Indian Patents. 225146:"OLIGONUCLEOTIDE PRIMERS HAVING SEQ ID NOS. 1 TO 21 AND A PROCESS FOR DETECTION OF PARASITE SALMONELLA USING OLIGONUCLEOTIDE PRIMERS"

Title of Invention	"OLIGONUCLEOTIDE PRIMERS HAVING SEQ ID NOS. 1 TO 21 AND A PROCESS FOR DETECTION OF PARASITE SALMONELLA USING OLIGONUCLEOTIDE PRIMERS"
Abstract	The present invention relates to designing of specific oligonucleotide primers to identify the Salmonella enterotoxin gene (stn) gene. The present invention also relates to a process for the rapid and specific detection of Salmonella enterotoxin gene (stn) using oligonucleotide primers by Polymerase Chain Reaction (PCR) which will facilitate detection of the Salmonella parasite.

Full Text	Field of the present invention The present invention relates to oligonucleotide primers comprising SEQ ID NOs. 1 to 21, specific for Salmonella enterotoxin gene (stn) gene, useful for rapid and specific screening of Salmonella. The present invention also relates to a process for the rapid and specific detection of Salmonella enterotoxin gene (stn) gene in a subject for the presence of parasite Salmonella using oligonucleotide primers comprising SEQ ID NOs. 1 to 21 for Polymerase Chain Reaction (PCR), said process comprising steps of preparing DNA template of the gene, amplifying the template using the primers by PCR, running the PCR products on gel, and detecting the parasite. Background of the invention Salmonella species are facultative, intracellular parasites that invade the mucous membrane of the epithelial cells and are transmitted to humans mainly through water, meat, eggs and poultry products. Salmonella infection is the most frequent food-borne gastrointestinal disease transmitted from animals to humans. Typhoid fever still remains endemic in many developing countries and non-typhoidal salmonellosis also is a major food-borne disease worldwide and is estimated to be responsible for the deaths of more than 500 people each year, with costs of $1 billion to $1.5 billion annually in the United States alone (Threlfall 1996; Mead et al. "Food-related illness and death in the United States," Emerg Infect Dis., 1999, 5:607 25.) These figures in India are not fully documented but expected to be much higher. To prevent Salmonella infection, good monitoring and screening programs are required. Detection of Salmonella by conventional bacteriological methods are time consuming and usually requires 5 to days. Therefore, efforts have been made by many workers to reduce time required and to increase the sensitivity of the methods to detect Salmonella (Notermans et al. 1997; Ferretti et al., "Twelve-hour PCR-based method for detection of Salmonella spp. in food," Appl Environ Microbiol., 2001, 67:977 8; Carli et al., "Detection of salmonellae in chicken feces by a combination of tetrathionate broth enrichment, capillary PCR, and capillary gel electrophoresis," J Clin Microbiol., 2001, 39:1871 6). Increased public awareness of the health related and economic impact of food-borne contamination and illness has resulted in greater efforts to develop more sensitive methods of pathogenic detection and identification. Advances in molecular biology technology, particularly the polymerase chain reaction (PCR), have allowed more reliable microbial identification and surveillance. PCR has also become a valuable tool for investigating food-borne outbreaks and identification of etiological agents responsible for the microbial epidemics. PCR techniques have provided increased sensitivity, allowed more rapid processing times and enhanced the detection of bacterial pathogens. In addition to analysis of foods, PCR has also been /Successfully applied for the detection and identification of pathogenic micro organisms in clinical and environmental samples (Simon 1999; White, 1992). Enterotoxigenicity has been recognized as one of the distinct pathological attributes of diarrhoea inducing bacteria. Salmonella serotypes, which are known for their association with gastroenteritis and diarrhoea in humans and animals, have also been shown to produce enterotoxin. The stn gene is located at approximately 89 minutes on the Salmonella lyphimurium chromosome and the presence of an intact stn gene contributes significantly to the overall virulence of Salmonella. We present here the use of stn gene as a detection marker for Salmonella. Objects of the present invention The main object of the present invention is to develop primers for the detection of parasite salmonella enterotoxin gene (stn) Another main object of the present invention is to develop a rapid and efficient process for the detection of Parasite Salmonella enterotoxin gene (stn) Yet another main object of the present invention is to develop a process for the detection of Parasite Salmonella from food, biological samples, etc. Summary of the invention The present invention relates to oligonucleotide primers of SEQ ID NOs: 1 to 21 specific for the Salmonella enterotoxin gene (stn) gene. The present invention also relates to a process for rapid and specific detection of the Salmonella enterotoxin gene (stn) gene using oligonucleotide primers of SEQ ID NOs: 1 to 21 for Polymerase chain reaction (PCR), said process comprising the steps of preparing DNA template of the gene, amplifying the template using the oligonucleotide primers by PCR, running the PCR products on an agarose gel, and detecting the stn gene. Detailed description of the present invention Accordingly, the present invention provides oligonucleotide primers of SEQ ID Nos.l to 21 to amplify Salmonella enterotoxin (sin) gene and also a process for the rapid and specific detection of Salmonella enterotoxin gene (stn) gene in a subject for the presence of parasite Salmonella using oligonucleotide primers of SEQ ID Nos. 1 to 21 for Polymerase Chain Reaction (PCR), said process comprising steps of preparing DNA template of the gene, amplifying the template using the primers by PCR, running the PCR products on gel, and detecting the parasite. Background of the invention Salmonella species are facultative, intracellular parasites that invade the mucous membrane of the epithelial cells and are transmitted to humans mainly through water, meat, eggs and poultry products. Salmonella infection is the most frequent food-borne gastrointestinal disease transmitted from animals to humans. Typhoid fever still remains endemic in many developing countries and non-typhoidal salmonellosis also is a major food-borne disease worldwide and is estimated to be responsible for the deaths of more than 500 people each year, with costs of $1 billion to $1.5 billion annually in the United States alone Threlfall 1996; Mead et al. 1999) These figures in India are not fully documented but expected to be much higher. To Prevent Salmonella infection good monitoring and screening programs are required. Detection of Salmonella by conventional bacteriological methods are time consuming and usually requires 5 to days. Therefore, efforts have been made by many workers to reduce time required and to increase the sensitivity of the methods to detect Salmonella (Notermans et al. 1997; Ferretti et al 2001 ; Carli et al. 2001). Increased public awareness of the health related and economic impact of food-borne contamination and illness has resulted in greater efforts to develop more sensitive methods of pathogenic detection and identification. Advances in molecular biology technology, particularly the polymerase chain reaction (PCR), have allowed more reliable microbial identification and surveillance. PCR has also become a valuable tool for investigating food-borne outbreaks and identification of etiological agents responsible for the microbial epidemics. PCR techniques have provided increased sensitivity, allowed more rapid processing times and enhanced the detection of bacterial pathogens. In addition to analysis of foods, PCR has also been successfully applied for the detection and^ identification of pathogenic microorganisms in clinical and environmental samples (Simon 1999; White, 1992). Enterotoxigenicity has been recognized as one of the distinct pathological attributes of diarrhoea inducing bacteria. Salmonella serotypes, which are known for their association with gastroenteritis and diarrhoea in humans and animals, have also been shown to produce enterotoxin. The stn gene is located at approximately 89 minutes on the Salmonella lyphimurium chromosome and the presence of an intact stn gene contributes significantly to the overall virulence of Salmonella. We present here the use of stn gene as a detection marker for Salmonella. Objects of the present invention The main object of the present invention is to develop primers for the detection of parasite salmonella. Another main object of the present invention is to develop a rapid and efficient process for the detection of Parasite Salmonella. Yet another main object of the present invention is to develop a process for the detection of Parasite Salmonella from food, biological samples, etc. Summary of the invention The present invention relates to oligonucleotide primers of SEQ ID Nos. 1 to 21 specific for Salmonella enterotoxin gene (stn) gene, useful for rapid and specific screening of Salmonella; and also, a process for the rapid and specific detection of Salmonella enterotoxin gene (stn) gene in a subject for the presence of parasite Salmonella using oligonucleotide primers of SEQ ID Nos. 1 to 21 for Polymerase Chain Reaction (PCR), said process comprising steps of preparing DNA template of the gene, amplifying the template using the primers by PCR, running the PCR products on gel, and detecting the parasite. Detailed description of the present invention Accordingly, the present invention relates to oligonucleotide primers of SEQ ID Nos. 1 to 21 specific for Salmonella enterotoxin gene (stn) gene, useful for rapid and specific screening of Salmonella; and also, a process for the rapid and specific detection of Salmonella enterotoxin gene (stn) gene in a subject for the presence of parasite Salmonella using oligonucleotide primers of SEQ ID Nos. 1 to 21 for Polymerase Chain Reaction (PCR), said process comprising steps of preparing DNA template of the gene, amplifying the template using the primers by PCR, running the PCR products on gel, and detecting the parasite. In an embodiment of the present invention, wherein oligonucleotide primers of SEQ ID Nos. 1 to 21 specific for Salmonella enterotoxin gene (stn) gene, useful for rapid and specific screening of Salmonella. In another embodiment of the present invention, wherein a process for the rapid and specific detection of Salmonella enterotoxin gene (stn) gene in a subject for the presence of parasite Salmonella using oligonucleotide primers of SEQ ID Nos. 1 to 21 for Polymerase Chain Reaction (PCR), said process comprising steps of: • preparing DNA template of the gene, • amplifying the template using the primers by PCR, • running the PCR products on gel, and • detecting the parasite. In yet another embodiment of the present invention, wherein the gene is sequenced from serotypes of Salmonella. In still another embodiment of the present invention, wherein the primers can detect upto about 1 cell per ml of water with or without any enrichment. In still another embodiment of the present invention, wherein the primers can detect upto 10 cells per ml of blood with or without any enrichment. In still another embodiment of the present invention, wherein the primers can detect upto 1 cell per gram of food and clinical sample with or without any enrichment. In still another embodiment of the present invention, wherein DNA from blood and background micro flora does not interfere with PCR assay. In still another embodiment of the present invention, wherein the said process can be used as quality control of water and diagnosis of bacterium Salmonella. In still another embodiment of the present invention, wherein the subject is humans and animals. In still another embodiment of the present invention, wherein the set of primers of SEQ ID Nos. 1 and 2 generates amplicons of 200bp. In still another embodiment of the present invention, wherein the set of primers of SEQ ID Nos. 3 and 4 generates amplicons of 207bp. In still another embodiment of the present invention, wherein the set of primers of SEQ ID Nos. 5 and 6 generates amplicons of 1318bp. In still another embodiment of the present invention, wherein the set of primers of SEQ ID Nos. 7 and 8 generates amplicons of 450bp. A In still another embodiment of the present invention, wherein the concentration of primers is ranging between 1 pM to 100 pM. In still another embodiment of the present invention, wherein visualizing the PCR products on gel of concentration ranging from 0.3% to 2.7%. In still another embodiment of the present invention, wherein PCR involves initial denaturation at 93°C to 97 °C for 30 sec. to 7 min. and 23 to 50 cycles of 93°C to 97°C for 3 sec. to 2 min., 50°C to 67 °C for 10 sec to 2 min., 70 °C to 75 °C for 10 sec. to 2 min. and final extension at 70 °C to 75 °C for 2 min. to 10 min. In still another embodiment of the present invention, wherein the DNA is isolated from pure cultures, water, food and clinical samples. Brief description of the accompanying drawings Fig 1 shows 1% agarose gel showing all the four PCR products used in the detection of Salmonella. Lane 1:1 kb DNA ladder (Fermentas). Lane 2: PCR amplification with primers QVR133 and QVR134 (200 bp); Lane 3: PCR amplification with primers QVR135 and QVR136 (207 bp); Lane 4: PCR amplification with primers QVR137 and QVR138 (1318 bp); Lane 5: PCR amplification with primers QVR139 and QVR140 (450 bp); Lane 6: Negative control with primers QVR139 and QVR140 Fig 2 shows 1% agarose gel showing the detection of different numbers of Salmonella cells from blood with primers QYR 137 and QVR 138. Lane 1: 1 kb DNA ladder (Fermentas) Lane 2: Positive control; Lane 3: Blood sample spiked with approx. 1 cell and given pre-enrichment for 5 hour? Lane 4: Negative control (unseeded blood sample); Lane 5: Blood sample spiked with less than 10 cells and PCR run without pre-enrichment; Lane 6: Blood sample spiked with 10 cells and PCR run without preenrichment and Lane 7: Blood sample spiked with 103 cells and PCR run without preenrichment Fig 3 shows 1% agarose gel showing PCR amplified product of the nested PCR for the detection of Salmonella. The first PCR reactions were run with primers QVR137 and QVR138 and those in the nested PCR were run with primers QVR 139 and QVR 140. Lane 1: 1 kb DNA ladder (Fermentas) Lanes 2-7: Different serotypes of Salmonella and Lane 8: Negative corttr.pl In still another embodiment of the present invention, wherein Stn gene was sequenced from several serotypes of Salmonella and the sequence was found to be conserved. A PCR based protocol for the detection of Salmonella has been developed by using specific primers based on Salmonella enterotoxin gene (stn). These primers and the PCR protocols have been deigned by us and are being reported for the first time. The method is highly specific and can detect upto 1 cell per ml of water and less than 10 cells per ml of blood without any pre-enrichment. The primers do not show any tendency to amplify non-Salmonella DNA. DNA from blood and background micro flora do not interfere with the PCR assay either by generating any non-specific PCR amplicons or by inhibiting the PCR assay. This method may be used as quality control of water and diagnosis of bacteremia by Salmonella in humans and animals. In still another embodiment of the present invention, wherein Oligonucleotide primers designed on the basis of stn gene (Salmonella enterotoxin gene) and used in Polymerase Chain reaction are useful for the rapid and specific detection of Salmonella by the PCR protocol consisting of initial denaturation at 93°C to 97 °C for 30 sec. to 7 min. and 23 to 50 cycles of 93°C toJj'C for 3 sec. to 2 min., 50°C to 67 °C for 10 sec to 2 min., 70 °C to 75 °C for 10 sec. to 2 min. artd final extension at 70 °C to 75 °C for 2 min. to 10 min. after DNA isolation by any known method suitable for PCR from pure cultures, water, food and clinical samples, using Ifg to lOug of DNA and any thermostable DNA polymerase enzyme followed by visualizing the PCR products on agarose gel. ranging from 0.5% to 2.5%. In still another embodiment of the present invention, wherein Rapid method for the detection of Salmonella wherein the primers selected are: Following is a Set 1 of primers of SEQ ID nos. 1 and 2 respectively. Also referred to asQVR133andQVR 134. 5'GAAGCAGCGCCTGTAAAATC3' / 5'TGGCTGTGGTGCAAAATATC 3'; Following is a Set 2 of primers of SEQ ID nos. 3 and 4 respectively. Also referred to asQVR135andQVR136. 5'GCCACCAGCTTTTCTTTACG 3' / S'ACGAACCAGCGAAACAAAOT; Following is a Set 3 of primers of SEQ ID nos. 5 and 6 respectively: Also referred to asQVR137andQVR 138. 5'GGTCAAAATCCAGCGGTTTA 3' / 5 'TTGCTGCTAACGGCGAGA 3', Following is a Set 4 of primers of SEQ ID nos. 7 and 8 respectively. Also referred to asQVR139andQVR140. 5'GCCGGCTTTCAACGCCTCTAC3' / 5'GACCAAAGCTGACGGGACAGS' SEQIDNO. 9 5' ACGCCTCTACCGCCGTTTCC3', SEQIDNO. 10 5'CGACCAAAGCTGACGGGACAGS', SEQ ID NO. 11 5 'CGTTTCC ACGCTGGAAAATGC3', SEQIDNO. 12 5 'GCCGGCTTTC AACGCCTCTAC3', SEQIDNO. 13 5 'CATGGCGGCGCGATTAAGG3', SEQIDNO. 14 5' AATCGGAATGGCGGGATTG AG3', SEQIDNO. 15 5 TGCCGTTCATAATCAAAATCG3', SEQIDNO. 16 5'GATTTTACAGGCGCTGCTTC3', SEQIDNO. 17 5'GGTCAAAATCCAGCGGTTTA3', SEQIDNO. 18 5'GCTCAGGTGCGTGAGAAAGT3', SEQIDNO. 19 5 'GTTCGAGCAATTCGCTTACC3', SEQ ID NO. 20 5' GCTTG ATGC AATG A AGCGTA3', SEQIDNO. 21 5 'TTCCCGCTATCGGTAACAGT3', In still another embodiment of the present invention, wherein Primers and a rapid method as claimed in claim land 2 for the detection of Salmonella wherein the concentration of primers used could rang from IpM to 100 pM set 1, set 2, set3 and set 4 generating specific amplicons 200bp, 207 bp, 1318 bp and 450 bp respectively (fig 1). In still another embodiment of the present invention, wherein Primers and a rapid method for the detection of Salmonella wherein all types of serotypes (Fig 3) of Salmonella could be detected from varied sources such as food, clinical (Fig 2) and water samples with or without enrichment as less as 1 cell per ml or per g Primers and a rapid method as claimed in claim 1 to 4 for the detection of Salmonella wherein all types of serotypes of Salmonella could be detected from varied sources containing 1 cell per 25 ml or 25 g of sample with or without enrichment. In still another embodiment of the present invention, wherein Primers and detection of pure cultures of Salmonella wherein chromosomal DNA isolation by any known method including preparation of heat shock lysate could be used in the PCR followed by visualizing the PCR products on agarose gel ranging from 0.5% to 2.5%. Methodology Protocol consists of three main steps:. • Preparation of template DNA • Polymerase Chain reaction • Visualization of the product on agarose gel DNA isolation for PCR: The cell pellet from 1 ml of the liquid culture or a single colony on the agar medium was suspended in 100 ul of sterilized Millipore water and incubated in a dry bath at 100°C for 5 min. The mixture was immediately transferred to ice bath and left for 3 min. The resultant cell lysate was centrifuged at 7000 rpm for 3 min. and 2 ul of the supernatant was directly used in a 20ul PCR reaction. Wherever felt necessary, the assay was performed by using isolated chromosomal DNA. For isolation of pure chromosomal DNA, the cultures were grown for 6 hr. in nutrient broth and DNA isolated by GES method (Pitcher et a/., 1989). lOng of DNA was normally used in a 20ul reaction assay Template preparation from blood: DNA isolation kit (M/S Bio Basic, Canada) was used for the isolation of DNA from blood, (fig 2) Template preparation from water: For isolation of DNA from water-borne bacteria, 1 ml of the sample was centrifuged at 7000 r.p.m for 3 min. in a 5 ml eppendorf tube, supernatant discarded and 10u.l of autoclaved Millipore water added to each tube. The resultant suspension was vortexed, incubated in a dry bath at 100°C for 5 min. and the whole volume used in a 20ul PCR reaction. Enrichment: In case of blood 250ul aliquots of the samples were inoculated into 5ml liquid medium and for water 1 ml aliquots inoculated into 1 ml of double strength Brain Heart Infusion Broth (HiMedia, India) and incubated at 37°C for 5h. The cell lysates were prepared as above. We claim: 1. Oligonucleotide primers of SEQ ID Nos.l to 21 to amplify Salmonella enterotoxin (stn) gene. 2. A process for rapid and specific detection of Salmonella enterotoxin gene (stn) said process comprising of: i. Preparing DNA template of the gene and designing specific primers against it, ii. Amplifying the template obtained in step i using the primers having SEQID nos.l-21 by polymerase Chain Reaction (PCR), iii. Detecting the product obtained in step ii as Salmonella enterotoxin gene (stn). 3. The process as claimed in claim 2, wherein the gene is sequenced from serotypes of Salmonella. 4. The process as claimed in claim 2, wherein the primers can detect up to about 1 cell per ml of water with or without enrichment. 5. The process as claimed in claim 2, wherein the primers can detect upto ten Salmonella cells per ml of blood with or without enrichment. 6. The process as claimed in claim 2, wherein the primers can detect upto one cell per gram of food and clinical sample with or without enrichment. 7. The process as claimed in claim 2, wherein DNA from blood and background micro flora does not interfere with PCR assay. 8. The process as claimed in claim 2, wherein the said method can be used as quality control of water and diagnosis of bacterium Salmonella. 9. The process as claimed in claim 2, wherein the subject is humans and animals. 10. The process as claimed in claim 2, wherein the set of primers of SEQ ID NOs. 1 and 2 generates amplicons of approximately 200 bp. 11. The process as claimed in claim 2, wherein the set of primers of SEQ ID NOs. 3 and 4 generates amplicons of approximately 207 bp. 12. A process as claimed in claim 2, wherein the set of primers of SEQ ID NOs. 5 and 6 generates amplicons of approximately 1318 bp. 13. A process as claimed in claim 2, wherein the primers comprising SEQ ID NOs. 7 and 8 generates PCR products of approximately 450 bp. 14. A process as claimed in claim 2, wherein the primers is used in a concentration ranging between 1 pM to 100 pM. 15. A process as claimed in claim 2, wherein PCR involves initial denaturation at a temperature of 93.degree. C. to 97.degree. C. for 30 sec. to 7 min, followed by 23 to 50 cycles of 93.degree. C. to 97.degree. C. for 3 sec. to 2 min for denaturation, 50.degree. C. to 67.degree. C. for 10 sec to 2 min. for annealing, 70.degree. C. to 75.degree. C. for 10 sec. to 2 min for extension, and followed by final extension at 70.degree. C. to 75.degree. C. for 2 min. to 10 min. 16. A process as claimed in claim 2, wherein the DNA is isolated from pure cultures, water, food and clinical samples. 17. Oligonucleotide primers of SEQ ID Nos. 1 -21 specific for Salmonella enterotoxin gene (stn) and a process for rapid and specific detection of Salmonella enterotoxin gene (stn) substantially as herein described with reference to examples accompanying this specification.

Full Text

Field of the present invention
The present invention relates to oligonucleotide primers comprising SEQ ID NOs. 1 to 21, specific for Salmonella enterotoxin gene (stn) gene, useful for rapid and specific screening of Salmonella. The present invention also relates to a process for the rapid and specific detection of Salmonella enterotoxin gene (stn) gene in a subject for the presence of parasite Salmonella using oligonucleotide primers comprising SEQ ID NOs. 1 to 21 for Polymerase Chain Reaction (PCR), said process comprising steps of preparing DNA template of the gene, amplifying the template using the primers by PCR, running the PCR products on gel, and detecting the parasite.
Background of the invention
Salmonella species are facultative, intracellular parasites that invade the mucous membrane of the epithelial cells and are transmitted to humans mainly through water, meat, eggs and poultry products. Salmonella infection is the most frequent food-borne gastrointestinal disease transmitted from animals to humans. Typhoid fever still remains endemic in many developing countries and non-typhoidal salmonellosis also is a major food-borne disease worldwide and is estimated to be responsible for the deaths of more than 500 people each year, with costs of $1 billion to $1.5 billion annually in the United States alone (Threlfall 1996; Mead et al. "Food-related illness and death in the United States," Emerg Infect Dis., 1999, 5:607 25.) These figures in India are not fully documented but expected to be much higher. To prevent Salmonella infection, good monitoring and screening programs are required. Detection of Salmonella by conventional bacteriological methods are time consuming and usually requires 5 to days. Therefore, efforts have been made by many workers to reduce time required and to increase the sensitivity of the methods to detect Salmonella (Notermans et al. 1997; Ferretti et al., "Twelve-hour PCR-based method for detection of Salmonella spp. in food," Appl Environ Microbiol., 2001, 67:977 8; Carli et al., "Detection of salmonellae in chicken feces by a combination of tetrathionate broth enrichment, capillary PCR, and capillary gel electrophoresis," J Clin Microbiol., 2001, 39:1871 6).
Increased public awareness of the health related and economic impact of food-borne contamination and illness has resulted in greater efforts to develop more sensitive methods of pathogenic detection and identification. Advances in molecular biology technology, particularly the polymerase chain reaction (PCR), have allowed more reliable microbial identification and surveillance. PCR has also become a valuable tool for investigating food-borne outbreaks and identification of etiological agents responsible for the microbial epidemics. PCR techniques have provided

increased sensitivity, allowed more rapid processing times and enhanced the detection of bacterial pathogens. In addition to analysis of foods, PCR has also been /Successfully applied for the detection and identification of pathogenic micro organisms in clinical and environmental samples (Simon 1999; White, 1992). Enterotoxigenicity has been recognized as one of the distinct pathological attributes of diarrhoea inducing bacteria. Salmonella serotypes, which are known for their association with gastroenteritis and diarrhoea in humans and animals, have also been shown to produce enterotoxin. The stn gene is located at approximately 89 minutes on the Salmonella lyphimurium chromosome and the presence of an intact stn gene contributes significantly to the overall virulence of Salmonella. We present here the use of stn gene as a detection marker for Salmonella. Objects of the present invention
The main object of the present invention is to develop primers for the detection of parasite salmonella enterotoxin gene (stn)
Another main object of the present invention is to develop a rapid and efficient process for the detection of Parasite Salmonella enterotoxin gene (stn) Yet another main object of the present invention is to develop a process for the detection of Parasite Salmonella from food, biological samples, etc. Summary of the invention
The present invention relates to oligonucleotide primers of SEQ ID NOs: 1 to 21
specific for the Salmonella enterotoxin gene (stn) gene. The present invention also
relates to a process for rapid and specific detection of the Salmonella enterotoxin gene
(stn) gene using oligonucleotide primers of SEQ ID NOs: 1 to 21 for Polymerase
chain reaction (PCR), said process comprising the steps of preparing DNA template
of the gene, amplifying the template using the oligonucleotide primers by PCR,
running the PCR products on an agarose gel, and detecting the stn gene. Detailed description of the present invention
Accordingly, the present
invention provides oligonucleotide primers of SEQ ID Nos.l to 21 to amplify
Salmonella enterotoxin (sin) gene and also a process for the rapid and specific
detection of Salmonella enterotoxin gene (stn) gene in a subject for the presence of
parasite Salmonella using oligonucleotide primers of SEQ ID Nos. 1 to 21 for
Polymerase Chain Reaction (PCR), said process comprising steps of preparing DNA
template of
the gene, amplifying the template using the primers by PCR, running the PCR
products on gel, and detecting the parasite.
Background of the invention
Salmonella species are facultative, intracellular parasites that invade the mucous
membrane of the epithelial cells and are transmitted to humans mainly through water,
meat, eggs and poultry products. Salmonella infection is the most frequent food-borne
gastrointestinal disease transmitted from animals to humans. Typhoid fever still
remains endemic in many developing countries and non-typhoidal salmonellosis also
is a major food-borne disease worldwide and is estimated to be responsible for the
deaths of more than 500 people each year, with costs of $1 billion to $1.5 billion
annually in the United States alone Threlfall 1996; Mead et al. 1999) These figures
in India are not fully documented but expected to be much higher. To Prevent
Salmonella infection good monitoring and screening programs are required. Detection
of Salmonella by conventional bacteriological methods are time consuming and
usually requires 5 to days. Therefore, efforts have been made by many workers to
reduce time required and to increase the sensitivity of the methods to detect
Salmonella (Notermans et al. 1997; Ferretti et al 2001 ; Carli et al. 2001).
Increased public awareness of the health related and economic impact of food-borne
contamination and illness has resulted in greater efforts to develop more sensitive
methods of pathogenic detection and identification. Advances in molecular biology
technology, particularly the polymerase chain reaction (PCR), have allowed more
reliable microbial identification and surveillance. PCR has also become a
valuable tool for investigating food-borne outbreaks and identification of etiological
agents responsible for the microbial epidemics. PCR techniques have provided
increased sensitivity, allowed more rapid processing times and enhanced the detection
of bacterial pathogens. In addition to analysis of foods, PCR has also been
successfully applied for the detection and^ identification of pathogenic microorganisms
in clinical and environmental samples (Simon 1999; White, 1992).
Enterotoxigenicity has been recognized as one of the distinct pathological attributes of
diarrhoea inducing bacteria. Salmonella serotypes, which are known for their
association with gastroenteritis and diarrhoea in humans and animals, have also been
shown to produce enterotoxin. The stn gene is located at approximately 89 minutes on
the Salmonella lyphimurium chromosome and the presence of an intact stn gene
contributes significantly to the overall virulence of Salmonella. We present here the
use of stn gene as a detection marker for Salmonella.
Objects of the present invention
The main object of the present invention is to develop primers for the detection of
parasite salmonella.
Another main object of the present invention is to develop a rapid and efficient
process for the detection of Parasite Salmonella.
Yet another main object of the present invention is to develop a process for the
detection of Parasite Salmonella from food, biological samples, etc.
Summary of the invention
The present invention relates to oligonucleotide primers of SEQ ID Nos. 1 to 21
specific for Salmonella enterotoxin gene (stn) gene, useful for rapid and specific
screening of Salmonella; and also, a process for the rapid and specific detection of
Salmonella enterotoxin gene (stn) gene in a subject for the presence of parasite
Salmonella using oligonucleotide primers of SEQ ID Nos. 1 to 21 for Polymerase
Chain Reaction (PCR), said process comprising steps of preparing DNA template of
the gene, amplifying the template using the primers by PCR, running the PCR
products on gel, and detecting the parasite.
Detailed description of the present invention
Accordingly, the present invention relates to oligonucleotide primers of SEQ ID Nos.
1 to 21 specific for Salmonella enterotoxin gene (stn) gene, useful for rapid and
specific screening of Salmonella; and also, a process for the rapid and specific
detection of Salmonella enterotoxin gene (stn) gene in a subject for the presence of
parasite Salmonella using oligonucleotide primers of SEQ ID Nos. 1 to 21 for
Polymerase Chain Reaction (PCR), said process comprising steps of preparing DNA
template of the gene, amplifying the template using the primers by PCR, running the
PCR products on gel, and detecting the parasite.
In an embodiment of the present invention, wherein oligonucleotide primers of SEQ
ID Nos. 1 to 21 specific for Salmonella enterotoxin gene (stn) gene, useful for rapid
and specific screening of Salmonella.
In another embodiment of the present invention, wherein a process for the rapid and
specific detection of Salmonella enterotoxin gene (stn) gene in a subject for the
presence of parasite Salmonella using oligonucleotide primers of SEQ ID Nos. 1 to 21
for Polymerase Chain Reaction (PCR), said process comprising steps of:
• preparing DNA template of the gene,
• amplifying the template using the primers by PCR,
• running the PCR products on gel, and
• detecting the parasite.
In yet another embodiment of the present invention, wherein the gene is sequenced
from serotypes of Salmonella.
In still another embodiment of the present invention, wherein the primers can detect
upto about 1 cell per ml of water with or without any enrichment.
In still another embodiment of the present invention, wherein the primers can detect
upto 10 cells per ml of blood with or without any enrichment.
In still another embodiment of the present invention, wherein the primers can detect
upto 1 cell per gram of food and clinical sample with or without any enrichment.
In still another embodiment of the present invention, wherein DNA from blood and
background micro flora does not interfere with PCR assay.
In still another embodiment of the present invention, wherein the said process can be
used as quality control of water and diagnosis of bacterium Salmonella.
In still another embodiment of the present invention, wherein the subject is humans
and animals.
In still another embodiment of the present invention, wherein the set of primers of
SEQ ID Nos. 1 and 2 generates amplicons of 200bp.
In still another embodiment of the present invention, wherein the set of primers of
SEQ ID Nos. 3 and 4 generates amplicons of 207bp.
In still another embodiment of the present invention, wherein the set of primers of
SEQ ID Nos. 5 and 6 generates amplicons of 1318bp.
In still another embodiment of the present invention, wherein the set of primers of
SEQ ID Nos. 7 and 8 generates amplicons of 450bp.
A In still another embodiment of the present invention, wherein the concentration of
primers is ranging between 1 pM to 100 pM.
In still another embodiment of the present invention, wherein visualizing the PCR
products on gel of concentration ranging from 0.3% to 2.7%.
In still another embodiment of the present invention, wherein PCR involves initial
denaturation at 93°C to 97 °C for 30 sec. to 7 min. and 23 to 50 cycles of 93°C to
97°C for 3 sec. to 2 min., 50°C to 67 °C for 10 sec to 2 min., 70 °C to 75 °C for 10
sec. to 2 min. and final extension at 70 °C to 75 °C for 2 min. to 10 min.
In still another embodiment of the present invention, wherein the DNA is isolated
from pure cultures, water, food and clinical samples.
Brief description of the accompanying drawings
Fig 1 shows 1% agarose gel showing all the four PCR products used in the detection
of Salmonella. Lane 1:1 kb DNA ladder (Fermentas). Lane 2: PCR amplification with
primers QVR133 and QVR134 (200 bp); Lane 3: PCR amplification with primers
QVR135 and QVR136 (207 bp); Lane 4: PCR amplification with primers QVR137
and QVR138 (1318 bp); Lane 5: PCR amplification with primers QVR139 and
QVR140 (450 bp); Lane 6: Negative control with primers QVR139 and QVR140
Fig 2 shows 1% agarose gel showing the detection of different numbers of Salmonella
cells from blood with primers QYR 137 and QVR 138. Lane 1: 1 kb DNA ladder
(Fermentas) Lane 2: Positive control; Lane 3: Blood sample spiked with approx. 1 cell
and given pre-enrichment for 5 hour? Lane 4: Negative control (unseeded blood
sample); Lane 5: Blood sample spiked with less than 10 cells and PCR run without
pre-enrichment; Lane 6: Blood sample spiked with 10 cells and PCR run without preenrichment
and Lane 7: Blood sample spiked with 103 cells and PCR run without preenrichment
Fig 3 shows 1% agarose gel showing PCR amplified product of the nested PCR for
the detection of Salmonella. The first PCR reactions were run with primers QVR137
and QVR138 and those in the nested PCR were run with primers QVR 139 and QVR
140. Lane 1: 1 kb DNA ladder (Fermentas) Lanes 2-7: Different serotypes of
Salmonella and Lane 8: Negative corttr.pl
In still another embodiment of the present invention, wherein Stn gene was sequenced
from several serotypes of Salmonella and the sequence was found to be conserved. A
PCR based protocol for the detection of Salmonella has been developed by using
specific primers based on Salmonella enterotoxin gene (stn). These primers and the
PCR protocols have been deigned by us and are being reported for the first time. The
method is highly specific and can detect upto 1 cell per ml of water and less than 10
cells per ml of blood without any pre-enrichment. The primers do not show any
tendency to amplify non-Salmonella DNA. DNA from blood and background micro
flora do not interfere with the PCR assay either by generating any non-specific PCR
amplicons or by inhibiting the PCR assay. This method may be used as quality control
of water and diagnosis of bacteremia by Salmonella in humans and animals.
In still another embodiment of the present invention, wherein Oligonucleotide primers
designed on the basis of stn gene (Salmonella enterotoxin gene) and used in
Polymerase Chain reaction are useful for the rapid and specific detection of
Salmonella by the PCR protocol consisting of initial denaturation at 93°C to 97 °C for
30 sec. to 7 min. and 23 to 50 cycles of 93°C toJj'C for 3 sec. to 2 min., 50°C to 67 °C
for 10 sec to 2 min., 70 °C to 75 °C for 10 sec. to 2 min. artd final extension at 70 °C
to 75 °C for 2 min. to 10 min. after DNA isolation by any known method suitable for
PCR from pure cultures, water, food and clinical samples, using Ifg to lOug of DNA
and any thermostable DNA polymerase enzyme followed by visualizing the PCR
products on agarose gel. ranging from 0.5% to 2.5%.
In still another embodiment of the present invention, wherein Rapid method for the
detection of Salmonella wherein the primers selected are:
Following is a Set 1 of primers of SEQ ID nos. 1 and 2 respectively. Also referred to
asQVR133andQVR 134.
5'GAAGCAGCGCCTGTAAAATC3' / 5'TGGCTGTGGTGCAAAATATC 3';
Following is a Set 2 of primers of SEQ ID nos. 3 and 4 respectively. Also referred to
asQVR135andQVR136.
5'GCCACCAGCTTTTCTTTACG 3' / S'ACGAACCAGCGAAACAAAOT;
Following is a Set 3 of primers of SEQ ID nos. 5 and 6 respectively: Also referred to
asQVR137andQVR 138.
5'GGTCAAAATCCAGCGGTTTA 3' / 5 'TTGCTGCTAACGGCGAGA 3',
Following is a Set 4 of primers of SEQ ID nos. 7 and 8 respectively. Also referred to
asQVR139andQVR140.
5'GCCGGCTTTCAACGCCTCTAC3' / 5'GACCAAAGCTGACGGGACAGS'
SEQIDNO. 9
5' ACGCCTCTACCGCCGTTTCC3',
SEQIDNO. 10
5'CGACCAAAGCTGACGGGACAGS',
SEQ ID NO. 11
5 'CGTTTCC ACGCTGGAAAATGC3',
SEQIDNO. 12
5 'GCCGGCTTTC AACGCCTCTAC3',
SEQIDNO. 13
5 'CATGGCGGCGCGATTAAGG3',
SEQIDNO. 14
5' AATCGGAATGGCGGGATTG AG3',
SEQIDNO. 15
5 TGCCGTTCATAATCAAAATCG3',
SEQIDNO. 16
5'GATTTTACAGGCGCTGCTTC3',
SEQIDNO. 17
5'GGTCAAAATCCAGCGGTTTA3',
SEQIDNO. 18
5'GCTCAGGTGCGTGAGAAAGT3',
SEQIDNO. 19
5 'GTTCGAGCAATTCGCTTACC3',
SEQ ID NO. 20
5' GCTTG ATGC AATG A AGCGTA3',
SEQIDNO. 21
5 'TTCCCGCTATCGGTAACAGT3',
In still another embodiment of the present invention, wherein Primers and a rapid method as
claimed in claim land 2 for the detection of Salmonella wherein the concentration of primers
used could rang from IpM to 100 pM set 1, set 2, set3 and set 4 generating specific amplicons
200bp, 207 bp, 1318 bp and 450 bp respectively (fig 1).
In still another embodiment of the present invention, wherein Primers and a rapid
method for the detection of Salmonella wherein all types of serotypes (Fig 3) of
Salmonella could be detected from varied sources such as food, clinical (Fig 2) and
water samples with or without enrichment as less as 1 cell per ml or per g Primers and
a rapid method as claimed in claim 1 to 4 for the detection of Salmonella wherein all
types of serotypes of Salmonella could be detected from varied sources containing 1
cell per 25 ml or 25 g of sample with or without enrichment.
In still another embodiment of the present invention, wherein Primers and detection of
pure cultures of Salmonella wherein chromosomal DNA isolation by any known
method including preparation of heat shock lysate could be used in the PCR followed
by visualizing the PCR products on agarose gel ranging from 0.5% to 2.5%.
Methodology
Protocol consists of three main steps:.
• Preparation of template DNA
• Polymerase Chain reaction
• Visualization of the product on agarose gel
DNA isolation for PCR: The cell pellet from 1 ml of the liquid culture or a single
colony on the agar medium was suspended in 100 ul of sterilized Millipore water and
incubated in a dry bath at 100°C for 5 min. The mixture was immediately transferred
to ice bath and left for 3 min. The resultant cell lysate was centrifuged at 7000 rpm for
3 min. and 2 ul of the supernatant was directly used in a 20ul PCR reaction.
Wherever felt necessary, the assay was performed by using isolated chromosomal
DNA. For isolation of pure chromosomal DNA, the cultures were grown for 6 hr. in
nutrient broth and DNA isolated by GES method (Pitcher et a/., 1989). lOng of DNA
was normally used in a 20ul reaction assay
Template preparation from blood: DNA isolation kit (M/S Bio Basic, Canada) was
used for the isolation of DNA from blood, (fig 2)
Template preparation from water: For isolation of DNA from water-borne bacteria,
1 ml of the sample was centrifuged at 7000 r.p.m for 3 min. in a 5 ml eppendorf tube,
supernatant discarded and 10u.l of autoclaved Millipore water added to each tube. The
resultant suspension was vortexed, incubated in a dry bath at 100°C for 5 min. and the
whole volume used in a 20ul PCR reaction.
Enrichment: In case of blood 250ul aliquots of the samples were inoculated into 5ml
liquid medium and for water 1 ml aliquots inoculated into 1 ml of double strength
Brain Heart Infusion Broth (HiMedia, India) and incubated at 37°C for 5h. The cell
lysates were prepared as above.

We claim:
1. Oligonucleotide primers of SEQ ID Nos.l to 21 to amplify Salmonella enterotoxin (stn) gene.
2. A process for rapid and specific detection of Salmonella enterotoxin gene (stn) said process comprising of:
i. Preparing DNA template of the gene and designing specific primers
against it, ii. Amplifying the template obtained in step i using the primers having
SEQID nos.l-21 by polymerase Chain Reaction (PCR), iii. Detecting the product obtained in step ii as Salmonella enterotoxin gene
(stn).
3. The process as claimed in claim 2, wherein the gene is sequenced from
serotypes of Salmonella.
4. The process as claimed in claim 2, wherein the primers can detect up to about 1 cell per ml of water with or without enrichment.
5. The process as claimed in claim 2, wherein the primers can detect upto ten Salmonella cells per ml of blood with or without enrichment.
6. The process as claimed in claim 2, wherein the primers can detect upto one cell per gram of food and clinical sample with or without enrichment.

7. The process as claimed in claim 2, wherein DNA from blood and background micro flora does not interfere with PCR assay.
8. The process as claimed in claim 2, wherein the said method can be used as quality control of water and diagnosis of bacterium Salmonella.
9. The process as claimed in claim 2, wherein the subject is humans and animals.
10. The process as claimed in claim 2, wherein the set of primers of SEQ ID NOs. 1 and 2 generates amplicons of approximately 200 bp.
11. The process as claimed in claim 2, wherein the set of primers of SEQ ID NOs. 3 and 4 generates amplicons of approximately 207 bp.

12. A process as claimed in claim 2, wherein the set of primers of SEQ ID NOs. 5 and 6 generates amplicons of approximately 1318 bp.
13. A process as claimed in claim 2, wherein the primers comprising SEQ ID NOs. 7 and 8 generates PCR products of approximately 450 bp.
14. A process as claimed in claim 2, wherein the primers is used in a concentration ranging between 1 pM to 100 pM.
15. A process as claimed in claim 2, wherein PCR involves initial denaturation at a temperature of 93.degree. C. to 97.degree. C. for 30 sec. to 7 min, followed by 23 to 50 cycles of 93.degree. C. to 97.degree. C. for 3 sec. to 2 min for denaturation, 50.degree. C. to 67.degree. C. for 10 sec to 2 min. for annealing, 70.degree. C. to 75.degree. C. for 10 sec. to 2 min for extension, and followed by final extension at 70.degree. C. to 75.degree. C. for 2 min. to 10 min.
16. A process as claimed in claim 2, wherein the DNA is isolated from pure cultures, water, food and clinical samples.
17. Oligonucleotide primers of SEQ ID Nos. 1 -21 specific for Salmonella enterotoxin gene (stn) and a process for rapid and specific detection of Salmonella enterotoxin gene (stn) substantially as herein described with reference to examples accompanying this specification.

Documents:

2979-DELNP-2004-Abstract-(26-06-2008).pdf

2979-delnp-2004-abstract.pdf

2979-DELNP-2004-Claims-(26-06-2008).pdf

2979-delnp-2004-claims.pdf

2979-DELNP-2004-Correspondence-Others-(26-06-2008).pdf

2979-delnp-2004-correspondence-others.pdf

2979-delnp-2004-description (complete)-26-06-2008.pdf

2979-delnp-2004-description (complete).pdf

2979-DELNP-2004-Drawings-(26-06-2008).pdf

2979-delnp-2004-drawings.pdf

2979-delnp-2004-form-1.pdf

2979-delnp-2004-form-18.pdf

2979-DELNP-2004-Form-2-(26-06-2008).pdf

2979-delnp-2004-form-2.pdf

2979-delnp-2004-form-3.pdf

2979-delnp-2004-form-5.pdf

2979-DELNP-2004-Others-Document-(26-06-2008).pdf

« Previous Patent

Next Patent »

Patent Number

225146

Indian Patent Application Number

2979/DELNP/2004

PG Journal Number

46/2008

Publication Date

14-Nov-2008

Grant Date

03-Nov-2008

Date of Filing

30-Sep-2004

Name of Patentee

COUNCIL OF SCIENTIFIC AND INDUSTRIAL RESEARCH

Applicant Address

RAFI MARG, NEW DELHI-110 001, INDIA.

Inventors:

#	Inventor's Name	Inventor's Address
1	GHULAM NABI QAZI	REGIONAL RESEARCH LABORATORY (CSIR), JAMMU
2	VIJESHWAR VERMA	REGIONAL RESEARCH LABORATORY (CSIR), JAMMU
3	SYED RIYAZ-UL-HASSAN	REGIONAL RESEARCH LABORATORY (CSIR), JAMMU

PCT International Classification Number

C12Q 1/68

PCT International Application Number

PCT/IN03/00124

PCT International Filing date

2003-03-31

PCT Conventions:

#	PCT Application Number	Date of Convention	Priority Country
1			NA