Indian Patents. 269642:"RECOMBINANT CHIMERIC FUSION PROTEIN AND PROCESS OF PREPARATION THEREOF"

Title of Invention	"RECOMBINANT CHIMERIC FUSION PROTEIN AND PROCESS OF PREPARATION THEREOF"
Abstract	The present invention relates to a recombinant chimeric fusion protein comprising conserved portions of Haemolysin BL (hbl D) toxin of Bacillus cereus; Listeriolysin O (hly)toxin of Listeria monocytogenes; and Enterotoxin B (Ent B) toxin of Staphylococus aureus and process of its preparation.

Full Text	TECHNICAL FIELD The present invention relates to a recombinant chimeric protein having conserved portions of Haemolysin BL of Bacillus cereus, Listeriolysin O of Listeria monocytogenes and Enterotoxin B toxin of Staphylococcus aureus and process of preparing the same. BACKGROUND Bacillus cereus, Listeria monocytogenes and Stapphylococcus aureus are closely related bacterial pathogens with potential to cause clinical infections and food-borne infections by secreting a variety of extra cellular toxins. Among the array of toxin components being possessed by these pathogens, Haemolysin BL (HBL) of Bacillus cereus, Listeriolysin O (LLO) of Listeria monocytogenes and Enterotoxin B (SEB) of Stapphylococcus aureus are the important virulence factors that play vital role in pathogenicity. HBL is a unique membrane-lytic toxin of Bacillus cereus and has a variety of toxic activities including haemolysis, cytotoxicity, vascular permeability, dermonecrosis, enterotoxicity and ocular toxicity. SEB is the primary cause of staphylococcal food poisoning and a potent mitogen that elicits life-threatening polyclonal T-cell proliferation and cytokine production at very low concentrations. At low serum concentrations, SEB can trigger toxic shock, profound hypotension and multi organ failure and is a recognized biowarfare molecule. Listeria monocytogenes, the etiological agent of listeriosis, possess a bacterial pore-forming toxin LLO, generally believed to be the central molecule in the host-pathogen interactions, responsible for lysing the vacuolar membrane and allowing the organism to escape into the cytoplasm of the cell. OBJECTIVE The principal object of the present invention is to provide a recombinant chimeric protein which can be used to produce sufficient quantities of protein to be used in immunoassay based diagnostic methods for simultaneous detection of Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus. Another object of the present invention is to provide a recombinant chimeric protein which can be used for vaccine development. SUMMARY The present invention relates to a recombinant chimeric fusion protein comprising conserved portions of - Haemolysin BL (hbl D) toxin of Bacillus cereus - Listeriolysin O (hly)toxin of Listeria monocytogenes; and - Enterotoxin B (Ent B) toxin of Staphylococus aureus The present invention further relates to a process for the preparation of recombinant chimeric fusion protein comprising the steps of - amplifying conserved portions of hbl D, hly, Ent B by PCR method using primer sequences; - introducing restriction sites in the 5' and 3' flanking sites of said primer sequences to facilitate ligase dependent directional cloning; - ligating the PCR amplified products to obtain fusion gene r-HLE ; - ligating the fusion gene into the restriction sites of the bacterial expression vector pRSETA to generate plasmid pR-r-HLE; - inserting fusion gene r-HLE inside said plasmid to generate the recombinant chimeric protein; and - purifying said protein BRIEF DESCRIPTION OF DRAWINGS Figure 1 relates to electrophoretic analysis of E. coli expressed chimeric protein. Figure 2 relates to Western immunoblotanalysis of culture free supematants of Bacillus cereus group, Listeria spp and S. aureus standards and isolates. Figure 3 relates to construction of Plasmid used for the expression of HBL fusion protein. DETAILED DESCRIPTION The present invention relates to preparation of recombinant chimeric protein having truncated portions of Haemolysin BL, Listeriolysin O and Enterotoxin B toxins of Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus respectively. The genetic material can be used to produce sufficient quantities of protein to be used in immunoassay based diagnostic methods for simultaneous detection of Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus and also for vaccine development. Fusion gene, codon-optimized for E.coli expression, was first generated by ligation of PCR amplified products encoding LI of HBL toxin complex of Bacillus cereus, Listeriolysin O of Listeria monocytogenes and Enterotoxin B of Staphylococcus aureus. The resultant 1.37kb fusion gene was sequenced and its expression resulted in a single recombinant multi domain chimeric protein r-HLE in E.coli host. The resultant 50 kDa fusion protein was purified using Ni-NTA chromatography. Polyclonal antibodies were raised against this purified fusion protein and the antigencity was confirmed by Western blot/ELISA using the purified native toxins of respective organisms. The present invention targets conserved portions of genes of the Haemolysin BL, Listeriolysin O and Enterotoxin B using NCBI database. These sequences were amplified by PCR and restriction sites were introduced into the 5' and 3' flanking sites of these three sequences to facilitate ligase dependant directional cloning (table 1) and to obtain fusion gene. Bacterial strains and media Reference strains were obtained from American Type Cultural Collection (ATCC) and National Collection of Industrial Microorganisms (NCIM). PCR amplification of hbl D, hly and ent B genes The conserved portions of hbl D, hly and ent B genes amplified by PCR, using Bacillus cereus ATCC 14579, Listeria monocytogenes ATCC 15313 and Staphylococcis aureus ATCC whole genomic DNA as template. Primers of L1 protein gene (hbl D) were synthesized to insert BamHI and Kpn I sites to the 5' and 3' ends of hbl D via PCR with amplicon size of 590 bp. Similarly, Primers of Lis O protein gene (hly) and Ent B protein gene (Ent B) were synthesized to insert Kpn I & Sac I sites and Sac I & Hind III sites to the 5' and 3' ends of hly and Ent b via PCR with amplicon sizes of 471 bp and 493 bp, respectively (Table 1). PCR was performed in 25 ul reaction volume containing 400 nM of each primer, 200 uM of each dNTP, 1.0 U Pfu polymerase, 1.5 mM of MgS04 in IX PCR buffer with 50 mg of template DNA. PCR was carried out through 30 cycles in Eppendorf master gradient thermal cycler at 94 °C for 1 min denaturation, 54 °C for 1 min annealing and 72 °C for 3 min extension. The DNA was denatured for 5 min in the beginning and finally extended for 15 min at 72 °C. The amplified PCR products were separated on 1% Agarose gel and subjected to restriction digestion with their respective enzymes. Cloning of fusion gene Primer designing Conserved portions of hbl D, hly and Ent B genes have been selected using NCBI database. Three pairs of PCR primers were designed to amplify conserved portions and restriction sites were introduced into the 5' and 3' flanking sites of these three primer sequences to facilitate ligase dependant directional cloning. Primers used for amplification of truncated portions of hbl D, hly and ent B genes are presented in table 1. TABLE1: Primers used for amplifications of conserved portions of hbl D, hly and entB (Table Removed) Plasmid construction Fusion gene, codon-optimized for E. coli expression, was first generated by ligation of PCR amplified products encoding conserved domains of L1 component of HBL, Lis O and Ent B using T4 DNA ligase and subsequent PCR amplification with L1 forward primer and Ent B reverse primer to get fusion gene (1372 bp). The resultant 1.37-kb gene (r- HLE) was ligated into the BamH I and Hind III sites of the bacterial expression vector pRSET A to generate the plasmid pR-r-HLE. In this plasmid, the r-HLE gene was inserted in frame with the ATG condon and the six-His tag-encoding sequence (at the 5' end) provided by the pRSET A vector to get protein with the expected size of 50 kDa. The ligated product was transformed into E. coli BL21 (DE3) pLysS cells and selected on ampicillin plates. Preparation and transformation of component E. coli BL21 (DE3) pLysS bacteria were performed according to procedures (Sambrook et al., 1989). Recombinant clones were subjected to direct colony PCR screenings using L1 forward primer and Ent B reverse primer to identify recombinants harboring the synthetic r-HLE gene. Sequence of fusion gene The DNA sequencing of the fusion gene was carried out using L1 forward and SEB reverse primers. The DNA sequence and the predicted amino acid sequence (Sequence ID No. 1) coded by the fusion gene for the recombinant protein are given below. Nucleotide sequence of the Recombinant fusion gene of HLE toxin ggatccacta ttcatgcart tgcacaagaa acgaccgctc aagaacaaaa agtaggcaat 61 tatgcattag gccccgaagg actgaagaaa gcattagctg aaacagggtc tcatattcta 121 gtaatggatt tatacgcaaa aacaatgatt aagcaaccaa atgtaaattt atctaatatc 181 gatttaggct cagagggggg agagttgctc aaaaatattc accttaatca agagctgtca 241 cgaatcaatg cgaattactg gttagataca gcgaagccac agattcaaaa aactgctcgt 301 aatattgtaa attacgatga acaatttcaa aattattacg acacattagt agaaactgta 361 caaaagaaag ataaggcagg tctaaaagag ggtataaatg atttaattac tacaatcaat 421 acaaattcaa aagaagttac agatgtgatt aagatgctac aagacttcaa agggaaacta 481 tatcaaaatt ctacagattt taaaaataat gttggtggtc cagatgggaa aggtggatta 541 actgcaatat tagcaggtca acaggcaacg gtacccttcg gcgcaatcag tgaagggaaa 601 atgcaagaag aagtcattag ttttaaacaa atttactata acgtgaatgt taatgaacct 661 acagaccttt ccagattttt cggcaaagct gttactaaag agcagttgca agcgcttgga 721 gtgaatgcag aaaatcctcc tgcatatatc tcaagtgtgg cgtatggccg tcaagtttat 781 ttgaaattat caactaattc ccatagtact aaagtaaaag ctgcttttga tgctgccgta 841 agcggaaaat ctgtctcagg tgatgtagaa ctaacaaata tcatcaaaaa ttcttccttc 901 aaagccgtaa tttacggagg ttccgcaaaa gatgaagttc aaatcatcga cggcaacctc 961 ggagacttac gcgatatttt gaaaaaaggc gctactttta atcgagaaac accaggagtt 1021 cccatgagct caccagatcc taaaccagat gagttgcaca aatcgagtaa attcactggt 1081 ttgatggaaa atatgaaagt tttgtatgat gataatcatg tatcagcaat aaacgttaaa 1141 tctatagatc aatttctata ctttgactta atatattcta ttaaggacac taagttaggg 1201 aattatgata atgttcgagt cgaatttaaa aacaaagatt tagctgataa atacaaagat 1261 aaatacgtag atgtgtttgg agctaattat tattatcaat gttatttttc taaaaaaacg 1321 aatgatatta attcgcatca aactgacaaa caagctt SEQUENCE ID NO. 1 (Sequence Removed) Expression and purification of r-chimeric protein: The E. coli cells carrying the recombinant plasmid were grown at 37 °C in Luria Bertani broth (100 ml) with 50 ug/ul of ampicillin at 200 rpm in 500 ml flask. When A60o reached 0.6, IPTG was added to a final concentration of ImM. After 5h of induction, cells were harvested by centrifugation at 4,000g for 20 min. All the samples were examined on 12% Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE). As r-HLE protein was mainly localized as the inclusion bodies, the protein was purified under denaturing conditions. The pellet from 200 ml of culture was resuspended in 5 ml of buffer containing 6M Urea, 0.1 M Na phosphate, and pH 8.0. Cells were stired at room temperature for lhr. Lysate was centrifuged at 10,000g for 30 min at 4 °C. The resultant supernatant was mixed with 1 ml Ni-NTA Super flow resin that had been pre equilibrated with the lysis buffer. This suspension was gently rocked for 1 hr at room temperature and then packed into a column. After collecting the flow through, the column was washed with a buffer containing 8m urea, 0.1 M Na-phosphate, 0.01 mM Tris-CI (pH 6.3) to facilitate the removal of contaminants. The recombinant protein was eluted with a buffer containing 8M urea, 0.1 M Na-phosphate, 0.01 mM Tris-CI (pH 4.5). Fractions of 1 ml were collected and analyzed by SDS-PAGE. Peak fractions were pooled together and stored at 80 °C until use. The protein content was estimated by the method of Lowry and coworkers (1951). Preparation of hyperimmune polyclonal antiserum: Hyperimmune anti-r-chimeric protein polyclonal antiserum was generated by intraperitoneal immunization of male BALB/c mice (6 weeks old) with affinity purified r-chimeric protein in Freund's complete adjuvant (Sigma, India). Two boosts of 10ug each of r-chimeric protein in Freund's incomplete adjuvant (Sigma, India) followed on days 14 and 28. The antibody reactivity of immunized mice sera was measured by plate-ELISA. Hyperimmune serum obtained 14 days after the last boost was used in Western immunoblot analysis as described below. Exoprotein preparations from Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus Exoprotein preparations were prepared from strains by 805 ammonium sulphate precipitation method. Western Blot analysis: The affinity-purified r-chimeric protein and toxin preparations of standards as well as isolates were separated by 12% Poly Acrylamide Gel Electrophoresis (PAGE) and transferred to a nitrocellulose sheet. The sheet was then immersed in TBS (150 mM Nacl, 50mM Tris-HCI pH 704) containing 0.05% Tween 20 and 5% milk at 4 °C overnight to saturate protein-binding site. The antigen electroblotted onto the nitrocellulose membranes was incubated with the hyperimmune mouse sera at a 1:1,000 dilution and then with peroxidase-conjugated anti-mouse igG (Sigma India) at a 1:1,000 dilution. The peroxidase-positive bands were detected by immersing the sheet in a developing solution (70mM sodium acetate, pH 6.2) containing 0.3% diaminobenzidine tetrahydrochloride (Sigma, India) and 0.03% H202 at room temperature for 5 min. The enzyme reaction was terminated by washing the sheet in 0.1 MH2S04. Western blot analysis showed that mouse anti-r-chimeric protein serum strongly reacted with all the three toxins (Fig. 2). Hyperimmune antisera of r-chimeric protein did not exhibit any reaction with other strains tested. Indirect Plate Enzyme Linked Immunosorbent Assay Prior to native toxin detection, the assay was standardized by incubating purified recombinant chimeric protein at different dilution (1-500) ng/ml). The indirect plate ELISA was performed as per the method described by Engwell and Perlman (1971) with suitable modifications. Crude toxin preparation of Bacillus cereus. Listeria monocytogenes and Staphylococcus aureus strains in 100 ul volumes were added to the microtiter wells and blocked with 0.5% bovine serum albumin (BSA) in phosphate buffered saline (PBS). After washing with PBS, polyclonal antisera produced from mice against recombinant chimeric protein was added and the plastes were incubated at 37 °C for 60 min. The wells were washed, and then secondary antibody (goat anti-mice IgG-HRP, 1:1,000) was added to the wells and incubated at room temperature for about 10 min. The reaction was then stopped with 100 ul of 2.5 N H2SO4 . The absorbance of each well was read at 450 nm. Samples with absorbance > 0.18 were considered positive. Each sample was tested in triplicates. Development of ELISA Although Western blot analysis, which separates out proteins, could clearly detect toxin-producing strains, it was considered impractical for routine clinical use. ELISA-based system was therefore developed that could be used in both clinical and food research laboratories. It would also have the advantage of quantitating toxin (HBL, SEB and LLO) levels produced by different Bacillus cereus, Staphylococcus aureus and Listeria monocytogenes strains, which may be related to the varying severity of illness. The ELISA detected toxins from culture supernatants at levels as low as 300 pg/ml. Staphylococcal enterotoxin 'B' was detected specifically by commercially available TECRA kit. Evaluation of the detection systems Presence of toxin genes in all standard and isolates of Bacillus cereus, Staphylococcus aureus and Listeria monocytogenes were checked by PCR to compare immunoassays including (i) Western blot analysis, (ii) ELISA. There was a 90% correlation between PCR and the Western blot assay. However, in case of some toxin producing strains namely, Bacillus cereus 2155, Bacillus cereus 2703, B. thuringiensis 5118, Staphylococcus aureus 2079, PCR was negative. It is most likely that heterogeneity among the genes causes the inability to detect all genes in some strains by PCR. Electrophoretic analysis of E. coli expressed chimeric protein (Fig. 1) All samples were separated by electrophoresis through SDS-12% PAGE. The gel was stained with Coomassie blue in order to visualize protein components. Lane M, Molecular weight standards; Lane 1 BL21 (DE3) pLysS cells; lane 2, Uninduced E. coli BLWQ (DE3) pLysS cell with the vector containing fusion gene; Lane 3, Cells expressing HBL chimeric protein after 5h; Lane 4 HBL chimeric protein during first elution of Ni-NTA affinity chromatography; Lane 5, Second Elution; Lane 6, Third elution; Lane 7, Fourth elution. Western immunoblotanalysis of culture free supernatants of Bacillus cereus group, Listeria spp and S. aureus standards and isolates (Fig.2) Lanes 1, Moleuclar weight standards; Lane 2, Recombinant HLE chimeric protein; Lane 3, Staphylococcus aureus ATCC159051; Lane 4, Listeria monocytogenes ATCC 13932; Lane 5, Bacillus cereus ATCC 14579; Lane 6, Mixture of culture supernatants of Staphylococcus aureus, Listeria monocytogenes and Bacillus cereus; Lane 7, Bacillus cereus ATCC 10876; Lane 8, Staphylococcus aureus NCIM 2654; Lane 9, Staphylococcus aureus NCIM 2120; Lane 10, ivanovii. Construction of plasmid used for the expression of HBL fusion protein (Fig. 3) Left panel: plasmid pRSET A, an expression vector containing P, T7 promoter; R, synthetic ribosome binding site; H, 6X Histidine affinity tag sequence; EX, express epitope; MCS, multiple cloning site; T, transcriptional terminator; O, origin of replication and ampr, ampicillin resistance gene. BXSBPPKNEBH in MCS are sites for restriction endonucleases BamH I, Xho I, Sac I, Bgl II, Pst I, Pvu II, Kpn I, Nco I, EcoR I, BstB I and Hind III respectively. Right panel: hbl D (codes for L1 component of HBL), hly (codes for Listeriolysin O), ent B (codes for Enterotoxin B) were amplified by PCR with new restriction sites added at the ends by primers and cloned into the BamH I and Hind III sites of pREST A to generate a fusion gene construct r-HLE. We Claim, 1. A recombinant chimeric fusion protein comprising conserved portions of: i. Haemolysin BL (hbl D) toxin of Bacillus cereus ii. Listeriolysin O (hly)toxin of Listeria monocytogenes; and iii. Enterotoxin B (Ent B) toxin of Staphylococus aureus 2. The recombinant chimeric fusion protein as claimed in claim 1, wherein the molecular weight of said protein is 50 Kda. 3. The recombinant chimeric fusion protein as claimed in claim 1, wherein said fusion protein has sequence ID no. 1. 4. A process for the preparation of recombinant chimeric fusion protein comprising the steps of: i. amplifying conserved portions of hbl D, hly, Ent B by PCR method using primer sequences; ii. introducing restriction sites in the 5' and 3' flanking sites of said primer sequences to facilitate ligase dependent directional cloning; iii. ligating the PCR amplified products to obtain fusion gene r-HLE ; iv. ligating the fusion gene into the restriction sites of the bacterial expression vector pRSETA to generate plasmid pR-r-HLE; v. inserting fusion gene r-HLE inside said plasmid to generate the recombinant chimeric protein; and vi. purifying said protein 5. The process as claimed in claim 4, wherein said primers of hbl D gene are ACTACCGGATCCACTATTCATG and TGAAGTTGTGGTACCGTTGC (Accession No. AJ237785.1) 6. The process as claimed in claim 4, wherein said primers of hly gene are ATGGGTACCCTTCGGCGCAATCAGTG and TCTGAGCTCATGGGAACTCCTGGTGTT (Accession No. AY856382) 7. The process as claimed in claim 4, wherein said primers of Ent B gene are ATAGAGCTCACCAGATCCTAAACCAGATG and TAGAAGCTTGTTTGTCAGTTTGATGCG (Accession No. AY750900) 8. The process as claimed in claim 4, wherein said restriction sites introduced at the 5' and 3' flanking sites of hbl D are BamH I and Kpn I. 9. The process as claimed in claim 4, wherein said restriction sites introduced at the 5' and 3' flanking sites of hly are Kpn I and Sac I. 10. The process as claimed in claim 4, wherein said restriction sites introduced at the 5' and 3' flanking sites of Ent B are Sac I and Hind III. 11. The process as claimed in claim 4, wherein said fusion gene has nucleotide sequence ID no. 2. 12. The process as claimed in claim 4, wherein said fusion gene has a size of 1.37kb. 13. The process as claimed in claim 4, wherein said protein is purified by affinity chromatography. 14. An immunoassay for the detection of Haemolysin BL, Listeriolysin O and Enterotoxin B toxins comprising polyclonal antibodies generated against recombinant chimeric protein. 15. The recombinant chimeric fusion protein substantially as herein described with reference to foregoing drawings. 16. The process of preparing recombinant chimeric fusion protein substantially as herein described with reference to foregoing drawings.

Full Text

TECHNICAL FIELD
The present invention relates to a recombinant chimeric protein having conserved portions of Haemolysin BL of Bacillus cereus, Listeriolysin O of Listeria monocytogenes and Enterotoxin B toxin of Staphylococcus aureus and process of preparing the same.
BACKGROUND
Bacillus cereus, Listeria monocytogenes and Stapphylococcus aureus are closely related bacterial pathogens with potential to cause clinical infections and food-borne infections by secreting a variety of extra cellular toxins. Among the array of toxin components being possessed by these pathogens, Haemolysin BL (HBL) of Bacillus cereus, Listeriolysin O (LLO) of Listeria monocytogenes and Enterotoxin B (SEB) of Stapphylococcus aureus are the important virulence factors that play vital role in pathogenicity.
HBL is a unique membrane-lytic toxin of Bacillus cereus and has a variety of toxic activities including haemolysis, cytotoxicity, vascular permeability, dermonecrosis, enterotoxicity and ocular toxicity.
SEB is the primary cause of staphylococcal food poisoning and a potent mitogen that elicits life-threatening polyclonal T-cell proliferation and cytokine production at very low concentrations. At low serum concentrations, SEB can trigger toxic shock, profound hypotension and multi organ failure and is a recognized biowarfare molecule.
Listeria monocytogenes, the etiological agent of listeriosis, possess a bacterial pore-forming toxin LLO, generally believed to be the central molecule in the host-pathogen interactions, responsible for lysing the vacuolar membrane and allowing the organism to escape into the cytoplasm of the cell.
OBJECTIVE
The principal object of the present invention is to provide a recombinant chimeric protein which can be used to produce sufficient quantities of protein to be used in immunoassay based diagnostic methods for simultaneous detection of Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus.
Another object of the present invention is to provide a recombinant chimeric protein which can be used for vaccine development.
SUMMARY
The present invention relates to a recombinant chimeric fusion protein comprising conserved portions of
- Haemolysin BL (hbl D) toxin of Bacillus cereus
- Listeriolysin O (hly)toxin of Listeria monocytogenes; and
- Enterotoxin B (Ent B) toxin of Staphylococus aureus
The present invention further relates to a process for the preparation of recombinant chimeric fusion protein comprising the steps of
- amplifying conserved portions of hbl D, hly, Ent B by PCR method using primer sequences;
- introducing restriction sites in the 5' and 3' flanking sites of said primer sequences to facilitate ligase dependent directional cloning;
- ligating the PCR amplified products to obtain fusion gene r-HLE ;
- ligating the fusion gene into the restriction sites of the bacterial expression vector pRSETA to generate plasmid pR-r-HLE;
- inserting fusion gene r-HLE inside said plasmid to generate the recombinant chimeric protein; and
- purifying said protein
BRIEF DESCRIPTION OF DRAWINGS
Figure 1 relates to electrophoretic analysis of E. coli expressed chimeric protein.
Figure 2 relates to Western immunoblotanalysis of culture free supematants of Bacillus cereus group, Listeria spp and S. aureus standards and isolates.
Figure 3 relates to construction of Plasmid used for the expression of HBL fusion protein.
DETAILED DESCRIPTION
The present invention relates to preparation of recombinant chimeric protein having truncated portions of Haemolysin BL, Listeriolysin O and Enterotoxin B toxins of Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus respectively. The genetic material can be used to produce sufficient quantities of protein to be used in immunoassay based diagnostic methods for simultaneous detection of Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus and also for vaccine development.
Fusion gene, codon-optimized for E.coli expression, was first generated by ligation of
PCR amplified products encoding LI of HBL toxin complex of Bacillus cereus,
Listeriolysin O of Listeria monocytogenes and Enterotoxin B of Staphylococcus aureus.
The resultant 1.37kb fusion gene was sequenced and its expression resulted in a single
recombinant multi domain chimeric protein r-HLE in E.coli host. The resultant 50 kDa
fusion protein was purified using Ni-NTA chromatography. Polyclonal antibodies were
raised against this purified fusion protein and the antigencity was confirmed by Western
blot/ELISA using the purified native toxins of respective organisms.
The present invention targets conserved portions of genes of the Haemolysin BL, Listeriolysin O and Enterotoxin B using NCBI database. These sequences were amplified by PCR and restriction sites were introduced into the 5' and 3' flanking sites of these three sequences to facilitate ligase dependant directional cloning (table 1) and to obtain fusion gene.
Bacterial strains and media
Reference strains were obtained from American Type Cultural Collection (ATCC) and National Collection of Industrial Microorganisms (NCIM).
PCR amplification of hbl D, hly and ent B genes
The conserved portions of hbl D, hly and ent B genes amplified by PCR, using Bacillus cereus ATCC 14579, Listeria monocytogenes ATCC 15313 and Staphylococcis aureus ATCC whole genomic DNA as template. Primers of L1 protein gene (hbl D) were synthesized to insert BamHI and Kpn I sites to the 5' and 3' ends of hbl D via PCR with amplicon size of 590 bp. Similarly, Primers of Lis O protein gene (hly) and Ent B protein gene (Ent B) were synthesized to insert Kpn I & Sac I sites and Sac I & Hind III sites to the 5' and 3' ends of hly and Ent b via PCR with amplicon sizes of 471 bp and 493 bp, respectively (Table 1). PCR was performed in 25 ul reaction volume containing 400 nM of each primer, 200 uM of each dNTP, 1.0 U Pfu polymerase, 1.5 mM of MgS04 in IX PCR buffer with 50 mg of template DNA. PCR was carried out through 30 cycles in Eppendorf master gradient thermal cycler at 94 °C for 1 min denaturation, 54 °C for 1 min annealing and 72 °C for 3 min extension. The DNA was denatured for 5 min in the beginning and finally extended for 15 min at 72 °C. The amplified PCR products were separated on 1% Agarose gel and subjected to restriction digestion with their respective enzymes.
Cloning of fusion gene
Primer designing
Conserved portions of hbl D, hly and Ent B genes have been selected using NCBI database. Three pairs of PCR primers were designed to amplify conserved portions and restriction sites were introduced into the 5' and 3' flanking sites of these three primer sequences to facilitate ligase dependant directional cloning. Primers used for amplification of truncated portions of hbl D, hly and ent B genes are presented in table 1.
TABLE1: Primers used for amplifications of conserved portions of hbl D, hly and entB

(Table Removed)
Plasmid construction
Fusion gene, codon-optimized for E. coli expression, was first generated by ligation of PCR amplified products encoding conserved domains of L1 component of HBL, Lis O and Ent B using T4 DNA ligase and subsequent PCR amplification with L1 forward primer and Ent B reverse primer to get fusion gene (1372 bp). The resultant 1.37-kb gene
(r- HLE) was ligated into the BamH I and Hind III sites of the bacterial expression vector pRSET A to generate the plasmid pR-r-HLE. In this plasmid, the r-HLE gene was inserted in frame with the ATG condon and the six-His tag-encoding sequence (at the 5' end) provided by the pRSET A vector to get protein with the expected size of 50 kDa. The ligated product was transformed into E. coli BL21 (DE3) pLysS cells and selected on ampicillin plates. Preparation and transformation of component E. coli BL21 (DE3) pLysS bacteria were performed according to procedures (Sambrook et al., 1989). Recombinant clones were subjected to direct colony PCR screenings using L1 forward primer and Ent B reverse primer to identify recombinants harboring the synthetic r-HLE gene.
Sequence of fusion gene
The DNA sequencing of the fusion gene was carried out using L1 forward and SEB reverse primers. The DNA sequence and the predicted amino acid sequence (Sequence ID No. 1) coded by the fusion gene for the recombinant protein are given below.
Nucleotide sequence of the Recombinant fusion gene of HLE toxin
ggatccacta ttcatgcart tgcacaagaa acgaccgctc aagaacaaaa agtaggcaat 61 tatgcattag gccccgaagg actgaagaaa gcattagctg aaacagggtc tcatattcta 121 gtaatggatt tatacgcaaa aacaatgatt aagcaaccaa atgtaaattt atctaatatc 181 gatttaggct cagagggggg agagttgctc aaaaatattc accttaatca agagctgtca 241 cgaatcaatg cgaattactg gttagataca gcgaagccac agattcaaaa aactgctcgt 301 aatattgtaa attacgatga acaatttcaa aattattacg acacattagt agaaactgta 361 caaaagaaag ataaggcagg tctaaaagag ggtataaatg atttaattac tacaatcaat 421 acaaattcaa aagaagttac agatgtgatt aagatgctac aagacttcaa agggaaacta 481 tatcaaaatt ctacagattt taaaaataat gttggtggtc cagatgggaa aggtggatta 541 actgcaatat tagcaggtca acaggcaacg gtacccttcg gcgcaatcag tgaagggaaa 601 atgcaagaag aagtcattag ttttaaacaa atttactata acgtgaatgt taatgaacct 661 acagaccttt ccagattttt cggcaaagct gttactaaag agcagttgca agcgcttgga 721 gtgaatgcag aaaatcctcc tgcatatatc tcaagtgtgg cgtatggccg tcaagtttat 781 ttgaaattat caactaattc ccatagtact aaagtaaaag ctgcttttga tgctgccgta 841 agcggaaaat ctgtctcagg
tgatgtagaa ctaacaaata tcatcaaaaa ttcttccttc 901 aaagccgtaa tttacggagg ttccgcaaaa gatgaagttc aaatcatcga cggcaacctc 961 ggagacttac gcgatatttt gaaaaaaggc gctactttta atcgagaaac accaggagtt 1021 cccatgagct caccagatcc taaaccagat gagttgcaca aatcgagtaa attcactggt 1081 ttgatggaaa atatgaaagt tttgtatgat gataatcatg tatcagcaat aaacgttaaa 1141 tctatagatc aatttctata ctttgactta atatattcta ttaaggacac taagttaggg 1201 aattatgata atgttcgagt cgaatttaaa aacaaagatt tagctgataa atacaaagat 1261 aaatacgtag atgtgtttgg agctaattat tattatcaat gttatttttc taaaaaaacg 1321 aatgatatta attcgcatca aactgacaaa caagctt
SEQUENCE ID NO. 1
(Sequence Removed)
Expression and purification of r-chimeric protein:
The E. coli cells carrying the recombinant plasmid were grown at 37 °C in Luria Bertani broth (100 ml) with 50 ug/ul of ampicillin at 200 rpm in 500 ml flask. When A60o reached 0.6, IPTG was added to a final concentration of ImM. After 5h of induction, cells were harvested by centrifugation at 4,000g for 20 min. All the samples were examined on 12% Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE). As r-HLE protein was mainly localized as the inclusion bodies, the protein was purified under denaturing conditions. The pellet from 200 ml of culture was resuspended in 5 ml of buffer containing 6M Urea, 0.1 M Na phosphate, and pH 8.0. Cells were stired at room temperature for lhr. Lysate was centrifuged at 10,000g for 30 min at 4 °C. The resultant
supernatant was mixed with 1 ml Ni-NTA Super flow resin that had been pre equilibrated with the lysis buffer. This suspension was gently rocked for 1 hr at room temperature and then packed into a column. After collecting the flow through, the column was washed with a buffer containing 8m urea, 0.1 M Na-phosphate, 0.01 mM Tris-CI (pH 6.3) to facilitate the removal of contaminants. The recombinant protein was eluted with a buffer containing 8M urea, 0.1 M Na-phosphate, 0.01 mM Tris-CI (pH 4.5). Fractions of 1 ml were collected and analyzed by SDS-PAGE. Peak fractions were pooled together and stored at 80 °C until use. The protein content was estimated by the method of Lowry and coworkers (1951).
Preparation of hyperimmune polyclonal antiserum:
Hyperimmune anti-r-chimeric protein polyclonal antiserum was generated by intraperitoneal immunization of male BALB/c mice (6 weeks old) with affinity purified r-chimeric protein in Freund's complete adjuvant (Sigma, India). Two boosts of 10ug each of r-chimeric protein in Freund's incomplete adjuvant (Sigma, India) followed on days 14 and 28. The antibody reactivity of immunized mice sera was measured by plate-ELISA. Hyperimmune serum obtained 14 days after the last boost was used in Western immunoblot analysis as described below.
Exoprotein preparations from Bacillus cereus, Listeria monocytogenes and Staphylococcus aureus
Exoprotein preparations were prepared from strains by 805 ammonium sulphate precipitation method.
Western Blot analysis:
The affinity-purified r-chimeric protein and toxin preparations of standards as well as isolates were separated by 12% Poly Acrylamide Gel Electrophoresis (PAGE) and transferred to a nitrocellulose sheet. The sheet was then immersed in TBS (150 mM Nacl, 50mM Tris-HCI pH 704) containing 0.05% Tween 20 and 5% milk at 4 °C overnight to
saturate protein-binding site. The antigen electroblotted onto the nitrocellulose membranes was incubated with the hyperimmune mouse sera at a 1:1,000 dilution and then with peroxidase-conjugated anti-mouse igG (Sigma India) at a 1:1,000 dilution. The peroxidase-positive bands were detected by immersing the sheet in a developing solution (70mM sodium acetate, pH 6.2) containing 0.3% diaminobenzidine tetrahydrochloride (Sigma, India) and 0.03% H202 at room temperature for 5 min. The enzyme reaction was terminated by washing the sheet in 0.1 MH2S04. Western blot analysis showed that mouse anti-r-chimeric protein serum strongly reacted with all the three toxins (Fig. 2). Hyperimmune antisera of r-chimeric protein did not exhibit any reaction with other strains tested.
Indirect Plate Enzyme Linked Immunosorbent Assay
Prior to native toxin detection, the assay was standardized by incubating purified recombinant chimeric protein at different dilution (1-500) ng/ml). The indirect plate ELISA was performed as per the method described by Engwell and Perlman (1971) with suitable modifications. Crude toxin preparation of Bacillus cereus. Listeria monocytogenes and Staphylococcus aureus strains in 100 ul volumes were added to the microtiter wells and blocked with 0.5% bovine serum albumin (BSA) in phosphate buffered saline (PBS). After washing with PBS, polyclonal antisera produced from mice against recombinant chimeric protein was added and the plastes were incubated at 37 °C for 60 min. The wells were washed, and then secondary antibody (goat anti-mice IgG-HRP, 1:1,000) was added to the wells and incubated at room temperature for about 10 min. The reaction was then stopped with 100 ul of 2.5 N H2SO4 . The absorbance of each well was read at 450 nm. Samples with absorbance > 0.18 were considered positive. Each sample was tested in triplicates.
Development of ELISA
Although Western blot analysis, which separates out proteins, could clearly detect toxin-producing strains, it was considered impractical for routine clinical use. ELISA-based
system was therefore developed that could be used in both clinical and food research laboratories. It would also have the advantage of quantitating toxin (HBL, SEB and LLO) levels produced by different Bacillus cereus, Staphylococcus aureus and Listeria monocytogenes strains, which may be related to the varying severity of illness. The ELISA detected toxins from culture supernatants at levels as low as 300 pg/ml. Staphylococcal enterotoxin 'B' was detected specifically by commercially available TECRA kit.
Evaluation of the detection systems
Presence of toxin genes in all standard and isolates of Bacillus cereus, Staphylococcus aureus and Listeria monocytogenes were checked by PCR to compare immunoassays including (i) Western blot analysis, (ii) ELISA. There was a 90% correlation between PCR and the Western blot assay. However, in case of some toxin producing strains namely, Bacillus cereus 2155, Bacillus cereus 2703, B. thuringiensis 5118, Staphylococcus aureus 2079, PCR was negative. It is most likely that heterogeneity among the genes causes the inability to detect all genes in some strains by PCR.
Electrophoretic analysis of E. coli expressed chimeric protein (Fig. 1)
All samples were separated by electrophoresis through SDS-12% PAGE. The gel was stained with Coomassie blue in order to visualize protein components. Lane M, Molecular weight standards; Lane 1 BL21 (DE3) pLysS cells; lane 2, Uninduced E. coli BLWQ (DE3) pLysS cell with the vector containing fusion gene; Lane 3, Cells expressing HBL chimeric protein after 5h; Lane 4 HBL chimeric protein during first elution of Ni-NTA affinity chromatography; Lane 5, Second Elution; Lane 6, Third elution; Lane 7, Fourth elution.
Western immunoblotanalysis of culture free supernatants of Bacillus cereus group, Listeria spp and S. aureus standards and isolates (Fig.2)
Lanes 1, Moleuclar weight standards; Lane 2, Recombinant HLE chimeric protein; Lane 3, Staphylococcus aureus ATCC159051; Lane 4, Listeria monocytogenes ATCC 13932; Lane 5, Bacillus cereus ATCC 14579; Lane 6, Mixture of culture supernatants of Staphylococcus aureus, Listeria monocytogenes and Bacillus cereus; Lane 7, Bacillus cereus ATCC 10876; Lane 8, Staphylococcus aureus NCIM 2654; Lane 9, Staphylococcus aureus NCIM 2120; Lane 10, ivanovii.
Construction of plasmid used for the expression of HBL fusion protein (Fig. 3)
Left panel: plasmid pRSET A, an expression vector containing P, T7 promoter; R, synthetic ribosome binding site; H, 6X Histidine affinity tag sequence; EX, express epitope; MCS, multiple cloning site; T, transcriptional terminator; O, origin of replication and ampr, ampicillin resistance gene. BXSBPPKNEBH in MCS are sites for restriction endonucleases BamH I, Xho I, Sac I, Bgl II, Pst I, Pvu II, Kpn I, Nco I, EcoR I, BstB I and Hind III respectively. Right panel: hbl D (codes for L1 component of HBL), hly (codes for Listeriolysin O), ent B (codes for Enterotoxin B) were amplified by PCR with new restriction sites added at the ends by primers and cloned into the BamH I and Hind III sites of pREST A to generate a fusion gene construct r-HLE.

We Claim,
1. A recombinant chimeric fusion protein comprising conserved portions of:
i. Haemolysin BL (hbl D) toxin of Bacillus cereus
ii. Listeriolysin O (hly)toxin of Listeria monocytogenes; and iii. Enterotoxin B (Ent B) toxin of Staphylococus aureus
2. The recombinant chimeric fusion protein as claimed in claim 1, wherein the molecular weight of said protein is 50 Kda.
3. The recombinant chimeric fusion protein as claimed in claim 1, wherein said fusion protein has sequence ID no. 1.
4. A process for the preparation of recombinant chimeric fusion protein comprising the steps of:
i. amplifying conserved portions of hbl D, hly, Ent B by PCR method using primer sequences;
ii. introducing restriction sites in the 5' and 3' flanking sites of said primer sequences to facilitate ligase dependent directional cloning;
iii. ligating the PCR amplified products to obtain fusion gene r-HLE ;
iv. ligating the fusion gene into the restriction sites of the bacterial expression vector pRSETA to generate plasmid pR-r-HLE;
v. inserting fusion gene r-HLE inside said plasmid to generate the recombinant chimeric protein; and
vi. purifying said protein
5. The process as claimed in claim 4, wherein said primers of hbl D gene are ACTACCGGATCCACTATTCATG and TGAAGTTGTGGTACCGTTGC (Accession No. AJ237785.1)
6. The process as claimed in claim 4, wherein said primers of hly gene are ATGGGTACCCTTCGGCGCAATCAGTG and TCTGAGCTCATGGGAACTCCTGGTGTT (Accession No. AY856382)
7. The process as claimed in claim 4, wherein said primers of Ent B gene are ATAGAGCTCACCAGATCCTAAACCAGATG and TAGAAGCTTGTTTGTCAGTTTGATGCG (Accession No. AY750900)
8. The process as claimed in claim 4, wherein said restriction sites introduced at the 5' and 3' flanking sites of hbl D are BamH I and Kpn I.
9. The process as claimed in claim 4, wherein said restriction sites introduced at the 5' and 3' flanking sites of hly are Kpn I and Sac I.
10. The process as claimed in claim 4, wherein said restriction sites introduced at the 5' and 3' flanking sites of Ent B are Sac I and Hind III.
11. The process as claimed in claim 4, wherein said fusion gene has nucleotide sequence ID no. 2.
12. The process as claimed in claim 4, wherein said fusion gene has a size of 1.37kb.
13. The process as claimed in claim 4, wherein said protein is purified by affinity chromatography.
14. An immunoassay for the detection of Haemolysin BL, Listeriolysin O and Enterotoxin B toxins comprising polyclonal antibodies generated against recombinant chimeric protein.
15. The recombinant chimeric fusion protein substantially as herein described with
reference to foregoing drawings.
16. The process of preparing recombinant chimeric fusion protein substantially as herein described with reference to foregoing drawings.

Documents:

http://ipindiaonline.gov.in/patentsearch/GrantedSearch/viewdoc.aspx?id=0KLf0RVm2ZIUGm6BiAwWUg==&loc=+mN2fYxnTC4l0fUd8W4CAA==

« Previous Patent

Next Patent »

Patent Number

269642

Indian Patent Application Number

838/DEL/2009

PG Journal Number

45/2015

Publication Date

06-Nov-2015

Grant Date

29-Oct-2015

Date of Filing

22-Apr-2009

Name of Patentee

DIRECTOR GENERAL, DEFENCE RESEARCH & DEVELOPMENT ORGANISATION

Applicant Address

MINISTRY OF DEFENCE, GOVERNMENT OF INDIA, ROOM NO.348, B-WING, DRDO BHAVAN, RAJAJI MARG, NEW DELHI-110011 INDIA

Inventors:

#	Inventor's Name	Inventor's Address
1	HARISHCHANDRA SRIPATHY MURALI	C/O DIVISION OF MICROBIOLOGY, DEFENSE FOOD RESEARCH LABORATORY, SIDDHARTHA NAGAR, MYSORE KARNATAKA 570011 INDIA
2	HARSH VARDHAN BATRA	C/O DIVISION OF MICROBIOLOGY, DEFENSE FOOD RESEARCH LABORATORY, SIDDHARTHA NAGAR, MYSORE KARNATAKA 570011 INDIA
3	AMARINDER SINGH BAWA	C/O DIVISION OF MICROBIOLOGY, DEFENSE FOOD RESEARCH LABORATORY, SIDDHARTHA NAGAR, MYSORE KARNATAKA 570011 INDIA
4	THAKASI DEVI KALYAN KUMAR	C/O DIVISION OF MICROBIOLOGY, DEFENSE FOOD RESEARCH LABORATORY, SIDDHARTHA NAGAR, MYSORE KARNATAKA 570011 INDIA
5	KONDURU BALAKRISHNA	C/O DIVISION OF MICROBIOLOGY, DEFENSE FOOD RESEARCH LABORATORY, SIDDHARTHA NAGAR, MYSORE KARNATAKA 570011 INDIA
6	RAMLAL SHYLAJA	C/O DIVISION OF MICROBIOLOGY, DEFENSE FOOD RESEARCH LABORATORY, SIDDHARTHA NAGAR, MYSORE KARNATAKA 570011 INDIA

PCT International Classification Number

C12P21/04

PCT International Application Number

N/A

PCT International Filing date

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1			NA