Title of Invention

A CHIMERIC PROTEIN COMPRISING A FIRST POLYPEPTIDE CHAIN AND A SECOND POLYPEPTIDE CHAIN, WHEREIN SAID FIRST CHAIN COMPRISES A CLOTTING FACTOR

Abstract The instant invention discloses a chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises a biologically active molecule as described herein, and at least a portion of an immunoglobulin constant region comprising an FcRn binding site as described herein and wherein said second chain comprises at least a portion of an immunoglobulin constant region comprising an FcRn binding site as described herein without a biologically active molecule as described herein or immunoglobulin variable region as described herein.
Full Text [001] This application claims priority to United States Provisional Appln.
No.: 60/469,600 filed May 6, 2003, United States Provisional Appln. No.: 60/487,964
filed July 17, 2003, and United States Provisional Appln. No.: 60/539,207 filed
January 26, 2004, all of which are incorporated by reference in their entirety. The
U.S. nonprovisional application entitled Methods for Chemically Synthesizing
Immunoglobulin Chimeric Proteins, filed concurrently on May 6, 2004, is
incorporated by reference.
FIELD OF THE INVENTION
[002] The invention relates generally to therapeutic chimeric proteins,
comprised of two polypeptide chains, wherein the first chain is comprised of a
therapeutic biologically active molecule and the second chain is not comprised of the
therapeutic biologically active molecule of the first chain. More specifically, the
invention relates to chimeric proteins, comprised of two polypeptide chains, wherein
both chains are comprised of at least a portion of an immunoglobulin constant region
wherein the first chain is modified to further comprise a biologically active molecule,
and the second chain is not so modified. The invention, thus relates to a chimeric
protein that is a monomer-dimer hybrid, i.e., a chimeric protein having a dimeric
aspect and a monomeric aspect, wherein the dimeric aspect relates to the fact that it
is comprised of two polypeptide chains each comprised of a portion of an
immunoglobulin constant region, and wherein the monomeric aspect relates to the
fact that only one of the two chains is comprised of a therapeutic biologically active
molecule. Figure 1 illustrates one example of a monomer-dimer hybrid wherein the

biologically active molecule is erythropoietin (EPO) and the portion of an
immunoglobulin constant region is an IgG Fc region.
BACKGROUND OF THE INVENTION
[003] Immunoglobulins are comprised of four polypeptide chains, two
heavy chains and two light chains, which associate via disulfide bonds to form
tetramers. Each chain is further comprised of one variable region and one constant
region. The variable regions mediate antigen recognition and binding, while the
constant regions, particularly the heavy chain constant regions, mediate a variety of
effector functions, e.g., complement binding and Fc receptor binding (see, e.g., U.S.
Patent Nos.: 6,086,875; 5,624,821; 5,116,964).
[004] The constant region is further comprised of domains denoted CH
(constant heavy) domains (CH1, CH2, etc.). Depending on the isotype, (i.e. IgG,
IgM, IgA IgD, IgE) the constant region can be comprised of three or four CH
domains. Some isotypes (e.g. IgG) constant regions also contain a hinge region
Janeway et al. 2001, Immunobiology, Garland Publishing, N.Y., N.Y.
[005] The creation of chimeric proteins comprised of immunoglobulin
constant regions linked to a protein of interest, or fragment thereof, has been
described (see, e.g., U.S. Patent Nos. 5,480,981 and 5,808,029; Gascoigne et al.
1987, Proc. Natl. Acad. Sci. USA 84:2936; Capon et al. 1989, Nature 337:525;
Traunecker et al. 1989, Nature 339:68; Zettmeissl et al. 1990, DNA Cell Biol. USA
9:347; Byrn et al. 1990, Nature 344:667; Watson et al. 1990, J. Cell. Biol. 110:2221;
Watson et al. 1991, Nature 349:164; Aruffo et al. 1990, Cell 61:1303; Linsley et al.
1991, J. Exp. Med. 173:721; Linsley et al. 1991, J. Exp. Med. 174:561; Stamenkovic
et al., 1991, Cell 66:1133; Ashkenazi et al. 1991, Proc. Natl. Acad. Sci. USA
2-

88:10535; Lesslauer et al. 1991, Eur. J. Immunol. 27:2883; Peppel et al. 1991, J.
Exp. Med. 174:1483; Bennett et al. 1991, J. Biol. Chem. 266:23060; Kurschner et al.
1992, J. Biol. Chem. 267:9354; Chalupny et al. 1992, Proc. Natl. Acad. Sci. USA
89:10360; Ridgway and Gorman, 1991, J. Cell. Biol. 115, Abstract No. 1448; Zheng
et al. 1995, J. Immun. 154:5590). These molecules usually possess both the
biological activity associated with the linked molecule of interest as well as the
effector function, or some other desired characteristic associated with the
immunoglobulin constant region (e.g. biological stability, cellular secretion).
[006] The Fc portion of an immunoglobulin constant region, depending on
the immunoglobulin isotype can include the CH2, CH3, and CH4 domains, as well as
the hinge region. Chimeric proteins comprising an Fc portion of an immunoglobulin
bestow several desirable properties on a chimeric protein including increased
stability, increased serum half life (see Capon et al. 1989, Nature 337:525) as well
as binding to Fc receptors such as the neonatal Fc receptor (FcRn) (U.S. Patent
Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1).
[007] FcRn is active in adult epithelial tissue and expressed in the lumen of
the intestines, pulmonary airways, nasal surfaces, vaginal surfaces, colon and rectal
surfaces (U.S. Patent No. 6,485,726). Chimeric proteins comprised of FcRn binding
partners (e.g. IgG, Fc fragments) can be effectively shuttled across epithelial barriers
by FcRn, thus providing a non-invasive means to systemically administer a desired
therapeutic molecule. Additionally, chimeric proteins comprising an FcRn binding
partner are endocytosed by cells expressing the FcRn. But instead of being marked
for degradation, these chimeric proteins are recycled out into circulation again, thus
increasing the in vivo half life of these proteins.
3

[008] Portions of immunoglobulin constant regions, e.g., FcRn binding
partners typically associate, via disulfide bonds and other non-specific interactions,
with one another to form dimers and higher order multimers. The instant invention is
based in part upon the surprising discovery that transcytosis of chimeric proteins
comprised of FcRn binding partners appears to be limited by the molecular weight of
the chimeric protein, with higher molecular weight species being transported less
efficiently.
[009] Chimeric proteins comprised of biologically active molecules, once
administered, typically will interact with a target molecule or cell. The instant
invention is further based in part upon the surprising discovery that monomer-dimer
hybrids, with one biologically active molecule, but two portions of an immunoglobulin
constant region, e.g., two FcRn binding partners, function and can be transported
more effectively than homodimers, also referred to herein simply as "dimers" or
higher order multimers with two or more copies of the biologically active molecule.
This is due in part to the fact that chimeric proteins, comprised of two or more
biologically active molecules, which exist as dimers and higher order multimers, can
be sterically hindered from interacting with their target molecule or cell, due to the
presence of the two or more biologically active molecules in close proximity to one
another and that the biologically active molecule can have a high affinity for itself.
[010] Accordingly one aspect of the invention provides chimeric proteins
comprised of a biologically active molecule that is transported across the epithelium
barrier. An additional aspect of the invention provides chimeric proteins comprised
of at least one biologically active molecule that is able to interact with its target
molecule or cell with little or no steric hindrance or self aggregation.

[011] The aspects of the invention provide for chimeric proteins comprising
a first and second polypeptide chain, the first chain comprising at least a portion of
immunoglobulin constant region, wherein the portion of an immunoglobulin constant
region has been modified to include a biologically active molecule and the second
chain comprising at least a portion of immunoglobulin constant region, wherein the
portion of an immunoglobulin constant region has not been so modified to include
the biologically active molecule of the first chain.
SUMMARY OF THE INVENTION
[012] The invention relates to a chimeric protein comprising one biologically
active molecule and two molecules of at least a portion of an immunoglobulin
constant region. The chimeric protein is capable of interacting with a target
molecule or cell with less steric hindrance compared to a chimeric protein comprised
of at least two biologically active molecules and at least a portion of two
immunoglobulin constant regions. The invention also relates to a chimeric protein
comprising at least one biologically active molecule and two molecules of at least a
portion of an immunoglobulin constant region that is transported across an
epithelium barrier more efficiently than a corresponding homodimer, i.e., wherein
both chains are linked to the same biologically active molecule. The invention, thus
relates to a chimeric protein comprising a first and a second polypeptide chain linked
together, wherein said first chain comprises a biologically active molecule and at
least a portion of an immunoglobulin constant region, and said second chain
comprises at least a portion of an immunoglobulin constant region, but no
immunoglobulin variable region and without any biologically active molecule
attached.

[013] The invention relates to a chimeric protein comprising a first and a
second polypeptide chain linked together, wherein said first chain comprises a
biologically active molecule and at least a portion of an immunoglobulin constant
region, and said second chain comprises at least a portion of an immunoglobulin
constant region without an immunoglobulin variable region or any biologically active
molecule and wherein said second chain is not covalently bonded to any molecule
having a molecular weight greater than 1 kD, 2 kD, 5 kD, 10 kD, or 20 kD. In one
embodiment, the second chain is not covalently bonded to any molecule having a
molecular weight greater than 0-2 kD. In one embodiment, the second chain is not
covalently bonded to any molecule having a molecular weight greater than 5-10 kD.
In one embodiment, the second chain is not covalently bonded to any molecule
having a molecular weight greater than 15-20 kD.
[014] The invention relates to a chimeric protein comprising a first and a
second polypeptide chain linked together, wherein said first chain comprises a
biologically active molecule and at least a portion of an immunoglobulin constant
region, and said second chain comprises at least a portion of an immunoglobulin
constant region not covalently linked to any other molecule except the portion of an
immunoglobulin of said first polypeptide chain.
[015] The invention relates to a chimeric protein comprising a first and a
second polypeptide chain linked together, wherein said first chain comprises a
biologically active molecule and at least a portion of an immunoglobulin constant
region, and said second chain consists of at least a portion of an immunoglobulin
constant region and optionally an affinity tag.
6

[016] The invention relates to a chimeric protein comprising a first and a
second polypeptide chain linked together, wherein said first chain comprises a
biologically active molecule and at least a portion of an immunoglobulin constant
region, and said second chain consists essentially of at least a portion of an
immunoglobulin constant region and optionally an affinity tag.
[017] The invention relates to a chimeric protein comprising a first and a
second polypeptide chain linked together, wherein said first chain comprises a
biologically active molecule and at least a portion of an immunoglobulin constant
region, and said second chain comprises at least a portion of an immunoglobulin
constant region without an immunoglobulin variable region or any biologically active
molecule and optionally a molecule with a molecular weight less than 10 kD, 5 kD, 2
kD or 1 kD. In one embodiment, the second chain comprises a molecule less than
15-20 kD. In one embodiment, the second chain comprises a molecule less than 5-
10 kD. In one embodiment, the second chain comprises a molecule less than 1-2
kD.
[018] The invention relates to a chimeric protein comprising a first and
second polypeptide chain, wherein said first chain comprises a biologically active
molecule, at least a portion of an immunoglobulin constant region, and at least a first
domain, said first domain having at least one specific binding partner, and wherein
said second chain comprises at least a portion of an immunoglobulin constant
region, and at least a second domain, wherein said second domain is a specific
binding partner of said first domain, without any immunoglobulin variable region or a
biologically active molecule.
7

[019] The invention relates to a method of making a chimeric protein
comprising a first and second polypeptide chain, wherein the first polypeptide chain
and the second polypeptide chain are not the same, said method comprising
transfecting a cell with a first DNA construct comprising a DNA molecuie encoding a
first polypeptide chain comprising a biologically active molecule and at least a
portion of an immunoglobulin constant region and optionally a linker, and a second
DNA construct comprising a DNA molecule encoding a second polypeptide chain
comprising at least a portion of an immunoglobulin constant region without any
biologically active molecule or an immunoglobulin variable region, and optionally a
linker, culturing the cells under conditions such that the polypeptide chain encoded
by the first DNA construct is expressed and the polypeptide chain encoded by the
second DNA construct is expressed and isolating monomer-dimer hybrids comprised
of the polypeptide chain encoded by the first DNA construct and the polypeptide
chain encoded by the second DNA construct.
[020] The invention relates to a method of making a chimeric protein
comprising a first and second polypeptide chain, wherein the first polypeptide chain
and the second polypeptide chain are not the same, and wherein said first
polypeptide chain comprises a biologically active molecule, at least a portion of an
immunoglobulin constant region, and at least a first domain, said first domain, having
at least one specific binding partner, and wherein said second polypeptide chain
comprises at least a portion of an immunoglobulin constant region and a second
domain, wherein said second domain, is a specific binding partner of said first
domain, without any biologically active molecule or an immunoglobulin variable
region, said method comprising transfecting a cell with a first DNA construct

comprising a DNA molecule encoding said first polypeptide chain and a second DNA
construct comprising a DNA molecule encoding, said second polypeptide chain,
culturing the cells under conditions such that the polypeptide chain encoded by the
first DNA construct is expressed and the polypeptide chain encoded by the second
DNA construct is expressed and isolating monomer-dimer hybrids comprised of the
polypeptide chain encoded by the first DNA construct and polypeptide chain
encoded by the second DNA construct.
[021] The invention relates to a method of making a chimeric protein of the
invention said method comprising transfecting a cell with a first DNA construct
comprising a DNA molecule encoding a first polypeptide chain comprising a
biologically active molecule and at least a portion of an immunoglobulin constant
region and optionally a linker, culturing the cell under conditions such that the
polypeptide chain encoded by the first DNA construct is expressed, isolating the
polypeptide chain encoded by the first DNA construct and transfecting a cell with a
second DNA construct comprising a DNA molecule encoding a second polypeptide
chain comprising at least a portion of an immunoglobulin constant region without any
biologically active molecule or immunoglobulin variable region, culturing the cell
under conditions such that the polypeptide chain encoded by the second DNA
construct is expressed, isolating the polypeptide chain, encoded by the second DNA
construct, combining the polypeptide chain, encoded by the first DNA construct and
the polypeptide chain encoded by the second DNA construct under conditions such
that monomer-dimer hybrids comprising the polypeptide chain encoded by the first
DNA construct and the polypeptide chain encoded by the second DNA construct
form, and isolating said monomer-dimer hybrids.

[022] The invention relates to a method of making a chimeric protein
comprising a first and second polypeptide chain, wherein the first polypeptide chain
and the second polypeptide chain are not the same, said method comprising
transfecting a cell with a DNA construct comprising a DNA molecule encoding a
polypeptide chain comprising at least a portion of an immunoglobulin constant
region, culturing the cells under conditions such that the polypeptide chain encoded
by the DNA construct is expressed with an N terminal cysteine such that dimers of
the polypeptide chain form and isolating dimers comprised of two copies of the
polypeptide chain encoded by the DNA construct and chemically reacting the
isolated dimers with a biologically active molecule, wherein said biologically active
molecule has a C terminus thioester, under conditions such that the biologically
active molecule reacts predominantly with only one polypeptide chain of the dimer
thereby forming a monomer-dimer hybrid.
[023] The invention relates to a method of making a chimeric protein
comprising a first and second polypeptide chain, wherein the first polypeptide chain
and the second polypeptide chain are not the same, said method comprising
transfecting a cell with a DNA construct comprising a DNA molecule encoding a
polypeptide chain comprising at least a portion of an immunoglobulin constant
region, culturing the cells under conditions such that the polypeptide chain encoded
by the DNA construct is expressed with an N terminal cysteine such that dimers of
the polypeptide chains form, and isolating dimers comprised of two copies of the
polypeptide chain encoded by the DNA construct, and chemically reacting the
isolated dimers with a biologically active molecule, wherein said biologically active
molecule has a C terminus thioester, such that the biologically active molecule is
10

linked to each chain of the dimer, denaturing the dimer comprised of the portion of
the immunoglobulin linked to the biologically active molecule such that monomeric
chains form, combining the monomeric chains with a polypeptide chain comprising
at least a portion of an immunoglobulin constant region without a biologically active
molecule linked to it, such that monomer-dimer hybrids form, and isolating the
monomer-dimer hybrids.
[024] The invention relates to a method of making a chimeric protein
comprising a first and second polypeptide chain, wherein the first polypeptide chain
and the second polypeptide chain are not the same, said method comprising
transfecting a cell with a DNA construct comprising a DNA molecule encoding a
polypeptide chain comprising at least a portion of an immunoglobulin constant
region, culturing the cells under conditions such that the polypeptide chain encoded
by the DNA construct is expressed as a mixture of two polypeptide chains, wherein
the mixture comprises a polypeptide with an N terminal cysteine, and a polypeptide
with a cysteine in close proximity to the N terminus, isolating dimers comprised of
the mixture of polypeptide chains encoded by the DNA construct and chemically
reacting the isolated dimers with a biologically active molecule, wherein said
biologically active molecule has an active thioester, such that at least some
monomer-dimer hybrid forms and isolating the monomer-dimer hybrid from said
mixture.
[025] The invention relates to a method of treating a disease or condition
comprising administering a chimeric protein of the invention thereby treating the
disease or condition.
11

[026] Additional objects and advantages of the invention will be set forth in
part in the description which follows, and in part will be obvious from the description,
or may be learned by practice of the invention. The objects and advantages of the
invention will be realized and attained by means of the elements and combinations
particularly pointed out in the appended claims.
[027] It is to be understood that both the foregoing general description and
the following detailed description are exemplary and explanatory only and are not
restrictive of the invention, as claimed.
12

BRIEF DESCRIPTION OF THE DRAWINGS
[028] Figure 1 is a schematic diagram comparing the structure of an EPO-
Fc homodimer, or dimer, and the structure of an Epo-FC monomer-dimer hybrid.
[029] Figure 2a is the amino acid sequence of the chimeric protein Factor
Vll-Fc. Included in the sequence is the signal peptide (underlined), which is cleaved
by the cell and the propeptide (bold), which is recognized by the vitamin K-
dependent y carboxylase which modifies the Factor Vll to achieve full activity. The
sequencers subsequently cleaved by PACE to yield Factor Vll-Fc.
[030] Figure 2b is the amino acid sequence of the chimeric protein Factor
IX-Fc. Included in the sequence is the signal peptide (underlined) which is cleaved
by the cell and the propeptide (bold) which is recognized by the vitamin K-dependent
y carboxylase which modifies the Factor IX to achieve full activity. The sequence is
subsequently cleaved by PACE to yield Factor IX-Fc.
[031] Figure 2c is the amino acid sequence of the chimeric protein IFNa-Fc.
Included in the sequence is the signal peptide (underlined), which is cleaved by the
cell resulting in the mature IFNa-Fc.
[032] Figure 2d is the amino acid sequence of the chimeric protein IFNa-Fc
A linker. Included in the sequence is the signal peptide (underlined) which is
cleaved by the cell resulting in the mature IFNa- Fc A linker.
[033] Figure 2e is the amino acid sequence of the chimeric protein Flag-Fc.
included in the sequence is the signal peptide (underlined), which is cieaved by the
cell resulting in the mature Flag-Fc.
[034] Figure 2f is the amino acid sequence of the chimeric protein Epo-
CCA-Fc. Included in the sequence is the signal peptide (underlined), which is

cleaved by the cell resulting in the mature Epo-CCA-Fc. Also shown in bold is the
acidic coiled coil domain.
[035] Figure 2g is the amino acid sequence of the chimeric protein CCB-Fc.
Included in the sequence is the signal peptide (underlined), which is cleaved by the
cell resulting in the mature CCB-Fc. Also shown in bold is the basic coiled coil
domain.
[036] Figure 2h is the amino acid sequence of the chimeric protein Cys-Fc.
Included in the sequence is the signal peptide (underlined), which is cleaved by the
cell resulting in the mature Cys-Fc. When this sequence is produced in CHO cells a
percentage of the molecules are incorrectly cleaved by the signal peptidase such
that two extra amino acids are left on the N terminus, thus preventing the linkage of
a biologically active molecule with a C terminal thioester (e.g., via native ligation).
When these improperly cleaved species dimerize with the properly cleaved Cys-Fc
and are subsequently reacted with biologically active molecules with C terminal
thioesters, monomer-dimer hybrids form.
[037] Figure 2i is the amino acid sequence of the chimeric protein IFNa-
GS15-Fc. Included in the sequence is the signal peptide (underlined) which is
cleaved by the cell resulting in the mature IFNa- GS15-Fc.
[038] Figure 2j is the amino acid sequence of the chimeric protein Epo-Fc.
Included in the sequence is the signal peptide (underlined), which is cleaved by the
cell resulting in the mature Epo-Fc. Also shown in bold is the 8 amino acid linker.
[039] Figure 3a is the nucleic acid sequence of the chimeric protein Factor
Vll-Fc. Included in the sequence is the signal peptide (underlined) and the
propeptide (bold) which is recognized by the vitamin K-dependent y carboxylase

which modifies the Factor VII to achieve full activity. The translated sequence is
subsequently cleaved by PACE to yield mature Factor Vll-Fc.
[040] Figure 3b is the nucleic acid sequence of the chimeric protein Factor
IX-Fc. Included in the sequence is the signal peptide (underlined) and the
propeptide (bold) which is recognized by the vitamin K-dependent y carboxylase
which modifies the Factor IX to achieve full activity. The translated sequence is
subsequently cleaved by PACE to yield mature Factor IX-Fc.
[041] Figure 3c is the nucleic acid sequence of the chimeric protein IFNa-
Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by
the cell after translation resulting in the mature IFNa-Fc.
[042] Figure 3d is the nucleic acid sequence of the chimeric protein IFNa-
Fc A linker. Included in the sequence is the signal peptide (underlined) which is
cleaved by the cell after translation resulting in the mature IFNa- Fc A linker.
[043] Figure 3e is the amino acid sequence of the chimeric protein Flag-Fc.
Included in the sequence is the signal peptide (underlined), which is cleaved by the
cell after translation resulting in the mature Flag-Fc.
[044] Figure 3f is the nucleic acid sequence of the chimeric protein Epo-
CCA-Fc. Included in the sequence is the signal peptide (underlined), which is
cleaved by the cell after translation resulting in the mature Epo-CCA-Fc. Also shown
in bold is the acidic coiled coil domain.
[045] Figure 3g is the nucleic acid sequence of the chimeric protein CCB-
Fc. Included in the sequence is the signal peptide (underlined), which is cleaved by
the cell after translation resulting in the mature CCB-Fc. Also shown in bold is the
basic coiled coil domain.

[046] Figure 3h is the nucleic acid sequence of the chimeric protein Cys-Fc.
Included in the sequence is the signal peptide (underlined), which is cleaved by the
cell after translation resulting in the mature Cys-Fc.
[047] Figure 3i is the nucleic acid sequence of the chimeric protein IFNa-
GS15-Fc. Included in the sequence is the signal peptide (underlined) which is
cleaved by the cell after translation resulting in the mature IFNa-GS15-Fc.
[048] Figure 3j is the nucleic acid sequence of the chimeric protein Epo-Fc.
Included in the sequence is the signal peptide (underlined), which is cleaved by the
cell after translation resulting in the mature Epo-Fc. Also shown in bold is a nucleic
acid sequence encoding the 8 amino acid linker.
[049] Figure 4 demonstrates ways to form monomer-dimer hybrids through
native ligation.
[050] Figure 5a shows the amino acid sequence of Fc MESNA (SEQ ID
NO:4).
[051] Figure 5b shows the DNA sequence of Fc MESNA (SEQ ID NO:5).
[052] Figure 6 compares antiviral activity of IFNa homo-dimer (i.e.
comprised of 2 IFNa molecules) with an IFNa monomer-dimer hybrid (i.e. comprised
of 1 IFNa molecule).
[053] Figure 7 is a comparison of clotting activity of a chimeric monomer-
dimer hybrid Factor Vlla-Fc (one Factor VII molecule) and a chimeric homodimer
Factor VIIa-Fc (two Factor VII molecules).
[054] Figure 8 compares oral dosing in neonatal rats of a chimeric
monomer-dimer hybrid Factor Vlla-Fc (one Factor VI! molecule) and a chimeric
homodimer Factor Vlla-Fc (two Factor VII molecules).

[055] Figure 9 compares oral dosing in neonatal rats of a chimeric
monomer-dimer hybrid Factor IX-Fc (one Factor IX molecule) with a chimeric
homodimer.
[056] Figure 10 is a time course study comparing a chimeric monomer-
dimer hybrid Factor IX-Fc (one Factor IX molecule) administered orally to neonatal
rats with an orally administered chimeric homodimer.
[057] Figure 11 demonstrates pharmokinetics of Epo-Fc dimer compared to
Epo-Fc monomer-dimer hybrid in cynomolgus monkeys after a single pulmonary
dose.
[058] Figure 12 compares serum concentration in monkeys of
subcutaneously administered Epo-Fc monomer-dimer hybrid with subcutaneously
administered Aranesp® (darbepoetin alfa).
[059] Figure 13 compares serum concentration in monkeys of intravenously
administered Epo-Fc monomer-dimer hybrid with intravenously administered
Aranesp® (darbepoetin alfa) and Epogen® (epoetin alfa).
[060] Figure 14 shows a trace from a Mimetic Red 2™ column (ProMetic
LifeSciences, Inc., Wayne, NJ) and an SDS-PAGE of fractions from the column
containing EpoFc monomer-dimer hybrid, EpoFc dimer, and Fc. EpoFc monomer-
dimer hybrid is found in fractions 11, 12, 13, and 14. EpoFc dimer is found in
fraction 18. Fc is found in fractions 1/2.
[061] Figure 15 shows the pharmacokinetics of IFNpFc with an 8 amino
acid linker in cynomolgus monkeys after a single pulmonary dose.
[062] Figure 16 shows neopterin stimulation in response to the IFN(3-Fc
homodimer and the lFNp-Fc N297A monomer-dimer hybrid in cynomolgus monkeys.

[063] Figure 17a shows the nucleotide sequence of interferon |3-Fc; Figure
17b shows the amino acid sequence of interferon p-Fc.
[064] Figure 18 shows the amino acid sequence of T20(a); T21 (b) and
T1249(c).
DESCRIPTION OF THE EMBODIMENTS
A. Definitions
[065] Affinity tag, as used herein, means a molecule attached to a second
molecule of interest, capable of interacting with a specific binding partner for the
purpose of isolating or identifying said second molecule of interest.
[066] Analogs of chimeric proteins of the invention, or proteins or peptides
substantially identical to the chimeric proteins of the invention, as used herein,
means that a relevant amino acid sequence of a protein or a peptide is at least 70%,
75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to a given
sequence. By way of example, such sequences may be variants derived from
various species, or they may be derived from the given sequence by truncation,
deletion, amino acid substitution or addition. Percent identity between two amino
acid sequences is determined by standard alignment algorithms such as, for
example, Basic Local Alignment Tool (BLAST) described in Altschul et al. 1990, J.
Mol. Biol., 215:403-410, the algorithm of Needleman et al. 1970, J. Mol. Biol.,
48:444-453; the algorithm of Meyers et al. 1988, Comput. Appl. Biosci., 4:11-17; or
Tatusova et al. 1999, FEMS Microbiol. Lett., 174:247-250, etc. Such algorithms are
incorporated into the BLASTN, BLASTP and "BLAST 2 Sequences" programs (see
www.ncbi.nlm.nih.gov/BLAST). When utilizing such programs, the default
parameters can be used. For example, for nucleotide sequences the following

settings can be used for "BLAST 2 Sequences": program BLASTN, reward for match
2, penalty for mismatch -2, open gap and extension gap penalties 5 and 2
respectively, gap x_dropoff 50, expect 10, word size 11, filter ON. For amino acid
sequences the following settings can be used for "BLAST 2 Sequences": program
BLASTP, matrix BLOSUM62, open gap and extension gap penalties 11 and 1
respectively, gap x_dropoff 50, expect 10, word size 3, filter ON.
[067] Bioavailability, as used herein, means the extent and rate at which a
substance is absorbed into a living system or is made available at the site of
physiological activity.
[068] Biologically active molecule, as used herein, means a non-
immunoglobulin molecule or fragment thereof, capable of treating a disease or
condition or localizing or targeting a molecuie to a site of a disease or condition in
the body by performing a function or an action, or stimulating or responding to a
function, an action or a reaction, in a biological context (e.g. in an organism, a cell,
or an in vitro model thereof). Biologically active molecules may comprise at least
one of polypeptides, nucleic acids, small molecules such as small organic or
inorganic molecules.
[069] A chimeric protein, as used herein, refers to any protein comprised of
a first amino acid sequence derived from a first source, bonded, covalently or non-
covalently, to a second amino acid sequence derived from a second source, wherein
the first and second source are not the same. A first source and a second source
that are not the same can include two different biological entities, or two different
proteins from the same biological entity, or a biological entity and a non-biological
entity. A chimeric protein can include for example, a protein derived from at least 2

different biological sources. A biological source can include any non-synthetically
produced nucleic acid or amino acid sequence (e.g. a genomic or cDNA sequence,
a plasmid or viral vector, a native virion or a mutant or analog, as further described
herein, of any of the above). A synthetic source can include a protein or nucleic acid
sequence produced chemically and not by a biological system (e.g. solid phase
synthesis of amino acid sequences). A chimeric protein can also include a protein
derived from at least 2 different synthetic sources or a protein derived from at least
one biological source and at least one synthetic source. A chimeric protein may also
comprise a first amino acid sequence derived from a first source, covalently or non-
covalently linked to a nucleic acid, derived from any source or a small organic or
inorganic molecule derived from any source. The chimeric protein may comprise a
linker molecule between the first and second amino acid sequence or between the
first amino acid sequence and the nucleic acid, or between the first amino acid
sequence and the small organic or inorganic molecule.
[070] Clotting factor, as used herein, means any molecule, or analog
thereof, naturally occurring or recombinantly produced which prevents or decreases
the duration of a bleeding episode in a subject with a hemostatic disorder. In other
words, it means any molecule having clotting activity.
[071] Clotting activity, as used herein, means the ability to participate in a
cascade of biochemical reactions that culminates in the formation of a fibrin clot
and/or reduces the severity, duration or frequency of hemorrhage or bleeding
episode.
[072] Dimer as used herein refers to a chimeric protein comprising a first
and second polypeptide chain, wherein the first and second chains both comprise a
20

biologically active molecule, and at least a portion of an immunoglobulin constant
region. A homodimer refers to a dimer where both biologically active molecules are
the same.
[073] Dimerically linked monomer-dimer hybrid refers to a chimeric
protein comprised of at least a portion of an immunloglobulin constant region, e.g. an
Fc fragment of an immunoglobulin, a biologically active molecule and a linker which
links the two together such that one biologically active molecule is bound to 2
polypeptide chains, each comprising a portion of an immunoglobulin constant region.
Figure 4 shows an example of a dimerically linked monomer-dimer hybrid.
[074] DNA construct, as used herein, means a DNA molecule, or a clone of
such a molecule, either single- or double-stranded that has been modified through
human intervention to contain segments of DNA combined in a manner that as a
whole would not otherwise exist in nature. DNA constructs contain the information
necessary to direct the expression of polypeptides of interest. DNA constructs can
include promoters, enhancers and transcription terminators. DNA constructs
containing the information necessary to direct the secretion of a polypeptide will also
contain at least one secretory signal sequence.
[075] Domain, as used herein, means a region of a polypeptide (including
proteins as that term is defined) having some distinctive physical feature or role
including for example an independently folded structure composed of one section of
a polypeptide chain. A domain may contain the sequence of the distinctive physical
feature of the polypeptide or it may contain a fragment of the physical feature which
retains its binding characteristics {i.e., it can bind to a second domain). A domain
21

may be associated with another domain. In other words, a first domain may
naturally bind to a second domain.
[076] A fragment, as used herein, refers to a peptide or polypeptide
comprising an amino acid sequence of at least 2 contiguous amino acid residues, of
at least 5 contiguous amino acid residues, of at least 10 contiguous amino acid
residues, of at least 15 contiguous amino acid residues, of at least 20 contiguous
amino acid residues, of at least 25 contiguous amino acid residues, of at least 40
contiguous amino acid residues, of at least 50 contiguous amino acid residues, of at
least 100 contiguous amino acid residues, or of at least 200 contiguous amino acid
residues or any deletion or truncation of a protein, peptide, or polypeptide.
[077] Hemostasis, as used herein, means the stoppage of bleeding or
hemorrhage; or the stoppage of blood flow through a blood vessel or body part.
[078] Hemostatic disorder, as used herein, means a genetically inherited or
acquired condition characterized by a tendency to hemorrhage, either spontaneously
or as a result of trauma, due to an impaired ability or inability to form a fibrin clot.
[079] Linked, as used herein, refers to a first nucleic acid sequence
covalently joined to a second nucleic acid sequence. The first nucleic acid
sequence can be directly joined or juxtaposed to the second nucleic acid sequence
or alternatively an intervening sequence can covalently join the first sequence to the
second sequence. Linked as used herein can also refer to a first amino acid
sequence covalently, or non-covalently, joined to a second amino acid sequence.
The first amino acid sequence can be directly joined or juxtaposed to the second
amino acid sequence or alternatively an intervening sequence can covalently join
the first amino acid sequence to the second amino acid sequence.
22

[080] Operatively linked, as used herein, means a first nucleic acid
sequence linked to a second nucleic acid sequence such that both sequences are
capable of being expressed as a biologically active protein or peptide.
[081] Polypeptide, as used herein, refers to a polymer of amino acids and
does not refer to a specific length of the product; thus, peptides, oligopeptides, and
proteins are included within the definition of polypeptide. This term does not exclude
post-expression modifications of the polypeptide, for example, glycosylation,
acetylation, phosphorylation, pegylation, addition of a lipid moiety, or the addition of
any organic or inorganic molecule. Included within the definition, are for example,
polypeptides containing one or more analogs of an amino acid (including, for
example, unnatural amino acids) and polypeptides with substituted linkages, as well
as other modifications known in the art, both naturally occurring and non-naturally
occurring.
[082] High stringency, as used herein, includes conditions readily
determined by the skilled artisan based on, for example, the length of the DNA.
Generally, such conditions are defined in Sambrook et al. Molecular Cloning: A
Laboratory Manual, 2 ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory
Press (1989), and include use of a prewashing solution for the nitrocellulose filters
5X SSC, 0.5% SDS, 1.0 mM EDTA (PH 8.0), hybridization conditions of 50%
formamide, 6X SSC at 42°C (or other similar hybridization solution, such as Stark's
solution, in 50% formamide at 42°C, and with washing at approximately 68°C, 0.2X
SSC, 0.1% SDS. The skilled artisan will recognize that the temperature and wash
solution salt concentration can be adjusted as necessary according to factors such
as the length of the probe.
23

[083] Moderate stringency, as used herein, include conditions that can be
readily determined by those having ordinary skill in the art based on, for example,
the length of the DNA. The basic conditions are set forth by Sambrook et al.
Molecular Cloning: A Laboratory Manual, 2d ed. Vol. 1, pp. 1.101-104, Cold Spring
Harbor Laboratory Press (1989), and include use of a prewashing solution for the
nitrocellulose filters 5X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization
conditions of 50% formamide, 6X SSC at 42°C (or other similar hybridization
solution, such as Stark's solution, in 50% formamide at 42°C), and washing
conditions of 60°C, 0.5X SSC, 0.1% SDS.
[084] A small inorganic molecule, as used herein means a molecule
containing no carbon atoms and being no larger than 50 kD.
[085] A small organic molecule, as used herein means a molecule
containing at least one carbon atom and being no larger than 50 kD.
[086] Treat, treatment, treating, as used herein means, any of the
following: the reduction in severity of a disease or condition," the reduction in the
duration of a disease course; the amelioration of one or more symptoms associated
with a disease or condition; the provision of beneficial effects to a subject with a
disease or condition, without necessarily curing the disease or condition, the
prophylaxis of one or more symptoms associated with a disease or condition.
B. Improvements Offered by Certain Embodiments of the Invention
[087] The invention provides for chimeric proteins (monomer-dimer hybrids)
comprising a first and a second polypeptide chain, wherein said first chain comprises
a biologically active molecule and at least a portion of an immunoglobulin constant
region, and said second chain comprises at least a portion of an immunoglobulin
24

constant region without any biologically active molecule or variable region of an
immunoglobulin. Figure 1 contrasts traditional fusion protein dimers with one
example of the monomer-dimer hybrid of the invention. In this example, the
biologically active molecule is EPO and the portion of an immunoglobulin is IgG Fc
region.
[088] Like other chimeric proteins comprised of at least a portion of an
immunoglobulin constant region, the invention provides for chimeric proteins which
afford enhanced stability and increased bioavailability of the chimeric protein
compared to the biologically active molecule alone. Additionally, however, because
only one of the two chains comprises the biologically active molecule, the chimeric
protein has a lower molecular weight than a chimeric protein wherein all chains
comprise a biologically active molecule and while not wishing to be bound by any
theory, this may result in the chimeric protein being more readily transcytosed
across the epithelium barrier, e.g., by binding to the FcRn receptor thereby
increasing the half-life of the chimeric protein. In one embodiment, the invention
thus provides for an improved non-invasive method {e.g. via any mucosal surface,
such as, orally, buccally, sublingually, nasally, rectally, vaginally, or via pulmonary or
occular route) of administering a therapeutic chimeric protein of the invention. The
invention thus provides methods of attaining therapeutic levels of the chimeric
proteins of the invention using less frequent and lower doses compared to previously
described chimeric proteins (e.g. chimeric proteins comprised of at least a portion of
an immunoglobulin constant region and a biologically active molecule, wherein all
chains of the chimeric protein comprise a biologically active molecule).
25

[089] In another embodiment, the invention provides an invasive method,
e.g., subcutaneously, intravenously, of administering a therapeutic chimeric protein
of the invention. Invasive administration of the therapeutic chimeric protein of the
invention provides for an increased half life of the therapeutic chimeric protein which
results in using less frequent and lower doses compared to previously described
chimeric proteins (e.g. chimeric proteins comprised of at least a portion of an
immunoglobulin constant region and a biologically active molecule, wherein all
chains of the chimeric protein comprise a biologically active molecule).
[090] Yet another advantage of a chimeric protein wherein only one of the
chains comprises a biologically active molecule is the enhanced accessibility of the
biologically active molecule for its target cell or molecule resulting from decreased
steric hindrance, decreased hydrophobic interactions, decreased ionic interactions,
or decreased molecular weight compared to a chimeric protein wherein all chains
are comprised of a biologically active molecule.
C. Chimeric Proteins
[091] The invention relates to chimeric proteins comprising one biologically
active molecule, at least a portion of an immunoglobulin constant region, and
optionally at least one linker. The portion of an immunoglobulin will have both an N,
or an amino terminus, and a C, or carboxy terminus. The chimeric protein may have
the biologically active molecule linked to the N terminus of the portion of an
immunoglobulin. Alternatively, the biologically active molecule may be linked to the
C terminus of the portion of an immunoglobulin. In one embodiment, the linkage is a
covalent bond. In another embodiment, the linkage is a non-covalent bond.
26

[092] The chimeric protein can optionally comprise at least one linker; thus,
the biologically active molecule does not have to be directly linked to the portion of
an immunoglobulin constant region. The linker can intervene in between the
biologically active molecule and the portion of an immunoglobulin constant region.
The linker can be linked to the N terminus of the portion of an immunoglobulin
constant region, or the C terminus of the portion of an immunoglobulin constant
region. If the biologically active molecule is comprised of at least one amino acid the
biologically active molecule will have an N terminus and a C terminus and the linker
can be linked to the N terminus of the biologically active molecule, or the C terminus
the biologically active molecule.
[093] The invention relates to a chimeric protein of the formula X-La-F:F or
F:F-I_a-X , wherein X is a biologically active molecule, L is an optional linker, F is at
least a portion of an immunoglobulin constant region and, a is any integer or zero.
The invention also relates to a chimeric protein of the formula Ta-X-La-F:F or Ta-F:F-
La-X, wherein X is a biologically active molecule, L is an optional linker, F is at least
a portion of an immunoglobulin constant region, a is any integer or zero, T is a
second linker or alternatively a tag that can be used to facilitate purification of the
chimeric protein, e.g., a FLAG tag, a histidine tag, a GST tag, a maltose binding
protein tag and (:) represents a chemical association, e.g. at least one non-peptide
bond. In certain embodiments, the chemical association, i.e., (:) is a covalent bond.
In other embodiments, the chemical association, i.e., (:) is a non-covalent
interaction, e.g., an ionic interaction, a hydrophobic interaction, a hydrophilic
interaction, a Van der Waals interaction, a hydrogen bond. It will be understood by
27

the skilled artisan that when a equals zero X will be directly linked to F. Thus, for
example, a may be 0, 1, 2, 3,4, 5, or more than 5.
[094] In one embodiment, the chimeric protein of the invention comprises
the amino acid sequence of figure 2a (SEQ ID NO:6). In one embodiment, the
chimeric protein of the invention comprises the amino acid sequence of figure 2b
(SEQ ID NO:8). In one embodiment, the chimeric protein of the invention comprises
the amino acid sequence of figure 2c (SEQ ID NO:10). In one embodiment, the
chimeric protein of the invention comprises the amino acid sequence of figure 2d
(SEQ ID NO:12). In one embodiment, the chimeric protein of the invention
comprises the amino acid sequence of figure 2e (SEQ ID NO:14). In one
embodiment, the chimeric protein of the invention comprises the amino acid
sequence of figure 2f (SEQ ID NO:16). In one embodiment, the chimeric protein of
the invention comprises the amino acid sequence of figure 2g (SEQ ID NO:18). In
one embodiment, the chimeric protein of the invention comprises the amino acid
sequence of figure 2h (SEQ ID NO:20). In one embodiment, the chimeric protein of
the invention comprises the amino acid sequence of figure 2i (SEQ ID NO:22). In
one embodiment, the chimeric protein of the invention comprises the amino acid
sequence of figure 2j (SEQ ID NO:24). In one embodiment, the chimeric protein of
the invention comprises the amino acid sequence of figure 17b (SEQ ID NO:27).
1. Chimeric Protein Variants
[095] Derivatives of the chimeric proteins of the invention, antibodies against
the chimeric proteins of the invention and antibodies against binding partners of the
chimeric proteins of the invention are all contemplated, and can be made by altering
their amino acids sequences by substitutions, additions, and/or deletions/truncations

or by introducing chemical modification that result in functionally equivalent
molecules. It will be understood by one of ordinary skill in the art that certain amino
acids in a sequence of any protein may be substituted for other amino acids without
adversely affecting the activity of the protein.
[096] Various changes may be made in the amino acid sequences of the
chimeric proteins of the invention or DNA sequences encoding therefore without
appreciable loss of their biological activity, function, or utility. Derivatives, analogs,
or mutants resulting from such changes and the use of such derivatives is within the
scope of the present invention. In a specific embodiment, the derivative is
functionally active, i.e., capable of exhibiting one or more activities associated with
the chimeric proteins of the invention, e.g., FcRn binding, viral inhibition, hemostasis,
production of red blood cells. Many assays capable of testing the activity of a
chimeric protein comprising a biologically active molecule are known in the art.
Where the biologically active molecule is an HIV inhibitor, activity can be tested by
measuring reverse transcriptase activity using known methods {see, e.g., Barre-
Sinoussi et al. 1983, Science 220:868; Gallo et al. 1984, Science 224:500).
Alternatively, activity can be measured by measuring fusogenic activity (see, e.g.,
Nussbaum et al. 1994, J. Virol. 68(9):5411). Where the biological activity is
hemostasis, a StaCLot FVIIa-rTF assay can be performed to assess activity of
Factor Vila derivatives (Johannessen et al. 2000, Blood Coagulation and Fibrinolysis
11:S159).
[097] Substitutes for an amino acid within the sequence may be selected
from other members of the class to which the amino acid belongs (see Table 1).
Furthermore, various amino acids are commonly substituted with neutral amino
29

acids, e.g., alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan,
and methionine (see, e.g., MacLennan et al. 1998, Acta Physiol. Scand. Suppl.
643:55-67; Sasaki et al. 1998, Adv. Biophys. 35:1-24).
TABLE 1

Original
Residues Exemplary
Substitutions Typical
Substitutions
Ala (A) Val, Leu, He Val
Arg (R) Lys, Gin, Asn Lys
Asn (N) Gin Gin
Asp (D) Glu Glu
Cys (C) Ser, Ala Ser
Gin (Q) Asn Asn
Gly (G) Pro, Ala Ala
His (H) Asn, Gin, Lys, Arg Arg
lie (I) Leu, Val, Met, Ala,
Phe, Norleucine Leu
Leu (L) Norleucine, lie, Val,
Met, Ala, Phe He
Lys (K) Arg,
1,4-Diamino-butyric
Acid, Gin, Asn Arg
Met (M) Leu, Phe, lie Leu
Phe (F) Leu, Val, lie, Ala, Tyr Leu
Pro (P) Ala Gly
Ser (S) Thr, Ala, Cys Thr
Thr (T) Ser Ser
Trp(W) Tyr, Phe Tyr
Tyr(Y) Trp, Phe, Thr, Ser Phe
Val (V) lie, Met, Leu, Phe, Ala,
Norleucine Leu
30

2. Biologically Active Molecules
[098] The invention contemplates the use of any biologically active molecule
as the therapeutic molecule of the invention. The biologically active molecule can be
a polypeptide. The biologically active molecule can be a single amino acid. The
biologically active molecule can include a modified polypeptide.
[099] The biologically active molecule can include a lipid molecule (e.g. a
steroid or cholesterol, a fatty acid, a triacylglycerol, glycerophospholipid, or
sphingolipid). The biologically active molecule can include a sugar molecule (e.g.
glucose, sucrose, mannose). The biologically active molecule can include a nucieic
acid molecule (e.g. DNA, RNA). The biologicaJly active molecule can include a small
organic molecule or a small inorganic molecule.
a. Cytokines and Growth Factors
[0100] In one embodiment, the biologically active molecule is a growth
factor, hormone or cytokine or analog or fragment thereof. The biologically active
molecule can be any agent capable of inducing cell growth and proliferation. In a
specific embodiment, the biologically active molecule is any agent which can induce
erythrocytes to proliferate. Thus, one example of a biologically active molecule
contemplated by the invention is EPO. The biologically active molecule can also
include, but is not limited to, RANTES, MIP1a, MIPip, IL-2, IL-3, GM-CSF, growth
hormone, tumor necrosis factor (e.g. TNFa or p).
[0101] The biologically active molecule can include interferon a, whether
synthetically or recombihantly produced, including but not limited to, any one of the
about twenty-five structurally related subtypes, as for example interferon-a2a, now
commercially available for clinical use (ROFERON®, Roche) and interferon-a2b also
31

versions 6T various subtypes, including, but not limited to, commercially available
consensus interferon a (INFERGEN®, Intermune, developed by Amgen) and
consensus human leukocyte interferon see, e.g., U.S. Patent Nos.: 4,695,623;
4,897,471, interferon B, epidermal growth factor, gonadotropin releasing hormone
(GnRH), leuprolide, follicle stimulating hormone, progesterone, estrogen, or
testosterone.
[0102] A list of cytokines and growth factors which may be used in the
chimeric protein of the invention has been previously described (se&, e.g., U.S.
Patent Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1).
b. Antiviral Agents
[0103] In one embodiment, the biologically active molecule is an antiviral
agent, including fragments and analogs thereof. An antiviral agent can include any
molecule that inhibits or prevents viral replication, or inhibits or prevents viral entry
into a ceil, or inhibits or prevents viral egress from a cell. In one embodiment, the
antiviral agent is a fusion inhibitor. In one embodiment, the antiviral agent is a
cytokine which inhibits viral replication. In another embodiment, the antiviral agent is
interferon a.
[0104] The viral fusion inhibitor for use in the chimeric protein can be any
molecule which decreases or prevents viral penetration of a cellular membrane of a
target cell. The viral fusion inhibitor can be any molecule that decreases or prevents
the formation of syncytia between at least two susceptible cells. The viral fusion
inhibitor can be any molecule that decreases or prevents the joining of a lipid bilayer
membrane of a eukaryotic cell and a lipid bilayer of an enveloped virus. Examples
32

of enveloped virus include, but are not limited to HIV-1, HIV-2, SIV, influenza,
parainfluenza, Epstein-Barr virus, CMV, herpes simplex 1, herpes simplex 2 and
respiratory syncytia virus.
[0105] The viral fusion inhibitor can be any molecule that decreases or
prevents viral fusion including, but not limited to, a polypeptide, a small organic
molecule or a small inorganic molecule. In one embodiment, the fusion inhibitor is a
polypeptide. In one embodiment, the viral fusion inhibitor is a polypeptide of 3-36
amino acids. In another embodiment, the viral fusion inhibitor is a polypeptide of 3-
50 amino acids, 10-65 amino acids, 10-75 amino acids. The polypeptide can be
comprised of a naturally occurring amino acid sequence (e.g. a fragment of gp41)
including analogs and mutants thereof or the polypeptide can be comprised of an
amino acid sequence not found in nature, so long as the polypeptide exhibits viral
fusion inhibitory activity.
[0106] In one embodiment, the viral fusion inhibitor is a polypeptide, identified
as being a viral fusion inhibitor using at least one computer algorithm, e.g.,
ALLMOTI5, 107x178x4 and PLZIP {see, e.g., U.S. Patent Nos.: 6,013,263;
6,015,881; 6,017,536; 6,020,459; 6,060,065; 6,068,973; 6,093,799; and 6,228,983).
[0107] In one embodiment, the viral fusion inhibitor is an HIV fusion inhibitor.
In one embodiment, HIV is HIV-1. In another embodiment, HIV is HIV-2. In one
embodiment, the HIV fusion inhibitor is a polypeptide comprised of a fragment of the
gp41 envelope protein of HIV-1. The HIV fusion inhibitor can comprise, e.g., T20
(SEQ ID NO:1) or an analog thereof, T21 (SEQ ID NO:2) or an analog thereof,
T1249 (SEQ ID NO:3) or an analog thereof, NCcGgp41 (Louis et al. 2001, J. Biol.
33

Chem. 276:(31)29485) or an analog thereof, or 5 helix (Root et al. 2001, Science
291:884) or an analog thereof.
[0108] Assays known in the art can be used to test for viral fusion inhibiting
activity of a polypeptide, a small organic molecule, or a small inorganic molecule.
These assays include a reverse transcriptase assay, a p24 assay, or syncytia
formation assay (see, e.g., U.S. Patent No. 5,464,933).
[0109] A list of antiviral agents which may be used in the chimeric protein of
the invention has been previously described (see, e.g., U.S. Patent Nos. 6,086,875,
6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1).
c. Hemostatic Agents
[0110] In one embodiment, the biologically active molecule is a clotting factor
or other agent that promotes hemostasis, including fragments and analogs thereof.
The clotting factor can include any molecule that has clotting activity or activates a
molecule with clotting activity. The clotting factor can be comprised of a polypeptide.
The clotting factor can be, as an example, but not limited to Factor VIII, Factor IX,
Factor XI, Factor XII, fibrinogen, prothrombin, Factor V, Factor VII, Factor X, Factor
XIII or von Willebrand Factor. In one embodiment, the clotting factor is Factor VII or
Factor Vila. The clotting factor can be a factor that participates in the extrinsic
pathway. The clotting factor can be a factor that participates in the intrinsic pathway.
Alternatively, the clotting factor can be a factor that participates in both the extrinsic
and intrinsic pathway.
[0111] The clotting factor can be a human clotting factor or a non-human
clotting factor, e.g., derived from a non-human primate, a pig or any mammal. The
clotting factor can be chimeric clotting factor, e.g., the clotting factor can comprise a
34

portion of a human clotting factor and a portion of a porcine clotting factor or a
portion of a first non-human clotting factor and a portion of a second non-human
clotting factor.
[0112] The clotting factor can be an activated clotting factor. Alternatively, the
clotting factor can be an inactive form of a clotting factor, e.g., a zymogen. The
inactive clotting factor can undergo activation subsequent to being linked to at least
a portion of an immunoglobulin constant region. The inactive clotting factor can be
activated subsequent to administration to a subject. Alternatively, the inactive
clotting factor can be activated prior to administration.
[0113] In certain embodiments an endopeptidase, e.g., paired basic amino
acid cleaving enzyme (PACE), or any PACE family member, such as PCSK1-9,
including truncated versions thereof, or its yeast equivalent Kex2 from S. cerevisiae
and truncated versions of Kex2 (Kex2 1-675) (see, e.g., U.S. Patent Nos. 5,077,204;
5,162,220; 5,234,830; 5,885,821; 6,329,176) may be used to cleave a propetide to
form the mature chimeric protein of the invention {e.g. factor VII, factor IX).
d. Other Proteinaceous Biologically Active Molecules
[0114] In one embodiment, the biologically active molecule is a receptor or a
fragment or analog thereof. The receptor can be expressed on a cell surface, or
alternatively the receptor can be expressed on the interior of the cell. The receptor
can be a viral receptor, e.g., CD4, CCR5, CXCR4, CD21, CD46. The biologically
active molecule can be a bacterial receptor. The biologically active molecule can be
an extra-cellular matrix protein or fragment or analog thereof, important in bacterial
colonization and infection (see, e.g., U.S. Patent Nos.: 5,648,240; 5,189,015;
5,175,096) or a bacterial surface protein important in adhesion and infection (see,

e.g., U.S. Patent No, 5,648,240). The biologically active molecule can be a growth
factor, hormone or cytokine receptor, or a fragment or analog thereof, e.g., TNFa
receptor, the erythropoietin receptor, CD25, CD122, or CD132.
[0115] A list of other proteinaceous molecules which may be used in the
chimeric protein of the invention has been previously described (see, e.g., U.S.
Patent Nos. 6,086,875; 6,485,726; 6,030,613; WO 03/077834; US2003-0235536A1).
e. Nucleic Acids
[0116] In one embodiment, the biologically active molecule is a nucleic acid,
e.g., DNA, RNA. In one specific embodiment, the biologically active molecule is a
nucleic acid that can be used in RNA interference (RNAi). The nucleic acid
molecule can be as an example, but not as a limitation, an anti-sense molecule or a
ribozyme or an aptamer.
[0117] Antisense RNA and DNA molecules act to directly block the translation
of mRNA by hybridizing to targeted mRNA and preventing protein translation.
Antisense approaches involve the design of oligonucleotides that are
complementary to a target gene mRNA. The antisense oligonucleotides will bind to
the complementary target gene mRNA transcripts and prevent translation. Absolute
complementariJy, is not required.
[0118] A sequence "complementary" to a portion of an RNA, as referred to
herein, means a sequence having sufficient complementarity to be able to hybridize
with the RNA, forming a stable duplex; in the case of double-stranded antisense
nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex
formation may be assayed. The ability to hybridize will depend on both the degree
of complementarity and the length of the antisense nucleic acid. Generally, the

longer the hybridizing nucleic acid, the more base mismatches with an RNA it may
contain and stiH-fo-r-m-a-stable duplex^orlripiexras^he-case may be), une sKiiiea in
the art can ascertain a tolerable degree ot mismatch by use ot standard procedures
to determine the melting point of the hybridized complex.
[0119] Antisense nucleic acids should be at least six nucleotides in length,
and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length.
In specific aspects, the oligonucleotide is at least 10 nucleotides, at least 17
nucleotides, at least 25 nucleotides or at least 50 nucleotides.
[0120] The oligonucleotides can be DNA or RNA or chimeric mixtures or
derivatives or modified versions thereof, single-stranded or double-stranded. The
oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate
backbone, for example, to improve stability of the molecule, hybridization, etc. The
oligonucleotide may include other appended groups such as polypeptides (e.g. for
targeting host cell receptors in vivo), or agents facilitating transport across the cell
membrane (see, e.g., Letsinger et al. 1989, Proc. Natl. Acad. Sci USA 86:6553;
Lemaitre et al. 1987, Proc. Natl. Acad. Sci. USA 84:648; WO 88/09810,) or the
blood-brain barrier (see, e.g., WO 89/10134), hybridization-triggered cleavage
agents (see, e.g., Krol et al. 1988, BioTechniques 6:958) or intercalating agents
(see, e.g., Zon 1988, Pharm. Res. 5:539). To this end, the oligonucleotide may be
conjugated to another molecule, e.g., a polypeptide, hybridization triggered cross-
linking agent, transport agent, or hybridization-triggered cleavage agent.
[0121] Ribozyme molecules designed to catalytically cleave target gene
mRNA transcripts can also be used to prevent translation of target gene mRNA and,
37

therefore, expression of target gene product. (See, e.g., WO 90/11364; Sarver et al.
!WG~ScFence 237, 1222^1225).
[0122] Ribozymes are enzymatic RNA molecules capable of catalyzing the
specific cleavage oi RNA. (See Rossi. 1994, Current Biology 4:469). The
mechanism of ribozyme action involves sequence specific hybridization of the
ribozyme molecule to complementary target RNA, followed by an endonucleolytic
cleavage event. The composition of ribozyme molecules must include one or more
sequences complementary to the target gene mRNA, and must include the well
known catalytic sequence responsible for mRNA cleavage. For this sequence, see,
e.g., U.S. Pat. No. 5,093,246.
[0123] In one embodiment, ribozymes that cleave mRNA at site specific
recognition sequences can be used to destroy target gene mRNAs. In another
embodiment, the use of hammerhead ribozymes is contemplated. Hammerhead
ribozymes cleave mRNAs at locations dictated by flanking regions that form
complementary base pairs with the target mRNA. The sole requirement is that the
target mRNA have the following sequence of two bases: 5'-UG-3'. The construction
and production of hammerhead ribozymes is well known in the art and is described
more fully in Myers 1995, Molecular Biology and Biotechnology: A Comprehensive
Desk Reference, VCH Publishers, New York, and in Haseloff and Gerlach 1988,
Nature, 334:585.
f. Small Molecules
[0124] The invention also contemplates the use of any therapeutic small
molecule or drug as the biologically active molecule in the chimeric protein of the
invention. A list of small molecules and drugs which may be used in the chimeric
38

protein of the invention has been previously described (see, e.g., U.S. Patent Nlos.
6,086,875; 6,485,726; 6,030,613; WO 03/077834; US2003-0235536A1).
2. Immunoglobulins
[0125] The chimeric proteins of the invention comprise at least a portion of an
immunoglobulin constant region. Immunoglobulins are comprised of four protein
chains that associate covalently—two heavy chains and two light chains. Each
chain is further comprised of one variable region and one constant region.
Depending upon the immunoglobulin isotype, the heavy chain constant region is
comprised of 3 or 4 constant region domains (e.g. CH1, CH2, CH3, CH4). Some
isotypes are further comprised of a hinge region.
[0126] The portion of an immunoglobulin constant region can be obtained
from any mammal. The portion of an immunoglobulin constant region can include a
portion of a human immunoglobulin constant region, a non-human primate
immunoglobulin constant region, a bovine immunoglobulin constant region, a
porcine immunoglobulin constant region, a murine immunoglobulin constant region,
an ovine immunoglobulin constant region or a rat immunoglobulin constant region.
[0127] The portion of an immunoglobulin constant region can be produced
recomb/nantly or synthetically. The immunoglobulin can be isolated from a cDNA
library. The portion of an immunoglobulin constant region can be isolated from a
phage library (See, e.g., McCafferty etal. 1990, Nature 348:552, Kang et al. 1991,
Proc. Natl. Acad. Set. USA 88:4363; EP 0 589 877 B1). The portion of an
immunoglobulin constant region can be obtained by gene shuffling of known
sequences (Mark et al. 1992, Bio/Technol. 10:779). The portion of an
immunoglobulin constant region can be isolated by in vivo recombination

(Waterhouse et at. 1993, Nucl. Add Res. 21:2265). The immunoglobulin can be a
humanized immunoglobulin (U.S. Patent No. 5,585,089, Jones etal. 1986, Nature
332:323).
[0128] The portion of an immunoglobulin constant region can include a portion
of an IgG, an IgA, an IgM, an IgD, or an IgE. In one embodiment, the
immunoglobulin is an IgG. In another embodiment, the immunoglobulin is lgG1. In
another embodiment, the immunoglobulin is lgG2.
[0129}The portion of an immunoglobulin constant region can include the
entire heavy chain constant region, or a fragment or analog thereof. In one
embodiment, a heavy chain constant region can comprise a CH1 domain, a CH2
domain, a CH3 domain, and/or a hinge region. In another embodiment, a heavy
chain constant region can comprise a CH1 domain, a CH2 domain, a CH3 domain,
and/or a CH4 domain.
[0130] The portion of an immunoglobulin constant region can include an Fc
fragment. An Fc fragment can be comprised of the CH2 and CH3 domains of an
immunoglobulin and the hinge region of the immunoglobulin. The Fc fragment can
be the Fc fragment of an lgG1, an lgG2, an lgG3 or an lgG4. In one specific
embodiment, the portion of an immunoglobulin constant region is an Fc fragment of
an lgG1. In another embodiment, the portion of an immunoglobulin constant region
is an Fc fragment of an lgG2.
[0131] In another embodiment, the portion of an immunoglobulin constant
region is an Fc neonatal receptor (FcRn) binding partner. An FcRn binding partner
is any molecule that can be specifically bound by the FcRn receptor with consequent
active transport by the FcRn receptor of the FcRn binding partner. Specifically
40

bound refers to two molecules forming a complex that is relatively stable under
plTyioloic'condilionSpeitlcnDindlng is characterizecTby a high affinity and a low
to moderate capacity as distinguished from nonspecific binding which usually has a
low affinity with a moderate to high capacity. Typically, binding is considered
specific when the affinity constant KA is higher than 106 M"1, or more preferably
higher than 108 M"1. If necessary, non-specific binding can be reduced without
substantially affecting specific binding by varying the binding conditions. The
appropriate binding conditions such as concentration of the molecules, ionic strength
of the solution, temperature, time allowed for binding, concentration of a blocking
agent (e.g. serum albumin, milk casein), etc., may be optimized by a skilled artisan
using routine techniques.
[0132] The FcRn receptor has been isolated from several mammalian species
including humans. The sequences of the human FcRn, monkey FcRn rat FcRn, and
mouse FcRn are known (Story et al. 1994, J. Exp. Med. 180:2377). The FcRn
receptor binds IgG (but not other immunoglobulin classes such as IgA, IgM, IgD, and
IgE) at relatively low pH, actively transports the IgG transcellularly in a luminal to
serosal direction, and then releases the IgG at relatively higher pH found in the
interstitial fluids. It is expressed in adult epithelial tissue (U.S. Patent Nos.
6,485,726, 6,030,613, 6,086,875; WO 03/077834; US2003-0235536A1) including
lung and intestinal epithelium (Israel et al. 1997, Immunology 92:69) renal proximal
tubular epithelium (Kobayashi et al. 2002, Am. J. Physiol. Renal Physiol. 282:F358)
as well as nasal epithelium, vaginal surfaces, and biliary tree surfaces.
[0133] FcRn binding partners of the present invention encompass any
molecule that can be specifically bound by the FcRn receptor including whole IgG,
41

the Fc fragment of IgG, and other fragments that include the complete binding region
ottfieTcRh receptorTThe region of the Fc portion of IgG that binds to the FcRn
receptor has been described based on X-ray crystallography (Burmeister et al. 1994,
Nature 372:379). The major contact area of the Fc with the FcRn is near the
junction of the CH2 and CH3 domains. Fc-FcRn contacts are all within a single Ig
heavy chain. The FcRn binding partners include whole IgG, the Fc fragment of IgG,
and other fragments of IgG that include the complete binding region of FcRn. The
major contact sites include amino acid residues 248, 250-257, 272, 285, 288, 290-
291, 308-311, and 314 of the CH2 domain and amino acid residues 385-387, 428,
and 433-436 of the CH3 domain. References made to amino acid numbering of
immunoglobulins or immunoglobulin fragments, or regions, are all based on Kabat et
al. 1991, Sequences of Proteins of Immunological Interest, U.S. Department of
Public Health, Bethesda, MD.
[0134] The Fc region of IgG can be modified according to well recognized
procedures such as site directed mutagenesis and the like to yield modified IgG or
Fc fragments or portions thereof that will be bound by FcRn. Such modifications
include modifications remote from the FcRn contact sites as well as modifications
within the contact sites that preserve or even enhance binding to the FcRn. For
example, the following single amino acid residues in human lgG1 Fc (Fcy1) can be
substituted without significant loss of Fc binding affinity for FcRn: P238A, S239A,
K246A, K248A, D249A, M252A, T256A, E258A, T260A, D265A, S267A, H268A,
E269A, D270A, E272A, L274A, N276A, Y278A, D280A, V282A, E283A, H285A,
N286A, T289A, K290A, R292A, E293A, E294A, Q295A, Y296F, N297A, S298A,
Y300F, R301A, V303A, V305A, T307A, L309A, Q311A, D312A, N315A, K317A,

E318A, K320A, K322A, S324A, K326A, A327Q, P329A, A330Q, P331 A, E333A,
K334ArT335ATS337A:i E356A, M358A, T359A, K360A, N361A, Q362A, Y373A, S375A, D376A, A378Q,
E380A, E382A, S383A ,N384A, Q386A, E388A, N389A, N390A, Y391F, K392A,
L398A, S400A, D401A, D413A, K414A, R416A, Q418A, Q419A, N421A, V422A,
S424A, E430A, N434A, T437A, Q438A, K439A, S440A, S444A, and K447A, where
for example P238A represents wildtype proline substituted by alanine at position
number 238, As an example, one specifc embodiment, incorporates the N297A
mutation, removing a highly conserved N-glycosylation site. In addition to alanine
other amino acids may be substituted for the wildtype amino acids at the positions
specified above. Mutations may be introduced singly into Fc giving rise to more than
one hundred FcRn binding partners distinct from native Fc. Additionally,
combinations of two, three, or more of these individual mutations may be introduced
together, giving rise to hundreds more FcRn binding partners. Moreover, one of the
FcRn binding partners of the monomer-dimer hybrid may be mutated and the other
FcRn binding partner not mutated at all, or they both may be mutated but with
different mutations. Any of the mutations described herein, including N297A, may
be used to modify Fc, regardless of the biologically active molecule (e.g., EPO, IFN,
Factor IX, T20).
[0135] Certain of the above mutations may confer new functionality upon the
FcRn binding partner. For example, one embodiment incorporates N297A,
removing a highly conserved N-glycosylation site. The effect of this mutation is to
reduce immunogenicity, thereby enhancing circulating half life of the FcRn binding
partner, and to render the FcRn binding partner incapable of binding to FcyRI,
43

FcyRIlA, FcvRliB, and FcyRIIIA, without compromising affinity for FcRn (Routiedge
et al. 1995, Transplantation 60:847; Friend et al. 1999, Transplantation 68:1632;
Shields et al. 1995, J. Biol. Chem. 276:6591). As a further example of new
functionality arising from mutations described above affinity for FcRn may be
increased beyond that of wild type in some instances. This increased affinity may
reflect an increased "on" rate, a decreased "off rate or both an increased "on" rate
and a decreased "off' rate. Mutations believed to impart an increased affinity for
FcRn include T256A, T307A, E380A, and N434A (Shields et al. 2001, J. Biol. Chem.
276:6591).
[0136] Additionally, at least three human Fc gamma receptors appear to
recognize a binding site on IgG within the lower hinge region, generally amino acids
234-237. Therefore, another example of new functionality and potential decreased
immunogenicity may arise from mutations of this region, as for example by replacing
amino acids 233-236 of human lgG1 "ELLG" to the corresponding sequence from
lgG2 "PVA" (with one amino acid deletion). It has been shown that FcyRI, FcyRII,
and FcyRHI, which mediate various effector functions will not bind to lgG1 when
such mutations have been introduced. Ward and Ghetie 1995, Therapeutic
immunology 2:77 and Armour et al.1999, Eur. J. Immunol. 29:2613.
[0137] In one embodiment, the FcRn binding partner is a polypeptide
including the sequence PKNSSMISNTP (SEQ ID NO:26) and optionally further
including a sequence selected from HQSLGTQ (SEQ ID NO:27), HQNLSDGK (SEQ
ID NO:28), HQNISDGK (SEQ ID NO:29), orVISSHLGQ (SEQ ID NO:30) (U.S.
Patent No. 5,739,277).
44

[0138] Two FcRn receptors can bind a single Fc molecule. Crystallographic
data suggest that each FcRn molecule binds a single polypeptide of the Fc
homodimer. In one embodiment, linking the FcRn binding partner, e.g., an Fc
fragment of an IgG, to a biologically active molecule provides a means of delivering
the biologically active molecule orally, buccally, sublingually, rectally, vaginally, as
an aerosol administered nasally or via a pulmonary route, or via an ocular route. In
another embodiment, the chimeric protein can be administered invasively, e.g.,
subcutaneously, intravenously.
[0139] The skilled artisan will understand that portions of an immunoglobulin
constant region for use in the chimeric protein of the invention can include mutants
or analogs thereof, or can include chemically modified immunoglobulin constant
regions (e.g. pegylated), or fragments thereof (see, e.g., Aslam and Dent 1998,
Bioconjugation: Protein Coupling Techniques For the Biomedical Sciences Macmilan
Reference, London). In one instance, a mutant can provide for enhanced binding of
an FcRn binding partner for the FcRn. Also contemplated for use in the chimeric
protein of the invention are peptide mimetics of at least a portion of an
immunoglobulin constant region, e.g., a peptide mimetic of an Fc fragment or a
peptide mimetic of an FcRn binding partner. In one embodiment, the peptide
mimetic is identified using phage display or via chemical library screening (see, e.g.,
McCafferty et al. 1990, Nature 348:552, Kang et al. 1991, Proc. Natl. Acad. Sci. USA
88:4363; EP 0 589 877 B1).
3. Optional Linkers
[0140] The chimeric protein of the invention can optionally comprise at least
one linker molecule. The linker can be comprised of any organic molecule. In one

embodiment, the linker is polyethylene glycol (PEG). In another embodiment, the
linker is comprised of amino acids. The linker can comprise 1-5 amino acids, 1-10
amino acids, 1-20 amino acids, 10-50 amino acids, 50-100 amino acids, 100-200
amino acids. In one embodiment, the linker is the eight amino acid linker
EFAGAAAV (SEQ ID NO:31). Any of the linkers described herein may be used in
the chimeric protein of the invention, e.g., a monomer-dimer hybrid, including
EFAGAAAV, regardless of the biologically active molecule (e.g. EPO, IFN, Factor
IX).
[0141] The linker can comprise the sequence Gn. The linker can comprise the
sequence (GA)n(SEQ ID NO:32). The linker can comprise the sequence (GGS)n
(SEQ ID NO:33). The linker can comprise the sequence (GGS)n(GGGGS)n(SEQ ID
NO:34). In these instances, n may be an integer from 1-10, i.e., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10. Examples of linkers include, but are not limited to, GGG (SEQ ID NO:35),
SGGSGGS (SEQ ID NO:36), GGSGGSGGSGGSGGG (SEQ ID NO:37),
GGSGGSGGGGSGGGGS (SEQ ID NO:38), GGSGGSGGSGGSGGSGGS (SEQ ID
NO:39). The linker does not eliminate or diminish the biological activity of the
chimeric protein. Optionally, the linker enhances the biological activity of the
chimeric protein, e.g., by further diminishing the effects of steric hindrance and
making the biologically active molecule more accessible to its target binding site.
[0142] In one specific embodiment, the linker for interferon a is 15-25 amino
acids long. In another specific embodiment, the linker for interferon a is 15-20 amino
acids long. In another specific embodiment, the linker for interferon a is 10-25 amino
acids long. In another specific embodiment, the linker for interferon a is 15 amino
acids long. In one embodiment, the linker for interferon a is (GGGGS)n (SEQ ID

NO:40) where G represents glycine, S represents serine and n is an integer from 1-
10. In a specific embodiment, n is 3.
[0143] The linker may also incorporate a moiety capable of being cleaved
either chemically (e.g. hydrolysis of an ester bond), enzymatically (i.e. incorporation
of a protease cleavage sequence) or photolytically (e.g.,a chromophore such as 3-
amino-3-(2-nitrophenyl) proprionic acid (ANP)) in order to release the biologically
active molecule from the Fc protein.
4. Chimeric Protein Dimerization Using Specific Binding Partners
[0144] In one embodiment, the chimeric protein of the invention comprises a
first polypeptide chajn comprising at least a first domain, said first domain having at
least one specific binding partner, and a second polypeptide chain comprising at
least a second domain, wherein said second domain, is a specific binding partner of
said first domain. The chimeric protein thus comprises a polypeptide capable of
dimerizing with another polypeptide due to the interaction of the first domain and the
second domain. Methods of dimerizing antibodies using heterologous domains are
known in the art (U.S. Patent Nos.: 5,807,706 and 5,910,573; Kostelny et al. 1992, J.
Immunol. 148(5): 1547).
[0145] Dimerization can occur by formation of a covalent bond, or
alternatively a non-covalent bond, e.g., hydrophobic interaction, Van der Waal's
forces, interdigitation of amphiphilic peptides such as, but not limited to, alpha
helices, charge-charge interactions of amino acids bearing opposite charges, such
as, but not limited to, lysine and aspartic acid, arginine and glutamic acid. In one
embodiment, the domain is a helix bundle comprising a helix, a turn and another
helix. In another embodiment, the domain is a leucine zipper comprising a peptide
47

having several repeating amino acids in which every seventh amino acid is a leucine
residue. In one embodiment, the specific binding partners are fos/jun. (see Branden
et al. 1991, Introduction To Protein Structure, Garland Publishing, New York).
[0146] In another embodiment, binding is mediated by a chemical linkage
(see, e.g., Brennan et al. 1985, Science 229:81). In this embodiment, intact
immunoglobulins, or chimeric proteins comprised of at least a portion of an
immunoglobulin constant region are cleaved to generate heavy chain fragments.
These fragments are reduced in the presence of the dithiol complexing agent
sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide
formation. The fragments generated are then converted to thionitrobenzoate (TNB)
derivatives. One of the TNB derivatives is then reconverted to the heavy chain
fragment thiol by reduction with mercaptoethylamine and is then mixed with an
equimolar amount of the other TNB derivative to form a chimeric dimer.
D. Nucleic Acids
[0147] The invention relates to a first nucleic acid construct and a second
nucleic acid construct each comprising a nucleic acid sequence encoding at least a
portion of the chimeric protein of the invention. In one embodiment, the first nucleic
acid construct comprises a nucleic acid sequence encoding a portion of an
immunoglobulin constant region operatively linked to a second DNA sequence
encoding a biologically active molecule, and said second DNA construct comprises a
DNA sequence encoding an immunoglobulin constant region without the second
DNA sequence encoding a biologically active molecule.
[0148] The biologically active molecule can include, for example, but not as a
limitation, a viral fusion inhibitor, a clotting factor, a growth factor or hormone, or a

receptor, or analog, or fragment of any of the preceding. The nucleic acid
sequencescwalsd include: additional sequences or elements known in the art (e.g.,
promoters, enhancers, poly A sequences, affinity tags). In one embodiment, the
nucleic acid sequence of the second construct can optionally include a nucleic acid
sequence encoding a linker placed between the nucleic acid sequence encoding the
biologically active molecule and the portion of the immunoglobulin constant region.
The nucleic acid sequence of the second DNA construct can optionally include a
linker sequence placed before or after the nucleic acid sequence encoding the
biologically active molecule and/or the portion of the immunoglobulin constant
region.
[0149] In one embodiment, the nucleic acid construct is comprised of DNA. In
another embodiment, the nucleic acid construct is comprised of RNA. The nucleic
acid construct can be a vector, e.g., a viral vector or a plasmid. Examples of viral
vectors include, but are not limited to adeno virus vector, an adeno associated virus
vector or a murine leukemia virus vector. Examples of plasmids include but are not
limited to pUC, pGEM and pGEX.
[0150] In one embodiment, the nucleic acid construct comprises the nucleic
acid sequence of figure 3a (SEQ ID NO:7). In one embodiment, the nucleic acid
construct comprises the nucleic acid sequence of figure 3b (SEQ ID NO:9 ). In one
embodiment, the nucleic acid construct comprises the nucleic acid sequence of
figure 3c (SEQ ID NO:11). In one embodiment, the nucleic acid construct comprises
the nucleic acid sequence of figure 3d (SEQ ID NO:13). In one embodiment, the
nucleic acid construct comprises the nucleic acid sequence of figure 3e (SEQ ID
NO:15). In one embodiment, the nucleic acid construct comprises the nucleic acid

sequence of figure 3f (SEQ ID NO:17). In one embodiment, the nucleic acid
construct comprises the nucleic acid sequence of figure 3g (SEQ ID NO:19). In one
embodiment, the nucleic acid construct comprises the nucleic acid sequence of
figure 3h (SEQ ID NO:21). In one embodiment, the nucleic acid construct comprises
the nucleic acid sequence of figure 3i (SEQ ID NO:23). In one embodiment, the
nucleic acid construct comprises the nucleic acid sequence of figure 3j (SEQ ID
NO:25). In one embodiment, the nucleic acid construct comprises the nucleic acid
sequence of figure 17a (SEQ ID NO:27).
[0151] Due to the known degeneracy of the genetic code, wherein more than
one codon can encode the same amino acid, a DNA sequence can vary from that
shown in SEQ ID NOS:7, 9, 11, 13, 15, 17, 19, 21, 23, 25 or 27 and still encode a
polypeptide having the corresponding amino acid sequence of SEQ ID NOS:6, 8, 10,
12,14,16,18, 20, 22, 24 or 26 respectively. Such variant DNA sequences can
result from silent mutations (e.g. occurring during PCR amplification), or can be the
product of deliberate mutagenesis of a native sequence. The invention thus
provides isolated DNA sequences encoding polypeptides of the invention, chosen
from: (a) DNA comprising the nucleotide sequence of SEQ ID NOS:7, 9, 11, 13, 15,
17, 19, 21, 23, 25 or 27; (b) DNA encoding the polypeptides of SEQ ID NOS:6, 8,
10,12,14,16, 18, 20, 22, 24 or 26; (c) DNA capable of hybridization to a DNA of (a)
or (b) under conditions of moderate stringency and which encodes polypeptides of
the invention; (d) DNA capable of hybridization to a DNA of (a) or (b) under
conditions of high stringency and which encodes polypeptides of the invention, and
(e) DNA which is degenerate as a result of the genetic code to a DNA defined in (a),
S"

(b), (c), or (d) and which encode polypeptides of the invention. Of course,
polypeptides encoded by such UNA sequences are encompassed by the invention.
[0152] In another embodiment, the nucleic acid molecules comprising a
sequence encoding the chimeric protein of the invention can also comprise
nucleotide sequences that are at least 80% identical to a native sequence. Also
contemplated are embodiments in which a nucleic acid molecules comprising a
sequence encoding the chimeric protein of the invention comprises a sequence that
is at least 90% identical, at least 95% identical, at least 98% identical, at least 99%
identical, or at least 99.9% identical to a native sequence. A native sequence can
include any DNA sequence not altered by the human hand. The percent identity
may be determined by visual inspection and mathematical calculation. Alternatively,
the percent identity of two nucleic acid sequences can be determined by comparing
sequence information using the GAP computer program, version 6.0 described by
Devereux et al. 1984, Nucl. Acids Res. 12:387, and available from the University of
Wisconsin Genetics Computer Group (UWGCG). The preferred default parameters
for the GAP program include: (1) a unary comparison matrix (containing a value of 1
for identities and 0 for non identities) for nucleotides, and the weighted comparison
matrix of Gribskov and Burgess 1986, Nucl. Acids Res. 14:6745, as described by
Schwartz and Dayhoff, eds. 1979, Atlas of Protein Sequence and Structure, National
Biomedical Research Foundation, pp. 353-358; (2) a penalty of 3.0 for each gap and
an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end
gaps. Other programs used by one skilled in the art of sequence comparison may
also be used.
F!

E. Synthesis of Chimeric Proteins
[0153]X:Tnmeric~proteins comprising at least a portion of an immunoglobulin
constant region and a biologically active molecule can be synthesized using
techniques well known in the art. For example, the chimeric proteins of the invention
can be synthesized recombinantly in cells (see, e.g., Sambrook et al. 1989,
Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and
Ausubel et al. 1989, Current Protocols in Molecular Biology, Greene Publishing
Associates and Wiley Interscience, N.Y.). Alternatively, the chimeric proteins of the
invention can be synthesized using known synthetic methods such as solid phase
synthesis. Synthetic techniques are well known in the art (see, e.g., Merr/field, 1973,
Chemical Polypeptides, (Katsoyannis and Panayotis eds.) pp. 335-61; Merrifield
1963, J. Am. Chem. Soc. 85:2149; Davis et al. 1985, Biochem. Intl. 10:394; Finn et
al. 1976, The Proteins (3d ed.) 2:105; Erikson et al. 1976, The Proteins (3d ed.)
2:257; U.S. Patent No. 3,941,763. Alternatively, the chimeric proteins of the
invention can be synthesized using a combination of recombinant and synthetic
methods. In certain applications, it may be beneficial to use either a recombinant
method or a combination of recombinant and synthetic methods.
[0154] Nucleic acids encoding a biologically active molecule can be readily
synthesized using recombinant techniques well known in the art. Alternatively, the
peptides themselves can be chemically synthesized. Nucleic acids of the invention
may be synthesized by standard methods known in the art, e.g., by use of an
automated DNA synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be
synthesized by the method of Stein et al. 1988, Nucl. Acids Res. 16:3209,

methylphosphonate oligonucleotides can be prepared by use of controlled pore
glass polymer supports as described in Sarin et al. 1988, Proc. Natl. Acad. Sci. USA
85:7448. Additional methods of nucleic acid synthesis are known in the art. (see,
e.g., U.S. Patent Nos. 6,015,881; 6,281,331; 6,469,136).
[0155] DNA sequences encoding immunoglobulin constant regions, or
fragments thereof, may be cloned from a variety of genomic or cDNA libraries known
in the art. The techniques for isolating such DNA sequences using probe-based
methods are conventional techniques and are well known to those skilled in the art.
Probes for isolating such DNA sequences may be based on published DNA
sequences (see, for example, Hieter et al. 1980, Cell 22:197-207). The polymerase
chain reaction (PCR) method disclosed by Mullis et al. (U.S. Patent No. 4,683,195)
and Mullis (U.S. Patent No. 4,683,202) may be used. The choice of library and
selection of probes for the isolation of such DNA sequences is within the level of
ordinary skill in the art. Alternatively, DNA sequences encoding immunoglobulins or
fragments thereof can be obtained from vectors known in the art to contain
immunoglobulins or fragments thereof.
[0156] For recombinant production, a first polynucleotide sequence encoding
a portion of the chimeric protein of the invention (e.g. a portion of an immunoglobulin
constant region) and a second polynucleotide sequence encoding a portion of the
chimeric protein of the invention (e.g. a portion of an immunoglobulin constant region
and a biologically active molecule) are inserted into appropriate expression vehicles,
I.e. vectors which contains the necessary elements for the transcription and
translation of the inserted coding sequence, or in the case of an RNA viral vector,
S"Z

the necessary elements for replication and translation. The nucleic acids encoding
the chimeric protein are inserted into the vector in proper reading frame.
[0157] The expression vehicles are then transfected or co-transfected into a
suitable target cell, which will express the polypeptides. Transfection techniques
known in the art include, but are not limited to, calcium phosphate precipitation
(Wigler et al. 1978, Cell 14:725) and electroporation (Neumann et al. 1982, EMBO,
J. 1:841), and liposome based reagents. A variety of host-expression vector
systems may be utilized to express the chimeric proteins described herein including
both prokaryotic or eukaryotic cells. These include, but are not limited to,
microorganisms such as bacteria (e.g. E. coli) transformed with recombinant
bacteriophage DNA or plasmid DNA expression vectors containing an appropriate
coding sequence; yeast or filamentous fungi transformed with recombinant yeast or
fungi expression vectors containing an appropriate coding sequence; insect cell
systems infected with recombinant virus expression vectors (e.g. baculovirus)
containing an appropriate coding sequence; plant cell systems infected with
recombinant virus expression vectors (e.g. cauliflower mosaic virus or tobacco
mosaic virus) or transformed with recombinant plasmid expression vectors (e.g. Ti
plasmid) containing an appropriate coding sequence; or animal cell systems,
including mammalian cells (e.g. CHO, Cos, HeLa cells).
[0158] When the chimeric protein of the invention is recombinantly
synthesized in a prokaryotic cell it may be desirable to refold the chimeric protein.
The chimeric protein produced by this method can be refolded to a biologically active
conformation using conditions known in the art, e.g., denaturing under reducing
conditions and then dialyzed slowly into PBS.

[0159] Depending on the expression system used, the expressed chimeric
protein"is the"nIsolated byrpfocedures well-established in the art (e.g. affinity
chromatography, size exclusion chromatography, ion exchange chromatography).
[0160] The expression vectors can encode for tags that permit for easy
purification of the recombinantly produced chimeric protein. Examples include, but
are not limited to vector pUR278 (Ruther et al. 1983, EMBO J. 2:1791) in which the
chimeric protein described herein coding sequences may be ligated into the vector in
frame with the lac z coding region so that a hybrid protein is produced; pGEX
vectors may be used to express chimeric proteins of the invention with a glutathione
S-transferase (GST) tag. These proteins are usuaffy so/ubfe and can easify be
purified from cells by adsorption to glutathione-agarose beads followed by elution in
the presence of free glutathione. The vectors include cleavage sites (thrombin or
Factor Xa protease or PreScission Protease™ (Pharmacia, Peapack, N.J.)) for easy
removal of the tag after purification.
[0161] To increase efficiency of production, the polynucleotides can be
designed to encode multiple units of the chimeric protein of the invention separated
by enzymatic cleavage sites. The resulting polypeptide can be cleaved (e.g. by
treatment with the appropriate enzyme) in order to recover the polypeptide units.
This can increase the yield of polypeptides driven by a single promoter. When used
in appropriate viral expression systems, the translation of each polypeptide encoded
by the mRNA is directed internally in the transcript; e.g., by an internal ribosome
entry site, IRES. Thus, the polycistronic construct directs the transcription of a
single, large polycistronic mRNA which, in turn, directs the translation of multiple,
individual polypeptides. This approach eliminates the production and enzymatic

processing of polyproteins and may significantly increase yield of polypeptide driven
by a single promoter.
[0162] Vectors used in transformation will usually contain a selectable marker
used to identify transformants. In bacterial systems, this can include an antibiotic
resistance gene such as ampicillin or kanamycin. Selectable markers for use in
cultured mammalian cells include genes that confer resistance to drugs, such as
neomycin, hygromycin, and methotrexate. The selectable marker may be an
amplifiable selectable marker. One amplifiable selectable marker is the DHFR gene.
Another amplifiable marker is the DHFR cDNA (Simonsen and Levinson 1983, Proc.
Natl. Acad. Sci. USA 80:2495). Selectable markers are reviewed by Thilly
(Mammalian Cell Technology, Butterworth Publishers, Stoneham, MA) and the
choice of selectable markers is well within the level of ordinary skill in the art.
[0163] Selectable markers may be introduced into the cell on a separate
plasmid at the same time as the gene of interest, or they may be introduced on the
same plasmid. If on the same plasmid, the selectable marker and the gene of
interest may be under the control of different promoters or the same promoter, the
latter arrangement producing a dicistronic message. Constructs of this type are
known in the art (for example, U.S. Pat. No. 4,713,339).
[0164] The expression elements of the expression systems vary in their
strength and specificities. Depending on the host/vector system utilized, any of a
number of suitable transcription and translation elements, including constitutive and
inducible promoters, may be used in the expression vector. For example, when
cloning in bacterial systems, inducible promoters such as pL of bacteriophage A,
plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used; when cloning in
J>Z

usedf when cloning in plantxeil systemsTpronTolWsnaeTived trom the aenome of
plant cells (e.g. heat shock promoters; the promoter forthe small subunit of
RUB1SCO; the promoter for the chlorophyll a/b binding protein) or from plant viruses
(e.g. the 35S RNA promoter of CaMV; the coat protein promoter of TMV) may be
used; when cloning in mammalian cell systems, promoters derived from the genome
of mammalian cells (e.g. metallothionein promoter) or from mammalian viruses (e.g.
the adenovirus late promoter; the vaccinia virus 7.5 K promoter) may be used; when
generating ceil lines that contain muiiipie copies of expression product, SV40-, BPV-
and EBV-based vectors may be used with an appropriate selectable marker.
[0165] In cases where plant expression vectors are used, the expression of
sequences encoding linear or non-cyclized forms of the chimeric proteins of the
invention may be driven by any of a number of promoters. For example, viral
promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brissori et al.
1984, Nature 310:511-514), or the coat protein promoter of TMV (Takamatsu et al.
1987, EMBO J. 6:307-311) may be used; alternatively, plant promoters such as the
small subunit of RUBISCO (Coruzzi et al. 1984, EMBO J. 3:1671-1680; Broglie et al.
1984, Science 224:838-843) or heat shock promoters, e.g., soybean hsp17.5-E or
hsp17.3-B (Gurley et al. 1986, Mol. Cell. Biol. 6:559-565) may be used. These
constructs can be introduced into plant cells using Ti plasmids, Ri plasmids, plant
virus vectors, direct DNA transformation, microinjection, electroporation, etc. For
reviews of such techniques see, e.g., Weissbach & Weissbach 1988, Methods for
Plant Molecular Biology, Academic Press, NY, Section VIII, pp. 421-463; and
Grierson & Corey 1988, Plant Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9.
s")

cbime71c~ple1ns~of the Invention, Auiographa californica nuclear polyhidrosis virus
(AcNPV) is used as a vector to express the foreign genes. The virus grows in
Spodoptera frugiperda cells. A coding sequence may be cloned into non-essential
regions (for example, the polyhedron gene) of the virus and placed under control of
an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of
a coding sequence will result in inactivation of the polyhedron gene and production
of non-occluded recombinant virus (i.e. virus lacking the proteinaceous coat coded
for by the poiyhedron gene). These recombinant viruses are then used to infect
Spodoptera frugiperda cells in which the inserted gene is expressed, (see, e.g.,
Smith et al. 1983, J. Virol. 46:584; U.S. Patent No. 4,215,051). Further examples of
this expression system may be found in Ausubel et al., eds. 1989, Current Protocols
in Molecular Biology, Vol. 2, Greene Publish. Assoc. & Wiley Interscience.
[0167] Another system which can be used to express the chimeric proteins of
the invention is the glutamine synthetase gene expression system, also referred to
as the "GS expression system" (Lonza Biologies PLC, Berkshire UK). This
expression system is described in detail in U.S. Patent No. 5,981,216.
[0168] In mammalian host cells, a number of viral based expression systems
may be utilized. In cases where an adenovirus is used as an expression vector, a
coding sequence may be ligated to an adenovirus transcription/translation control
complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene
may then be inserted in the adenovirus genome by in vitro or in vivo recombination.
Insertion in a non-essential region of the viral genome (e.g. region E1 or E3) will
result in a recombinant virus that is viable and capable of expressing peptide in
J-S

infected hosts (see, e.g., Logan & Shenk 1984, Proc. Natl. Acad. Sci. USA 81:3655).
Alternatively, the vaccinia 7.5K~promoter may be used (see, e.g., Mackett et al.
1982, Proc. Natl. Acad. Sci. USA 79:7415; Mackett et al. 1984, J. Virol. 49:857;
Panicali et al. 1982, Proc. Natl. Acad. Sci. USA 79:4927).
[0169] In cases where an adenovirus is used as an expression vector, a
coding sequence may be ligated to an adenovirus transcription/translation control
complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene
may then be inserted in the adenovirus genome by in vitro or in vivo recombination.
Insertion in a non-essential region of the viral genome (e.g. region E1 or E3) will
result in a recombinant virus that is viable and capable of expressing peptide in
infected hosts (see, e.g., Logan & Shenk 1984, Proc. Natl. Acad. Sci. USA 81:3655).
Alternatively, the vaccinia 7.5 K promoter may be used (see, e.g., Mackett et al.
1982, Proc. Natl. Acad. Sci. USA 79:7415; Mackett et al. 1984, J. Virol. 49:857;
Panicali et al. 1982, Proc. Natl. Acad. Sci. USA 79:4927).
[0170] Host cells containing DNA constructs of the chimeric protein are grown
in an appropriate growth medium. As used herein, the term "appropriate growth
medium" means a medium containing nutrients required for the growth of cells.
Nutrients required for cell growth may include a carbon source, a nitrogen source,
essential amino acids, vitamins, minerals and growth factors. Optionally the media
can contain bovine calf serum or fetal calf serum. In one embodiment, the media
contains substantially no IgG. The growth medium will generally select for cells
containing the DNA construct by, for example, drug selection or deficiency in an
essential nutrient which is complemented by the selectable marker on the DNA
construct or co-transfected with the DNA construct. Cultured mammalian cells are


generally grown in commercially available serum-containing or serum-free media
Xe.gTMEM, DMEM). Selection of a medium appropriate for the particular cell line
used is within the level of ordinary skill in the art.
[0171] The recombinantly produced chimeric protein of the invention can be
isolated from the culture media. The culture medium from appropriately grown
transformed or transfected host cells is separated from the cell material, and the
presence of chimeric proteins is demonstrated. One method of detecting the
chimeric proteins, for example, is by the binding of the chimeric proteins or portions
of the chimeric proteins to a specific antibody recognizing the chimeric protein of the
invention. An anti-chimeric protein antibody may be a monoclonal or polyclonal
antibody raised against the chimeric protein in question. For example, the chimeric
protein contains at least a portion of an immunoglobulin constant region. Antibodies
recognizing the constant region of many immunoglobulins are known in the art and
are commercially available. An antibody can be used to perform an ELISA or a
western blot to detect the presence of the chimeric protein of the invention.
[0172] The chimeric protein of the invention can be synthesized in a
transgenic animal, such as a rodent, cow, pig, sheep, or goat. The term "transgenic
animals" refers to non-human animals that have incorporated a foreign gene into
their genome. Because this gene is present in germline tissues, it is passed from
parent to offspring. Exogenous genes are introduced into single-celled embryos
(Brinster et a!. 1985, Proc. Natl. Acad. Sci. USA 82:4438). Methods of producing
transgenic animals are known in the art, including transgenics that produce
immunoglobulin molecules (Wagner et al. 1981, Proc. Natl. Acad. Sci. USA 78:6376;
McKnight et al. 1983, Cell 34:335; Brinster et al. 1983, Nature 306:332; Ritchie et al.
bo

1984, Nature 312:517; Baldassarre et al. 2003, Therioyenology 59:831; Robl et al.
2003, Theriogenology 59:107; Malassagne et al. 2003, Xenotransplantation
10(3):267).
[0173] The chimeric protein of the invention can also be produced by a
combination of synthetic chemistry and recombinant techniques. For example, the
portion of an immunoglobulin constant region can be expressed recombinantly as
described above. The biologically active molecule, can be produced using known
chemical synthesis techniques (e.g. solid phase synthesis).
[0174] The portion of an immunoglobulin constant region can be ligated to the
biologically active molecule using appropriate ligation chemistry and then combined
with a portion of an immunoglobulin constant region that has not been ligated to a
biologically active molecule to form the chimeric protein of the invention. In one
embodiment, the portion of an immunoglobulin constant region is an Fc fragment.
The Fc fragment can be recombinantly produced to form Cys-Fc and reacted with a
biologically active molecule expressing a thioester to make a monomer-dimer hybrid.
In another embodiment, an Fc-thioester is made and reacted with a biologically
active molecule expressing an N terminus Cysteine (Figure 4).
[0175] In one embodiment, the portion of an immunoglobulin constant region
ligated to the biologically active molecule will form homodimers. The homodimers
can be disrupted by exposing the homodimers to denaturing and reducing conditions
(e.g. beta-mercaptoethanol and 8M urea) and then subsequently combined with a
portion of an immunoglobulin constant region not linked to a biologically active
molecule to form monomer-dimer hybrids. The monomer-dimer hybrids are then

renatured and refolded by dialyzing into PBS and isolated, e.g., by size exclusion or
affinity chromatography.
[0176] In another embodiment, the portion of an immunoglobulin constant
region will form homodimers before being linked to a biologically active molecule. In
this embodiment, reaction conditions for linking the biologically active molecule to
the homodimer can be adjusted such that linkage of the biologically active molecule
to only one chain of the homodimer is favored (e.g. by adjusting the molar
equivalents of each reaetant).
[0177] The biologically active molecule can be chemically synthesized with an
N terminal cysteine. The sequence encoding a portion of an immunoglobulin
constant region can be sub-cloned into a vector encoding intein linked to a chitin
binding domain (New England Biolabs, Beverly, MA). The intein can be linked to the
C terminus of the portion of an immunoglobulin constant region. In one
embodiment, the portion of the immunoglobulin with the intein linked to its C
terminus can be expressed in a prokaryotic cell. In another embodiment, the portion
of the immunoglobulin with the intein linked to its C terminus can be expressed in a
eukaryotic cell. The portion of immunoglobulin constant region linked to intein can
be reacted with MESNA. In one embodiment, the portion of an immunoglobulin
constant region linked to intein is bound to a column, e.g., a chitin column and then
eluted with MESNA. The biologically active molecule and portion of an
immunoglobulin can be reacted together such that nucleophilic rearrangement
occurs and the biologically active molecule is covalently linked to the portion of an
immunoglobulin via an amide bond. (Dawsen et al. 2000, Annu. Rev. Biochem.
69:923). The chimeric protein synthesized this way can optionally include a linker

peptide between the portion of an immunoglobulin and the biologically active
molecule. The linker can for example be synthesized on the N terminus of the
biologically active molecule. Linkers can include peptides and/or organic molecules
(e.g. polyethylene glycol and/or short amino acid sequences). This combined
recombinant and chemical synthesis allows for the rapid screening of biologically
active molecules and linkers to optimize desired properties of the chimeric protein of
the invention, e.g., viral inhibition, hemostasis, production of red blood cells,
biological half-life, stability, binding to serum proteins or some other property of the
chimeric protein. The method also allows for the incorporation of non-natural amino
acids into the chimeric protein of the invention which may be useful for optimizing a
desired property of the chimeric protein of the invention. If desired, the chimeric
protein produced by this method can be refolded to a biologically active
conformation using conditions known in the art, e.g., reducing conditions and then
dialyzed slowly into PBS.
[0178] Alternatively, the N-terminal cysteine can be on the portion of an
immunoglobulin constant region, e.g., an Fc fragment. An Fc fragment can be
generated with an N- terminal cysteine by taking advantage of the fact that a native
Fc has a cysteine at position 226 (see Kabat et al. 1991, Sequences of Proteins of
Immunological Interest, U.S. Department of Public Health, Bethesda, MD).
[0179] To expose a terminal cysteine, an Fc fragment can be recombinantly
expressed. In one embodiment, the Fc fragment is expressed in a prokaryotic cell,
e.g., E.coli. The sequence encoding the Fc portion beginning with Cys 226 (EU
numbering) can be placed immediately following a sequence endcoding a signal
peptide, e.g., OmpA, PhoA, STII. The prokaryotic cell can be osmotically shocked to

release the recombinant Fc fragment. In another embodiment, the Fc fragment is
produced in a eukaryotic cell, e.g., a CHO cell, a BHK cell. The sequence encoding
the Fc portion fragment can be placed directly following a sequence encoding a
signal peptide, e.g., mouse IgK light chain or MHC class I Kb signal sequence, such
that when the recombinant chimeric protein is synthesized by a eukaryotic cell, the
signal sequence will be cleaved, leaving an N terminal cysteine which can than be
isolated and chemically reacted with a molecule bearing a thioester (e.g. a C
terminal thioester if the molecule is comprised of amino acids).
[0180] The N terminal cysteine on an Fc fragment can also be generated
using an enzyme that cleaves its substrate at its N terminus, e.g., Factor Xa,
enterokinase, and the product isolated and reacted with a molecule with a thioester.
[0181] The recombinantly expressed Fc fragment can be used to make
homodimers or monomer-dimer hybrids.
[0182] In a specific embodiment, an Fc fragment is expressed with the human
a interferon signal peptide adjacent to the Cys at position 226. When a construct
encoding this polypeptide is expressed in CHO cells, the CHO cells cleave the signal
peptide at two distinct positions (at Cys 226 and at Val within the signal peptide 2
amino acids upstream in the N terminus direction). This generates a mixture of two
species of Fc fragments (one with an N-terminal Val and one with an N-terminal
Cys). This in turn results in a mixture of dimeric species (homodimers with terminal
Val, homodimers with terminal Cys and heterodimers where one chain has a
terminal Cys and the other chain has a terminal Val). The Fc fragments can be
reacted with a biologically active molecule having a C terminal thioester and the
resulting monomer-dimer hybrid can be isolated from the mixture (e.g. by size

exclusion chromatography). It is contemplated that when other signal peptide
sequences are used for expression of Fc fragments in CHO cells a mixture of
species of Fc fragments with at least two different N termini will be generated.
[0183] In another embodiment, a recombinantly produced Cys-Fc can form a
homodimer. The homodimer can be reacted with peptide that has a branched linker
on the C terminus, wherein the branched linker has two C terminal thioesters that
can be reacted with the Cys-Fc. In another embodiment, the biologically active
molecule has a single non-terminal thioester that can be reacted with Cys-Fc.
Alternatively, the branched linker can have two C terminal cysteines that can be
reacted with an Fc thioester. In another embodiment, the branched linker has two
functional groups that can be reacted with the Fc thioester, e.g., 2-mercaptoamine.
The biologically active molecule may be comprised of amino acids. The biologically
active molecule may include a small organic molecule or a small inorganic molecule.
F. Methods of Using Chimeric Proteins
[0184] The chimeric proteins of the invention have many uses as will be
recognized by one skilled in the art, including, but not limited to methods of treating a
subject with a disease or condition. The disease or condition can include, but is not
limited to, a viral infection, a hemostatic disorder, anemia, cancer, leukemia, an
inflammatory condition or an autoimmune disease (e.g. arthritis, psoriasis, lupus
erythematosus, multiple sclerosis), or a bacterial infection (see, e.g., U.S. Patent
Nos. 6,086,875, 6,030,613, 6,485,726; WO 03/077834; US2003-0235536A1).
1. Methods of Treating a Subject with a Red Blood Cell Deficiency
[0185] The invention relates to a method of treating a subject having a
deficiency of red blood cells, e.g., anemia, comprising administering a

therapeutically effective amount of at least one chimeric protein, wherein the
chimeric protein comprises a first and a second polypeptide chain, wherein the first
chain comprises at least a portion of an immunoglobulin constant region and at least
one agent capable of inducing proliferation of red blood cells, e.g., EPO, and the
second polypeptide chain comprises at least a portion of an immunoglobulin without
the agent capable of inducing red blood cell proliferation of the first chain.
2. Methods of Treating a Subject with a Viral Infection
[0186] The invention relates to a method of treating a subject having a viral
infection or exposed to a virus comprising administering a therapeutically effective
amount of at least one chimeric protein, wherein the chimeric protein comprises a
first and a second polypeptide chain, wherein the first chain comprises at least a
portion of an immunoglobulin constant region and at least one antiviral agent, e.g., a
fusion inhibitor or interferon a and the second polypeptide chain comprises at least a
portion of an immunoglobulin without the antiviral agent of the first chain. In one
embodiment, the subject is infected with a virus which can be treated with IFNa, e.g.,
hepatitis C virus. In one embodiment, the subject is infected with HIV, such as HIV-
1 or HIV-2.
[0187] In one embodiment, the chimeric protein of the invention inhibits viral
replication. In one embodiment, the chimeric protein of the invention prevents or
inhibits viral entry into target cells, thereby stopping, preventing, or limiting the
spread of a viral infection in a subject and decreasing the viral burden in an infected
subject. By linking a portion of an immunoglobulin to a viral fusion inhibitor the
invention provides a chimeric protein with viral fusion inhibitory activity with greater
stability and greater bioavailability compared to viral fusion inhibitors alone, e.g.,
$4

T20, T21, T1249. Thus, in one embodiment, the viral fusion inhibitor decreases or
preventsrHIVlnfetloTrdTalarget cell, e.g., HIV-1.
a. Conditions That May Be Treated
[0188] The chimeric protein of the invention can be used to inhibit or prevent
the infection of a target cell by a hepatitis virus, e.g., hepatitis virus C. The chimeric
protein may comprise an anti-viral agent which inhibits viral replication.
[0189] In one embodiment, the chimeric protein of the invention comprises a
fusion inhibitor. The chimeric protein of the invention can be used to inhibit or
prevent the infection of any target cell by any virus (see, e.g., U.S. Patent Nos.
6,086,875, 6,030,613, 6,485,726; WO 03/077834; US2003-0235536A1). In one
embodiment, the virus is an enveloped virus such as, but not limited to HIV, SIV,
measles, influenza, Epstein-Barr virus, respiratory syncytia virus, or parainfluenza
virus. In another embodiment, the virus is a non-enveloped virus such as rhino virus
or polio virus
[0190] The chimeric protein of the invention can be used to treat a subject
already infected with a virus. The subject can be acutely infected with a virus.
Alternatively, the subject can be chronically infected with a virus. The chimeric
protein of the invention can also be used to prophylactically treat a subject at risk for
contracting a viral infection, e.g., a subject known or believed to in close contact with
a virus or subject believed to be infected or carrying a virus. The chimeric protein of
the invention can be used to treat a subject who may have been exposed to a virus,
but who has not yet been positively diagnosed.
[0191] In one embodiment, the invention relates to a method of treating a
subject infected with HCV comprising administering to the subject a therapeutically
67

effective amount of a chimeric protein, wherein the chimeric protein comprises an Fc
fragment of an IgG and a cytokine, e.g., IFNa.
[0192] In one embodiment, the invention relates to a method of treating a
subject infected with HIV comprising administering to the subject a therapeutically
effective amount of a chimeric protein wherein the chimeric protein comprises an Fc
fragment of an IgG and the viral fusion inhibitor comprises T20.
3. Methods of Treating a Subject Having a Hemostatic Disorder
[0193] The invention relates to a method of treating a subject having a
hemostatic disorder comprising administering a therapeutically effective amount of at
least one chimeric protein, wherein the chimeric protein comprises a first and a
second chain, wherein the first chain comprises at least one clotting factor and at
least a portion of an immunoglobulin constant region, and the second chain
comprises at least a portion of an immunoglobulin constant region.
[0194] The chimeric protein of the invention treats or prevents a hemostatic
disorder by promoting the formation of a fibrin clot. The chimeric protein of the
invention can activate any member of a coagulation cascade. The clotting factor can
be a participant in the extrinsic pathway, the intrinsic pathway or both. In one
embodiment, the clotting factor is Factor VII or Factor Vila. Factor Vila can activate
Factor X which interacts with Factor Va to cleave prothrombin to thrombin, which in
turn cleaves fibrinogen to fibrin. In another embodiment, the clotting factor is Factor
IX or Factor IXa. In yet another embodiment, the clotting factor is Factor VIII or
Factor Villa. In yet another embodiment, the clotting factor is von Willebrand Factor,
Factor XI, Factor XII, Factor V, Factor X or Factor XIII.
&*

a. Conditions That May Be Treated
[0195]This- chimericprotein_onhe~fnen1ioTrcan be used "tolfeat any
hemostatic disorder. The hemostatic disorders that may be treated by
administration of the chimeric protein of the invention include, but are not limited to,
hemophilia A, hemophilia B, von Willebrand's disease, Factor XI deficiency (PTA
deficiency), Factor XII deficiency, as well as deficiencies or structural abnormalities
in fibrinogen, prothrombin, Factor V, Factor VII, Factor X, or Factor XIII.
[0196] In one embodiment, the hemostatic disorder is an inherited disorder.
In one embodiment, the subject has hemophilia A, and the chimeric protein
comprises Factor VIII or Factor Villa. In another embodiment, the subject has
hemophilia A and the chimeric protein comprises Factor VII or Factor Vila. In
another embodiment, the subject has hemophilia B and the chimeric protein
comprises Factor IX or Factor IXa. In another embodiment, the subject has
hemophilia B and the chimeric protein comprises Factor VII or Factor Vila. In
another embodiment, the subject has inhibitory antibodies to Factor VIII or Factor
Villa and the chimeric protein comprises Factor VII or Factor Vila. In yet another
embodiment, the subject has inhibitory antibodies against Factor IX or Factor IXa
and the chimeric protein comprises Factor VII or Factor Vila.
[0197] The chimeric protein of the invention can be used to prophylactically
treat a subject with a hemostatic disorder. The chimeric protein of the invention can
be used to treat an acute bleeding episode in a subject with a hemostatic disorder
[0198] In one embodiment, the hemostatic disorder is the result of a
deficiency in a clotting factor, e.g., Factor IX, Factor VIII. In another embodiment,
&>y

the hemostatic disorder can be the result of a defective clotting factor, e.g., von
Willebrand's Factor.
[0199] In another embodiment, the hemostatic disorder can be an acquired
disorder. The acquired disorder can result from an underlying secondary disease or
condition. The unrelated condition can be, as an example, but not as a limitation,
cancer, an autoimmune disease, or pregnancy. The acquired disorder can result
from old age or from medication to treat an underlying secondary disorder (e.g.
cancer chemotherapy).
4. Methods of Treating a Subject In Need of a General Hemostatic
Agent
[0200] The invention also relates to methods of treating a subject that does
not have a hemostatic disorder or a secondary disease or condition resulting in
acquisition of a hemostatic disorder. The invention thus relates to a method of
treating a subject in need of a general hemostatic agent comprising administering a
therapeutically effective amount of at least one chimeric protein, wherein the
chimeric protein comprises a first and a second polypeptide chain wherein the first
polypeptide chain comprises at least a portion of an immunoglobulin constant region
and at least one clotting factor and the second chain comprises at least a portion of
an immunoglobulin constant region without the clotting factor of the first polypeptide
chain.
a. Conditions That May Be Treated
[0201] In one embodiment, the subject in need of a general hemostatic agent
is undergoing, or is about to undergo, surgery. The chimeric protein of the invention
can be administered prior to or after surgery as a prophylactic. The chimeric protein
2t>

of the invention can be administered during or after surgery to control an acute
bleeding episode. The surgery can include, but is not limited to, liver transplantation,
liver resection, or stem cell transplantation.
[0202] The chimeric protein of the invention can be used to treat a subject
having an acute bleeding episode who does not have a hemostatic disorder. The
acute bleeding episode can result from severe trauma, e.g., surgery, an automobile
accident, wound, laceration gun shot, or any other traumatic event resulting in
uncontrolled bleeding.
5. Treatment Modalities
[0203] The chimeric protein of the invention can be administered
intravenously, subcutaneously, intra-muscularly, or via any mucosal surface, e.g.,
orally, sublingually, buccally, sublingually, nasally, rectally, vaginally or via
pulmonary route. The chimeric protein can be implanted within or linked to a
biopolymer solid support that allows for the slow release of the chimeric protein to
the desired site.
[0204] The dose of the chimeric protein of the invention will vary depending
on the subject and upon the particular route of administration used. Dosages can
range from 0.1 to 100,000 ug/kg body weight. In one embodiment, the dosing range
is 0.1-1,000 ug/kg. The protein can be administered continuously or at specific
timed intervals. In vitro assays may be employed to determine optimal dose ranges
and/or schedules for administration. Many in vitro assays that measure viral
infectivity are known in the art. For example, a reverse transcriptase assay, or an rt
PCR assay or branched DNA assay can be used to measure HIV concentrations. A
7/

StaClot assay can be used to measure clotting activity. Additionally, effective doses
may be extrapolated from dose-response curves obtained from animal models.
[0205] The invention also relates to a pharmaceutical composition comprising
a viral fusion inhibitor, at least a portion of an immunoglobulin and a
pharmaceutically acceptable carrier or excipient. Examples of suitable
pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by
E.W..Martin. Examples of excipients can include starch, glucose, lactose, sucrose,
gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate,
talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and
the like. The composition can also contain pH buffering reagents, and wetting or
emulsifying agents.
[0206] For oral administration, the pharmaceutical composition can take the
form of tablets or capsules prepared by conventional means. The composition can
also be prepared as a liquid for example a syrup or a suspension. The liquid can
include suspending agents (e.g. sorbitol syrup, cellulose derivatives or hydrogenated
edible fats), emulsifying agents (lecithin or acacia), non-aqueous vehicles (e.g.
almond oil, oily, esters, ethyl alcohol, or fractionated vegetable oils), and
preservatives (e.g. methyl or propyl -p-hydroxybenzoates or sorbic acid). The
preparations can also include flavoring, coloring and sweetening agents.
Alternatively, the composition can be presented as a dry product for constitution with
water or another suitable vehicle.
[0207] For buccal and sublingual administration the composition may take the
form of tablets, lozenges or fast dissolving films according to conventional protocols.
71-

[0208] For administration by inhalation, the compounds for use according to
the present invention are conveniently delivered in theTorm of arTaerosol spray from
a pressurized pack or nebulizer (e.g. in PBS), with a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoromethane, carbon
dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit
can be determined by providing a valve to deliver a metered amount. Capsules and
cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated
containing a powder mix of the compound and a suitable powder base such as
lactose or starch.
[0209] The pharmaceutical composition can be formulated for parenteral
administration (i.e. intravenous or intramuscular) by bolus injection. Formulations for
injection can be presented in unit dosage form, e.g., in ampoules or in multidose
containers with an added preservative. The compositions can take such forms as
suspensions, solutions, or emulsions in oily or aqueous vehicles, and contain
formulatory agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the active ingredient can be in powder form for constitution with a
suitable vehicle, e.g., pyrogen free water.
[0210] The pharmaceutical composition can also be formulated for rectal
administration as a suppository or retention enema, e.g., containing conventional
suppository bases such as cocoa butter or other glycerides.
73

6. Combination Therapy
[0211] The chimeric protein of the invention can be used to treat a subject
with a disease or condition in combination with at least one other known agent to
treat said disease or condition.
[0212] In one embodiment, the invention relates to a method of treating a
subject infected with HIV comprising administering a therapeutically effective amount
of at least one chimeric protein comprising a first and a second chain, wherein the
first chain comprises an HIV fusion inhibitor and at least a portion of an
immunoglobulin constant region and the second chain comprises at least a portion
of an immunoglobulin without an HIV fusion inhibitor of the first chain, in combination
with at least one other anti-HIV agent. Said other anti-HIV agent can be any
therapeutic with demonstrated anti-HIV activity. Said other anti-HIV agent can
include, as an example, but not as a limitation, a protease inhibitor (e.g.
Amprenavir®, Crixivan®, Ritonivir®), a reverse transcriptase nucleoside analog (e.g.
AZT, DDI, D4T, 3TC, Ziagen®), a nonnucleoside analog reverse transcriptase
inhibitor (e.g. Sustiva®), another HIV fusion inhibitor, a neutralizing antibody specific
to HIV, an antibody specific to CD4, a CD4 mimic, e.g., CD4-lgG2 fusion protein
(U.S. Patent Application 09/912,824) or an antibody specific to CCR5, or CXCR4, or
a specific binding partner of CCR5, or CXCR4.
[0213] In another embodiment, the invention relates to a method of treating a
subject with a hemostatic disorder comprising administering a therapeutically
effective amount of at least one chimeric protein comprising a first and a second
chain, wherein the first chain comprises at least one clotting factor and at least a
portion of an immunoglobulin constant region and the second chain comprises at
7 If

least a portion of an immunoglobulin constant region without the clotting factor of the
first chain, in combination with at least one other clotting factor or agent that
promotes hemostasis. Said other clotting factor or agent that promotes hemostasis
can be any therapeutic with demonstrated clotting activity. As an example, but not
as a limitation, the clotting factor or hemostatic agent can include Factor V, Factor
VII, Factor VIII, Factor IX, Factor X, Factor XI, Factor XII, Factor XIII, prothrombin, or
fibrinogen or activated forms of any of the preceding. The clotting factor of
hemostatic agent can also include anti-fibrinolytic drugs, e.g., epsilon-amino-caproic
acid, tranexamic acid.
7. Methods of Inhibiting Viral Fusion With a Target Cell
[0214] The invention also relates to an in vitro method of inhibiting HIV fusion
with a mammalian cell comprising combining the mammalian cell with at least one
chimeric protein, wherein the chimeric protein comprises a first and a second chain,
wherein the first chain comprises at least a portion of an immunoglobulin constant
region and an HIV inhibitor and the second chain comprises at least a portion of an
immunoglobulin constant region without the HIV inhibitor of the first chain. The
mammalian cell can include any cell or cell line susceptible to infection by HIV
including but not limited to primary human CD4+ T cells or macrophages, MOLT-4
cells, CEM cells, AA5 cells or HeLa cells which express CD4 on the cell surface.
G. Methods of Isolating Chimeric Proteins
[0215] Typically, when chimeric proteins of the invention are produced they
are contained in a mixture of other molecules such as other proteins or protein
fragments. The invention thus provides for methods of isolating any of the chimeric
proteins described supra from a mixture containing the chimeric proteins. It has

been determined that the chimeric proteins of the invention bind to dye ligands under
suitable conditions and that altering those conditions subsequent to binding can
disrupt the bond between the dye ligand and the chimeric protein, thereby providing
a method of isolating the chimeric protein. In some embodiments the mixture may
comprise a monomer-dimer hybrid, a dimer and at least a portion of an
immunoglobulin constant region, e.g., an Fc. Thus, in one embodiment, the
invention provides a method of isolating a monomer-dimer hybrid. In another
embodiment, the invention provides a method of isolating a dimer.
[0216] Accordingly, in one embodiment, the invention provides a method of
isolating a monomer-dimer hybrid from a mixture, where the mixture comprises
a) the monomer-dimer hybrid comprising a first and second polypeptide
chain, wherein the first chain comprises a biologically active molecule, and at least a
portion of an immunoglobulin constant region and wherein the second chain
comprises at least a portion of an immunoglobulin constant region without a
biologically active molecule or immunoglobulin variable region;
b) a dimer comprising a first and second polypeptide chain, wherein the first
and second chains both comprise a biologically active molecule, and at least a
portion of an immunoglobulin constant region; and
c) a portion of an immunoglobulin constant region; said method comprising

1) contacting the mixture with a dye ligand linked to a solid support
under suitable conditions such that both the monomer-dimer hybrid and the dimer
bind to the dye ligand;
2) removing the unbound portion of an immunoglobulin constant
region;

3) altering the suitable conditions of 1) such that the binding
freWeerffffe monomer-dirTieTlTybTid and the dye Ngand linked to the solid support is
disrupted;
4) isolating the monomer-dimer hybrid.
In some embodiments, prior to contacting the mixture with a dye ligand, the mixture
may be contacted with a chromatographic substance such as protein A sepharose or
the like. The mixture is eluted from the chromatographic substance using an
appropriate elution buffer (e.g. a low pH buffer) and the eluate containing the mixture
is then contacted with the dye ligand.
[0217] Suitable conditions for contacting the mixture with the dye ligand may
include a buffer to maintain the mixture at an appropriate pH. An appropriate pH
may include a pH of from, 3-10, 4-9, 5-8. In one embodiment, the appropriate pH is
8.0. Any buffering agent known in the art may be used so long as it maintains the
pH in the appropriate range, e.g., tris, HEPES, PIPES, MOPS. Suitable conditions
may also include a wash buffer to elute unbound species from the dye ligand. The
wash buffer may be any buffer which does not disrupt binding of a bound species.
For example, the wash buffer can be the same buffer used in the contacting step.
[0218] Once the chimeric protein is bound to the dye ligand, the chimeric
protein is isolated by altering the suitable conditions. Altering the suitable conditions
may include the addition of a salt to the buffer. Any salt may be used, e.g., NaCI,
KCI. The salt should be added at a concentration that is high enough to disrupt the
binding between the dye ligand and the desired species, e.g., a monomer-dimer
hybrid.
71

[0219] In some embodiments where the mixture is comprised of an Fc, a
monomer-dimer hybrid, and a dinner, it has been found that the Fc does not bind to
the dye ligand and thus elutes with the flow through. The dimer binds more tightly to
the dye ligand than the monomer-dimer hybrid. Thus a higher concentration of salt
is required to disrupt the bond (e.g. elute) between the dimer and the dye ligand
compared to the salt concentration required to disrupt the bond between the dye
ligand and the monomer-dimer hybrid.
[0220] In some embodiments NaCI may be used to isolate the monomer-
dimer hybrid from the mixture. In some embodiments the appropriate concentration
of salt which disrupts the bond between the dye ligand and the monomer-dimer
hybrid is from 200-700 mM, 300-600 mM, 400:500 mM. In one embodiment, the
concentration of NaCI required to disrupt the binding between the dye ligand the
monomer-dimer hybrid is 400 mM.
[0221] NaCI may also be used to isolate the dimer from the mixture.
Typically, the monomer-dimer hybrid is isolated from the mixture before the dimer.
The dimer is isolated by adding an appropriate concentration of salt to the buffer,
thereby disrupting the binding between the dye ligand and the dimer. In some
embodiments the appropriate concentration of salt which disrupts the bond between
the dye ligand and the dimer is from 800 mM to 2 M, 900 mM to1.5 M, 950 mM to
1.2 M. In one specific embodiment, 1 M NaCI is used to disrupt the binding between
the dye ligand and the dimer.
[0222] The dye ligand may be a bio-mimetic. A bio-mimetic is a human-
made substance, device, or system that imitates nature. Thus in some
embodiments the dye ligand imitates a molecule's naturally occurring ligand. The
7%

dye ligand may be chosen from Mimetic Red 1™, Mimetic Kea •«•, iviinmuu v-/.a..yv.
1™, Mimetic Orange 2™, Mimetic Orange"3"™",' Mimetic Yellow-IVMimetic Yellow
2™, Mimetic Green 1™, Mimetic Blue 1™, and Mimetic Blue 2™ (Prometic
Biosciences (USA) Inc., Wayne, NJ). In one specific embodiment, the dye ligand is
Mimetic Red 2™ (Prometic Biosciences (USA) Inc., Wayne, NJ). In certain
embodiments the dye ligand is linked to a solid support, e.g., from Mimetic Red
1A6XL™, Mimetic Red 2 A6XL™, Mimetic Orange 1 A6XL™, Mimetic Orange 2
A6XL™, Mimetic Orange 3 A6XL™, Mimetic Yellow 1 A6XL™, Mimetic Yellow 2
A6XL™, Mimetic Green 1 A6XL™, Mimetic Blue 1 A6XL™, and Mimetic Blue 2
A6XL™ (Prometic Biosciences (USA) Inc., Wayne, NJ).
[0223] The dye ligand may be linked to a solid support. The solid support
may be any solid support known in the art (see, e.g., www.seperationsNOW.com).
Examples of solid supports may include a bead, a gel, a membrane, a nanoparticle,
or a microsphere. The solid support may comprise any material which can be linked
to a dye ligand (e.g. agarose, polystyrene, sepharose, sephadex). Solid supports
may comprise any synthetic organic polymer such as polyacrylic, vinyl polymers,
acrylate, polymethacrylate, and polyacrylamide. Solid supports may also comprise a
carbohydrate polymer, e.g., agarose, cellulose, or dextran. Solid supports may
comprise inorganic oxides, such as silica, zirconia, titania, ceria, alumina, magnesia
(i.e., magnesium oxide), or calcium oxide. Solid supports may also comprise
combinations of some of the above-mentioned supports including, but not limited to,
dextran-acrylamide.
73

Examples
Example 1: Molecular Weight Affects FcRn Mediated Trancytosis
[0224] Chimeric proteins comprised of various proteins of interest and IgG
Fc were recombinantly produced (Sambrook et al. Molecular Cloning: A Laboratory
Manual, 2 ed., Cold Spring Harbor Laboratory Press, (1989)) or in the case of
contactin-Fc, MAB-f3-gal, (a complex of a monoclonal antibody bound to 0-gal)
(Biodesign International, Saco, ME) and MAB-GH (a complex of monoclonal
antibody and growth hormone)(Research Diagnostics, Inc. Flanders, NJ) were
purchased commercially. Briefly, the genes encoding the protein of interest were .
cloned by PCR, and then sub-cloned into an Fc fusion expression plasmid. The
plasmids were transfected into DG44 CHO cells and stable transfectants were
selected and amplified with methotrexate. The chimeric protein homodimers were
purified over a protein A column. The proteins tested included interferon a, growth
hormone, erythropoietin, follicle stimulating hormone, Factor IX, beta-galactosidase,
contactin, and Factor VIII. Linking the proteins to immunoglobulin portions, including
the FcRn receptor binding partner, or using commercially available whole antibody
(including the FcRn binding region)-antigen complexes permitted the investigation of
transcytosis as a function of molecular weight (see U.S. Patent No. 6,030,613). The
chimeric proteins were administered to rats orally and serum levels were measured
2-4 hours post administration using an ELISA for recombinantly produced chimeric
proteins and both a western blot and ELISA for commercially obtained antibody
complexes and chimeric proteins. Additionally, all of the commercially obtained
proteins or complexes as well as Factor Vlll-Fc, Factor )X-Fc and Epo-Fc controls
were iodinated using IODO beads (Pierce, Pittsburgh, PA). The results indicated
&o

serum levels of Fc and monoclonal antibody chimeric proteins orally administered to
rats are directly related to the size of the proteinTTheapparentcutoff point for orally
administered Fc chimeric proteins is between 200-285 kD. (Table 2).
TABLE 2

Protein Size (kD) Transcytosis
IFNa-Fc 92 ++++
GH-Fc 96 +++
Epo-Fc 120 +++
FSH-Fc 170 +++
MAB:GH 172-194 +++
FIX-Fc 200 +
MAB:pGai 285-420 -
Contactin-Fc 300 -
FVIIIA-Fc 380 -
Example 2: Cloning of pcDNA 3.1 -Flag-Fc
[0225] The sequence for the FLAG peptide (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-
Lys), a common affinity tag used to identify or purify proteins, was cloned into the
pcDNA 3.1-Fc plasmid, which contains the mouse IgK signal sequence followed by
the Fc fragment of human lgG1 (amino acids 221-447, EU numbering). The
construct was created by overlapping PCR using the following primers:
FlagFc-F1: 5'-GCTGGCTAGCCACCATGGA -3'(SEQ ID NO:41)
FlagFc-R1: 5'- CTTGTCATCGTCGTCCTTGTAGTCGTCA
CCAGTGGAACCTGGAAC -3' (SEQ ID NO:42)
FlagFc-F2: 5'- GACTACAAGG ACGACGATGA CAAGGACAAA ACTCACACAT
GCCCACCGTG CCCAGCTCCG GAACTCC -3' (SEQ ID N0.43)
FlagFc-R2: 5'- TAGTGGATCCTCATTTACCCG -3' (SEQ ID NO:44)
[0226] The pcDNA 3.1-Fc template was then added to two separate PCR
reactions containing 50 pmol each of the primer pairs FlagFc-F1/R1 or FlagFc-F2/R2
in a 50 pi reaction using Pfu Ultra DNA polymerase (Stratagene, CA) according to
B>{

manufacturer's standard protocol in a MJ Thermocycler using the following cycles:
95°C 2 minutes; 30 cycles of (95°C 30 seconds, 52°C 30 seconds, 72°C 45
seconds), followed by 72°C for 10 minutes. The products of these two reactions
were then mixed in another PCR reaction (2 pi each) with 50 pmol of FlagFc-F1 and
FlagFc-R2 primers in a 50 pi reaction using Pfu Ultra DNA polymerase (Stratagene,
CA) according to manufacturer's standard protocol in a MJ Thermocycler using the
following cycles: 95°C 2 minutes; 30 cycles of (95°C 30 seconds, 52°C 30 seconds,
72°C 45 seconds), followed by 72°C for 10 minutes. The resulting fragment was gel
purified, digested and inserted into the pcDNA 3.1-Fc plasmid Nhel-Bam HI. The
resulting plasmid contains contains the mouse IgK signal sequence producing the
FlagFc protein.
Example 3: Cloning of -Factor VM-Fc construct
[0227] The coding sequence for Factor VII, was obtained by RT-PCR from
human fetal liver RNA (Clontech, Palo Alto, CA). The cloned region is comprised of
the cDNA sequence from bp 36 to bp 1430 terminating just before the stop codon. A
Sbfl site was introduced on the N-terminus. A BspEI site was introduced on the C-
terminus. The construct was cloned by PCR using the primers:
Downstream: 5' GCTACCTGCAGGCCACCATGGTCTCCCAGGCCCTCAGG
3'(SEQ ID NO:45)
Upstream : 5* CAGTTCCGGAGCTGGGCACGGCGGGCACGTGTGAGTTT
TGTCGGGAAAT GG 3' (SEQ ID NO:46)
and the following conditions: 95°C for 5 minutes followed by 30 cycles of 95°C for 30
seconds, 55°C for 30 seconds, 72°C for 1 minute and 45 seconds, and a final
extension cycle of 72°C for 10 minutes.
&

[0228] The fragment was digested Sbfl - BspE I and inserted into pED.dC-Fc
a plasmid encoding for the Fc fragment of an lgG1.
Example 4: Cloning of Factor IX-Fc construct
[0229] The human Factor IX coding sequence, including the prepropeptide
sequence, was obtained by RT-PCR amplification from adult human liver RNA using
the following primers:
natFIX-F: 5'-TTACTGCAGAAGGTTATGCAGCGCGTGAACATG- 3'(SEQ ID
NO:47)
F9-R: 5'-TTTTTCGAATTCAGTGAGCTTTG-| I I I I I CCTTAATCC- 3'(SEQ ID
NO:48)
[0230] 20 ng of adult human liver RNA (Clontech, Palo Alto, CA) and 25
pmol each primer were added to a RT-PCR reaction using the Superscript.™ One-
Step RT-PCR with PLATINUM® Taq system (Invitrogen, Carlsbad, CA) according to
manufacturers protocol. Reaction was carried out in a MJ Thermocycler using the
following cycles: 50°C 30 minutes; 94°C 2 minutes; 35 cycles of (94°C 30 seconds,
58°C 30 seconds, 72°C 1 minute), and a final 72°C 10 minutes. The fragment was
gel purified using Qiagen Gel Extraction Kit (Qiagen, Valencia, CA), and digested
with Pstl-EcoRI, gel purified, and cloned into the corresponding digest of the
pED.dC.XFc piasmid.
Example 5: Cloning of PACE construct
[0231] The coding sequence for human PACE (paired basic amino acid
cleaving enzyme), an endoprotease, was obtained by RT-PCR. The following
primers were used:
PACE-F1: 5'-GGTAAGCTTGCCATGGAGCTGAGGCCCTGGTTGC -3'(SEQ ID
NO:49)
31

PACE-R1: 5'- GTTTTCAATCTCTAGGACCCACTCGCC -3'(SEQ ID NO:50)
PACE-F2: 5'- GCCAGGCCACATGACTACTCCGC -3'(SEQ ID N0:51)
PACE-R2: 5'- GGTGAATTCTCACTCAGGCAGGTGTGAGGGCAGC -3'(SEQ ID
NO:52)
[0232] The PACE-F1 primer adds a Hindlll site to the 5' end of the PACE
sequence beginning with 3 nucleotides before the start codon, while the PACE-R2
primer adds a stop codon after amino acid 715, which occurs at the end of the
extracellular domain of PACE, as well as adding an EcoRI site to the 3' end of the
stop codon. The PACE-R1 and -F2 primers anneal on the 3' and 5' sides of an
internal BamHI site, respectively. Two RT-PCR reactions were then set up using 25
pmol each of the primer pairs of PACE-F1/R1 or PACE-F2/R2 with 20 ng of adult
human liver RNA (Clontech; Palo Alto, CA) in a 50 pi RT-PCR reaction using the
Superscript.™ One-Step RT-PCR with PLATINUM® Taq system (Invitrogen,
Carlsbad, CA) according to manufacturers protocol. The reaction was carried out in
a MJ Thermocycler using the following cycles: 50°C 30 minutes; 94°C 2 minutes; 30
cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 2 minutes), followed by 72°C 10
minutes. These fragments were each ligated into the vector pGEM T-Easy
(Promega, Madison, Wl) and sequenced fully. The F2-R2 fragment was then
subcloned into pcDNA6 V5/His (Invitrogen, Carlsbad, CA) using the BamHI/EcoRI
sites, and then the F1-R1 fragment was cloned into this construct using the
Hindlll/BamHI sites. The final plasmid, pcDNA6-PACE, produces a soluble form of
PACE (amino acids 1-715), as the transmembrane region has been deleted. The
sequence of PACE in pcDNA6-PACE is essentially as described in Harrison et al.
1998, Seminars in Hematology 35:4.
9Cf

Example 6: Cloning of IFNa-Fc eight amino acid linker construct
[0233J The human inteneroTT2F(hlFNodlngsequeTTce7 including the
signal sequence, was obtained by PCR from human genomic DNA using the
following primers:
IFNa-Sig-F: 5'-GCTACTGCAGCCACCATGGCCTTGACCTTTGCTTTAC-
3'(SEQ ID NO:53)
IFNa-EcoR-R: 5"-CGTTGAATTCTTCCTTACTTCTTAAACTTTCTTGC-
3"(SEQ ID NO:54)
[0234] Genomic DNA was prepared from 373MG human astrocytoma cell
line, according to standard methods (Sambrook et al. 1989, Molecular Cloning: A
Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press). Briefly,
approximately 2 x 105 cells were pelleted by centrifugation, resuspended in 100 pi
phosphate buffered saline pH 7.4, then mixed with an equal volume of lysis buffer
(100 mM Tris pH 8.0/ 200 mM NaCI / 2% SDS / 5 mM EDTA). Proteinase K was
added to a final concentration of 100 pg/ml, and the sample was digested at 37°C for
4 hours with occasional gentle mixing. The sample was then extracted twice with
phenolrchloroform, the DNA precipitated by adding sodium acetate pH 7.0 to
100 mM and an equal volume of isopropanol, and pelleted by centrifugation for 10
min at room temperature. The supernatant was removed and the pellet was washed
once with cold 70% ethanol and allowed to air dry before resuspending in TE
(10 mM Tris pH 8.0 /1 mM EDTA).
[0235] 100 ng of this genomic DNA was then used in a 25 pi PCR reaction
with 25 pmol of each primer using Expand High Fidelity System (Boehringer
Mannheim, Indianapolis, IN) according to manufacturer's standard protocol in a MJ
Thermocycler using the following cycles: 94°C 2 minutes; 30 cycles of (94°C 30
£s

seconds, 50°C 30 seconds, 72°C 45 seconds), and finally 72°C 10 minutes. The
expected sized band (-550 bp) was gel purified with a Gel Extraction kit (Qiagen,
Valencia, CA), digested with Pstl/EcoRI, gel purified again, and cloned into the
Pstl/EcoRI site of pED.dC.XFc, which contains an 8 amino acid linker (EFAGAAAV)
followed by the Fc region of human lgG1.
Example 7: Cloning of IFNaFc Alinker construct
[0236] 1 ug of purified pED.dC.native human IFNaFc DNA, from Example 6,
was then used as a template in a 25 ul PCR reaction with 25 pmol of each primer
IFNa-Sig-F and the following primer:
hlFNaNoLinkFc-R: 5'CAGTTCCGGAGCTGGGCACGGCGGG
CACGTGTGAGTTTTGTCTTCCTTACTTCTTAAACI I I II GCAAGTTTG- 3'(SEQ ID
NO:55)
[0237] The PCR reaction was carried out using Expand High Fidelity System
(Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's standard
protocol in a RapidCycler thermocycler (Idaho Technology, Salt Lake City, UT),
denaturing at 94°C for 2 minutes followed by 18 cycles of 95°C for 15 seconds, 55°C
for 0 seconds, and 72°C for 1 minute with a slope of 6, followed by 72°C extension
for 10 minutes. A PCR product of the correct size (-525 bp) was gel purified using a
Gel Extraction kit (Qiagen; Valencia, CA), digested with the Pstl and BspEI
restriction enzymes, gel purified, and subcloned into the corresponding sites of a
modified pED.dC.XFc, where amino acids 231-233 of the Fc region were altered
using the degeneracy of the genetic code to incorporate a BspEI site while
maintaining the wild type amino acid sequence.
£6

Example 8: Cloning of IFNccFc 6S15 linker construct
[0238] A new backbone vector was created using the Fc found in the Alinker
construct (containing BspEI and Rsrll sites in the 5' end using the degeneracy of the
genetic code to maintain the amino acid sequence), using this DNA as a template for
a PCR reaction with the following primers:
5' B2xGGGGS: 5' gtcaggatccggcggtggagggagcgacaaaactcacacgtgccc
3'(SEQ ID NO:56)
3' GGGGS: 5' tgacgcggccgctcatttacccggagacaggg 3'(SEQ ID NO:57)
[0239] A PCR reaction was carried out with 25 pmoi of each primer using
Pfu Turbo enzyme (Stratagene, La Jolla, CA) according to manufacturer's standard
protocol in a MJ Thermocycler using the following method: 95°C 2 minutes; 30
cycles of (95°C 30 seconds, 54°C 30 seconds, 72°C 2 minutes), 72°C 10 minutes.
The expected sized band (-730 bp) was gel purified with a Gel Extraction kit
(Qiagen, Valencia CA), digested BamHI/Notl; gel purified again, and cloned into the
BamHI/Notl digested vector of pcDNA6 ID, a version of pcDNA6 with the IRES
sequence and dhfr gene inserted into Notl/Xbai site.
[0240] 500 ng of purified pED.dC.native human IFNccFc DNA was then used
as a template in a 25 pi PCR reaction with the following primers:
5' IFNa for GGGGS: 5' ccgctagcctgcaggccaccatggccttgacc 3'(SEQ ID
NO:58)
3' IFNa for GGGGS: 5' ccggatccgccgccaccttccttactacgtaaac 3'(SEQ ID
NO:59)
[0241] A PCR reaction was carried out with 25 pmol of each primer using
Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to
manufacturer's standard protocol in a MJ Thermocycler using the following cycles:
97

95°C 2 minutes; 14 cycles of (94°C 30 seconds, 48°C 30 seconds, 72°C 1 minute),
72°C 10 minutes. The expected sized band (-600 bp) was gel purified with a Gel
Extraction kit (Qiagen, Valencia CA), digested Nhel/BamHI, gel purified again, and
cloned into the Nhel/BamHI site of the pcDNA6 ID/Fc vector, above, to create an
IFNa Fc fusion with a 10 amino acid Gly/Ser linker (2xGGGGS), pcDNA6 ID/IFNa-
GSIO-Fc.
[0242] A PCR reaction was then performed using 500 ng of this pcDNA6
ID/IFNa-GS10-Fc with the following primers
5' B3XGGGGS:5'(SEQ ID NO:60)
gtcaggatccggtggaggcgggtccggcggtggagggagcgacaaaactcacacgtgccc 3'(SEQ
IDNO:61)
fcclv-R: 5' atagaagcctttgaccaggc 3'(SEQ ID NO:62)
[0243] A PCR reaction was carried out with 25 pmol of each primer using
Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to
manufacturer's standard protocol in a MJ Thermocycler using the following cycles:
95°C 2 minutes; 14 cycles of (94°C 30 seconds, 48°C 30 seconds, 72°C 1 minute),
72°C 10 minutes. The expected sized band (504 bp) was gel purified with a Gel
Extraction kit (Qiagen, Valencia CA), digested BamHI/BspEI, the 68 bp band was gel
purified, and cloned into the BamHI/BspEI site of the pcDNA6 ID/IFNa-GS10-Fc
vector, above, to create an IFNa Fc fusion with a 15 amino acid Gly/Ser linker
(3xGGGGS), pcDNA6 ID/IFNa-GS15-Fc.
Example 9: Cloning of a Basic Peptide Construct
[0244] The hinge region of the human lgG1 Fc fragment from amino acid
221-229 (EU numbering) was replaced with a basic peptide (CCB).
2£

Four overlapping oligos were used (IDT, Coralville, IA):
1. CCB-Fc Sense 1:
5' GCC GGC GAA TTC GGT GGT GAG TAC CAG GCC CTG AAG AAG AAG GTG
GCC CAG CTG AAG GCC AAG AAC CAG GCC CTG AAG AAG AAG 3'(SEQ ID
NO:63)
2. CCB-Fc Sense 2:
5' GTG GCC CAG CTG AAG CAC AAG GGC GGC GGC CCC GCC CCA GAG
CTC CTG GGC GGA CCG A 3'(SEQ ID NO:64)
3. CCB-Fc Anti-Sense 1 :
5' CGG TCC GCC CAG GAG CTC TGG GGC GGG GCC GCC GCC CTT GTG CTT
CAG CTG GGC CAC CTT CTT CTT CAG GGC CTG GTT CTT G 3\SEQ ID
NO:65)
4. CCB-Fc Anti-Sense 2:
5* GCC TTC AGC TGG GCC ACC TTC TTC TTC AGG GCC TGG TAC TCA CCA
CCG AAT TCG CCG GCA 3"(SEQ ID NO:66)
[0245] The oligos were reconstituted to a concentration of 50 uM with dH20.
5 ul of each oligo were annealed to each other by combining in a thin walled PCR
tube with 2.2 ul of restriction buffer #2 {i.e. final concentration of 10 mM Tris HCI pH
7.9, 10 mM MgCI2, 50 mM Na CI, 1 mM dithiothreitol) (New England Biolabs,
Beverly, MA) and heated to 95°C for 30 seconds and then allowed to anneal by
cooling slowly for 2 hours to 25°C. 5 pmol of the now annealed oligos were ligated
into a pGEM T-Easy vector as directed in the kit manual. (Promega, Madison Wl).
The ligation mixture was added to 50 ul of DH5a competent E. co//'cells (lnvitrogen,
Carlsbad, CA) on ice for 2 minutes, incubated at 37°C for 5 minutes, incubated on
ice for 2 minutes, and then plated on LB+100 ug/L ampicillin agar plates and placed
at 37°C for 14 hours. Individual bacterial colonies were picked and placed in 5 ml of
LB+100 ug/L ampicillin and allowed to grow for 14 hours. The tubes were spun

down at 2000xg, 4°C for 15 minutes and the vector DNA was isolated using Qiagen
miniprep kit (Qiagen, Valencia, CA) as indicated in the kit manual. 2 ug of DNA was
digested with NgoM IV-Rsr-ll. The fragment was gel purified by the Qiaquick
method as instructed in the kit manual (Qiagen, Valencia, CA) and ligated to
pED.dcEpoFc with NgoM IV/Rsr II. The ligation was transformed into DH5a
competent E. coli cells and the DNA prepared as described for the pGEM T-Easy
vector.
Example 10: Cloning of the erythropoietin-acidic peptide Fc construct
[0246] The hinge region of the human lgG1 Fc fragment in EPO-Fc from
amino acid 221-229 (EU numbering) was replaced with an acidic peptide (CCA).
Four overlapping oligos were used (IDT, Coralville, IA):
1. Epo-CCA-Fc Sense 1:
5' CCG GTG ACA GGG AAT TCG GTG GTG AGT ACC AGG CCC TGG AGA AGG
AGG TGG CCC AGC TGG AG 3'(SEQ ID NO:67)
2. Epo-CCA-Fc Sense 2:
5' GCC GAG AAC CAG GCC CTG GAG AAG GAG GTG GCC CAG CTG GAG
CAC GAG GGT GGT GGT CCC GCT CCA GAG CTG CTG GGC GGA CA 3'(SEQ
ID NO:68)
3. Epo-CCA-Fc Anti-Sense 1:
5' GTC CGC CCA GCA GCT CTG GAG CGG GAC CAC CAC CCT CGT GCT CCA
GCT GGG CCA C 3'(SEQ ID NO:69)
4. Epo-CCA-Fc Anti-Sense 2:
5' CTC CTT CTC CAG GGC CTG GTT CTC GGC CTC CAG CTG GGC CAC CTC
CTT CTC CAG GGC CTG GTA CTC ACC ACC GAA TTC CCT GTC ACC GGA
3'(SEQ ID NO:70)

[0247] The oligos were reconstituted to a concentration of 50 uM with dH20.
5 pi of each oligo were annealed to each other by combining in a thin walled PCR
tube with 2.2 ul of restriction buffer No. 2 (New England Biolabs, Beverly, MA) and
heated to 95°C for 30 seconds and then allowed to cool slowly for 2 hours to 25°C.
5 pmol of the now annealed oligos were ligated into a pGEM T-Easy vector as
directed in the kit manual. (Promega, Madison, Wl). The ligation mixture was added
to 50 ul of DH5a competent E. coli cells (Invitrogen, Carlsbad, CA) on ice for 2
minutes, incubated at 37°C 5 minutes, incubated on ice for 2 minutes, and then
plated on LB+100 ug/L ampicillin agar plates and placed at 37°C for 14 hours.
Individual bacterial colonies were picked and placed in 5 ml of LB+100 ug/L
ampicillin and allowed to grow for 14 hours. The tubes were spun down at 2000xg,
4°C for 15 minutes and the vector DNA was prepared using Qiagen miniprep kit
(Qiagen, Valencia, CA) as indicated in the kit manual. 2 pg of DNA was digested
with Age l-Rsr-ll. The fragment was gel purified by the Qiaquick method as
instructed in the kit manual (Qiagen, Valencia, CA) and ligated into pED.Epo Fc.1
Age l-Rsr II. The ligation was transformed into DH5a competent E. coli cells and
DNA prepped as described above.
Example 11: Cloning of CysFc construct
[0248] Using PCR and standard molecular biology techniques (Sambrook et
al. 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor
Laboratory Press), a mammalian expression construct was generated such that the
coding sequence for the human IFNa signal peptide was directly abutted against the
coding sequence of Fc beginning at the first cysteine residue (Cys 226, EU
Numbering). Upon signal peptidase cleavage and secretion from mammalian cells,

an Fc protein with an N-terminal cysteine residue was thus generated. Briefly, the
primers
IFNa-Sig-F (IFNa-Sig-F: 5'-GCTACTGCAGCCACCATGGCCTTGACCTT
TGCTTTAC-3')(SEQ ID NO:71) and Cys-Fc-R
(5'-CAGTTCCGGAGCTGGGCACGGCGGA
GAGCCCACAGAGCAGCTTG-3') (SEQ ID NO:72) were used in a PCR reaction to
create a fragment linking the IFNa signal sequence with the N terminus of Fc,
beginning with Cys 226. 500 ng of pED.dC.native hlFNa Alinker was added to 25
pmol of each primer in a PCR reaction with Expand High Fidelity System
(Boehringer Mannheim, Indianapolis, IN) according to manufacturer's standard
protocol. The reaction was carried out in a MJ Thermocycler using the following
cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 50°C 30 seconds, 72°C 45
seconds), and finally 72°C 10 minutes. The expected sized band (-112 bp) was gel
purified with a Gel Extraction kit (Qiagen, Valencia CA), digested with the Pstl and
BspEI restriction enzymes, gel purified, and subcloned into the corresponding sites
pED.dC.native hlFNa Alinker to generate pED.dC.Cys-Fc (Figure 5).
Example 12: Protein Expression and Preparation of Fc-MESNA
[0249] The coding sequence for Fc (the constant region of human lgG1) was
obtained by PCR amplification from an Fc-containing plasmid using standard
conditions and reagents, following the manufacturer's recommended procedure to
subclone the Fc coding sequence Nde\/Sap\. Briefly, the primers 5'- GTGGTCATA
TGGGCATTGAAGGCAGAGGCGCCGCTGCGGTCG - 3'(SEQ ID NO:73) and 5' -
GGTGGTTGC TCTTCCGCAAAAACCCGGAGACAGGGAGAGACTCTTCTGCG - 3'
41-

(SEQ ID NO:74)were used to amplify the Fc sequence from 500 ng of the plasmid
pED.dC.Epo-Fc using Expand High Fidelity System (Boehringer Mannheim, Basel
Switzerland) in a RapidCylcler thermocycler (Idaho Technology Salt Lake City,
Utah), denaturing at 95°C for 2 minutes followed by 18 cycles of 95°C for 0 sec,
55°C for 0 sec, and 72°C for 1 minute with a slope of 4, followed by 72°C extension
for 10 minutes. The PCR product was subcloned into an intermediate cloning vector
and sequenced fully, and then subcloned using the A/del and Sapl sites in the
pTWINI vector following standard procedures. Sambrook, J., Fritsch, E.F. and
Maniatis, T. 1989, Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring
Harbor, New York: Cold Spring Harbor Laboratory Press. This plasmid was then
transformed into BL21(DE3) pLysS cells using standard methods. Id. A 1 liter
culture of cells was grown to an absorbance reading of 0.8 AU at 37°C, induced with
1 mM isopropyl beta-D-1-thiogalactopyranoside, and grown overnight at 25°C. Cells
were pelleted by centrifugation, lysed in 20 mM Tris 8.8/1% NP40/0.1 mM
phenylmethanesulfonyl fluoride/1 pg/ml Benzonase (Novagen Madison, Wl), and
bound to chitin beads (New England Biolabs; Beverly, MA) overnight at 4°C. Beads
were then washed with several column volumes of 20 mM Tris 8.5/ 500 mM NaCI/1
mM EDTA, and then stored at -80°C. Purified Fc-MESNA was generated by eluting
the protein from the beads in 20 mM Tris 8.5/ 500 mM NaCI /1 mM EDTA / 500 mM
2-mercapto ethane sulfonic acid (MESNA), and the eluate was used directly in the
coupling reaction, below.
Example 13: Factor Vll-Fc monomer-dimer hybrid expression and purification
[0250] CHO DG-44 cells expressing Factor Vll-Fc were established. CHO
DG-44 cells were grown at 37°C, 5% C02, in MEM Alpha plus nucleoside and
?*>

ribonucleosides and supplemented with 5% heat-inactivated fetal bovine serum until
transfection.
[0251] DG44 cells were plated in 100 mm tissue culture petri dishes and
grown to a confluency of 50%- 60%. A total of 10 ug of DNA was used to transfect
one 100 mm dish: 7.5 ug of pED.dC.FVII-Fc + 1.5 ug pcDNA3/Flag-Fc + 1 ug of
pcDNA6-PACE. The cells were transfected as described in the Superfect
transfection reagent manual (Qiagen, Valencia, CA). The media was removed from
transfection after 48 hours and replaced with MEM Alpha without nucleosides plus
5% dialyzed fetal bovine serum and 10 ug/ml of Blasticidin (Invitrogen, Carlsbad,
CA) and 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 10 days, the cells
were released from the plate with 0.25% trypsin and transferred into T25 tissue
culture flasks, and the selection was continued for 10-14 days until the cells began
to grow well as stable cell lines were established. Protein expression was
subsequently amplified by the addition 25 nM methotrexate.
[0252] Approximately 2 x 107 cells were used to inoculate 300 ml of growth
medium in a 1700 cm2 roller bottle (Corning, Corning, NY) supplemented with 5
ug/ml of vitamin K3 (menadione sodium bisulfite) (Sigma, St Louis, MO). The roller
bottles were incubated in a 5% CO2 at 37°C for 72 hours. Then the growth medium
was exchanged with 300 ml serum-free production medium (DMEM/F12 with 5 ug/ml
bovine insulin and 10 ug/ml Gentamicin) supplemented with 5 ug/L of vitamin K3.
The production medium (conditioned medium) was collected every day for 10 days
and stored at 4°C. Fresh production medium was added to the roller bottles after
each collection and the bottles were returned to the incubator. Pooled media was
first clarified using a Sartoclean glass fiber filter (3.0 urn + 0.2 urn) (Sartorious Corp.
**

Gottingen, Germany) followed by an Acropack 500 filter (0.8 urn + 0.2 urn) (Pall
Corp., East Hills, NY). The clarified media was then concentrated approximately 20-
fold using Pellicon Biomax tangential flow filtration cassettes (10 kDa MWCO)
(Millipore Corp., Billerica, MA).
[0253] Fc chimeras were then captured from the concentrated media by
passage over a Protein A Sepharose 4 Fast Flow Column (AP Biotech, Piscataway,
NJ). A 5 x 5 cm (100 ml) column was loaded with volume at a linear flow rate of 100 cm/hour to achieve a residence time of > 3
minutes. The column was then washed with >5 column volumes of 1X DPBS to
remove non-specifically bound proteins. The bound proteins were eluted with
100 mM Glycine pH 3.0. Elution fractions containing the protein peak were then
neutralized by adding 1 part 1 M Tris-HCL, pH 8 to 10 parts elute fraction.
[0254] To remove FLAG-Fc homodimers (that is, chimeric Fc dimers with
FLAG peptide expressed as fusions with both Fc molecules) from the preparation,
the Protein A Sepharose 4 Fast Flow pool was passed over a Unosphere S cation-
exchange column (BioRad Corp., Richmond, CA). Under the operating conditions
for the column, the FLAG-Fc monomer-dimer hybrid is uncharged (FLAG-Fc
theoretical pl=6.19) and flows through the column while the hFVII-Fc constructs are
positively charged, and thus bind to the column and elute at higher ionic strength.
The Protein A Sepharose 4 Fast Flow pool was first dialyzed into 20 mM MES,
20 mM NaCI, pH 6.1. The dialyzed material was then loaded onto a 1.1 x 11 cm
(9.9 ml) column at 150 cm/hour. During the wash and elution, the flow rate was
increased to 500 cm/hour. The column was washed sequentially with 8 column
volumes of 20 mM MES, 20 mM NaCI, pH 6.1 and 8 column volumes of 20 mM
9

MES, 40 mM NaCI, pH 6.1. The bound protein was eluted with 20 mM MES,
750 mM NaCI, pH 6.1. Elution fractions containing the protein peak were pooled
and sterile filtered through a 0.2 urn filter disc prior to storage at -80°C.
[0255] An anti-FLAG MAB affinity column was used to separate chimeric Fc
dimers with hFVII fused to both Fc molecules from those with one FLAG peptide and
one hFVII fusion. The Unosphere S Eluate pool was diluted 1:1 with 20 mM Tris,
50 mM NaCI, 5 mM CaCI2, pH 8 and loaded onto a 1.6 x 5 cm M2 anti-FLAG
sepharose column (Sigma Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour.
Loading was targeted to loading the column was washed with 5 column volumes 20 mM Tris, 50 mM NaCI,
5 mM CaCI2, pH 8.0, monomer-dimer hybrids were then eluted with 100 mM Glycine,
pH 3.0. Elution fractions containing the protein peak were then neutralized by
adding 1 part 1 M Tris-HCI, pH 8 to 10 parts eluate fraction. Pools were stored at
-80°C.
Example 14: Factor IX-Fc homodimer and monomer-dimer hybrid expression
and purification
[0256] CHO DG-44 cells expressing Factor IX-Fc were established. DG44
cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of
50%- 60%. A total of 10 ug of DNA was used to transfect one 100 mm dish: for the
homodimer transfection, 8 ug of pED.dC.Factor IX-Fc + 2 ug of pcDNA6-PACE was
used; for the monomer-dimer hybrid transfection, 8 ug of pED.dC.Factor IX-Fc + 1
ug of pcDNA3-FlagFc +1 ug pcDNA6-PACE was used. The cells were transfected
as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA).
The media was removed from transfection after 48 hours and replaced with MEM

Alpha without nucleosides plus 5% dialyzed fetal bovine serum and 10 pg/ml of
Blasticidin (Invitrogen, Carlsbad, CA) for both transfections, while the monomer-
dimer hybrid transfection was also supplemented with 0.2 mg/ml geneticin
(Invitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with
•0.25% trypsin and transferred into T25 tissue culture flasks, and the selection was
continued for 10-14 days until the cells began to grow well as stable cell lines were
established. Protein expression was subsequently amplified by the addition 10 nM
or 100 nM methotrexate for the homodimer or monomer-dimer hybrid, respectively.
[0257] For both cell lines, approximately 2 x 107 cells were used to inoculate
300 ml of growth medium in a 1700 cm2 roller bottle (Corning, Corning, NY),
supplemented with 5 ug/L of vitamin K3 (menadione sodium bisuWite) (Sigma, St.
Louis, MO). The roller bottles were incubated in a 5% C02 at 37°C for
approximately 72 hours. The growth medium was exchanged with 300 ml serum-
free production medium (DMEM/F12 with 5 ng/ml bovine insulin and 10 ug/ml
Gentamicin), supplemented with 5 pg/L of vitamin K3. The production medium
(conditioned medium) was collected everyday for 10 days and stored at 4°C. Fresh
production medium was added to the roller bottles after each collection and the
bottles were returned to the incubator. Prior to chromatography, the medium was
clarified using a SuporCap-100 (0.8/0.2 pm) filter (Pall Gelman Sciences, Ann Arbor,
MI). All of the following steps were performed at 4°C. The clarified medium was
applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM
phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine, pH
2.7 , and then neutralized with 1/10 volume of 1 M Tris-HCl, pH 9.0. The protein
was then dialyzed into PBS.
77

[0258] The monomer-dimer hybrid transfection protein sample was subject
to further purification, as it contained a mixture of FIX-Fc:FIX-Fc homodimer, FIX-
Fc:Flag-Fc monomer-dimer hybrid, and Flag-Fc:Flag-Fc homodimer. Material was
concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep Grade
column at a flow rate of 4 ml/minute (36 cm/hour) and then eluted with 3 column
volumes of 1X PBS. Fractions corresponding to two peaks on the UV detector were
collected and analyzed by SDS-PAGE. Fractions from the first peak contained
either FIX-Fc:FIX-Fc homodimer or FlX-Fc:FlagFc monomer-dimer hybrid, while the
second peak contained FlagFc:FlagFc homodimer. All fractions containing the
monomer-dimer hybrid but no FlagFc homodimer were pooled and applied directly to
a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St. Louis, MO) at a
linear flow rate of 60 cm/hour. After loading, the column was washed with 5 column
volumes PBS. Monomer-dimer hybrids were then eluted with 100 mM Glycine,
pH 3.0. Elution fractions containing the protein peak were then neutralized by
adding 1/10 volume of 1 M Tris-HCI, and analyzed by reducing and nonreducing
SDS-PAGE. Fractions were dialyzed into PBS, concentrated to 1-5 mg/ml, and
stored at -80°C.
Example 15: IFNa homodimer and monomer-dimer hybrid expression and
purification
[0259] CHO DG-44 cells expressing hlFNoc were established. DG44 cells
were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%-
60%. A total of 10 pg of DNA was used to transfect one 100 mm dish: for the
homodimer transfection, 10 pg of the hlFNaFc constructs; for the monomer-dimer
hybrid transfection, 8 pg of the hlFNaFc constructs + 2 pg of pcDNA3-FlagFc. The
93

cells were transfected as described in the Superfect transfection reagent manual
(Qiagen, Valencia, CA). The media was removed from transfection after 48 hours
and replaced with MEM Alpha without nucleosides plus 5% diaiyzed fetal bovine
serum, while the monomer-dimer hybrid transfection was also supplemented with
0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 3 days, the cells were released
from the plate with 0.25% trypsin and transferred into T25 tissue culture flasks, and
the selection was continued for 10-14 days until the cells began to grow well and
stable cell lines were established. Protein expression was subsequently amplified
by the addition methotrexate: ranging from 10 to 50 nM.
[0260] For all cell lines, approximately 2 x 107 cells were used to inoculate
300 ml of growth medium in a 1700 cm2 roller bottle (Corning, Corning, NY). The
roller bottles were incubated in a 5% CO2 at 37°C for approximately 72 hours. Then
the growth medium was exchanged with 300 ml serum-free production medium
(DMEM/F12 with 5 ug/ml bovine insulin and 10 pg/ml Gentamicin). The production
medium (conditioned medium) was collected every day for 10 days and stored at
4°C. Fresh production medium was added to the roller bottles after each collection
and the bottles were returned to the incubator. Prior to chromatography, the
medium was clarified using a SuporCap-100 (0.8/0.2 urn) filter from Pall Gelman
Sciences (Ann Arbor, Ml). All of the following steps were performed at4°C. The
clarified medium was applied to Protein A Sepharose, washed with 5 column
volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI),
eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-
HCI, pH 9.0. The protein was then diaiyzed into PBS.
9?

[0261] The monomer-dimer hybrid transfection protein samples were then
subject to further purification, as it contained a mixture of IFNaFc:IFNaFc
homodimer, IFNaFc:FlagFc monomer-dimer hybrid, and FlagFc:FlagFc homodimer
(or Alinker or GS15 linker). Material was concentrated and applied to a 2.6 cm x 60
cm (318 ml) Superdex 200 Prep Grade column at a flow rate of 4 ml/min (36 cm/hr)
and then eluted with 3 column volumes of 1X PBS. Fractions corresponding to two
peaks on the UV detector were collected and analyzed by SDS-PAGE. Fractions
from the first peak contained either IFNaFc:IFNctFc homodimer or IFNaFc:FlagFc
monomer-dimer hybrid, while the second peak contained FlagFc:FlagFc homodimer.
All fractions containing the monomer-dimer hybrid, but no FlagFc homodimer, were
pooled and applied directly to a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma
Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour. After loading the column
was washed with 5 column volumes PBS monomer-dimer hybrids were then eluted
with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were
then neutralized by adding 1/10 volume of 1 M Tris-HCI, and analyzed by reducing
and nonreducing SDS-PAGE. Fractions were dialyzed into PBS, concentrated to 1-
5 mg/ml, and stored at -80°C.
Example 16: Coiled coil protein expression and purification
[0262] The plasmids, pED.dC Epo-CCA-Fc and pED.dC CCB-Fc will be
transfected either alone or together at a 1:1 ratio into CHO DG44 cells. The cells will
be transfected as described in the Superfect transfection reagent manual (Qiagen,
Valencia, CA). The media will be removed after 48 hours and replaced with MEM
Alpha w/o nucleosides plus 5% dialyzed fetal bovine serum. Purification will be
done by affinity chromatography over a protein A column according to methods
loo

known in the art. Alternatively, purification can be achieved using size exclusion
chromatography.
Example 17: Cvs-Fc expression and purification
[0263] CHO DG-44 cells expressing Cys-Fc were established. The
pED.dC.Cys-Fc expression plasmid, which contains the mouse dihydrofolate
reductase (dhfr) gene, was transfected into CHO DG44 (dhfr deficient) cells using
Superfect reagent (Qiagen; Valencia, CA) according to manufacturer's protocol,
followed by selection for stable transfectants in. aMEM (without nucleosides) tissue
culture media supplemented with 5% dialyzed FBS and penicillin/streptomycin
antibiotics (Invitrogen; Carlsbad, CA) for 10 days. The resulting pool of stably
transfected cells were then amplified with 50 nM methotrexate to increase
expression. Approximately 2 x 107 cells were used to inoculate 300 ml of growth
medium in a 1700 cm2 roller bottle (Corning, Corning, NY). The roller bottles were
incubated in a 5% C02 at 37°C for approximately 72 hours. The growth medium
was exchanged with 300 ml serum-free production medium (DMEM/F12 with 5 pg/ml
bovine insulin and 10 pg/ml Gentamicin). The production medium (conditioned
medium) was collected every day for 10 days and stored at 4°C. Fresh production
medium was added to the roller bottles after each collection and the bottles were
returned to the incubator. Prior to chromatography, the medium was clarified using
a SuporCap-100 (0.8/0.2 urn) filter from Pall Gelman Sciences (Ann Arbor, Ml). All
of the following steps were performed at 4°C. The clarified medium was applied to
Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate,
pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine, pH 2.7, and then

neutralized with 1/10 volume of 1 M Tris-HCl, pH 9.0. Protein was dialyzed into PBS
and used directly in conjugation reactions.
Example 18: Coupling of T20-thioesters to Cvs-Fc
[0264] Cys-Fc (4 mg, 3.2 mg/ml final concentration) and either T20-thioester
or T20-PEG-thioester (2 mg, approximately 5 molar equivalents) were incubated for
16 hours at room temperature in 0.1 M Tris 8/10 mM MESNA. Analysis by SDS-
PAGE (Tris-Gly gel) using reducing sample buffer indicated the presence of a new
band approximately 5 kDa larger than the Fc control (>40-50% conversion to the
conjugate). Previous N-terminal sequencing of Cys-Fc and unreacted Cys-Fc
indicated that the signal peptide is incorrectly processed in a fraction of the
molecules, leaving a mixture of (Cys)-Fc, which will react through native ligation with
peptide-thioesters, and (Val)-(Gly)-(Cys)-Fc, which will not. As the reaction
conditions are insufficient to disrupt the dimerization of the Cys-Fc molecules, this
reaction generated a mixture of T20-Cys-Fc:T20-Cys-Fc homodimers, T20-Cys-Fc:
Fc monomer-dimer hybrids, and Cys-Fc:Cys-Fc Fc-dimers. This protein was purified
using size exclusion chromatography as indicated above to separate the three
species. The result was confirmed by SDS-PAGE analysis under nonreducing
conditions.
Example 19: Antiviral assay for IFNa activity
[0265] Antiviral activity (lU/ml) of IFNa fusion proteins was determined using
a CPE (cytopathic effect) assay. A549 cells were plated in a 96 well tissue culture
plate in growth media (RPM11640 supplemented with 10% fetal bovine serum (FBS)
and 2 mM L-glutamine) for 2 hours at 37°C, 5% C02. IFNa standards and IFNa
fusion proteins were diluted in growth media and added to cells in triplicate for 20

hours at 37°C, 5% CO2. Following incubation, all media was removed from wells,
encephalomyocarditis virus (EMC) virus was diluted in growth media and added
(3000 pfu/well) to each well with the exception of control wells. Plates were
incubated at 37°C, 5% C02for 28 hours. Living cells were fixed with 10% cold
trichloroacetic acid (TCA) and then stained with Sulforhodamine B (SRB) according
to published protocols (Rubinstein et al. 1990, J. Natl. Cancer Inst. 82, 1113). The
SRB dye was solubilized with 10 mM Tris pH 10.5 and read on a spectrophotometer
at 490 nm. Samples were analyzed by comparing activities to a known standard
curve World Health Organization IFNcc 2b International Standard ranging from 5 to
0.011 lU/ml. The results are presented below in Table 3 and Figure 6 and
demonstrate increased antiviral activity of monomer-dimer hybrids.
TABLE 3: INTERFERON ANTIVIRAL ASSAY
HOMODIMER V. MONOMER-DIMER HYBRID

Protein Antiviral Activity
(lU/nmol) Std dev
IFNaFc 8aa linker homodimer 0.45 x10s 0.29 x10s
IFNaFc 8aa linkenFlagFc
monomer-dimer hybrid 4.5x10& 1.2 x10s
IFNaFc A linker homodimer 0.22 x10s 0.07 x10s
IFNaFc A delta linker: FlagFc
monomer-dimer hybrid 2.4 x10s 0.0005 x10s
IFNaFc GS15 linker
homodimer 2.3x10s 1.0x10s
IFNaFc GS15 linker
monomer-dimer hybrid 5.3x10s 0.15x10s
Example 20: FVIIa Clotting Activity Analysis
[0266] The StaClot FVIIa-rTF assay kit was purchased from Diagnostica
Stago (Parsippany, NJ) and modified as described in Johannessen et al. 2000,
/02.

Blood Coagulation and Fibrinolysis 11:S159. A standard curve was preformed with
the FVIIa World Health Organization standard 89/688. The assay was used to
compare clotting activity of monomer-dimer hybrids compared to homodimers. The
results showed the monomer-dimer hybrid had four times the clotting activity
compared to the homodimer (Figure 7).
Example 21:FVIIa-Fc Oral dosing in day 10 rats
[0267] 25 gram day 9 newborn Sprague Dawley rats were purchased from
Charles River (Wilmington, MA) and allowed to acclimate for 24 hours. The rats
were dosed orally with FVllaFc homodimer, monomer-dimer hybrid or a 50:50 mix of
the two. A volume of 200 pi of a FVllaFc solution for a dose of 1 mg/kg was
administered. The solution was composed of a Tris-HCI buffer pH 7.4 with 5 mg/ml
soybean trypsin inhibitor. The rats were euthanized with CO2 at several time points,
and 200 pi of blood was drawn by cardiac puncture. Plasma was obtained by the
addition of a 3.8% sodium citrate solution and centrifugation at room temperature at
a speed of 1268xg. The plasma samples were either assayed fresh or frozen at
20°C. Orally dosed monomer-dimer hybrid resulted in significantly higher maximum
(Cmax) serum concentrations compared to homodimeric Factor VII (Figure 8).
Example 22: Factor IX-Fc Oral dosing of neonatal rats
[0268] Ten-day old neonatal Sprague-Dawley rats were dosed p.o. with
200 pi of FIX-Fc homodimer or FIX-Fc: FlagFc monomer-dimer hybrid at
approximately equimolar doses of 10 nmol/kg in 0.1 M sodium phosphate buffer, pH
6.5 containing 5 mg/ml soybean trypsin inhibitor and 0.9% NaCI. At 1, 2,4, 8, 24,
48, and 72 hours post injection, animals were euthanized with C02, blood was
drawn via cardiac puncture and plasma was obtained by the addition of a 3.8%

sodium citrate solution and centrifugation at room temperature at a speed of 1268xg.
Samples were then sedimented by centrifugation, serum collected and frozen at
-20°C until analysis of the fusion proteins by ELISA.
Example 23: Factor IX-Fc EL1SA
[0269] A 96-well Immulon 4HBX ELISA plate (Thermo LabSystems, Vantaa,
Finland) was coated with 100 ul/well of goat anti-Factor IX IgG (Affinity Biologicals,
Ancaster, Canada) diluted 1:100 in 50 mM carbonate buffer, pH 9.6. The plates
were incubated at ambient temperature for 2 hours or overnight at 4°C sealed with
plastic film. The wells were washed 4 times with PBST, 300 pl/well using the
TECAN plate washer. The wells were blocked with PBST + 6% BSA, 200 ul/well,
and incubated 90 minutes at ambient temperature. The wells were washed 4 times
with PBST, 300 ul/well using the TECAN plate washer. Standards and blood
samples from rats described in Example 18 were added to the wells, (100 pl/well),
and incubated 90 minutes at ambient temperature. Samples and standards were
diluted in HBET buffer (HBET: 5.95 g HEPES, 1.46 g NaCI, 0.93 g Na2EDTA, 2.5 g
Bovine Serum Albumin, 0.25 ml Tween-20, bring up to 250 ml with dH20, adjust pH
to 7.2). Standard curve range was from 200 ng/ml to 0.78 ng/ml with 2 fold dilutions
in between. Wells were washed 4 times with PBST, 300 ul/well using the TECAN
plate washer. 100 pl/well of conjugated goat anti-human IgG-Fc-HARP antibody
(Pierce, Rockford, IL) diluted in HBET 1:25,000 was added to each well. The plates
were incubated 90 minutes at ambient temperature. The wells were washed 4 times
with PBST, 300 pl/well using the TECAN plate washer. The plates were developed
with 100 pl/well of tetramethylbenzidine peroxidase substrate (TMB) (Pierce,
Rockford, IL) was added according to the manufacturer's instructions. The plates

were incubated 5 minutes at ambient temperature in the dark or until color
developed. The reaction was stopped with 100 ul/well of 2 M sulfuric acid.
Absorbance was read at 450 nm on SpectraMax plusplate reader (Molecular
Devices, Sunnyvale, CA). Analysis of blood drawn at 4 hours indicated more than a
10 fold difference in serum concentration between Factor IX-Fc monomer-dimer
hybrids compared to Factor IX Fc homodimers (Figure 9). The results indicated
Factor IX-Fc monomer-dimer hybrid levels were consistently higher than Factor IX-
Fc homodimers (Figure 10).
Example 24: Cloning of Epo-Fc
[0270] The mature Epo coding region was obtained by PCR amplification
from a plasmid encoding the mature erythropoietin coding sequence, originally
obtained by RT-PCR from Hep G2 mRNA, and primers hepoxba-F and hepoeco-R,
indicated below. Primer hepoxba-F contains an Xbal site, while primer hepoeco-R
contains an EcoRI site. PCR was carried out in the Idaho Technology RapidCycler
using Vent polymerase, denaturing at 95°C for 15 seconds, followed by 28 cycles
with a slope of 6.0 of 95°C for 0 seconds, 55°C for 0 seconds, and 72°C for 1 minute
20 seconds, followed by 3 minute extension at 72°C. An approximately 514 bp
product was gel purified, digested with Xbal and EcoRI, gel purified again and
directionally subcloned into an Xoal/EcoRI-digested, gel purified pED.dC.XFc vector,
mentioned above. This construct was named pED.dC.EpoFc.
[0271] The Epo sequence, containing both the endogenous signal peptide
and the mature sequence, was obtained by PCR amplification using an adult kidney
QUICK-clone cDNA preparation as the template and primers Epo+Pep-Sbf-F and
Epo+Pep-Sbf-R, described below. The primer Epo+Pep-Sbf-F contains an Sbf\ site
le>4

upstream of the start codon, while the primer Epo+Pep-Sbf-R anneals downstream
of the endogenous Sbfl site in the Epo sequence. The PCR reaction was carried out
in the PTC-200 MJ Thermocycler using Expand polymerase, denaturing at 94°C for
2 minutes, followed by 32 cycles of 94°C for 30 seconds, 57°C for 30 seconds, and
72°C for 45 seconds, followed by a 10 minute extension at 72°C. An approximately
603 bp product was gel isolated and subcloned into the pGEM-T Easy vector. The
correct coding sequence was excised by Sbf\ digestion, gel purified, and cloned into
the Psfl-digested, shrimp alkaline phosphatase (SAP)-treated, gel purified
pED.dC.EpoFc plasmid. The plasmid with the insert in the correct orientation was
initially determined by Kpn\ digestion. AXmn\ and PvuU digestion of this construct
was compared with pED.dC.EpoFc and confirmed to be in the correct orientation.
The sequence was determined and the construct was named pED.dC.natEpoFc.
PCR Primers:
hepoxba-F (EPO-F): 5'-AATCTAGAGCCCCACCACGCCTCATCTGTGAC-3'(SEQ
ID NO:75)
hepoeco-R (EPO-R) 5'-TTGAATTCTCTGTCCCCTGTCCTGCAGGCC-3'(SEQ ID
N0.76)
Epo+Pep-Sbf-F: 5'-GTACCTGCAGGCGGAGATGGGGGTGCA-3'(SEQ ID
NO:77)
Epo+Pep-Sbf-R: 5'-CCTGGTCATCTGTCCCCTGTCC-3'(SEQ ID NO:78)
Example 25: Cloning of Epo-Fc
[0272] An alternative method of cloning EPO-Fc is described herein.
Primers were first designed to amplify the full length Epo coding sequence, including
the native signal sequence, as follows:
Epo-F: 5'-GTCCAACCTG CAGGAAGCTTG CCGCCACCAT GGGAGTGCAC
GAATGTCCTG CCTGG- 3'(SEQ ID NO:79)
to?

Epo-R: 5'-GCCGAATTCA GTTTTGTCGA CCGCAGCGG CGCCGGCGAA
CTCTCTGTCC CCTGTTCTGC AGGCCTCC- 3'(SEQ ID NO:80)
[0273] The forward primer incorporates an Sbfl and Hindlll site upstream of
a Kozak sequence, while the reverse primer removes the internal Sbfl site, and adds
an 8 amino acid linker to the 3' end of the coding sequence (EFAGAAAV) (SEQ ID
NO:81) as well as Sail and EcoRI restriction sites. The Epo coding sequence was
then amplified from a kidney cDNA library (BD Biosciences Clontech, Palo Alto, CA)
using 25 pmol of these primers in a 25 pi PCR reaction using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's
standard protocol in a MJ Thermocycler using the following cycles: 94°C 2 minutes;
30 cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 45 seconds), followed by
72°C for 10 minutes. The expected sized band (641 bp) was gel purified with a Gel
Extraction kit (Qiagen, Valencia, CA) and ligated into the intermediate cloning vector
pGEM T-Easy (Promega, Madison, Wl). DNA was transformed into DH5a cells
(Invitrogen, Carlsbad, CA) and miniprep cultures grown and purified with a Plasmid
Miniprep Kit (Qiagen, Valencia, CA) both according to manufacturer's standard
protocols. Once the sequence was confirmed, this insert was digested out with
Sbfl/EcoRI restriction enzymes, gel purified, and cloned into the Pstl/EcoRI sites of
the mammalian expression vector pED.dC in a similar manner.
[0274] Primers were designed to amplify the coding sequence for the
constant region of human lgG1 (the Fc region, EU numbering 221-447) as follows:
Fc-F: 5'-GCTGCGGTCG ACAAAAC.TCA CACATGCCCA CCGTGCCCAG
CTCCGGAACT CCTGGGCGGA CCGTCAGTC- 3'(SEQ ID NO:82)
Fc-R 5'-ATTGGAATTC TCATTTACCC GGAGACAGGG AGAGGC- 3'(SEQ ID
NO:83)
fv2>

The forward primer incorporates a Sail site at the linker-Fc junction, as well as
introducing BspEI and Rsrll sites into the Fc region without affecting the coding
sequence, while the reverse primer adds an EcoRI site after the stop codon. The Fc
coding sequence was then amplified from a leukocyte cDNA library (BD Biosciences
Clontech, Palo Alto, CA) using 25 pmol of these primers in a 25 pi PCR reaction
using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN)
according to manufacturer's standard protocol in a MJ Thermocycler using the
following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 58°C 30 seconds,
72°C 45 seconds), followed by 72°C for 10 minutes. The expected sized band (696
bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia, CA) and ligated into
the intermediate cloning vector pGEM T-Easy (Promega, Madison, Wl). DNA was
transformed into DH5a cells (Invitrogen, Carlsbad, CA) and miniprep cultures grown
and purified with a Plasmid Miniprep Kit (Qiagen, Valencia, CA), both according to
manufacturer's standard protocols. Once the sequence was confirmed, this insert
was digested out with Sal/EcoRI restriction enzymes, gel purified, and cloned into
the Sall/EcoRI sites of the plasmid pED.dC.Epo (above) in a similar manner, to
generate the mammalian expression plasmid pED.dC.EpoFc. In another experiment
this plasmid was also digested with Rsrll/Xmal, and the corresponding fragment
from pSYN-Fc-002, which contains the Asn 297 Ala mutation (EU numbering) was
cloned in to create pED.dC.EPO-Fc N297A (pSYN-EPO-004). Expression in
mammalian cells was as described in Example 26. The amino acid sequence of
EpoFc with an eight amino acid linker is provided in figure 2j. During the process of
this alternative cloning method, although the exact EpoFc amino acid sequence was
preserved (figure 2J), a number of non-coding changes were made at the nucleotide

level (figure 3J). These are G6A (G at nucleotide 6 changed to A) (eliminate
possible secondary structure in primer), G567A (removes endogenous Sbfl site from
Epo), A582G (removes EcoRI site from linker), A636T and T639G (adds unique
BspEI site to Fc), and G651C (adds unique Rsrll site to Fc). The nucleotide
sequence in figure 3J is from the construct made in Example 25, which incorporates
these differences from the sequence of the construct from Example 24.
Example 26: EPO-Fc Homodimer And Monomer-dimer Hybrid Expression And
Purification
[0275] DG44 cells were plated in 100 mm tissue culture petri dishes and
grown to a confluency of 50%-60%. A total of 10 ug of DNA was used to transfect
one 100 mm dish: for the homodimer transfection,10 ug of pED.dC.EPO-Fc; for the
monomer-dimer hybrid transfection, 8 ug of pED.dC.EPO-Fc + 2 pg of pcDNA3-
FlagFc. The constructs used were cloned as described in Example 24. The cloning
method described in Example 25 could also be used to obtain constructs for use in
this example. The cells were transfected as described in the Superfect transfection
reagent manual (Qiagen, Valencia, CA). Alternatively, pED.dC.EPO-Fc was
cotransfected with pSYN-Fc-016 to make an untagged monomer. The media was
removed from transfection after 48 hours and replaced with MEM Alpha without
nucleosides plus 5% dialyzed fetal bovine serum for both transfections, while the
monomer-dimer hybrid transfection was also supplemented with 0.2 mg/ml geneticin
(lnvitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with
0.25% trypsin and transferred into T25 tissue culture flasks, and the selection was
continued for 10-14 days until the cells began to grow well as stable cell lines were
// b>

established. Protein expression was subsequently amplified by the addition
methotrexate.
[0276] For both cell lines, approximately 2 x 107 cells were used to inoculate
300 ml of growth medium in a 1700 cm2 roller bottle (Corning, Corning, NY). The
roller bottles were incubated in a 5% C02 at 37°C for approximately 72 hours. The
growth medium was exchanged with 300 ml serum-free production medium
(DMEM/F12 with 5 ug/ml bovine insulin and 10 ug/ml Gentamicin). The production
medium (conditioned medium) was collected every day for 10 days and stored at
4°C. Fresh production medium was added to the roller bottles after each collection
and the bottles were returned to the incubator. Prior to chromatography, the
medium was clarified using a SuporCap-100 (0.8/0.2 urn) filter from Pall Gelman
Sciences (Ann Arbor, Ml). All of the following steps were performed at 4°C. The
clarified medium was applied to Protein A Sepharose, washed with 5 column
volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI),
eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-
HCI, pH 9.0. Protein was then dialyzed into PBS.
[0277] The monomer-dimer hybrid transfection protein sample was subject
to further purification, as it contained a mixture of EPO-Fc:EPO-Fc homodimer,
EPO-Fc:Flag-Fc monomer-dimer hybrid, and Flag-Fc:Flag-Fc homodimer. Material
was concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep
Grade column at a flow rate of 4 ml/min (36 cm/hour) and then eluted with 3 column
volumes of 1X PBS. Fractions corresponding to two peaks on the UV detector were
collected and analyzed by SDS-PAGE. Fractions from the first peak contained
either EPO-Fc:EPO-Fc homodimer or EPO-Fc:FlagFc monomer-dimer hybrid, while

the second peak contained FlagFc:FlagFc homodimer. All fractions containing the
monomer-dimer hybrid but no FlagFc homodimer were pooled and applied directly to
a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp.) at a linear flow rate of
60 cm/hour. After loading the column was washed with 5 column volumes PBS.
Monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution
fractions containing the protein peak were then neutralized by adding 1/10 volume of
1 M Tris-HCI, and analyzed by reducing and nonreducing SDS-PAGE. Fractions
were dialyzed into PBS, concentrated to 1-5 mg/ml, and stored at-80°C.
[0278] Alternatively, fractions from first peak of the Superdex 200 were
analyzed by SDS-PAGE, and only fractions containing a majority of EpoFc
monomer-dimer hybrid, with a minority of EpoFc homodimer, were pooled. This
pool, enriched for the monomer-dimer hybrid, was then reapplied to a Superdex 200
column, and fractions containing only EpoFc monomer-dimer hybrid were then
pooled, dialyzed and stored as purified protein. Note that this alternate purification
method could be used to purify non-tagged monomer-dimer hybrids as well:
Example 27: Administration of EpoFc Dimer and Monomer-Dimer Hybrid With
an Eight Amino Acid Linker to Cynomolgus Monkeys
[0279] For pulmonary administration, aerosols of either EpoFc dimer or
EpoFc monomer-dimer hybrid proteins (both with the 8 amino acid linker) in PBS, pH
7.4 were created with the Aeroneb Pro™ (AeroGen, Mountain View, CA) nebulizer,
in-line with a Bird Mark 7A respirator, and administered to anesthetized naTve
cynomolgus monkeys through endotracheal tubes (approximating normal tidal
breathing). Both proteins were also administered to naTve cynomolgus monkeys by
intravenous injection. Samples were taken at various time points, and the amount of

Epo-containing protein in the resulting plasma was quantitated using the Quantikine
IVD Human Epo Immunoassay (R&D Systems, Minneapolis, MN). Pharmacokinetic
parameters were calculated using the software WinNonLin. Table 4 presents the
bioavailability results of cynomolgus monkeys treated with EpoFc monomer-dimer
hybrid or EpoFc dimer.
TABLE 4: ADMINISTRATION OF EPOFC MONOMER-DIMER
HYBRID AND EPOFC DIMER TO MONKEYS

Protein Monkey
# Route Approx.
Deposited
Dose1
(ug/kg) Cmax
(ng/ml) Cmax
(fmol/ml) tl/2
(hr) ti/2 avg
(hr)
EpoFc
monomer-
dimer
hybrid C06181 pulm 20 72.3 1014 23.6 25.2

C06214 pulm 20 50.1 703 23.5


CO7300 pulm 20 120 1684 36.2


C07332 pulm 20 100 1403 17.5


C07285 IV 25 749 10508 21.3 22.6

C07288 IV 25 566 7941 23


C07343 IV 25 551 1014 23.5

EpoFc
dimer DD026 pulm 15 10.7 120 11.5 22.1

DD062 pulm 15 21.8 244 27.3


DD046 pulm 15 6.4 72 21.8


DD015 pulm 15 12.8 143 20.9


DD038 pulm 35 27 302 29


F4921 IV 150 3701 41454 15.1 14.6

96Z002 IV 150 3680 41219 15.3


1261CQ IV 150 2726 30533 23.6


127-107 IV 150 4230 47379 15.0


118-22 IV 150 4500 50403 8.7


126-60 IV 150 3531 39550 9.8

Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy
[0280] The percent bioavailability (F) was calculated for the pulmonary
doses using the following equation:
F= (AUC pulmonary / Dose pulmonary) / (AUC IV / Dose IV) * 100
ni

TABLE 5: CALCULATION OF PERCENT BIOAVAILABILITY FOR EPOFC
MONOMER-DIMER HYBRID V. DIMER AFTER PULMONARY ADMINISTRATION
TO NAIVE CYNOMOLGUS MONKEYS

Protein Monkey # Approx.
Dose1
(deposited) AUC
ng»hr/mL Bioavailability2
(F) Average
Bioavailabiity
EpoFc
monomer-
dimer
hybrid C06181 20 pg/kg 3810 25.2% 34.9%

C06214 20 pg/kg 3072 20.3%


CO7300 20 pg/kg 9525 63.0%


C07332 20 pg/kg 4708 31.1%

EpoFc
dimer DD026 15 pg/kg 361 5.1% 10.0 %

DD062 15 pg/kg 1392 19.6%


DD046 15 pg/kg 267 3.8%


DD015 15 pg/kg 647 9.1%


nnnoo
L/UUOO onco -10/10/
l..t/0

Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy
2 Mean AUC for IV EpoFc monomer-dimer hybrid = 18,913 ng-hr/mL (n=3 monkeys), dosed at
25 pg/kg. Mean AUC for IV EpoFc dimer = 70, 967 ng-hr/mL (n=6 monkeys), dosed at 150 pg/kg
[0281] The pharmacokinetics of EpoFc with an 8 amino acid linker
administered to cynomolgus monkeys is presented in figure 11. The figure
compares the EpoFc dimer with the EpoFc monomer-dimer hybrid in monkeys after
administration of a single pulmonary dose. Based on a molar comparison
significantly higher serum levels were obtained in monkeys treated with the
monomer-dimer hybrid compared to the dimer.
Example 28: Subcutaneous Administration of EPOFc Monomer-dimer Hybrid
[0282] To compare serum concentrations of known erythropoietin agents
with EPOFc monomer-dimer hybrids, both EPOFc monomer-dimer hybrid and
Aranesp® (darbepoetin alfa), which is not a chimeric fusion protein, were
administered subcutaneously to different monkeys and the serum concentration of
both was measured over time.
[0283] Cynomolgus monkeys (n = 3 per group) were injected
subcutaneously with 0.025 mg/kg EpoFc monomer-dimer hybrid. Blood samples
l,U

were collected predose and at times up to 144 hours post dose. Serum was
prepared from the blood and stored frozen until analysis by ELISA (Human Epo
Quantikine Immunoassay) (R&D Systems, Minneapolis, MN). Pharmacokinetic
parameters were determined using WinNonLina® software (Pharsight,
Mountainview, CA).
[0284] The results indicated the serum concentrations of both EPOFc
monomer-dimer hybrid and Aranesp® (darbepoetin alfa) were equivalent over time,
even though the administered molar dose of Aranesp® (darbepoetin alfa) was
slightly larger (Table 6) (figure 12).
TABLE 6

Route Dose
(ng/kg) Dose
(nmol/kg) Cmax
(ng/mL) AUC
(ng»hr»ml_"1) Tl/2
(hr) %
Bioavailability
(F)
EpoFc
Monomer-
dimer
hybrid Subcutaneous 25 0.3 133 ±
34 10,745 +
3,144 26
±5 57 ±17
Aranesp® Subcutaneous 20 0.54 83 ±11 5390 ± 747 22
±2 53 ±8
Example 29: Intravenous Administration of EPOFc Monomer-dimer Hybrid
[0285] To compare serum concentrations of known erythropoietin agents
with EPOFc monomer-dimer hybrids, EPOFc monomer-dimer hybrid, Aranesp®
(darbepoetin alfa), and Epogen® (epoetin alfa), neither of which is a chimeric fusion
protein, were administered intravenously to different monkeys and the serum
concentration of both was measured over time.
[0286] Cynomolgus monkeys (n = 3 per group) were injected intravenously
with 0.025 mg/kg EpoFc monomer-dimer hybrid. Blood samples were collected
predose and at times up to 144 hours post dose. Serum was prepared from the
//s."

blood and stored frozen until analysis by ELISA (Human Epo Quantikine
Immunoassay) (R&D Systems, Minneapolis, MN). Pharmacokinetic parameters
were determined using WinNonLina software (Pharsight, Mountainview, CA).
[0287] The results indicated the serum concentration versus time (AUC) of
EPOFc monomer-dimer hybrid was greater than the concentrations of either
Epogen® (epoetin alfa) or Aranesp® (darbepoetin alfa), even though the monkeys
received larger molar doses of both Epogen® (epoetin alfa) and Aranesp®
(darbepoetin alfa) (Table 7) (Figure 13).
TABLE 7

Route Dose
(wj/kg) Dose
(nmol/kg) Cmax
(ng/mL) AUC
(ng»hr»ml_"1) T1/2
(hr)
EpoFc
Monomer-
dimer
hybrid Intravenous 25 0.3 622 +
110 18,913±
3,022 23 ±1
Aranesp® Intravenous 20 0.54 521 ±8 10,219 +
298 20 ±1
Epogen Intravenous 20 0.66 514 +
172 3936 + 636 6.3 + 0.6
Example 30: Alternative Purification of EpoFc Monomer-dimer Hybrid
[0288] Yet another alternative for purifying EPO-Fc is described herein. A
mixture containing Fc, EpoFc monomer-dimer hybrid, and EpoFc dimer was applied
to a Protein A Sepharose column (Amersham, Uppsala, Sweden). The mixture was
eluted according to the manufacturer's instructions. The Protein A Sepharose
eluate, containing the mixture was buffer exchanged into 50 mM Tris-CI (pH 8.0).
The protein mixture was loaded onto an 8 ml_ Mimetic Red 2 XL column (ProMetic
Life Sciences, Inc., Wayne, NJ) that had been equilibrated in 50 mM Tris-CI (pH
8.0). The column was then washed with 50 mM Tris-CI (pH 8.0); 50 mM NaCI. This
)fb

step removed the majority of the Fc. EpoFc monomer-dimer hybrid was specifically
eluted from the column with 50 mM Tris-CI (pH 8.0); 400 mM NaCI. EpoFc dimer
can be eluted and the column regenerated with 5 column volumes of 1 M NaOH.
Eluted fractions from the column were anafyzed by SDS-PAGE (Figure 14).
Example 31: Cloning of IgK signal sequence - Fc construct for making
untagged Fc alone.
[0289] The coding sequence for the constant region of lgG1 (EU # 221-447;
the Fc region) was obtained by PCR amplification from a leukocyte cDNA library
(Clontech, CA) using the following primers:
rcFc-F 5'- GCTGCGGTCGACAAAACTCACACATGCCCACCGTGCCCAGCTCC
GGAACTCCTGGGCGGACCGTCAGTC -3' (SEQ ID NO: 84)
rcFc-R 5'- ATTGGAATTCTCATTTACCCGGAGACAGGGAGAGGC -3' (SEQ ID
NO: 85)
[0290] The forward primer adds three amino acids (AAV) and a Sail cloning
site before the beginning of the Fc region, and also incorporates a BspEl restriction
site at amino acids 231-233 and an Rsrll restriction site at amino acids 236-238
using the degeneracy of the genetic code to preserve the correct amino acid
sequence (EU numbering). The reverse primer adds an EcoRI cloning site after the
stop codon of the Fc. A 25 pi PCR reaction was carried out with 25 pmol of each
primer using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN)
according to the manufacturer's standard protocol in a MJ Thermocycler using the
following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds, 58°C 30 seconds,
72°C 45 seconds), 72°C 10 minutes. The expected sized band (-696 bp) was gel
'/>

purified with a Gel Extraction kit (Qiagen, Valencia CA), and cloned into pGEM T-
Easy (Promega, Madison, Wl) to produce an intermediate plasmid pSYN-Fc-001
(pGEM T-Easy/Fc).
[0291] The mouse IgK signal sequence was added to the Fc CDS using the
following primers:
rc-lgK sig seq-F: 5'-TTTAAGCTTGCCGCCACCATGGAGACAGACACACTCC
TGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACAAAACT
CACACATGCCCACCG -3' (SEQ ID NO: 86)
Fc-noXma-GS-R: 5'- GGTCAGCTCATCGCGGGATGGG -3' (SEQ ID NO: 87)
Fc-noXma-GS-F: 5'- CCCATCCCGCGATGAGCTGACC -3' (SEQ ID NO: 88)
[0292] The rc-lgK signal sequence-F primer adds a Hindi 11 restriction site to
the 5'end of the molecule, followed by a Kozak sequence (GCCGCCACC) (SEQ ID
NO: 89) followed by the signal sequence from the mouse IgK light chain, directly
abutted to the beginning of the Fc sequence (EU# 221). The Fc-noXma-GS-F and -
R primers remove the internal Xmal site from the Fc coding sequence, using the
degeneracy of the genetic code to preserve the correct amino acid sequence. Two
25 ul PCR reactions were carried out with 25 pmol of either rc-lgK signal sequence-F
and Fc-noXma-GS-R or Fc-noXma-GS-F and rcFc-R using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's
standard protocol in a MJ Thermocycler. The first reaction was carried out with 500
ng of leukocyte cDNA library (BD Biosciences Clontech, Palo Alto, CA) as a
template using the following cycles: 94°C 2 minutes; 30 cycles of (94°C 30 seconds,
55°C 30 seconds, 72°C 45 seconds), 72°C 10 minutes. The second reaction was

carried out with 500 ng of pSYN-Fc-001 as a template (above) using the following
cycles: 94°C 2 minutes; 16 cycles of (94°C 30 seconds, 58°C 30 seconds, 72°C 45
seconds), 72°C 10 minutes. The expected sized bands (-495 and 299 bp,
respectively) were gel purified with a Gel Extraction kit (Qiagen, Valencia CA), then
combined in a PCR reaction with 25 pmol of rc-lgK signal sequence-F and rcFc-R
primers and run as before, annealing at 58°C and continuing for 16 cycles. The
expected sized band (-772 bp) was gel purified with a Gel Extraction kit (Qiagen,
Valencia CA) and cloned into pGEM T-Easy (Promega, Madison, Wl) to produce an
intermediate plasmid pSYN-Fc-007 (pGEM T-Easy/lgK sig seq-Fc). The entire IgK
signal sequence-Fc cassette was then subcloned using the Hindlll and EcoRI sites
into either the pEE6.4 (Lonza, Slough, UK) or pcDNA3.1 (Invitrogen, Carlsbad, CA)
mammalian expression vector, depending on the system to be used, to generate
pSYN-Fc-009 (pEE6.4/lgK sig seq-Fc) and pSYN-Fc-015 (pcDNA3/lgK sig seq-Fc).
Example 32: Cloning of IgK signal sequence - Fc N297A construct for making
untagged Fc N297A alone.
[0293] In order to mutate Asn 297 (EU numbering) of the Fc to an Ala
residue, the following primers were used:
N297A-F 5'- GAGCAGTACGCTAGCACGTACCG -3' (SEQ ID NO: 90)
N297A-R 5'- GGTACGTGCTAGCGTACTGCTCC -3* (SEQ ID NO: 91)
[0294] Two PCR reactions were carried out with 25 pmol of either rc-lgK
signal sequence-F and N297A-R or N297A-F and rcFc-R using Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's
standard protocol in a MJ Thermocycler. Both reactions were carried out using 500
ttj

ng of pSYN-Fc-007 as a template using the following cycles: 94°C 2 minutes; 16
cycles of (94°C 30 seconds, 48°C 30 seconds, 72°C 45 seconds), 72°C 10 minutes.
The expected sized bands (-319 and 475 bp, respectively) were gel purified with a
Gel Extraction kit (Qiagen, Valencia CA), then combined in a PCR reaction with 25
pmol of rc-lgK signal sequence-F and rcFc-R primers and run as before, annealing at
58°C and continuing for 16 cycles. The expected sized band (-772 bp) was gel
purified with a Gel Extraction kit (Qiagen, Valencia CA) and cloned into pGEM T-
Easy (Promega, Madison, W!) to produce an intermediate plasmid pSYN-Fc-008
(pGEM T-Easy/lgK sig seq-Fc N297A). The entire IgK signal sequence-Fc alone
cassette was then subcloned using the Hindlll and EcoRI sites into either the
pEE6.4 (Lonza, Slough, UK) or pcDNA3.1 (Invitrogen, Carlsbad, CA) mammalian
expression vector, depending on the system to be used, to generate pSYN-Fc-010
(pEE6.4/lgK sig seq-Fc N297A) and pSYN-Fc-016 (pcDNA3/lgK sig seq-Fc N297A).
[0295] These same N297A primers were also used with rcFc-F and rcFc-R
primers and pSYN-Fc-001 as a template in a PCR reaction followed by subcloning
as indicated above to generate pSYN-Fc-002 (pGEM T Easy/Fc N297A).
Example 33:Cloning of EpoFc and Fc into single plasmid for double gene
vectors for making EpoFc wildtvpe or N297A monomer-dimer hybrids, and
expression.
[0296] An alternative to transfecting the EpoFc and Fc constructs on
separate plasmids is to clone them into a single plasmid, also called a double gene
vector, such as used in the Lonza Biologies (Slough, UK) system. The Rsrll/EcoRI
fragment from pSYN-Fc-002 was subcloned into the corresponding sites in pEE12.4
(Lonza Biologies, Slough, UK) according to standard procedures to generate pSYN-
Fc-006 (pEE12.4/Fc N297A fragment). The pSYN-EPO-004 plasmid was used as a

template for a PCR reaction using Epo-F primer from Example 25 and the following
primer:
EpoRsr-R: 5'- CTGACGGTCCGCCCAGGAGTTCCG
GAGCTGGGCACGGTGGGCATG TGTGAGTTTTGTCGACCGCAGCGG -3' (SEQ
ID HO: 91)
[0297] A PCR reaction was carried out using Expand High Fidelity System
(Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's standard
protocol in a MJ Thermocycler as indicated above, for 16 cycles with 55°C annealing
temperature. The expected sized band (-689 bp) was gel purified with a Gel
Extraction kit (Qiagen, Valencia CA) and cloned into pSYN-Fc-006 using the
Hindlll/Rsrll restriction sites, to generate pSYN-EPO-005 (pEE12.4/EpoFc N297A).
The double gene vector for the EpoFc N297A monomer-dimer hybrid was then
constructed by cloning the Notl/BamHl fragment from pSYN-Fc-010 into the
corresponding sites in pSYN-EPO-005 to generate pSYN-EPO-008 (pEE12.4-
6.4/EpoFc N297A/FC N297A).
[0298] The wild type construct was also made by subcloning the wild type Fc
sequence from pSYN-Fc-001 into pSYN-EPO-005 using the Rsrll and EcoRI sites,
to generate pSYN-EPO-006 (pEE12.4/EpoFc). The double gene vector for the
EpoFc monomer-dimer hybrid was then constructed by cloning the Notl/BamHl
fragment from pSYN-Fc-009 into the corresponding sites in pSYN-EPO-006 to
generate pSYN-EPO-007 (pEE12.4-6.4/EpoFc/Fc).
[0299] Each pfasmid was transfected into CHOK1SV cells and positive
clones identified and adpated to serum-free suspension, as indicated in the Lonza
I )

Biologies Manual for Standard Operating procedures (Lonza Biologies, Slough, UK),
and purified as indicated for the other monomer-dimer constructs.
Example 34: Cloning of human IFNBFc, lFNB-Fc N297A with eight amino acid
linkers and lgic-Fc-6His constructs
[0300] 10 ng of a human genomic DNA library from Clontech (BD
Biosciences Clontech, Palo Alto, CA) was used as a template to isolate human IFNp
with its native signal sequence using the following primers:
IFNp-F H3/SWI:
5'- CTAGCCTGCAGGAAGCTTGCCGCCACCATGACCA
ACAAGTGTCTCCTC -3' (SEQ ID NO: 92)
IFNB-R (EFAG) Sal:
5TTTGTCGACCGCAGCGGCGCCGGCGAACTCGTTTCGG
AGGTAACCTGTAAG -3' (SEQ ID NO: 93)
[0301] The reverse primer was also used to create an eight amino acid linker
sequence (EFAGAAAV) (SEQ ID NO: 94) on the 3" end of the human IFNp
sequence. The PCR reaction was carried out using the Expand High Fidelity
System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's
standard protocol in a Rapid Cycler thermocycler (Idaho Technology, Salt Lake City,
UT). A PCR product of the correct size (-607 bp) was gel purified using a Gel
Extraction kit (Qiagen; Valencia, CA), cloned into TA cloning vector (Promega,
Madison, Wl) and sequenced. This construct was named pSYN-IFNp-002. pSYN-
IFNp-002 was digested with Sbfl and Sail and cloned into pSP72 (Promega) at Pstl
and Sail sites to give pSYN-IFNp-005.
[0302] Purified pSYN-Fc-001 (0.6 ug) was digested with Sail and EcoRI
and cloned into the corresponding sites of pSYN-IFNp-005 to create the plasmid
pSYN-IFNp-006 which contains human IFNp linked to human Fc through an eight
l*~*-~

amino acid linker sequence. pSYN-IFNp-006 was then digested with Sbfl and EcoRl
and the full-length IFNfi-Fc sequence cloned into the Pstl and EcoRl sites of
pEDdC.sig to create plasmid pSYN-IFNp-008.
[0303] pSYN-Fc-002 containing the human Fc DNA with a single amino acid
change from asparagine to alanine at position 297 (N297A; EU numbering) was
digested with BspEI and Xmal to isolate a DNA fragment of -365 bp containing the
N297A mutation. This DNA fragment was cloned into the corresponding sites in
pSYN-IFNp-008 to create plasmid pSYN-IFNp-009 that contains the IFNp-Fc
sequence with an eight amino acid linker and an N297A mutation in Fc in the
expression vector, pED.dC.
[0304] Cloning of IgK signal sequence-Fc N297A - 6His. The following
primers were used to add a 6xHis tag to the C terminus of the Fc N297A coding
sequence:
Fc GS-F: 5'- GGCAAGCTTGCCGCCACCATGGAGACAGACACACTCC -3' (SEQ ID
NO: 95)
Fc.6His-R: 5'- TCAGTGGTGATGGTGATGATGTTTACCCGGAGACAGGGAG -3'
(SEQ ID NO: 96)
Fc.6His-F: 5'- GGTAAACATCATCACCATCACCACTGAGAATTCC
AATATCACTAGTGAATTCG -3' (SEQ ID NO: 97) .
Sp6+T-R: 5'- GCTATTTAGGTGACACTATAGAATACTCAAGC -3' (SEQ ID NO: 98)
[0305] Two PCR reactions were carried out with 50 pmol of either Fc GS-F
and Fc.6His-R or Fc.6His-F and Sp6+T-R using the Expand High Fidelity System
(Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's standard
protocol in a MJ Thermocycler. Both reactions were carried out using 500 ng of
A2-S

pSYN-Fc-008 as a template in a 50 JJI reaction, using standard cycling conditions.
The expected sized bands (-780 and 138 bp, respectively) were gel purified with a
Gel Extraction kit (Qiagen, Valencia CA), then combined in a 50 pi PCR reaction
with 50 pmol of Fc GS-F and Sp6+T-R primers and run as before, using standard
cycling conditions. The expected sized band (-891 bp) was gel purified with a Gel
Extraction kit (Qiagen, Valencia CA) and cloned into pcDNA6 V5-His B using the
Hindlll and EcoRI sites to generate pSYN-Fc-014 (pcDNA6/lgK sig seq-Fc N297A-6
His).
Example 35: Expression and purification of lFNBFc, IFNB-Fc N297A
homodimer and IFNP-Fc N297A monomer-dimer hybrid
[0306] CHO DG44 cells were plated in 100 mm tissue culture dishes and
grown to a confluency of 50%-60%. A total of 10 ug of DNA was used to transfect a
single 100 mm dish. For the homodimer transfection, 10 pg of the pSYN-FNB-008 or
pSYN-IFNB-009 construct was used; for the monomer-dimer hybrid transfection, 8
pg of the pSYN-IFNB-009 + 2 pg of pSYN-Fc-014 construct was used. The cells
were transfected using Superfect transfection reagents (Qiagen, Valencia, CA)
according to the manufacturer's instructions. 48 to 72 hours post-transfection,
growth medium was removed and cells were released from the plates with 0.25%
trypsin and transferred to T75 tissue culture flasks in selection medium (MEM Alpha
without nucleosides plus 5% dialyzed fetal bovine serum). The selection medium for
the monomer-dimer hybrid transfection was supplemented with 5 pg/ml Blasticidin
(Invitrogen, Carlsbad, CA). Selection was continued for 10-14 days until the cells
began to grow well and stable cell lines were established. Protein expression was
subsequently amplified by the addition methotrexate: ranging from 10 to 50 nM.

[0307] For all cell lines, approximately 2 x 107 cells were used to inoculate
300 ml of growth medium in a 1700 cm2 roller bottle (Corning, Corning, NY). The
roller bottles were incubated in a 5% C02 incubator at 37°C for approximately 72
hours. The growth medium was then exchanged with 300 mi serum-free production
medium (DMEM/F12 with 5 ug/ml human insulin). The production medium
(conditioned medium) was collected every day for 10 days and stored at 4°C. Fresh
production medium was added to the roller bottles after each collection and the
bottles were returned to the incubator. Prior to chromatography, the medium was
clarified using a SuporCap-100 (0.8/0.2 urn) filter from Pall Gelman Sciences (Ann
Arbor, Ml). All of the following steps were performed at 4°C. The clarified medium
was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10
mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine,
pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-HCI pH 8.0, 5 M NaCI.
The homodimer proteins were further purified over a Superdex 200 Prep Grade
sizing column run and eluted in 50 mM sodium phosphate pH 7.5, 500 mM NaCI,
10% glycerol.
[0308] The monomer-dimer hybrid protein was subject to further purification
since it contained a mixture of IFNpFc. N297A:IFNpFc N297A homodimer, IFNJ3Fc
N297A: Fc N297A His monomer-dimer hybrid, and Fc N297A His: Fc N297A His
homodimer. Material was applied to a Nickel chelating column in 50 mM sodium
phosphate pH 7.5, 500 mM NaCI. After loading, the column was washed with 50
mM imidazole in 50 mM sodium phosphate pH 7.5, 500 mM NaCI and protein was
eluted with a gradient of 50 - 500 mM imidazole in 50 mM sodium phosphate pH
7.5, 500 mM NaCI. Fractions corresponding to elution peaks on a UV detector were
J2S>

collected and analyzed by SDS-PAGE. Fractions from the first peak contained
IFNpFc N297A: Fc N297A His monomer-dimer hybrid, while the second peak
contained Fc N297A His: Fc N297A His homodimer. All fractions containing the
monomer-dimer hybrid, but no Fc homodimer, were pooled and applied directly to a
Superdex 200 Prep Grade sizing column, run and eluted in 50 mM sodium
phosphate pH 7.5, 500 mM NaCI, 10% glycerol. Fractions containing IFNp-Fc
N297A:Fc N297A His monomer-dimer hybrids were pooled and stored at -80°C.
Example 36: Antiviral assay for IFNP activity
[0309] Antiviral activity (lU/ml) of IFNp fusion proteins was determined using
a CPE (cytopathic effect) assay. A549 cells were plated in a 96 well tissue culture
plate in growth media (RPM11640 supplemented with 10% fetal bovine serum (FBS)
and 2 mM L-glutamine) for 2 hours at 37°C, 5% C02. IFNp standards and IFNp
fusion proteins were diluted in growth media and added to cells in triplicate for 20
hours at 37°C, 5% C02. Following incubation, all media was removed from wells,
encephalomyocarditis virus (EMCV) was diluted in growth media and added (3000
pfu/well) to each well with the exception of control wells. Plates were incubated at
37°C, 5% CCfor 28 hours. Living cells were fixed with 10% cold trichloroacetic acid
(TCA) and then stained with Sulforhodamine B (SRB) according to published
protocols (Rubinstein et al. 1990, J. Natl. Cancer Inst 82,1113). The SRB dye was
solubilized with 10 mM Tris pH 10.5 and read on a spectrophotometer at 490 nm.
Samples were analyzed by comparing activities to a known standard curve ranging
from 10 to 0.199 Ill/ml. The results are presented below in Table 8 and demonstrate
increased antiviral activity of monomer-dimer hybrids.
/2-£

TABLE 8: INTERFERON BETA ANTIVIRAL ASSAY
HOMODIMER V. MONOMER-DIMER HYBRID

Protein Antiviral
Activity
(lU/nmol) Std dev
IFNP-Fc 8aa linker homodimer 4.5x10* 0.72 x10s
IFNpFc N297A 8aa linker homodimer 3.21x10" 0.48 x10&
IFNpFc N297A 8aa linker: Fc His
monomer-dimer hybrid 12.2x10* 2x10*
hxampie 37: Administration of IFNftFc Homodimer and Monomer-Dimer
Hybrid With an Eight Amino Acid Linker to Cynomolqus Monkeys
[0310] For pulmonary administration, aerosols of either IFNpFc homodimer
or IFNpFc N297A monomer-dimer hybrid proteins (both with the 8 amino acid linker)
in PBS, pH 7.4, 0.25% HSA were created with the Aeroneb Pro™ (AeroGen,
Mountain View, CA) nebulizer, in-line with a Bird Mark 7A respirator, and
administered to anesthetized na'ive cynomolgus monkeys through endotracheal
tubes (approximating normal tidal breathing). Blood samples were taken at various
time points, and the amount of IFNp-containing protein in the resulting serum was
quantitated using a human IFNp Immunoassay (Biosource International, Camarillo,
CA). Pharmacokinetic parameters were calculated using the software WinNonLin.
Table 9 presents the results of cynomolgus monkeys treated with IFNpFc N297A
monomer-dimer hybrid or IFNpFc homodimer.
>i>

TABLE 9: ADMINISTRATION OF IFNBFC N297A MONOMER-DIMER
HYBRID AND IFNBFC HOMODIMER TO MONKEYS

Protein Monkey
# Route Approx.
Deposited
Dose1
(ug/kg) (ng/ml) AUC
(hr*ng/ml) tl/2
(hr) ti/2 avg
(hr)
IFNpFc
N297A
monomer-
dimer hybrid CO7308 pulm 20 23.3 987.9 27.6 27.1

C07336 pulm 20 22.4 970.6 25.6


C07312 pulm 20 21.2 1002.7 28.0

IFNpFc
homodimer C07326 pulm 20 2.6 94.6 11.1 11.4

C07338 pulm 20 5.0 150.6 11.7

Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy
[0311] The pharmacokinetics of IFNpFc with an 8 amino acid linker
administered to cynomolgus monkeys is presented in figure 15. The figure
compares the IFNpFc homodimer with the IFNpFc N297A monomer-dimer hybrid in
monkeys after administration of a single pulmonary dose. Significantly higher serum
levels were obtained in monkeys treated with the monomer-dimer hybrid compared
to the homodimer.
[0312] Serum samples were also analyzed for neopterin levels (a biomarker
of IFNp activity) using a neopterin immunoassay (MP Biomedicals, Orangeburg,
NY). The results for this analysis are shown in figure 16. The figure compares
neopterin stimulation in response to the IFNp-Fc homodimer and the IFNp-Fc N297A
monomer-dimer hybrid. It can be seen that significantly higher neopterin levels were
detected in monkeys treated with IFNp-Fc N297A monomer-dimer hybrid as
compared to the IFNp-Fc homodimer.
[0313] All numbers expressing quantities of ingredients, reaction conditions,
and so forth used in the specification and claims are to be understood as being
/ 2-6

modified in all instances by the term "about." Accordingly, unless indicated to the
contrary, the numerical parameters set forth in the specification and attached claims
are approximations that may vary depending upon the desired properties sought to
be obtained by the present invention. At the very least, and not as an attempt to
limit the application of the doctrine of equivalents to the scope of the claims, each
numerical parameter should be construed in light of the number of significant digits
and ordinary rounding approaches.
[0314] Aii references cited herein are incorporated herein by reference in their
entirety and for all purposes to the same extent as if each individual publication or
patent or patent application was specifically and individually indicated to be
incorporated by reference in its entirety for all purposes. To the extent publications
and patents or patent applications incorporated by reference contradict the
disclosure contained in the specification, the specification is intended to supercede
and/or take precedence over any such contradictory material.
[0315] Many modifications and variations of this invention can be made
without departing from its spirit and scope, as will be apparent to those skilled in the
art. The specific embodiments described herein are offered by way of example only
and are not meant to be limiting in any way. It is intended that the specification and
examples be considered as exemplay only, with a true scope and spirit of the
invention being indicated by the following claims.
I2?>

WE CLAIM:
1. A chimeric protein comprising a first and second polypeptide chain, wherein said
first chain comprises a biologically active molecule as described herein, and at least a portion of
an immunoglobulin constant region comprising an FcRn binding site as described herein and
wherein said second chain comprises at least a portion of an immunoglobulin constant
region comprising an FcRn binding site as described herein without a biologically active
molecule as described herein or immunoglobulin variable region as described herein.
2. The chimeric protein as claimed in claim 1, wherein said second chain optionally
comprises an affinity tag as described herein.
3. The chimeric protein as claimed in claim 2, wherein the affinity tag is a FLAG
tag.
4. The chimeric protein as claimed in claim 1, wherein the portion of an
immunoglobulin is an Fc fragment.
5. The chimeric protein as claimed in claim 1, wherein the FcRn binding site is a
peptide mimetic as claimed in an FcRn binding site.
6. The chimeric protein as claimed in claim 1, wherein the immunoglobulin is IgG.
7. The chimeric protein as claimed in claim 1, wherein the biologically active
molecule is a polypeptide.
8. The chimeric protein as claimed in claim 6, wherein the IgG is an IgGl or an
IgG2.
9. The chimeric protein as claimed in claim 1, wherein the biologically active
molecule is a viral fusion inhibitor.
10. The chimeric protein as claimed in claim 9, wherein the viral fusion inhibitor is an
- I3O -

HIV fusion inhibitor.
11. The chimeric protein as claimed in claim 10, wherein the HIV fusion inhibitor is
T20 (SEQ ID NO:l), T21 (SEQ ID NO:2), or T1249 (SEQ ID NO:3).
12. The chimeric protein as claimed in claim 1, wherein the biologically active
molecule is a clotting factor.
13. The chimeric protein as claimed in claim 12, wherein the clotting factor is Factor
VII or Vila.
14. The chimeric protein as claimed in claim 12, wherein the clotting factor is Factor
DC.
15. The chimeric protein as claimed in claim 1, wherein the biologically active
molecule is a small molecule.
16. The chimeric protein as claimed in claim 15, wherein the biologically active
molecule is leuprolide.
17. The chimeric protein as claimed in claim 1, wherein the biologically active
molecule is interferon.
18. The chimeric protein as claimed in claim 17, wherein the interferon is interferon a
and has a linker of 15-25 amino acids.
19. The chimeric protein as claimed in claim 18, wherein the interferon a has a linker
of 15-20 amino acids.
20. The chimeric protein as claimed in claim 1, wherein the biologically active
molecule is a nucleic acid as described herein.
21. The chimeric protein as claimed in claim 20, wherein the nucleic acid is DNA or
RNA.
22. The chimeric protein as claimed in claim 20, wherein the nucleic acid is an
- rn -

antisense molecule.
23. The chimeric protein as claimed in claim 20, wherein the nucleic acid is a
ribozyme.
24. The chimeric protein as claimed in claim 1, wherein the biologically active
molecule is a growth factor.
25. The chimeric protein as claimed in claim 24, wherein the growth factor is
erythropoietin.
26. The chimeric protein as claimed in claim 15, wherein the small molecule is a
VLA4 antagonist.
27. A chimeric protein comprising a first and second polypeptide chain, wherein said
first chain comprises a biologically active molecule as described herein, and at least a portion of
an immunoglobulin constant region comprising an FcRn binding site as described herein and
wherein said second chain consists of at least a portion of an immunoglobulin constant
region comprising an FcRn binding site as described herein and optionally an affinity tag as
described herein.
28. The chimeric protein as claimed in claim 275 wherein the affinity tag is a FLAG
tag.
29. A chimeric protein comprising a first and second polypeptide chain

a) wherein said first chain comprises a biologically active molecule as
described herein, at least a portion of an immunoglobulin constant region comprising an FcRn
binding site as described herein, and a first domain having at least one specific binding partner;
and
b) wherein said second chain comprises at least a portion of an
immunoglobulin comprising an FcRn binding site as described herein without a biologically

active molecule as described herein or immunoglobulin variable region as described herein and
further comprising a second domain said second domain being a specific binding partner of said
first domain.
30. The chimeric protein as claimed in claim 29, wherein said second chain optionally
comprises an affinity tag as described herein.
31. The chimeric protein as claimed in claim 30, wherein the affinity tag is a FLAG
tag.
32. The chimeric protein as claimed in claim 29, wherein the portion of an
immunoglobulin is an Fc fragment.
33. The chimeric protein as claimed in claim 29 or claim 32, wherein the
immunoglobulin is IgG.
34. The chimeric protein as claimed in claim 29, wherein the FcRn binding site is a
peptide mimetic of an FcRn binding site.
35. The chimeric protein as claimed in claim 29, wherein the first domain binds with
the second domain non-covalently.
36. The chimeric protein as claimed in claim 29, wherein the first domain is one naif
of a leucine zipper coiled coil and said second domain is the complementary binding partner of
said leucine zipper coiled coil.
37. The chimeric protein as claimed in claim 29, wherein the biologically active
molecule is a peptide.
38. The chimeric protein as claimed in claim 29, wherein the biologically active
molecule is interferon.
39. The chimeric protein as claimed in claim 37, wherein the biologically active
molecule is leuprolide.
- /33> -

40. The chimeric protein as claimed in claim 29, wherein the biologically active
molecule is a viral fusion inhibitor.
41. The chimeric protein as claimed in claim 40, wherein the viral fusion inhibitor is
an HIV fusion inhibitor.
42. The chimeric protein as claimed in claim 41, wherein the HIV fusion inhibitor is
T20 (SEQ ID NOT), or T21 (SEQ ID NO:2), or T1249 (SEQ ID NO:3).
43. The chimeric protein as claimed in claim 29, wherein the biologically active
molecule is a clotting factor.
44. The chimeric protein as claimed in claim 43, wherein the clotting factor is Factor
VII or Factor Vila.
45. The chimeric protein as claimed in claim 43, wherein the clotting factor is Factor
DC.
46. The chimeric protein as claimed in claim 29, wherein the biologically active
molecule is a small molecule.
47. The chimeric protein as claimed in claim 46, wherein the small molecule is a
VLA4 antagonist.
48. The chimeric protein as claimed in claim 29, wherein the biologically active
molecule comprises a nucleic acid as described herein.
49. The chimeric protein as claimed in claim 48, wherein the nucleic acid is DNA or
RNA.
50. The chimeric protein as claimed in claim 48, wherein the nucleic acid is an
antisense nucleic acid.
51. The chimeric protein as claimed in claim 48, wherein the nucleic acid is a
ribozyme.
- /3tf -

52. The chimeric protein as claimed in claim 29, wherein the biologically active
molecule is a growth factor or hormone.
53. The chimeric protein as claimed in claim 52, wherein the growth factor is
erythropoietin.
54. A pharmaceutical composition comprising the chimeric protein as claimed in
claim 1 or 29 and a pharmaceutical acceptable excipient.
55. A method of making a biologically active chimeric protein comprising:

a) transfecting a first cell with a first DNA construct comprising a DNA
molecule encoding a polypeptide comprising a biologically active molecule as described herein
operatively linked to a second DNA molecule encoding at least a portion of an immunoglobulin
constant region comprising an FcRn binding site as described herein;
b) transfecting a second cell with a second DNA construct comprising a
DNA molecule encoding a polypeptide comprising at least a portion of an immunoglobulin
constant region comprising an FcRn binding site as described herein without a biologically active
molecule as described herein or variable region of an immunoglobulin.
c) culruring the cell of a) and b) under conditions such that the polypeptide
encoded by said first DNA construct and said second DNA construct is expressed; and
d) isolating dimers of a) and b) from said transfected cell.

56. The method as claimed in claim 55, wherein the dimers are isolated by
chromatography.
57. The method as claimed in claim 55, wherein the cell is a eukaryotic cell.
58. The method as claimed in claim 57, wherein the eukaryotic cell is a CHO cell.
59. The method as claimed in claim 55, wherein the cell is a prokaryotic cell.
60. The method as claimed in claim 59, wherein the prokaryotic cell is E. coll
- t 3> 5" -

61. A chimeric protein of the formula
X-La-F:F or F:F-La-X
wherein X is a biologically active molecule as described herein, L is a linker, F is at least
a portion of an immunoglobulin constant region comprising an FcRn binding site as described
herein, and a is any integer or zero.
62. The chimeric protein as claimed in claim 61, wherein the FcRn binding site is a
peptide mimetic of an FcRn binding site.
63. The chimeric protein as claimed in claim 61, wherein each F is chemically
associated with the other F.
64. The chimeric protein as claimed in claim 63, wherein the chemical association is a
non-covalent interaction.
65. The chimeric protein as claimed in claim 63, wherein the chemical bond is a
covalent bond.
66. The chimeric protein as claimed in claim 63, wherein the chemical bond is a
disulfide bond.
o7. iiie cmmenc protein as ciaimeu in ciaim 6], wnerein F is linkeu to F by a bonu
that is not a disulfide bond.
68. The chimeric protein as claimed in claim 61, wherein F is an IgG immunoglobulin
constant region.
69. The chimeric protein as claimed in claim 61, wherein F is an IgGl.
70. The chimeric protein as claimed in claim 61, wherein F is an Fc fragment.
71. The chimeric protein as claimed in claim 61, wherein X is a polypeptide.
72. The chimeric protein as claimed in claim 61, wherein X is leuprolide.
73. The chimeric protein as claimed in claim 61, wherein X is a small molecule.

- /

3,6 -

74. The chimeric protein as claimed in claim 73, wherein the small molecule is a
VLA4 antagonist.
75. The chimeric protein as claimed in claim 61, wherein X is a viral fusion inhibitor.
76. The chimeric protein as claimed in claim 75, wherein the viral fusion inhibitor is
an HIV fusion inhibitor.
77. The chimeric protein as claimed in claim 76, wherein the HIV fusion inhibitor is
T20 (SEQ ID N0:1), or T21 (SEQ ID NO:2), or T1249 (SEQ ID NO:3).
78. The chimeric protein as claimed in claim 61, wherein X is a clotting Factor.
79. The chimeric protein as claimed in claim 78, wherein the clotting factor is Factor
VH or Vila.
80. The chimeric protein as claimed in claim 78, wherein the clotting factor is Factor
rx.
81. The chimeric protein as claimed in claim 61, wherein X is a nucleic acid as
described herein.
82. The chimeric protein as claimed in claim 81, wherein the nucleic acid is a DNA or
DM A 1 1_
Oil JVLN/VUHJICWUIC.
83. The chimeric protein as claimed in claim 61, wherein X is a growth factor.
84. The chimeric protein as claimed in claim 83, wherein the growth factor is
erythropoietin.
85. A chimeric protein comprising a first and a second polypeptide chain linked
together, wherein said first chain comprises a biologically active molecule as described herein
and at least a portion of an immunoglobulin constant region comprising an FcRn binding site as
described herein, and said second chain comprises at least a portion of an immunoglobulin
constant region comprising an FcRn binding site as described herein without the biologically
- I2& -

active molecule of the first chain and wherein said second chain is not covalently bonded to any
molecule having a molecular weight greater than 2 kD.
86. A method of making a chimeric protein comprising an Fc fragment of an
immunoglobulin comprising an FcRn binding site as described herein linked to a biologically
active molecule as described herein, said method comprising
a) transfecting a cell with a DNA construct comprising a DNA sequence
encoding an Fc fragment of an immunoglobulin comprising an FcRn binding site as described
herein and a second DNA sequence encoding intein;
b) culturing said cell under conditions such that the Fc fragment and intein is
expressed;
c) isolating said Fc fragment and intein from said cell;
d) chemically synthesizing a biologically active molecule as described herein
having an N terminal Cys;
e) reacting the isolated intein Fc of c) with MESNA to generate a C terminal
thioester;
f) reacting the biologically active molecule of d) with the Fc of e) to make a
chimeric protein comprising an Fc linked to a biologically active molecule.
87. A method of making a chimeric protein comprising an Fc fragment of an
immunoglobulin comprising an FcRn binding site as described herein linked to a biologically
active molecule as described herein, said method comprising
a) transfecting a cell with a DNA construct comprising a DNA sequence
encoding an Fc fragment of an immunoglobulin comprising an FcRn binding site as described
herein and a second DNA sequence encoding a signal peptide wherein said signal peptide is
adjacent to an Fc fragment cysteine;
-1?>& -

b) culturing said cell under conditions such that the Fc fragment and signal
peptide is expressed and the Fc fragment is secreted from the cell without the signal peptide and
with a N terminal cysteine;
c) isolating dimers of said Fc fragment with an N terminal cysteine from said
cell,
d) chemically synthesizing a biologically active molecule as described herein
having a thioester;
e) reacting the biologically active molecule of d) with the Fc of c) under
conditions such that the biologically active molecule can link to one chain of the dimer of c) to
make a chimeric protein comprising an Fc linked to a biologically active molecule.

88. The method as claimed in claim 87, wherein the thioester is a C terminal thioester.
89. A method of making a chimeric protein comprising an Fc fragment of an
immunoglobulin comprising an FcRn binding site as described herein linked to a biologically
active molecule as described herein, said method comprising

a) transfecting a cell with a DNA construct comprising a DNA sequence
encoding an Fc fragment of an immunoglobulin comprising an FcRn binding site as described
herein and a second DNA sequence encoding a signal peptide wherein said signal peptide is
adjacent to an Fc fragment cysteine;
b) culturing said cell under conditions such that the Fc fragment and signal
peptide are expressed linked together and said signal peptide is cleaved from the Fc fragment by
the cell at a first position adjacent to a cysteine or a second position adjacent to a valine;
c) isolating dimers of said Fc fragments with two N terminal cysteines or two
N terminal valines or an N terminal cysteine and an N terminal valine from said cell;
d) chemically synthesizing a biologically active molecule as described herein
- /3? -

having a thioester;
e) reacting the biologically active molecule of d) with the dimers of c) to
make a chimeric protein comprising a first chain comprising an Fc linked to a biologically active
molecule and a second chain comprising an Fc not linked to any biologically active molecule or a
variable region of an immunoglobulin as described herein.
90. The method as claimed in claim 89, wherein the thioester is a C terminal thioester.
91. The chimeric protein as claimed in claim 19, wherein the linker is (GGGGS)3.
92. A method of isolating a monomer-dimer hybrid from a mixture, where the
mixture comprises,

a) the monomer-dimer hybrid comprising a first and second polypeptide
chain, wherein the first chain comprises a biologically active molecule as described herein, and at
least a portion of an immunoglobulin constant region comprising an FcRn binding site as
described herein and wherein the second chain comprises at least a portion of an immunoglobulin
constant region comprising an FcRn binding site as described herein without a biologically active
molecule as described herein or immunoglobulin variable region as described herein;
b) a dimer comprising a first and second polypeptide chain, wherein the first
and second chains both comprise a biologically active molecule, and at least a portion of an
immunoglobulin constant region;
c) a portion of an immunoglobulin constant region comprising an FcRn
binding site as described herein; said method comprising
i) contacting the mixture with a dye ligand linked to a solid support
under suitable conditions such that both the monomer-dimer hybrid and the dimer bind to
the dye ligand;
ii) removing the unbound portion of an immunoglobulin constant
- /i/o -

region;
iii) altering the suitable conditions of 1) such that the binding between
the monomer-dimer hybrid and the dye ligand linked to the solid support is disrupted;
iv) isolating the monomer-dimer hybrid.
93. The method as claimed in claim 92, wherein the dye ligand is a bio-mimetic
molecule.
94. The method as claimed in claim 92, wherein the dye ligand is chosen from
Mimetic Red 1™, Mimetic Red 2™, Mimetic Orange 1™, Mimetic Orange 2™, Mimetic Orange
3™, Mimetic Yellow 1™, Mimetic Yellow 2™, Mimetic Green 1™, Mimetic Blue I™, and
Mimetic Blue 2™ .
95. The method as claimed in claim 94, wherein the dye ligand is Mimetic Red 2™.
96. The method as claimed in claim 94, wherein the dye ligand is Mimetic Green 1™.
97. The method as claimed in claim 92, wherein the suitable conditions comprises a
buffer having a pH in the range of 4-9 inclusive.
98. The method as claimed in claim 97, wherein altering the suitable conditions
comprises adding at least one salt to the buffer at a concentration sufficient to disrupt the binding
of the monomer-dimer hybrid to the dye ligand thereby isolating the monomer-dimer hybrid.
99. The method as claimed in claim 98, wherein the at least one salt is NaCl.
100. The method as claimed in claim 97, wherein the buffer has a pH of 8.
101. The method as claimed in claim 98, further comprising adding a higher
concentration of salt compared to the concentration of salt which disrupts the binding of the
monomer-dimer hybrid to the dye ligand such that the higher concentration of salt disrupts the
binding of the dimer to the dye ligand thereby isolating the dimer.
102. The chimeric protein as claimed in claim 17, wherein the biologically active

molecule is interferon a.
103. The chimeric protein as claimed in claim 17, wherein the biologically active
molecule is interferon p104. The chimeric protein as claimed in claim 38, wherein the biologically active
molecule is interferon a.
105. The chimeric protein as claimed in claim 38, wherein the biologically active
molecule is interferon |3.
106. A chimeric protein comprising a first and second polypeptide chain, wherein said
first chain comprises EPO, an eight amino acid linker having the amino acid sequence
EFAGAAAV, and an Fc fragment of an immunoglobulin constant region comprising a mutation
of aspargine to alanine at position 297; and
wherein said second chain comprises an Fc fragment of an immunoglobulin constant
region comprising a mutation of aspargine to alanine at position 297 and does not comprise a
biologically active molecule as described herein or an immunoglobulin variable region as
described herein.
107. The chimeric protein as claimed inxlaim 106, optionally comprising.an affinity
tag as described herein.
108. A chimeric protein comprising a first and second polypeptide chain, wherein said
first chain comprises IFN(3, an eight amino acid linker having the amino acid sequence
EFAGAAAV, and an Fc fragment of an immunoglobulin constant region comprising a mutation
of aspargine to alanine at position 297; and
wherein said second chain comprises an Fc fragment of an immunoglobulin constant
region comprising a mutation of aspargine to alanine at position 297 and does not comprise a
biologically active molecule as described herein or an immunoglobulin variable region as
- /tf2~-

described herein.
109. The chimeric protein as claimed in claim 108, optionally comprising an affinity
tag as described herein.
110. A chimeric protein comprising a first and second polypeptide chain, wherein saic
first chain comprises factor IX, an eight amino acid linker having the amino acid sequence
EFAGAAAV, and an Fc fragment of an immunoglobulin constant region comprising a mutatior
of aspargine to alanine at position 297; and
wherein said second chain comprises an Fc fragment of an immunoglobulin constant
region comprising a mutation of aspargine to alanine at position 297 and does not comprise a
biologically active molecule as described herein or an immunoglobulin variable region as
described herein.
111. The chimeric protein as claimed in claim 110, optionally comprising an affinity
tag as described herein.
Dated this 18th day of February 2008

The instant invention discloses a chimeric protein comprising a first and second
polypeptide chain, wherein said first chain comprises a biologically active molecule as described
herein, and at least a portion of an immunoglobulin constant region comprising an FcRn binding
site as described herein and
wherein said second chain comprises at least a portion of an immunoglobulin constant
region comprising an FcRn binding site as described herein without a biologically active
molecule as described herein or immunoglobulin variable region as described herein.

Documents:

http://ipindiaonline.gov.in/patentsearch/GrantedSearch/viewdoc.aspx?id=z4/WqbJSPJzU3LigX6QzFw==&loc=wDBSZCsAt7zoiVrqcFJsRw==


Patent Number 269172
Indian Patent Application Number 713/KOLNP/2008
PG Journal Number 41/2015
Publication Date 09-Oct-2015
Grant Date 07-Oct-2015
Date of Filing 18-Feb-2008
Name of Patentee BIOGEN IDEC HEMOPHILIA, INC.
Applicant Address 14 CAMBRIDGE CENTER, CAMBRIDGE MA 02142
Inventors:
# Inventor's Name Inventor's Address
1 PETERS, ROBERT, T 51 NEW FIELD STREET, WEST , ROXBURY, MA 02132
2 RIVERA, DANIEL, S 31 BARQUE HILL DRIVE , NORWELL, MA 02061
3 BITONTI, ALAN, J 32 CARLTON DRIVE, ACTON , MA 01720
4 STATTEL, JAMES, M 20 SARGENT AVENUE, LEOMINSTER , MA 01453
5 LOW, SUSAN, C 86 BROOKLINE STREET, PEPPERELL , MASSACHUSETTS 01463
6 MEZO, ADAM, R 15 MONTCLAIR AVENUE , WALTHAM, MA 02451
PCT International Classification Number C07K 1/02, C07K 1/06
PCT International Application Number PCT/US2004/014064
PCT International Filing date 2004-05-06
PCT Conventions:
# PCT Application Number Date of Convention Priority Country
1 60/469600 2003-05-06 U.S.A.
2 60/487964 2003-07-17 U.S.A.
3 60/539207 2004-01-26 U.S.A.