4.01 (s, 3H). MS: (ES 535.1 (M+1); LC/MS (ES^: 535.1 (M+l)"". [0096] To a solution of {2-[5-(4-fluorO"phenyl)-3-(2,4,6-trifluoro-benzoyI)"2,3- dihedral-[l,3,4]thiadiazol-2-yI]-phooey}-acetic acid methyl ester (2.93 mmol) in 30 mL of a mixture of THF and Mesh (3:2), is added Loin (1 M) (30 mL). After stirring for 12 hours the reaction is complete as determined by LC/MS. The reaction is diluted with ethyl acetate and water, washed with brine and dried over MgS04 and the solvent is removed from the reaction mixture to yield {2-[5-(4-Fluoro-phenyI)-3-(2,4,6-trifluoro-benzoyl)-2,3-dihydro- [l,3,4]thiadiazol-2-yl3-phenoxy}-acetic acid: ^H NMR (400 MHz, acetone-dg) 5 7.66 (m, 3H), 7.39 (m, IE), 7.3 (dd, Juju = 7.6Hz, J2 = 1.6Hz, IH), 7.22 (m, 4H), 7.13 (m, IH), 7.07 (t, /- 7.6Hz, IH), 4.94 (s, 2H); LC/MS (ES"): 491.0 Quail)[0097] To a solution of {2-[5-(4-fluoro-phenyl)-3-(2,4,6-trifluoro-benzoyl)-2,3- dihedron-[l,3,4]thiadiazol-2-yI]-phenotype}-acetic acid (0.031 mmol) in DMF (1 mL) is added DIEA (0.058 mmol), HATU (0.058 mmol) and 5-methyl-isoxazol-3-ylamine (0.058 mmol). The reaction mixture is stirred for 12 hours. The mixture is purified by preparative LC/MS (20-100% MeCN/HaO) to |give 2- l2-r5-(4-fluoro-t?henvlV3-r2.4.6-trifluoro-ben2ovn-2.3-dihvdrO'[l,3.41thiadiazol-2-vlVphenoxvi-N-f5-methvI-isoxazol-3-vlVacetamide: ^H NMR (400 MHz, CDCI3) 5 7.55-7.51 (m, 3H), 7.35-7.26 (m, 2H), 7.05-6.96 (m, 3H), 6.85 (d, 7 = 8 Hz, IH), 6,69 (t, / - 7.6 Hz. 2H). 6.56 (s, IH), 4.72 (s, 2H), 2.33 (s, 3H); LC/MS (ES^: 571.1 (M+1)"*". Example 9 3,|2-rS-f4-Fluoro-T)henvlV3-f2.4.6"trifluoro-benzovIV2,3-dihvdro-ri-3,41thiadia2ol-2- vll-phenoxvmethvU -Benz amide [0098] [5-(4-Fluoro-phenyI)-2-(2-triisopropylsilanyloxy-phenyl)-[l,3,4]thiadiazoI-3- eel]-(2,4,6-trifluoro-phenyl)-methanone (41 /imol), prepared in a similar manner as described for [5-(4-fluoro-phenyl)-2-(3-methoxy-2-triisopropylsilanyloxy-phenyI)"[l,3,4]thiadiazol-3-yl]-(2,4,6-trifluoro-phenyl)-methanone in example 3, is treated with tetrabutylammonium fluoride (1.0 M in THF) (48 /imol) at room temperature for 40 minutes. Tiles solvent is removed in vacuums and dried over MgS04 to yield [5-(4"fluoro-phenyl)-2-(2-hydroxy-phenyI)- [1,3,4]thiadiazol-3-yI]-(2,4,6-txifluoro-phenyl)-methanone to be used without further purification. [0099] To [5-(4-fluoro-phenyl)-2-(2-hydroxy-phenyl)-[l,3,4]thiadiazol-3"yl]-(2,4,6- trifler-phenyl)-methanone (41) dissolved in acetonitrile (1 mL) is added K2CO3 (61.5 /imol) and S-bromomethyl-benzamide (94.2 ^mol) and the mixture is heated at 90'C. After 12 hours, the reaction is complete as determined by LC/MS. Purification is accomplished by preparative LC/MS (20-100 % MeCN/H20) to give 3-(2-r5-f4-fluoro-phenvn-3-r2.46-trifluoro-benzovn-23-dihvdro-ri.3,4')thiadiazol-2-vn-T3heDOXvmethvU-ben2aniide: *H NMR (400 MHz, Cached) 8 8.09 (s, IH), 7.9 (d, 7- 7.6H2, IH), 7.7 (s, IH), 7.6-7.5 (m, 4H) 7.35 (d, J= 7.6Hz, IH), 7.06 (t, J = 8.4H2, IH), 6.99 (t, 7= 7.6Hz, 2H), 6.88 (d, /= 8Hz), 6.79 (t, J= 8.4Hz, 2H), 6.26 (bs, IH), 5.33 (d, 7 = 7.6Hz); LC/MS (ES^): 566.1 (M4-l)^, Example 10 2-(2-f5f4-Fluoro-t)henvlV3-f2,4.6--trifluoro-ben2ovlV23-dihvdro-riJ41fliiadiazol-2-v^^ phenoxvmethvU"fiiTan-3-carboxvlic acid [00100] [5-(4-Fluoro-phenyl)-2-(2-triisopropylsilanyloxy-phenyl)-[l,3,4]thiadia2ol-3- yo]-(2,4,6-trifluoro-phenyl)-methanone (0.67 mmol), prepared as described for [5-(4-fluoro- phenyl)-2-(3-methoxy-2-triisopropylsilanyloxy-phenyl)-[l,3,4]thiadiazol-3-yl]-(2,4,6-trifluoro-phenyl)-methanone in example 3, is treated with tetrabutylammonium fluoride (1.0 M in THF) (1.3 mmol) at room temperature. Aster 15 minutes, methyl 2-(bromomethyl)-3-fiiroate (0.74 mmol) is added and the mixture is stirred for an additional 12 hours. The solvent is removed in vacuums and the residue is purified on silica to yield 2-{2-[5(4-fluoro- phenyl)"3"(2,4,6"trifluoro-ben2oyl)--23-dihydro-[13,4]thiadiazol"2-yl]-peen furan-3-carboxylic acid methyl ester as a yellow solid: LC/MS (ES"*^: 571.1 (M+l)" [00101] To a solution of 2-{2-[5(4-fluoro-phenyl)-.3-(2,4,6-trifluoro-benzoyl)-2,3- dihedral-[l,3,4]thiadiazol-2-yl]-phenoxymethyl}-foran-3-carboxylic acid methyl ester (0.49 mmol) in THF/MeOH/HaO (3:2:1), is added Lion (3 N) (4.9 mmol). After stirring for 12 hours, the reaction is acidified with HCI (1 N) and extracted within ethyl acetate. The organic layer is dried over MgS04, filtered, and concentrated. The residue is purified using preparative LC/MS to give 2-l2-[5(4-fluoro-phenvlV3"f2,4,6-trifluoro-benzovlV2.3-dihvdro-[l,3.4tthiadiazol-2-vll-phenoxvmethvU-ftiran-3-carboxvIic acid as a white solid: ^H NMR (400 MHz, CDCI3) 5 7.26-7.23 (m, 3H), 7.20 (d, J=1.9, IH), 7.10-7.05 (m, IH), 7.03-6.99 (m, IH), 6.86 (d, /=8.1, IH), 6.78-6.74 (m, 3H), 6.55 (d, J=1.9, IH), 6.55-6.50 (m, 2H), 5.38-5.21 (m, 2H); LC/MS (ES^^: 557.1 (M+l)"^. Example 11 r2-f2-Difluoroniethoxv-phenvlV5-r6-nietfavl-Pvridm-3-vn-ri.3,41thiadiazol-3-vl1-f2.4.6- trifluoro-phenvlVmethanone [00102] N -(6-Methyl-pyridine-3-carbothioyl)-hydrazinecarboxylc acid fruity ester (0.1 noon) prepared as described in example 3 for N -(4-fluoro-benzoyl)-hydrazine carboxylic acid art-butyl ester, is treated with TFA (1 mmol) in dry CH2CI2 (1 mL) at room temperature for 30 minutes. Solvent is removed and the residue is dissolved in dry CH2CI2 (1 mL). DIEA (0.287 mmol) is added to the solution and the mixture is treated with 2-difluoromethoxy-benzaldehyde (0.12 mmol) in the presence of 4 A molecular sieves. 2,4,6-Trifluorobenzoyl chloride (0.15 oriole) is added after 5 minutes. The mixture is kept at ambient temperature for 16 hours and purified by preparative HPLC (20-100 % MeCN/H20) to yield r2-f2-diJauoromethoxv-phenvlV5-f6-methvl-pvridin-3-vIVf'13.41thiadiazol-3--vl'|-r2.4.6-trifluorD-pheDvlVmethanoneH NMR (400 MHz, Koch) 8,71 (d, J = 2.1 Hz, IH), 7.81 (dd, /i = 8.2 Hz, J2 = 2.2 Hz, IH), 7.53 (s, IH), 7.36-7.4 (m, 2H), 7.26 (d, 7= 8.1 Hz, 2H), 7.18 (d, J= 8,3 Hz, IH), 6.78 (t, J= 8.3 Hz, 2H), 6.67 (dd, /i = 75.0 Hz, J2 = 71.7 Hz, IH), 2.64 (s, 3H); LCTMS (ES): (M+1) 480.1. Example 12 r2-(2-Kfluoromethoxv-phenvlV5-f6"methvl-pvridin-3-vIV[13.4]lMadiazol-3-vl]-r2- hvdroxv-phenvlVmethanone [00103] (2-(2-(Difluoromethoxy)plainly)-5-(6-methylpyridin"3-yl)-l,3,4-thiadiazol- 3(2jE0-yI)(2-acetoxyptienyI)methanon6 (0.02 mmol) prepared in a similar manner as described in experiment 11 for [2-(2-difluoromethoxy-phenyl)-5-(6-methyl-pyridin"3-yI)-[l,3,4]thiadiazol-3-ylH2,4,6-trifluoro-phenyl)-methanone, is dissolved in THF/Mesh (1 mL/0.5 mL) and treated with aqueous Leo (1 M) (0.5 mL) at room temperature for 30 minutes. Aqueous Hal (3 M) is added to adjust the pH to 5-6. Solvent is removed and the residue is purified by preparative HPLC (20-100 % MeCN/H20) to yield [•2-(2-difluoromethoxv-phenvlV5-(6-methvl-Pvridin-3-vlVri,3.41thiadiazoI-3-vl]-f2-favdroxv-phenvn-metfaanone: *H NMR (400 MHz, CDCI3) 9.02 (d, J = 2.0 Hz, IH), 8.41 (d, J = 8.6 Hz, IH), 8.23 (dd, A = 8,2 Hz, J2 = 2.2 Hz, IH), 7.77 (d, J^ 7.5 Hz, IH), 7.65 (s, IH), 7.62 (dd, /] - 7.8 Hz, J2 = 1.3 Hz, IH), 7.45-7.53 (m, 5H), 6.97-7.01 (m, 2H), 2.79 (s, 3H); LC/MS(ES'^: (M+1) 442.1. Example 13 [2-r2-Difluoromethoxv-phenvlV5>r6-fluoro-pvridin-3-vlVri3.41thiadi^^ triflTioro-phenvn-methanone [00104] N-(6-fluoro-pyridine-3-carbothioyl)-hydrazine carboxylic acid ear/-butyl ester (0,044 annul) prepared as described in example 3 for N'-(4-fluoro-benzoyl)-hydrazine carboxylic acid tent-butyl ester, is treated with TFA (0.44 mmol) and thioanisole (0,44 mmol) in dry Cha-Cha (1 mL) at room temperature for 30 minutes. The solvent is removed and the residue is dissolved in dry CH2CI2 (1 mL), DIEA (0.22 mmol) is added to the solution and the mixture is treated with 2-difluoromethoxy-ben2aldehyde (0.067 mmol) in the presence of 4 A molecular sieves. 2,4,6-Trifluorobenzoyl chloride (0.089 mmol) is added after 5 minutes. The mixture is kept at room temperature for 16 hours and purified by preparative silica gel TLC (30% Etowah/hexane) to yield ["2-f2-difluoromethoxV"phenvn-5-(6-fluoro-pvridin-3-vl)-ri.3.41thiadiazol"3-vlVf2.4.6-trifluoro-phenvl)-methanone: 1H NMR (400 MHz, CDCI3) 8.39 (s, IH), 7.93-7,97 (m, IH), 7.54 (s, IH), 7.37-7.41 (m, 2H), 7.24-7.27 (m, IH), 7.19 (d, /= 8.1 Hz, IH), 6.97 (dd, ^i - 8.6 Hz, Jazz = 2.7 Hz, IH), 6.78 (t, 7= 8.3 Hz, 2H), 6,67 (dd, Ji - 75.0 Hz, J2 = 71.7 Hz, IH); LC/MS (ES^: (M+1) 484.1. Example 14 3-l4-r5-r3.4-Difluoro-phenvI)-3-r2,4.6-trifluoro-ben2ovn-2,3-dihvdro-rL3.41thiadiazQl- 2-vl]-benzooxazol-2-vU-benzoic acid [00105] 2-Amiino-3-methyl-phenol (6.09 mmol) is heated with 3-fonnyl-benzoic acid methyl ester (6.09 mmol) in Mesh (6 mL) at 60 **C for 30 minutes. The solvent is removed from the mixture to obtain a dark red oil which is dissolved in dry CH2CI2 (6 mL) at room temperature and treated with DDQ (6.4 mmol) for 16 hours. The mixture is diluted with Teac and poured onto saturated aqueous NaHCOs. The aqueous phase is further extracted with Etna and the combined organic phases are dried over Na2S04. Filtration and removal of the solvent yields a residue which is purified by silica gel chromatography (5-10 % Teac/hexane) to yield 3-(4--methyl-benzooxazol-2-yI)-benzoic acid methyl ester as a white solid: ^H NMR (400 MHz, CDCI3) 8.92 (d, J= 1.6 Hz, IH), 8.47 (dot, Ox = 7.8 Hz, J2 « 1-5 Hz, IH), 8.2 (dot, Jig = 7.8 Hz, Juju = 1.4 Hz, IH), 7,61 (t, 7- 7.9 Hz, IH), 7.43 (d, /= 8.1 Hz, IH), 7.27 (t, J= 7.7 Hz, IH), 7.17 (t, 7= 7.5 Hz, IH), 3.99 (s, 3H), 2.69 (s, 3H); LCMS (ES"*):(M+1) 268.1. [00106] A solution of 3-(4-methyl"benzooxazol-2-yl)-benzoic acid methyl ester (1.2 mmol), N-broom succinimide (1.5 mmol) and AIBN (0.3 name) in CCI4 are heated in microwave at 100 °C for 30 minutes (1 mL). The mixture is filtered and concentrated to yield the crude 3-(4-bromomethyl-benzooxazol-2-yl)-benzoic acid methyl ester. LC/MS (ES"*"): (M^ 346.1,348.1, (M-Br) 266.1, 268.1. [00107] The crude 3-(4-bromomethyl-benzooxazol-2-yl)-ben2oic acid methyl ester is treated with HMTA (1.8 mmol) in acetic acid/H20 (3 mL/1.5 mL) in a microwave oven at 130 for 20 minutes. The solvent is removed and the mixture is purified by since gel chromatography (10-20 % Stoic/hexane) to yield 3"(4-fonnyl-benzooxazol-2-yl)-benzoic acid methyl ester as a white solid. Yield: 32%. H2>JMR (400 MHz, CDCI3) 10.8 (s, IH), 8.97 (s, IH), 8.53 (d, J = 7.8 Hz, IH), 8.26 (d, J - 7.8 Hz, IH), 7.94 (dd, Ox - 7.7 Hz, A = 1 Hz, IH), 7.86 (d, y = 8.1 Hz, IH), 7.66 (t, J= 7.8 Hz, IH), 7.51 (t, J= 7.9 Hz, IH), 4.0 (s, 3H). LC/MS (ES^: (M+I) 282.1, (Mane) 304.1. [00108] N'-(3,4-Difluoro-thiobenzoyl)-hydrazine carboxylic acid far butyl ester (0.1 mmol) prepared as described in example 3 for N'-(4-fluoro-beiizoyl)-hydrazine carboxylic acid fret-butyl ester, is treated with TFA (1 remold) in dry CH2CI2 (1 mL) at room temperature for 30 minutes. Solvent is removed and the residue is dissolved in dry CH2CI2 (1 mL). DIEA (0.57 mmol) is added to the solution and the mixture is treated with 3-(4-formyl-benzooxazol- 2-yl)-benzoic acid methyl ester (0.064 mmol) in the presence of 4 A molecular sieves. 2,4,6- Trifluorobenzoyl chloride (0.15 mmol) is added after 5 minutes. The mixture is kept at room temperature for 16 hours and purified by preparative HPLC (20-100 % MeCN/H20) to yield 3-{4-[5-(3,4-difluoro-phenyl)-3-(2,4,6-trifluoro-benzoyl)-2,3"dihydro-[l,3,4]thiadiazol-2-yI]- benzoo xazol-2-yl}-benzoic acid methyl ester. LC/MS (ES"^: (M+1) 610.0, (Mona) 632.0. [00109] 3-{4-[5-(3,4-Difluoro-phenyl)-3-(2,4,6-trifluoro-benzoyl)-2,3-dihydro- [l,3,4]thiadiazol-2-yl]-benzooxazol-2-yl}-benzoic acid methyl ester (0.02 mmol) is dissolved in THF/Mesh (1 mL/0.5 mL) and treated with aqueous Leo (1 M) (0.5 mL) at room temperature for 30 minutes. Aqueous HCI (3 M) is added to adjust the pH to 5-6. The solvent is removed and the residue is purified by preparative HPLC (20-100% MeCN/HaO) to yield 3-M-r5-r3.4-difluoro-phenvl)-3-f2.4,6-trifluoro-benzovlV2.3-dihydro-[1.3.41thiadiazol-2-vn-benzooxazol-2-vU-benzoic acid: ^H NMR (400 MHz, CDCI3) 8.95 (s, IH), 8.48 (d, J= IB Hz, IH), 8.27 (d, J = 7.8 Hz, IH), 7.92 (s, IH), 7.66 (t, J= 7.8 Hz, IH), 7.6 (dd, J^ = 7.7 Hz, Jig = 1.2 Hz, IH), 7.46 (m, IH), 7.29-7.42 (m, 3H), 7.19 (q, J= 8.2 Hz, IH), 6.76-6.81 (m, 2H); LC/MS (ES^: (M+1) 596.0, (Manna) 618.0. Example 15 4-(3-r5-4-Fluoro-phenvn-3-f2-hvdroxv-benzovn-2.3-dihvdro-fL3.4]thiadiazol-2-vl1-2-methoxv-phenoxvmethvU -benzene sulfonamide [00110] A solution of 4-(bromoniethyl)benzenesulfonyl chloride (5.6 inions) in 5 mL of CH2CI2 at 25 ""C is treated with Eton (8.4 granola) followed by bus-(4-methoxy-benzyl)- amine (5.8 mmol). The reaction is stirred for 12 hours, diluted with H2O, extracted with CH2CI2, dried (MgS04), filtered and concentrated. The resultant crude material is purified by silica flash chromatography (20% Teac/hexanes) to yield 4-bromomethyl"7\y/-bis-(4- methoxy-benzyI)-benzene sulfonamide H NMR (400 MHz, CDCI3): 5 7.72 (apparent t, J- 8.4 Hz, 2H), 7.44 (dd, /; - 1.6 Hz, J2 = 8.4 Hz, 2H), 6.91-6.86 (m, 4H), 6.69 (ad= 8.8 Hz, 4H), 4.5 (s, 2H), 4.19 (s, 4H), 3.71 (s, 3H); LC/MS: (ES"*") 490.1 (M+l)"". [00111] 2-Methoxy-3-triisopropyIsilanyloxy-benzaldehyde (2.9 mmol), prepared as described in example 4, and 4-bromomcthyl-Ay^-biS"(4-methoxy-benzyI)-benzene sulfonamide (3.0 mmol) in anhydrous THF (4 mL) are treated with 4 A mL of a 1.0 M solution of TBAF in THF. The reaction is stirred for 12 hours at ambient temperature and concentrated. The resultant material was purified by silica flash chromatography (30% Etna/hexanes) to yield 4-(3-formyl-2-methoxy-phenoxymethyl)-N,N-bibs(4-methoxy- ben2yl)-beiizainide: H NMR (400 MHz, CDCI3): 5 10.45 (s, IH), 7.85 (d, J = 8 Hz, 2H), 7.58 (d, /= 8 Hz, 2H), 7.48 (dd, Jj = l2 Hz, J2 = 7.6 Hz, IH), 7.11 7.19 (m, 2H), 6.97 (d, J= 8.8 Hz, 4H), 6.74 (d, /= 8.4 Hz, 4H), 5.23 (s, 2H), 4.26 (s, 4H), 4.05 (s, 3H), 3.77 (s, 6H); LC/MS: (ES"^ 562.6 (M+l)"". [00112] 4-FIuorobenzothiohydrazide hydrochloride salt (0.045 mmol) as prepared in example 3 is dissolved in CH2CI2 (1 mL). DDEA (0.133 mmol) is added to the solution and the mixture is treated with 4-(3-fonrryl-2-methoxy-phenoxymethyl)-N,N-bus(4-methoxy- benzyl)-benzainide (0.047 mmol) in the presence of 4 A molecular sieves. Acetic acid 2- chlorocarbonyl-phenyl ester (0.047 mmol) is added after 5 minutes. The mixture was kept at ambient temperature for 16 hours and concentrated. The resultant material is dissolved in trifluoroacetic acid. After 3 hours, the reaction mixture is concentrated. The crude material is dissolved in DMSO and purified by preparative LC/MS (20-100% MeCN/HaO) to give 4-{3- [5-4-fluoro-phenyI)-3-(2-hydroxy-benzoyl)-2,3-dihydro-[l,3,4]thiadiazol-2-yl]-2-methoxy- phenoxymethyl}-benzene sulfonamide as a white sold after evaporation of solvent: ^ H NMR (400 MHz, CDCI3): 5 11.27 (s, IH), 8.55 (dd, Juju - 1.2 Hz, /^ = 8 Hz, IH), 7.96 (d, /= 8 Hz, 2H), 7.71-7.77 (m, 2H), 7.59-7.64 (m, 3H), 7.42-7.47 (m, IH), 7,12-7,8 (m, 2H), 6.95-7.03 (m, 3H), 6.86-6.92 (m, 2H), 5.2 (s, 2H), 4.77 (s, 2H), 4.07 (s, 3H); LC/MS: (ES") 594.0 (M+1)^ Example 16 3-(3-rS-f4-Fluoro-phenvn-3-f2.4,6-trifluoro-benzovlV2,3-dihvdro-fL3.41thiadiazol-2- vl]-2-methoxv-phenoxvmethvl\-N-hvdroxv-benzamidine 7.5H2;, 2H), 5.31 (s, 2H), 4.94 (d, 7= 7.8Hz. 2H), 4.8 (bs, IH), 3.8 (s, 3H); LC/MS (ES"^: (M+1) 656.3. [00118] By repeating the procedures described in the above examples, using appropriate starting materials, the following compounds of Formula I, as identified in Table 1 and 2, are obtained. Table 1 Assay 1 - Transcriptional Assay [00119] Transfixion assays are used to assess the ability of compounds of the invention to modulate the transcriptional activity of the Lures. Briefly, expression vectors for chimerical proteins containing the DNA binding domain of yeast GAL4 fused to the legend-binding domain (LBD) of either Lore or Lerp are introduced via transient transecting motor mammalian cells, together with a reporter plastids where the Lucifer’s gene is under the control of a GAL4 binding site. Upon exposure to an LXR modulator, LXR transcriptional activity varies, and this can be monitored by changes in Lucifer’s levels. If transected cells are exposed to an LXR agonist, LXR-dependent transcriptional activity increases and Lucifer’s levels rise. [00120] 293T human embryonic kidney cells (8x10^ axe seeded in a 175cm^ flask 2 days prior to the start of the experiment in 10% FBS, 1% Penicillin/Streptomycin/ Fungizome, DMEM Media. The transfixion mixture for chimerical proteins is prepared using GAL4-LXR LBD expression plastid (4 g), UAS-Lucifer’s reporter plastid (5]big\ Eugene (3:1 ratio; 27M.L) and denim-free media (210pL). The transfixion mixture is incubated for 20 minutes at room temperature. The cells are harvested by washing with PBS (30mL) and then dissociated using try sin (0.05%; 3mL). The tripping is inactivated by the addition of assay media (DMEM, lipoprotein-deficient fetal bovine serum (5%), stating (e.g. overstating 7.5|iM), and metabolic acid (logjam)) (loll). The cells are counted using a 1:10 dilution and the concentration of cells adjusted to 160,000ceEs/mL. The cells are mixed with the transecting mixture (10 mL of cells per 250 p\ of transfusion mixture) and are further incubated for 30 minutes at room temperature with periodic mixing by inversion. Cells (50p.l/well) are then plated into 384 white, solid-bottom, TC-treated plates. The cells are further incubated at 37°C, 5.0% CO2 for 24 hours. A 12-point series of dilutions (half-log serial dilutions) are prepared for each test compound in DMSO with a starting concentration of compound of Yom. Test compound (500nl) is added to each well of cells in the assay plate and the cells are incubated at 37°C, 5,0% CO2 for 24 hours. The cell lysis/luciferase assay buffer Bright-Glow™ (25%; 25 1; Protégé), is added to each well. After a further incubation for 5 minutes at room temperature, the Lucifer’s activity is measured. [00121] Raw luminescence values are normalized by dividing them by the value of the DMSO control present on each plate. Normalized data is visualized using XLfit3 and dose-response curves are fitted using a 4-parameter logistic model or sigmoid single-site dose-response equation (equation 205 in XLfit3.05). EC50 is defined as the concentration at which the compound elicits a response that is halfway between the maximum and minimum values. Relative efficacy (or percent efficacy) is calculated by comparison of the response elicited by the compound with fee maximum value obtained for the known LXR modulator, (3-{3-[(2-Chloro-3-trifluoromefeyl-benzyl)-(2,2-diphenyl-ethyl)-amino]-prosody}-phenyl)" acetic acid. Assay 2 - Method for assessing endogenous gene expression induced by LXR modulator Abaci gene expression [00122] Human Top cells are grown in propagation media (10% defined FBS, 2mM L-glutamine, lOmM HEPES, loom sodium private, 4,5g/L glucose, 1.5g/L bicarbonate, Opossum 2-Mercaptoethanol in RPMI 1640). On day 1, Oslo of cells at a concentration of 250,000 cells/mL in propagation media plus Anomy PMA are plated per well on a 48-well dish. Plate is incubated for 24 hours at 37 degrees Celsius. On day 2, media is replaced with Oslo fresh assay media (same as propagation media but with 2% lipoprotein deficient FBS as the serum supplement) and compounds are added 6 hours later (1 or lop in DMSO). Plate is then incubated at 37 degrees for 24 hours. On day 3, cells are harvested and RNA is isolated using the Creasy kit (Siege) with Danes option. RNA is eluted in lookup of water, quantities (UV absorbance at 260nm) and stored at -80 degrees till use. [00123] Aback gene expression is measured using Taxman quantitative PCR using the following primers/probe set for human Baca, forward 5'TGTCCAGTCCAGTAATGGTTCTGT3', reverse 5'AAGCGAGATATGGTCCGGATT3', probe 5TAM ACACCTGGAGAGAAGCTTTCAACGAGACTAACCTAMRA2\ and human 36B4, forward 5'CCACGCTGCTGAACATGC3', reverse 5'TCGAACACCTGCTGGATGAC3', probe 5'VIC AACATCTCCCCCTTCTCCTTTGGGCT TAMRA3'. Reverse transcription and PCR reactions are run in sequence in the same sample mixture using the Superscript Platinum E Q-PCR reagent (Nitrogen). Reaction mixes (Superscript RT/ platinum Taw - 0.4p.l, 2x Reaction Mix -10^1, 36B4 primers - 0.4 1 of 10|iM stock, ABCAl primers - Sill of lops stock, ABCAl probe-FAM - 0.04^.1 of lOOpM stock, 36B4 probe-VIC - 0.04^1 of Sonic stock, RNA (50ng/p.I) - 2^1, 50x ROX dye - 0.4fil, MgS04 -0.4nl of 50n3M stock, water - 4.52p.l) are placed in a 384-well plate and run on an ABIHT7900 machine using standard conditions. ABCAl gene expression is evaluated in reference to a curve of diluted RNA, and nonnalized to the levels of 36B4 RNA present in the sample. Fold induction induced by compound is calculated in reference to DMSO. Relative efficacy (or percent delicacy) is calculated by comparison of the response elicited by the compound with the maximum value obtained for the known LXR modulator, (3-(3-[(2-Chloro-3-trifluoromethyl-ben2yl)-(2,2-diphenyl-ethyl)-amino]-propoxy} "phenyl)"acetic acid. Fats gene expression [00124] Human HepG2 cells are grown in propagation media (10% FBS, 2mM L- glutamine, 1.5g/L bicarbonate, Holm non-essential amino acids, loom sodium private in DMEM). On day 1, 0.5»ii of cells in propagation media at a concentration of 150,000 cells/Mil are plated per well on a 48-well plate. Plate is then incubated at 37 degrees for 24 hours. On day 2, media is changed to Oslo of assay media (same as propagation media but with 2% lipoprotein deficient FBS as the serum supplement) and compounds are added 6 hours later (1 or loin in DMSO). Plate is then incubated at 37 degrees for 36-48 hours. Cells are harvested and RNA is isolated using the Rheas kit (Queen) with Dassel option. RNA is eluted in lout of water, quantities (UV absorbance at 260nm) and stored at -80 degrees till use. Fast gene expression is measured using Atman quantitative PCR using the following primers/probe set for human Fast, forward 5'GCAAATTCGACCTTTCTCAGAAC3'. reverse 5'GGACCCCGTGGAATGTCA3', probe 5'FAM ACCCGCTCGGCATGGCTATCTTC TAMRA3' and human 36B4, forward 5'CCACGCTGCTGAACATGC3', reverse S'TCGAACACCTGCTGGATGACS \ probe 5 'VIC AACATCTCCCCCTTCTCCTTTGGGCJ1: AMSA3\ Reverse transcription and PCR reactions are run in sequence in the same sample mixture using the Superscript Platinum HI Q-PCR reagent (Nitrogen). Reaction mixes (Superscript RT/ platinum Taw - 0.4|il, 2x Reaction Mix - loin, 36B4 primers - 1.2) j,l of loom stock, Fats primers - 1.2p,l of lei stock, Fats probe-FAM -0.045nl of logic stock, 36B4 probe-VIC - 0.08^1 of Sonic stock, RNA (50ng/p.l) - 2^il, 50x ROX dye - 0.4|il, MgS04 - Film of 50mM stock, water - 3.68|xl) are placed in a 384-well plate and run on an ABIHT7900 machine with standard conditions. Fats gene expression is evaluated in reference to a curve of diluted RNA, and normalized to the levels of 36B4 RNA present in the sample. Fold induction induced by compound is calculated in reference to DMSO. Assay 3 - FRET Co-Activator Recruitment Assay [00125] A FRET assay is used to assess the ability of a compound of the invention to bind directly to the LXR legend-binding domain (LBD) and promote the recruitment of proteins that potentate the transcriptional activity of Lars (e.g. co-activators). This cell-free assay uses a recombinant fusion protein composed of the LXR LBD and a tag (e.g. GST, His, FLAG) that simplifies its purification, and a synthetic biotinylated peptide derived from the nuclear receptor interacting domain of a transcriptional co-activator protein, such as steroid receptor co-activator 1 (SRC-1). In one format, the tagged LBD fusion protein can be labeled using an antibody against the LBD tag coupled to europium (e.g. EU-labeled anti- GST antibody), and the co-activator peptide can be labeled with allophycocyanin (APC) coupled to streptavidin. In the presence of an agonist for LXR, the co-activator peptide is recruited to the LXR LBD, bringing the EU and APC moieties in close proximity. Upon excitation of the complex with light at 340nM, EU absorbs and transfers energy to the APC moiety resulting in emission at 665 nm. If there is no energy transfer (indicating lack of EU-APC profundity), EU emits at 615nm. Thus tutee ratio of the 665 to 615mn light emitted gives an indication of the strength of co-activator peptide recruitment, and thus of agonist binding totheLXRLBD. [00126] Fusion proteins, amino acids 205-447 (Embank NM_005693) for Lora (NR1H3) and amino acids 203-461 (NM_007121for |3) for LXRP (NR1H3), were cloned in-frame at tile Sail and Not sites of pGEX4T-3 (27-4583-03 Amerce Pharmacia Biotech). A biotinylated peptide sequence was derived from SRC-1 (amino acids 676 to 700): biotin-CPSSHSSLTERHKILHRLLQEGSPSC-OH. [001271 A master mix is prepared (5nM GST-LXR-LBD, 5nM Biotinylated SRC-1 peptide, loam APC-Streptavidin (Presume Phycolink streptavidin APC, PJ25S), and 5n MEU-Anti-GST Antibody) in FRET buffer (50mM Tries pH 7.5, 50mM Kill Imam DTT, 0.1% BSA). To each well of a 384 well plate, 20fiL of this master mix is added. Final FRET reaction: 5nM fusion protein, 5nM SRC-1 peptide, loam APC-Streptavidin, 5nm EU-Anti-GST Antibody (Perk Elmer AD0064). Test compounds are diluted m half-log, 12-point serial dilutions in DMSO, starting at Imam and loon of compound is transcended to the master mix for a final concentration of 5pM-28pM in the assay wells. Plates are incubated at room temperature for 3 hours and fluorescence resonance energy transfer read. Results are expressed as the ratio of APC fluorescence to EU fluorescence times one thousand. [00128] The ratio of 665nm to 615nm is multiplied by a factor of 1000 to simplify data analysis. DMSO values are subtracted from ratios to account for background. Data is visualized using XLfit3 and dose-response curves are fitted using a 4-parameter logistic model or sigmoid single-site dose-response equation (equation 205 in XLfit3.05). EC50 is defined as the concentration at which the compound elicits a response that is half way between the maximum and minimum values. Relative efficacy (or percent efficacy) is calculated by comparison of the response elicited by the compound with the maximum value obtained for a reference LXR modulator, [00129] Compounds of Formula I, in free form or in pharmaceutically acceptable salt form, exhibit valuable phannacological properties, for example, as indicated by die in vitro tests described in this application. Compounds of the invention display %Efficacy for expression of endogenous ABCAl ranging from 10% to 130%. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference for all purposes. WE CLAIM: 1. A compound of Formula I: in which n is selected from 0,1,2 and 3; Z is selected from C and S(0); each Y is independently selected from -CR4= and -N=; wherein R4 is selected from hydrogen, cyano, hydroxyl, C1-6alkyl, C1-6alkoxy, halo-substituted-C1-6alkyl and halo-substituted-C1-6alkoxjr, R1is selected from halo, cyano, hydroxyl, C1-6alkyl, C1-6alkoxy, halo-substituted-C1-6alkyl, halo-substituted-C1-6alkoxy and -C(0)0R4; wherein R4 is as described above; R2 is selected from C1-6arylj C1-6heteroaryl, C1-6cycloalkyl and C3. gheterocycloalkyl; wherein any aryl, heteroaryl, cyclically or heterocycloalkyl of R2 is optionally substituted with 1 to 5 radicals independently selected from halo, hydroxy, cyano, nitro, C1-6alkyl, C1-6alkoxy, halo-substituted-C1-6alkyl, halo-substituted-C1-6alkoxy, -C(0)NR5R5, -OR5, -0C(0)R5, -NR5R6, -C(0)R5 and -NR5C(0)R5; wherein R5 and R6 are dependently selected from hydrogen, C1-6alkyl, C1-6alkoxy, halo-substituted-C1-6alkyI, halo-substituted-C1-6alkoxy, C1-6axyl- o alkyl, C1-6heteroaryl-C1-6alkyl,C1-6cycloalkyl-C1-4alkyl and C1-6heterocycloalkyl-C1-6alkyl; or R5 and Re tog flier with the nitrogen atom to which R5 and R6 are attached form C1-6beteroaryl or C1-6heterocycloalkyl; wherein any aryl, heteroaryl, cyclically or heterocycloalkyl of R5 or the combination of R5 and R6 is optionally substituted with 1 to 4 radicals independently selected from halo, hydroxy, cyano, nitro, C1-6alkyl,C1-6alkoxy, halo-substituted-C1-6alkyl andhalo-substituted-C1-6alkoxy; R3 is selected from C6-10aryl, C3-12heproaryl, C3-12cycloalkyl and C3. gheterocycloalkyl; wherein any aryl, heteroatyl, cyclically or heterocycloalkyl of R3 is substituted with 1 to 5 radicals independently selected from halo, C alloy, halo substituted-C1-6alkyl, halo-substituted-C1-6alkoxy, -OXR7, -OXC(0)NR7R8, OXC(0)NR7XC(0)OR8, -OXC(0)NR7XOR8, -OXC(0)HR7XNR7R8, "OXC(0)NR7XS(0)o-sirs, OXC(0)NR7XNR7C(0)RIB, -OXC(0)NR7XC(0)XC(0)OR8, -OXC(0)NR7R9, -0XC(0)0R7, -OXOR7, -OXR9, -XR9, -0XC(0)R9, -OXS(0)o.2R9 and -OXC(0)lSIR7CR7[C(0)R8]2;wherein X is a selected from a bond and C1-6alkylene wherein any ethylene of X can optionally be replaced with a divalent radical selected from C(0), NR7, S(0)2 and O; R7 and Mrs. are independently selected from hydrogen, cyano, C1-6alkyl, halo-substituted-C1-6alkyl, C3-12lkenyl and C3-12cycloalkyl-C3-12aIkyl; R9 is selected from C6. 10aryl-Co4alkyl, C3-12heteroaiyl-C1-6alkyl, C1-6cyploalkyl-C3-12alkyl and C3, sheterocycloalkyl-C1-6alkyl; wherein any alkyl of R9 can; have a hydrogen replaced with -C(0)OR10; and any aryl, heteroaryl, cyclically or heterocycloalkyl of R9 is optionally substituted with 1 to 4 radicals independently selected from halo, C1-6alkyl, C3-12cycloalkyl, halo-substituted-C1-6alkyl, C1-6alkoxy, halo-substituted-C1-6alkoxy, -XC(0)OR10, -XC(0)R10, -XC(0)NR10R10, "XS(0)o-2NR10R10 and >XS(0)o-2R10; wherein R10 is independently selected from hydrogen and C1-6alkyl; and the pharmaceutically acceptable salts, hydrates, solvates and isomers thereof. Ri is selected from halo, C1-6alky\, and -C(0)0R4; wherein R4 is selected from hydrogen and C1-6alkyl; R2 is selected from C1-6aryl, C3-10heteroaryl, C3-i2cycloalkyl and C3-gheterocycloalkyl; wherein any aryl, heteroaryl, cyclically or heterocycloalkyl of R2 is optionally substituted with 1 to 4 radicals independently selected from halo, hydroxy, C1_ 6alkyl, halo-substitated-C1-6alkyl and -OC(0)R5; wherein R5 is selected from hydrogen and C1-6alkyl; and R3 is selected from C6-10aryl, C6-10heteroaryl, C3-i2cycloalkyl and C3-Bheterocycloalkyl; wherein any aryl, heteroaryl, cyclically or heterocycloalkyl of R3 is substituted with 1 to 5 radicals independently selected from halo, hydroxyl, C1-6 alloy, halo-substituted-Ci.6aIkyl, halo-substituted-C1-6alkoxy, -OXR7, -OXC(0)NR7R8, 0XC(0)NR7XC(0)0Rg, -OXC(0)NR7XOR8, -OXC(0)NR7XNR7R8, -OXC(0)NR7XS(0)o. 2R8, -OXC(0)NR7X]SIR7C(0)Rest, -OXC(0)NR7XC(0)XC(0)OR8, -OXC(0)NR7R9, -0XC(0)0R7, -OXOR7, -OXR9, -XR9, -OXC(0)R9 and -OXC(0)NR7CR7[C(0)R8]2;wherein X is a selected from a bond and C1-6aUcylene; R7 and R are independently selected from hydrogen, cyano, C1-6alkyl, halo-substituted-C1-6alkyl, C2alkenyl and C1-6cycloalkyl-Co. 4alkyl; R9 is selected from C1-6aryl-C1-6alkyl, C5-ioheteroaryl-Co-4alkyl, ycloalkyl-Co-4alkyl andC1-6heterocycloalkyl-C1-6alkyl; wherein any alkyl of R9 can have a hydrogen replaced with -C(0)OR10; and any aryl, heteroaryl, cyclically or heterocycloalkyl of R9 is optionally substituted with 1 to 4 radicals independently selected from halo, C1-6alkyl, C3. [2cycloalkyl, halo-substituted-C1-6alkyl, C1-6alkoxy, halo-substituted-C1-6alkoxy, XC(0)OR10. -XC(0)R10, -CR10(NR10R10)=NOR10, -XC(0)NR10R10, -XS(0)o-2NR10R!o and -XS(0)o-2R10; wherein R10 is independently selected from hydrogen and C1-6alkyl. 3. The compound of claim 2 in which Rim is selected from flour, chloral, methyl and -C(0)0CH3; and R2 is selected from phenyl, cyclohexyl, cyclopentyl, payroll, pyrazolyl, naphthalene, benzoic[l,3]duopoly, thinly, tyranny and pyridine; wherein any aryl, heteroaryl or cyclically of R2 is optionally substituted with 1 to 4 radicals independently selected from floury, cholera, brooms, hydroxy, mealy, ethyl, propyl, t-butyl, amino, dim ethyl-amino, ethoxy, trifluoromethyl, trifluoromethoxy and -0C(0)CH3. wherein R9 is phenyl, cyclopropyl-methyl, isoxazolyl, benzthiazolylj furan, fairway-methyl, tetrahydro-furanyl, pyridines, 4-oxo-4,5-dihydro-thiazol-2-yl, pyrazolyl, isothiazolyl, 1,3,4-thiadiazolyl, thiazolyl, phenethyl, morpholino, morpholino-propy], isoxazolyl-methyl, pyrimidinyl, tetrahydro-pyranyl, 2-oxo-2,3-dihydrO"pyrimidin-4-yI, piperazinyl, payroll, piperidinyl, pyrazinyl, imidazolyl, imidazolyl-propyl, banjo[l,3]duopoly, banjo[l,3]dioxoIyI-propyl, 2-oxo-pyrroIidin-l-yI and 2~oxo-pyrrolidin-1-yl-propyl; wherein any alkyl of R9 can have a hydrogen replaced with -C(0)OC2H5; wherein any aryl, heteroaryl or heterocycloalky of R9 is optionally substituted with 1 to 4 radicals independently selected from methyl, ethyl, cyclopropyl, ethoxy, trifluoromethyl, -0C(0)CH3, -COOH, -S(0)2NH2, -CH(NH2)=N0H, -C(0)OC2H5, -CH2C(0)0H, -CH2C(0)OC2H5, -CH2C(0)OCH3, -C(0)0CH3, -C(0)NH2, -C(0)NHCH3 and -C(0)CH3. 5. A pharmaceutical composition comprising a therapeutically effective amount of a compound of Claim 1 in combination with a pharmaceutically acceptable recipient. 6. A method for treating a disease or disorder in an animal in which modulation of LXR activity can prevent, inhibit or ameliorate the pathology and/or symptomatology of the disease, which method comprises administering to the animal a therapeutically effective amount of a compound of Claim 1. 7. The method of claim 6 wherein the diseases or disorder are selected from cardiovascular disease, diabetes, neurodegenerative diseases and inflammation. 8. The use of a compound of claim 1 in the manufacture of a medicament for treating a disease or disorder in an animal in which LXR activity contributes to the pathology and/or symptomatology of the disease, said disease being selected from cardiovascular disease, diabetes, neurodegenerative diseases and inflammation. 9. A method for treating a disease or disorder in an animal in which modulation of LXR activity can prevent, inhibit or ameliorate the pathology and/or symptomatology of the disease, which method comprises administering to the animal a therapeutically effective amount of a compound of Claim 1. 10. The method of claim 9 further comprising administering a therapeutically effective amount of a compound of Claim 1 in combination with another therapeutically relevant agent

Documents:

2926-CHENP-2006 CORRESPONDENCE OTHERS 05-09-2011.pdf

2926-CHENP-2006 CORRESPONDENCE OTHERS 06-09-2012.pdf

2926-CHENP-2006 CORRESPONDENCE OTHERS 29-08-2012.pdf

2926-CHENP-2006 FORM-13 06-09-2012.pdf

2926-CHENP-2006 AMENDED CLAIMS 10-04-2012.pdf

2926-CHENP-2006 AMENDED PAGES OF SPECIFICATION 10-04-2012.pdf

2926-CHENP-2006 CORRESPONDENCE OTHERS 27-04-2012.pdf

2926-CHENP-2006 CORRESPONDENCE OTHRES 12-07-2012.pdf

2926-CHENP-2006 EXAMINATION REPORT REPLY RECEIVED 10-04-2012.pdf

2926-CHENP-2006 FORM-1 10-04-2012.pdf

2926-CHENP-2006 FORM-13 27-04-2012.pdf

2926-CHENP-2006 FORM-13 10-04-2012.pdf

2926-CHENP-2006 FORM-3 10-04-2012.pdf

2926-CHENP-2006 FORM-3 12-07-2012.pdf

2926-CHENP-2006 OTHER PATENT DOCUMENT 10-04-2012.pdf

2926-CHENP-2006 POWER OF ATTORNEY 10-04-2012.pdf

2926-chenp-2006-abstract.pdf

2926-chenp-2006-claims.pdf

2926-chenp-2006-correspondnece-others.pdf

2926-chenp-2006-description(complete).pdf

2926-chenp-2006-form 1.pdf

2926-chenp-2006-form 26.pdf

2926-chenp-2006-form 3.pdf

2926-chenp-2006-form 5.pdf

2926-chenp-2006-pct.pdf